HUGO ID Detailed Result 11892

HUGO ID 11892
Symbol TNF
Name tumor necrosis factor (TNF superfamily, member 2)
#Occurrence 475
#Paper 43

 

PMID Match String Actual String Score Flanking text Edited by Edit
9562310TNFTNF0.2response with other recombinant human cytokines (IL-1 IL-1 IL-1_amp_#x3b2 IL-2 TNF and abrogating the IL-6 effect by anti-IL-6 polyclonal antibody (Genzyme, 
9562310TNFTNF-0.0IL-6 along with TNF- has been reported to be highly expressed in perivascular inflammatory 
10525172TNFTNF0.3an overexpression of the proinflammatory cytokines IL1-_amp_#x3b2 IL2 IFN_amp_#x3b3 and TNF and a defective production of the anti-inflammatory cytokine TGF-_amp_#x3b2 associated 
11796754TNF-alphaTNF-alpha2.7an inflammatory process such as the tumor necrosis factor-alpha (TNF-alpha) TNF-alpha gene resulting from glial cell activation together with the change 
11847479TNFTNF1.2Tumor necrosis factor (TNF) TNF has been implicated in the pathogenesis of various central nervous 
11847479TNFTNF1.2Elevated TNF levels were observed in animal models of motor neuron disease 
11847479TNFTNF1.2of motor neuron disease (MND), MND and activation of the TNF system has been reported in patients with amyotrophic lateral sclerosis 
11847479TNFTNF1.2This review discusses the possible role of TNF in motoneuronal degeneration 
11847479TNFTNF1.2Although TNF is mostly regarded as neurotoxic cytokine there are reports of 
11847479TNFTNF1.2animal models of ALS are not sufficient to show whether TNF has a pathogenic or a protective role in MND though 
11847479TNFTNF-deficient1.2On the other hand while TNF-deficient mice are protected from EAE anti-TNF antibodies worsen the disease 
12124437TNFTNF1.2only exceptions being FADD and the tumor necrosis factor (TNF)alpha TNF alpha receptor p55 which was up-regulated at 80 days and 
12124437TNFalphaTNFalpha1.2cytokine expression in FALS are likely minor and (iii) iii TNFalpha and its receptors may link inflammation to apoptosis in ALS 
14739060TNFTNF0.3amplification resulting in production of neurotoxins such as cytokine (TNF, TNF IL1 eicosanoides ROS and RNS 9 and 13 
14960605TNF-alphaTNF-alpha1.7factor-kappaB NF-kappaB (index index of NF-kappaB activity tumor necrosis factor-alpha TNF-alpha and CD14 (data data not shown 
14960605TNF-alphaTNF-alpha1.7The proapoptotic cytokine TNF-alpha is likely to play a determinant role in this model 
14960605TNF-alphaTNF-alpha1.7is able to trigger transcriptional activation of the gene encoding TNF-alpha in microglial cells across the CNS and TNF-alpha gene expression 
14960605TNF-alphaTNF-alpha1.7gene encoding TNF-alpha in microglial cells across the CNS and TNF-alpha gene expression progressively increased in the spinal cord of SOD1 
14960605TNF-alphaTNF-alpha1.7dark-field photomicrographs depict representative examples of the hybridization signal for TNF-alpha ( B IL-12 ( C and TLR2 ( D mRNA 
14960605TNF-alphaTNF-alpha1.7dark-field photomicrographs depict representative examples of the hybridization signal for TNF-alpha IL-12 and TLR2 mRNA in the L5 segment of the 
14960605TNF-alphaTNF-alpha1.7the receptor of innate immunity TLR2 and the proapoptotic cytokine TNF-alpha in the SOD1 mice challenged chronically with LPS 
14960605TNF-alphaTNF-alpha1.7strong hybridization signals for the genes encoding the proapoptotic cytokines TNF-alpha andinterleukin-12 (IL-12) IL-12 in degenerating efferent fiber tracts of the 
14960605TNF-alphaTNF-alpha1.7al Qu_amp_eacute bec Canada for the plasmid containing the mouse TNF-alpha cDNA Dr I Campbell (The The Scripps Research Institute La 
15081582TNFTNF1.2Astrocytic COX-2 is also induced by LPS TNF basic fibroblast growth factor (bFGF), bFGF and phorbol ester ( 
15081582TNFTNF1.2and synovial cells that can induce COX-2 via the cytokines TNF IL-1_amp_#x3b2 and IL-6 
15453089TNFTNF-0.4prominent microglial activation classical pro-inflammatory mediators such as IL-1 IL-6 TNF- alpha and IFN- gamma were not detected in significant amount 
15572176TNFTNF-A1.2Activation of murine astrocytes with tumour necrosis factor-alpha (TNF-_amp_#x3b1;), TNF-_amp_#x3b1 IL-1_amp_#x3b2 and IFN_amp_#x3b3 induces IL-6 COX-2 and iNOS and makes 
15572176TNFTNF-A1.2and trophic factors produced by activated astrocytes such as FasL TNF-_amp_#x3b1 and NGF are capable of activating death receptors expressed in 
15657392TNF-alphaTNF-alpha1.7(c) c RT-PCR analysis of TNF-alpha and _amp_#223 -actin of wt (lane lane 1 MLC/mIgf-1 MLC 
15657392TNF-alphaTNF-alpha1.7Lane 6 identifies the RNA positive control (pc) pc for TNF-alpha obtained from spleen 
15657392TNF-alphaTNF-alpha1.7be correlated with the expression of certain cytokines such as TNF-alpha which enhance the response to inflammatory states and contribute to 
15657392TNF-alphaTNF-alpha1.7Although TNF-alpha expression was normally undetectable in the CNS of healthy mice 
15657392TNF-alphaTNF-alpha1.7In contrast TNF-alpha expression was not apparent in the spinal cord of SOD1 
15657392TNF-alphaTNF-alpha1.7The following oligonucleotides were used TNF-alpha sense 5'-CCCAGACCCTCACACACTCAGAT-3' and anti-sense 5'-TTGTCCCTTGAAGAGAACCTG-3' _amp_#223 -actin sense 5'-GTGGGCCGCTCTAGGCACAA-3' and 
15681814TNF-alphaTNF-alpha2.7therapeutic strategies and drug candidates for neurodegenerative diseases p53 and TNF-alpha inhibitors and GLP-1 receptor agonists 
15681814TNF-alphaTNF-alpha2.7Such targets include TNF-alpha p53 and GLP-1 receptor 
15681814TNF-alphaTNF-alpha2.7The cytokine TNF-alpha is elevated in Alzheimer's disease Parkinson's disease stroke and amyotrophic 
15777251TNFTNF0.1display gender specific alterations of IFN-gamma and IL-12 variations of TNF and IL-6 were associated with PD 
16380619TNF-alphaTNF-alpha1.7The authors compared IL-6 and tumor necrosis factor alpha TNF-alpha levels in CSF and sera from 10 hypoxemics and 10 
16380619TNF-alphaTNF-alpha1.7An excessive production of tumor necrosis factor alpha TNF-alpha with lower CSF levels of interleukin (IL)-6 IL -6 was 
16380619TNF-alphaTNF-alpha1.7TNF-alpha could act as a principal driver for neuroinflammation because its 
16380619TNF-alphaTNF-alpha1.7However there were conflicting results either no difference in IL-6 TNF-alpha or IL-12 was found in patients with ALS and healthy 
16380619TNF-alphaTNF-alpha1.7role of hypoxemia in the regulation of cytokines by studying TNF-alpha and IL-6 in the sera and CSF of hypoxemic and 
16380619TNF-alphaTNF-alpha1.7IL-6 and TNF-alpha levels in CSF and sera were determined using a chemiluminescent 
16380619TNF-alphaTNF-alpha1.7in serum ( z = -2.1 p = 0.04 and TNF-alpha in serum ( z = -2.5 p = 0.01 in 
16380619TNF-alphaTNF-alpha1.7serum IL-6 ( p = 0.007 r = -0.6 serum TNF-alpha ( p = 0.001 r = -0.7 in patients with 
16380619TNF-alphaTNF-alpha1.7in serum ( z = -2.3 p = 0.02 and TNF-alpha in serum ( z = -2.0 p = 0.05 in 
16380619TNF-alphaTNF-alpha1.7IL-6 ( p = 0.01 r = 0.5 and serum TNF-alpha levels ( p = 0.01 r = 0.5 in neurologic 
16380619TNF-alphaTNF-alpha1.7TNF-alpha was undetectable in CSF 
16380619TNF-alphaTNF-alpha1.7We found no correlation between IL-6 or TNF-alpha levels in plasma and those in CSF 
16380619TNF-alphaTNF-alpha1.7IL-6 and TNF-alpha levels did not correlate with age clinical presentation or disease 
16380619TNF-alphaTNF-alpha1.7an increase in IL-6 levels in CSF and sera and TNF-alpha in sera in hypoxemic patients with ALS and hypoxemic neurologic 
16380619TNF-alphaTNF-alpha1.7the other hand hypoxia stimulates the proinflammatory cytokines such as TNF-alpha and IL-6 mediated by others transcriptional factors nuclear factor-kappaB AP-1 
16380619TNF-alphaTNF-alpha1.7amino acid nitric oxide and proinflammatory cytokines such as IL-6 TNF-alpha and IL-1_amp_#223 
16380619TNF-alphaTNF-alpha1.7Higher IL-6 and TNF-alpha levels could therefore correspond to a normal response to hypoxemia 
16380619TNF-alphaTNF-alpha1.7Our findings suggest that increased levels of IL-6 TNF-alpha PGE-2 and COX-2 observed in patients with ALS parallel motor 
16436205TNFTNF-Related1.2TRAIL (TNF-Related TNF-Related Apoptosis-Inducing Ligand was likewise very markedly upregulated in G93A-SOD1 cells 
16510725TNF-alphaTNF-alpha1.7mediators of inflammation such as the cytokine tumor necrosis factor-alpha TNF-alpha and its superfamily member fibroblast-associated cell-surface ligand (FasL) FasL have 
16510725TNF-alphaTNF-alpha1.7We found increased TNF-alpha and FasL immunoreactivity in lumbar spinal cord sections of ALS 
16510725TNF-alphaTNF-alpha1.7Both increased TNF-alpha and FasL immunostaining in the lumbar spinal cord of the 
16510725TNF-alphaTNF-alpha1.7its analog lenalidomide pharmacological agents that inhibit the expression of TNF-alpha and other cytokines by destabilizing their mRNA 
16510725TNF-alphaTNF-alpha1.7Treated G93A mice showed a reduction in TNF-alpha and FasL immunoreactivity as well as their mRNA in the 
16510725TNF-alphaTNF-alpha1.7Key words G93A SOD1 thalidomide lenalidomide TNF-alpha FasL 
16510725TNF-alphaTNF-alpha1.7Tumor necrosis factor-alpha TNF-alpha is a major inflammatory cytokine that elicits a wide range 
16510725TNFTNF1.7G93A mice (Hensley Hensley et al. 2002 alpha and soluble TNF receptor are elevated in serum of humans with ALS (Poloni 
16510725TNF-alphaTNF-alpha1.7In the present study we examined the temporal pattern of TNF-alpha and FasL immunoreactivity in the lumbar spinal cord of G93A 
16510725TNF-alphaTNF-alpha1.7Because previous work showed that the pro-inflammatroy cytokines TNF-alpha and FasL are elevated in both human and mouse models 
16510725TNF-alphaTNF-alpha1.7effects of thalidomide and lenalidomide two immunomodulatory agents that inhibit TNF-alpha production (Corral Corral et al. 1999 Bartlett et al. 2004 
16510725TNF-alphaTNF-alpha1.7The primers used were as follows TNF-alpha sense 5'-GACCCAGTGTGGGAAG-3' and antisense 5'-GGTTCAGTGATGT-AGCGA-3' glyceraldehyde-3-phosphate dehydrogenase (GAPDH), GAPDH sense 
16510725TNF-alphaTNF-alpha1.7The amounts of TNF-alpha and GAPDH cDNA were calculated using linear regression analysis from 
16510725TNF-alphaTNF-alpha1.7calculated using linear regression analysis from standard curves for both TNF-alpha and GAPDH and the amount of TNF-alpha cDNA was expressed 
16510725TNF-alphaTNF-alpha1.7curves for both TNF-alpha and GAPDH and the amount of TNF-alpha cDNA was expressed as a percentage of GAPDH 
16510725TNF-alphaTNF-alpha1.7The sections were immunostained with antibodies to TNF-alpha (Serotec, Serotec Raleigh NC FasL (Santa Santa Cruz Biotechnology Santa 
16510725TNF-alphaTNF-alpha1.7Double immunofluorescence was performed to demonstrate the glial localization of TNF-alpha and FasL 
16510725TNF-alphaTNF-alpha1.7sections (7 7 microm thick were prepared and processed for TNF-alpha or FasL immunohistochemistry as described above 
16510725TNF-alphaTNF-alpha1.7TNF-alpha and FasL immunoreactivity in G93A SOD1 mouse model of ALS 
16510725TNF-alphaTNF-alpha1.7We investigated the temporal pattern of TNF-alpha and FasL immunoreactivity in G93A SOD1 mice at 40 and 
16510725TNF-alphaTNF-alpha1.7Immunohistochemical analysis showed little TNF-alpha immunoreactivity at 40 d which appeared similar to controls in 
16510725TNF-alphaTNF-alpha1.7from G93A mice with a healthy appearance were stained with TNF-alpha moderately and immunoreactivity became more intense at 90 and 110 
16510725TNF-alphaTNF-alpha1.7TNF-alpha colocalized with the motor neuron marker (SMI-32) SMI-32 (Kiaei Kiaei 
16510725TNF-alphaTNF-alpha1.7TNF-alpha and FasL are important mediators of inflammation and they play 
16510725TNFTNF-alpha.1.7models of ALS and patients with ALS show increases in TNF-alpha. 
16510725TNF-alphaTNF-alpha1.7In ALS patients antigenic TNF-alpha and its soluble receptors measured by ELISA were significantly higher 
16510725TNF-alphaTNF-alpha1.7using RPAs showed increased Fas-associated death domain (FADD) FADD and TNF-alpha receptor p55 at 80 d which increased further at 120 
16510725TNF-alphaTNF-alpha1.7Glial cells are the major source of TNF-alpha expression in the CNS 
16510725TNF-alphaTNF-alpha1.7and glia from G93A SOD1 mice express high levels of TNF-alpha and this occurs at 60 d well before the onset 
16510725TNF-alphaTNF-alpha1.7An increase in TNF-alpha mRNA was confirmed by real-time RT-PCR in G93A mice at 
16510725TNF-alphaTNF-alpha1.7Double labeling of TNF-alpha with GFAP confirmed expression of TNF-alpha in astrocytes ( Fig 
16510725TNF-alphaTNF-alpha1.7Double labeling of TNF-alpha with GFAP confirmed expression of TNF-alpha in astrocytes ( Fig 1 
16510725TNF-alphaTNF-alpha1.7This is consistent with a previous study in which TNF-alpha immunoreactivity was increased at 17 weeks of age in microglia 
16510725TNF-alphaTNF-alpha1.7in the neurons of adjacent sections suggesting that FasL and TNF-alpha are coexpressed in these neurons ( Fig 3 
16510725TNF-alphaTNF-alpha1.7Because both TNF-alpha and FasL immunostaining were increased in G93A mice we examined 
16510725TNF-alphaTNF-alpha1.7thalidomide and its analog lenalidomide which inhibits the stability of TNF-alpha mRNA (Moreira Moreira et al. 1993 alpha and FasL expression 
16510725TNF-alphaTNF-alpha1.7Quantitative RT-PCR showed that both thalidomide and lenalidomide significantly reduced TNF-alpha mRNA levels at 110 d of age 
16510725TNF-alphaTNF-alpha1.7a role of pro-inflammatory cytokines in ALS and suggest that TNF-alpha and FasL and related cytokines have important triggering roles in 
16510725TNF-alphaTNF-alpha1.7TNF-alpha binds to TNF receptor-1 and activates it to ligate with 
16510725TNFTNF1.7TNF-alpha binds to TNF receptor-1 and activates it to ligate with TNF-alpha receptor-associated death 
16510725TNF-alphaTNF-alpha1.7binds to TNF receptor-1 and activates it to ligate with TNF-alpha receptor-associated death domain (TRADD), TRADD forming the DISC that leads 
16510725TNF-alphaTNF-alpha1.7Lenalidomide inhibited TNF-alpha with less potency compared with thalidomide in contrast lenalidomide was 
16510725TNF-alphaTNF-alpha1.7In both erythema nodosum leprosum and myelodysplastic syndromes upregulation of TNF-alpha production is postulated to contribute to disease pathogenesis 
16510725TNF-alphaTNF-alpha1.7The suppression of spinal cord TNF-alpha mRNA in our study by thalidomide and lenalidomide hence extension 
16510725TNF-alphaTNF-alpha1.7TNF-alpha immunoreactivity in G93A SOD1 and control mice 
16510725TNF-alphaTNF-alpha1.7TNF-alpha immunoreactivity was examined in the spinal cords of transgenic G93A 
16510725TNF-alphaTNF-alpha1.7TNF-alpha immunoreactivity is seen in the anterior horn motor neurons (arrows), 
16510725TNF-alphaTNF-alpha1.7Thalidomide treatment reduced TNF-alpha immunoreactivity (middle middle row left panel 
16510725TNF-alphaTNF-alpha1.7TNF-alpha double immunofluorescence with GFAP showed that TNF-alpha colocalizes with GFAP 
16510725TNF-alphaTNF-alpha1.7TNF-alpha double immunofluorescence with GFAP showed that TNF-alpha colocalizes with GFAP in astrocytes 
16510725TNF-alphaTNF-alpha1.7The white arrowhead points to an astrocyte labeled with TNF-alpha (green) green and GFAP (red) red and colocalization of TNF-alpha 
16510725TNF-alphaTNF-alpha1.7TNF-alpha (green) green and GFAP (red) red and colocalization of TNF-alpha and GFAP (yellow) yellow 
16510725TNF-alphaTNF-alpha1.7TNF-alpha and FasL immunoreactivity in human ALS and controls 
16510725TNF-alphaTNF-alpha1.7FasL (top top panels and TNF-alpha (bottom bottom panels immunoreactivities in the lumbar ventral horn of 
16510725TNF-alphaTNF-alpha-1.7We found TNF-alpha- and FasL-immunoreactive neurons in the lumbar spinal cord sections of 
16510725TNF-alphaTNF-alpha1.7Intense TNF-alpha and FasL immunoreactivity occurred predominantly in neurons of ALS patients 
16510725TNF-alphaTNF-alpha1.7Coexistence of TNF-alpha and FasL occurred in the same neurons in adjacent sections 
16510725TNF-alphaTNF-alpha1.7Real-time RT-PCR for TNF-alpha expression in the spinal cord tissue of G93A SOD1 control 
16510725TNF-alphaTNF-alpha1.7The amount of TNF-alpha cDNA was measured in the total cDNA made from total 
16510725TNF-alphaTNF-alpha1.7TNF-alpha cDNA amount in different samples was normalized against GAPDH cDNA 
16510725TNF-alphaTNF-alpha1.7Both TNF-alpha and FasL immunoreactivity persisted relatively strong in the lumbar spinal 
16510725TNFTNF-alpha.1.7immunostaining was found in both neurons and astrocytes similar to TNF-alpha. 
16510725TNF-alphaTNF-alpha1.7TNF-alpha and FasL immunoreactivity in human ALS 
16510725TNF-alphaTNF-alpha1.7Consistent with the immunohistochemical findings in ALS transgenic mice intense TNF-alpha and FasL immunoreactivity occurred in the lumbar spinal cord sections 
16510725TNF-alphaTNF-alpha1.7ALS patients whereas control tissues showed very little or no TNF-alpha and FasL immunoreactivity ( Fig 3 
16510725TNF-alphaTNF-alpha1.7TNF-alpha and FasL coexisted in the motor neurons 
16510725TNF-alphaTNF-alpha1.7in survival was associated with a marked dose-dependent decrease in TNF-alpha immunoreactivity in the motor neurons and glial cells in the 
16510725TNF-alphaTNF-alpha1.7We show that thalidomide treatment reduced TNF-alpha and FasL immunoreactivity in the spinal cords of G93A mice 
16510725TNF-alphaTNF-alpha1.7TNF-alpha mRNA in G93A mice 
16510725TNF-alphaTNF-alpha1.7To determine whether TNF-alpha mRNA is upregulated and whether thalidomide and lenalidomide can block 
16510725TNF-alphaTNF-alpha1.7TNF-alpha mRNA was increased 10-fold in G93A SOD1 mice compared with 
16510725TNF-alphaTNF-alpha1.7Thalidomide and lenalidomide treatment reduced TNF-alpha mRNA significantly ( p _lt_ 0.01 
16624536TNFTNF0.3astrocytes including interferon _amp_#x3b3 (IFN_amp_#x3b3;), IFN_amp_#x3b3 tumour necrosis factor (TNF TNF macrophage colony stimulating factor (M-CSF), M-CSF and granulocyte macrophage colony 
16624536TNFTNF-0.3to secondary stimuli such as interleukin-1 (IL-1), IL-1 IL-6 and TNF- microglia exert maximal activity through secretion of inflammatory mediators ( 
16624536TNFTNF-0.3Both TNF- and the soluble extracellular domains of its receptors TNFRI and 
16624536TNFTNF-expression0.31 and M-CSF expression are upregulated in presymptomatic mice with TNF-expression being increased well in advance of the appearance of motor 
16624536TNFTNF-0.3induces neurotoxicity in primary cortical neurons via coincident stimulation of TNF- and NMDA receptors 
16624536TNFTNF-0.3Stimulation of either TNF- or NMDA receptors alone does not initiate cell death 
16624536TNFTNF-0.3a number of pro-inflammatory cytokines (e.g., e.g. IL-1 IL-6 and TNF- 77 78 and 79 and neurotrophic factors (e.g., e.g. plasminogen 
16624536TNFTNF0.3When signaling through the TNFR1 TNFR1 recruits a TNF receptor associated death domain (TRADD) TRADD that can then interact 
16624536TNFTNF-0.3The interaction of TNF- or TNF-_amp_#x3b2 with TNFR2 leads to the activation of NF-_amp_#x3ba 
16624536TNFTNF0.3response in experimental autoimmune encephalitis and the use of p74 TNF receptor (TNFR2) TNFR2 antisense oligonucleotides will increase the extent of 
16624536TNFTNF-dependant0.3(an an NO-donor -induced neuronal apoptosis in vitro through a TNF-dependant mechanism whereas IL-3 IL-6 bFGF and M-CSF are ineffective in 
16624536TNFTNF-0.3can produce proinflammatory mediators including prostaglandins 115 IL-6 116 and TNF- 114 
16624536TNFTNF-produced0.3Fas ligand and TNF-produced by reactive astrocytes can also activate death receptors in injured 
16753239TNFTNF-A0.0agonist 15d-PGJ 2 was demonstrated to inhibit NO IL-1_amp_#x3b2 and TNF-_amp_#x3b1 production by the BV-2 mouse microglial cell line ( Koppal 
16753239TNFTNF-A0.0( Bernardo et al. 2000 demonstrated that 15d-PGJ 2 suppressed TNF-_amp_#x3b1 NO and MHC class II expression by primary rat microglia 
16753239TNFTNF-A0.1inhibited NO as well as the cytokines IL-1_amp_#x3b2 IL-6 and TNF-_amp_#x3b1 and the chemokine MCP-1 by both primary mouse microglia and 
16753239TNFTNF-A0.0the PPAR-_amp_#x3b3 agonist 15d-PGJ 2 inhibited LPS induction of NO TNF-_amp_#x3b1 IL-1_amp_#x3b2 and IL-6 in primary astrocytes 
16753239TNFTNF-A0.1For example these PPAR-_amp_#x3b3 agonists blocked TNF-_amp_#x3b1 and IL-6 expression by monocytes 
16753239TNFTNF-A0.4Recent studies demonstrated that TZDs block the production of iNOS TNF-_amp_#x3b1 IL-6 and COX-2 by primary rat microglia and astrocytes and 
16753239TNFTNF-A0.1the production of NO as well as the pro-inflammatory cytokines TNF-_amp_#x3b1 IL-1_amp_#x3b2 IL-6 IL-12 p40 and the chemokine MCP-1 by primary 
16753239TNFTNF-A0.0receptor agonist 9-cis retinoic acid suppressed microglial production of NO TNF-_amp_#x3b1 IL-1_amp_#x3b2 and IL-6 in an additive manner ( Xu et 
16753239TNFTNF-A0.1in an additive manner in inhibiting LPS induction of NO TNF-_amp_#x3b1 IL-1_amp_#x3b2 IL-6 and MCP-1 expression in primary astrocytes (unpublished unpublished 
16909005TNF-alphaTNF-alpha2.7Celastrol treatment reduced TNF-alpha iNOS CD40 and GFAP immunoreactivity in the lumbar spinal cord 
16909005TNF-alphaTNF-alpha2.7TNF-alpha immunoreactivity co-localized with SMI-32 (neuronal neuronal marker and GFAP (astrocyte 
17018025TNFATNF-A1.7pro-inflammatory cytokines such as IL-6 IL-8 tumor necrosis factor-alpha (TNF-A), TNF-A MIP-1A and RANTES in glial cultures treated with lipopolysaccharide or 
17018025TNFATNF-A1.7documented that protection of IL-4 was attributed to down-regulation of TNF-A and up-regulation of insulin-like growth factor 1 (IGF-1) IGF-1 from 
17018025TNFATNF-A1.7nitric oxide and superoxide ( pro-inflammatory neurotoxic cytokines such as TNF-A and glutamate ( Gonzalez-Scarano and Baltuch 1999 Bal-Price and Brown 
17018025TNFATNF-A1.7reported that IL-4 suppressed production in human microglia activated by TNF-A or interferon (IFN)-G IFN -G 
17018025TNFATNF-A1.7(2005 2005 demonstrated that AB-stimulated microglia released TNF-A and glutamate which synergistically increased NOS expression and activity in 
17018025TNFATNF-A1.72004 we also showed that lipopolysaccharide induced microglia to release TNF-A and higher levels of glutamate (30-40 30-40 _amp_#x03BC m present 
17018025TNFATNF-A1.7It has also been shown that TNF-A had neurotoxic effects through up-regulating iNOS nitric oxide and production 
17018025TNFATNF-A1.7documented that neuroprotection of IL-4 was attributed to down-regulation of TNF-A ( Butovsky et al 2005 
17018025TNFATNF-A1.7In accordance with this we did find lipopolysaccharide dramatically enhanced TNF-A produced by microglia ( Zhao et al 2004 and IL-4 
17018025TNFATNF-A1.7microglia ( Zhao et al 2004 and IL-4 significantly decreased TNF-A levels in MN Mc lipopolysaccharide cocultures (data data not shown 
17018025TNFATNF-A1.7Therefore down-regulation of TNF-A is one of mechanisms by which IL-4 inhibited nitric oxide 
17034351TNF-alphaTNF-alpha2.7(NOS) NOS isoforms cytokines (particularly particularly tumor necrosis factor alpha TNF-alpha chemokines and immunoglobulin Fc receptors (FcgammaRs) FcgammaRs 
17418957TNFTNF-A1.2fluid levels of the inflammatory cytokine tumor necrosis factor-alpha (TNF-_amp_#x3b1;) TNF-_amp_#x3b1 have been implicated in the pathogenesis of amyotrophic lateral sclerosis 
17418957TNFTNF-A1.2cords were established and directly exposed in vitro to recombinant TNF-_amp_#x3b1 for varying lengths of time 
17418957TNFTNF-A1.2Our results demonstrate that TNF-_amp_#x3b1 induced mitochondrial redistribution toward the soma in MN 
17418957TNFTNF-A1.2Serum levels of the cytokine tumor necrosis factor-alpha (TNF-_amp_#x3b1;) TNF-_amp_#x3b1 and its soluble receptors have been reported to be elevated 
17418957TNFTNF-A1.2In the G93A-SOD1 mouse the TNF-_amp_#x3b1 receptor p55 is upregulated between pre-symptomatic and symptomatic stages of 
17418957TNFTNF-A1.2upregulated between pre-symptomatic and symptomatic stages of disease suggesting that TNF-_amp_#x3b1 and its receptors may be involved in MN degeneration ( 
17418957TNFTNF-A1.2TNF-_amp_#x3b1 has been shown to cause or contribute to cell death 
17418957TNFTNF-A1.2Previous reports have demonstrated that stimulation of sensitive cells with TNF-_amp_#x3b1 induces abnormal perinuclear clustering of mitochondria from an evenly spread 
17418957TNFTNF-A1.2trafficking of mitochondria in MN within neurites is altered by TNF-_amp_#x3b1 an observation that mimics the in vivo histological findings in 
17418957TNFTNF-A1.2Because of the reported elevation of TNF-_amp_#x3b1 and its receptors ( Poloni et al 2000 Hensley et 
17418957TNFTNF-A1.2setting of ALS and the known positive effects of the TNF-_amp_#x3b1 blocker thalidomide on the progression of ALS in the SOD1 
17418957TNFTNF-A1.22006 we initiated experiments to study the biological effects of TNF-_amp_#x3b1 on MN in vitro 
17418957TNFTNF-A1.2survival axonal transport necrosis and apoptosis have well-documented responses to TNF-_amp_#x3b1 (both both related to apoptosis and cellular migration and have 
17418957TNFTNF-A1.2vitro studies specifically to evaluate the responses of mitochondria to TNF-_amp_#x3b1 
17418957TNFTNF-A1.2cultures were exposed to 0 or 20 ng/ml ng ml TNF-_amp_#x3b1 (R_amp_#x26;D R_amp_#x26 D Systems Minneapolis MN USA on days 3 
17418957TNFTNF-A1.2was also evaluated with exposure to 100 ng/ml ng ml TNF-_amp_#x3b1 using TUNEL staining (DeadEndTM DeadEndTM Fluorometric TUNEL System Promega Madison 
17418957TNFTNF-A1.2Doses of 100 ng/ml ng ml or lower of TNF-_amp_#x3b1 were used in all experiments 
17418957TNFTNF-A1.2washed three times with the medium cells were treated with TNF-_amp_#x3b1 at 20 ng/ml ng ml in growth medium 
17418957TNFTNF-A1.2For the TNF-_amp_#x3b1 cultures and the same conditions 16 cells were counted from 
17418957TNFTNF-A1.2were used to determine velocity of mitochondrial transport in both TNF-_amp_#x3b1 -treated and untreated cell populations 
17418957TNFTNF-A1.2For the TNF-_amp_#x3b1 treated cells we looked at five cells from three different 
17418957TNFTNF-A1.2There were more cells of sufficient clarity for the TNF-_amp_#x3b1 group 
17418957TNFTNF-A1.2left fewer wells as controls and treated the rest with TNF-_amp_#x3b1 
17418957TNFTNF-A1.2were determined from multiple experiments using 20 ng/ml ng ml TNF-_amp_#x3b1 between 6 and 20 h 
17418957TNFTNF-A1.2MN survival and cellular distribution of mitochondria in response to TNF-_amp_#x3b1 
17418957TNFTNF-A1.2in MN cultures exposed to 100 ng/ml ng ml of TNF-_amp_#x3b1 appeared similar to untreated cultures based on cell numbers and 
17418957TNFTNF-A1.2of multiple neurites (untreated=23.2_amp_#xb1;2.1 untreated=23.2_amp_#xb1 2.1 neurons/mm neurons mm 2 TNF-_amp_#x3b1 =23.9_amp_#xb1 2.7 neurons/mm neurons mm 2 
17418957TNFTNF-A1.2the percentage of TUNEL-positive cells was observed after treatment with TNF-_amp_#x3b1 (18_amp_#xb1;4%) 18_amp_#xb1 4% for 2 days at concentrations of 100 
17418957TNFTNF-A1.2TNF-_amp_#x3b1 alone was insufficient in inducing MN death in cultures 
17418957TNFTNF-A1.2the somas of cells treated with 20 ng/ml ng ml TNF-_amp_#x3b1 ( Fig 2 B D as compared with controls ( 
17418957TNFTNF-A1.2of mitochondrial movement in neurites of MN during exposure to TNF-_amp_#x3b1 
17418957TNFTNF-A1.2and 0.671_amp_#xb1 0.115 _amp_#x3bc;m/s _amp_#x3bc m s for control and TNF-_amp_#x3b1 -treated respectively 
17418957TNFTNF-A1.2and 0.704_amp_#xb1 0.117 _amp_#x3bc;m/s _amp_#x3bc m s for control and TNF-_amp_#x3b1 -treated respectively 
17418957TNFTNF-A1.2No significant velocity changes were observed with TNF-_amp_#x3b1 treatment as assessed using Student t -test for two-sample comparisons 
17418957TNFTNF-A1.21.5 2_amp_#x2013 4 and 6_amp_#x2013 8 h after treatment with TNF-_amp_#x3b1 to evaluate the time-frame that an increase in MT Green 
17418957TNFTNF-A1.2the retrograde-moving was observed after 1.5 h of treatment with TNF-_amp_#x3b1 ( Fig 3 B 
17418957TNFTNF-A1.2opposed to the exposure to 20 ng/ml ng ml of TNF-_amp_#x3b1 (stacktnf3.avi) stacktnf3.avi at 6 h 
17418957TNFTNF-A1.2Retrograde/anterograde Retrograde anterograde neuritic transport ratios in response to TNF-_amp_#x3b1 
17418957TNFTNF-A1.2retrograde/anterograde retrograde anterograde mitochondrial movement increases in the presence of TNF-_amp_#x3b1 in vitro 
17418957TNFTNF-A1.2In the presence of TNF-_amp_#x3b1 we observed an increase in the retrograde/anterograde retrograde anterograde ratio 
17418957TNFTNF-A1.2a unipolar perinuclear cluster has been documented in response to TNF-_amp_#x3b1 in murine L929 cells ( De Vos et al. 1998 
17418957TNFTNF-A1.2Our observed effects with TNF-_amp_#x3b1 seem to be greatest at about 4 h and then 
17418957TNFTNF-A1.2We are unable to say by what mechanism TNF-_amp_#x3b1 effects the localization and movement of mitochondria in MN 
17418957TNFTNF-A1.2We did not see an effect of TNF-_amp_#x3b1 on the average or maximum velocity of anterograde or retrograde 
17418957TNFTNF-A1.2the net mitochondrial transport toward the soma in response to TNF-_amp_#x3b1 appears to be related to an increased amount of retrograde 
17418957TNFTNF-A1.2ratio of retrograde to anterograde movements the observed changes with TNF-_amp_#x3b1 treatment were significant 
17418957TNFTNF-A1.2Whether TNF-_amp_#x3b1 perturbs the ATP distribution in MNs is not known but 
17418957TNFTNF-A1.2the ATP distribution in MNs is not known but if TNF-_amp_#x3b1 were able to decrease levels of ATP near the cell 
17418957TNFTNF-A1.2TNF-_amp_#x3b1 has been shown to cause or contribute to cell death 
17418957TNFTNF-A1.2Previous studies have shown that TNF-_amp_#x3b1 mediates apoptosis in cultured MN and DRG neurons that over-express 
17418957TNFTNF-A1.2Recent studies have demonstrated that the TNF-_amp_#x3b1 blocker thalidomide is effective in increasing survival and delaying progression 
17418957TNFTNF-A1.2Interestingly TNF-_amp_#x3b1 knockout mice are resistant to some forms of neurodegeneration as 
17418957TNFTNF-A1.2SOD1 G37R or SOD1 G93A mutants in the context of TNF-_amp_#x3b1 gene knockout did not affect the lifespan or the extent 
17418957TNFTNF-A1.2In the G93A-SOD1 mouse the TNF-_amp_#x3b1 receptor p55 is upregulated between presymptomatic and symptomatic stages of 
17418957TNFTNF-A1.2upregulated between presymptomatic and symptomatic stages of disease suggesting that TNF-_amp_#x3b1 and its receptors may connect inflammation to apoptosis in ALS 
17418957TNFTNF-A1.2in isolated MNs was affected on the order of hours TNF-_amp_#x3b1 exposure for several days failed to increase the number of 
17418957TNFTNF-A1.2The role of TNF-_amp_#x3b1 appears to often require the synergism of other cytokines 
17418957TNFTNF-A1.2There is a 20-fold increase in the amount of TNF-_amp_#x3b1 required to kill NSC-34 cells in the absence of LPS-activated 
17418957TNFTNF-A1.2indicating that microglia secrete a factor(s) factor s that facilitate TNF-_amp_#x3b1 mediated MN death in vitro ( He et al. 2002 
17418957TNFTNF-A1.2Our data suggest that TNF-_amp_#x3b1 alone is not sufficient to cause apoptosis in our isolated 
17418957TNFTNF-A1.2of mitochondria closer to the cell body in response to TNF-_amp_#x3b1 could predispose cells to elevated levels of reactive oxygen species 
17418957TNFTNF-A1.2shown effects on neuritic transport of mitochondria with the cytokine TNF-_amp_#x3b1 
17418957TNFTNF-A1.2The observed redistribution of mitochondria in response to TNF-_amp_#x3b1 is similar to that observed in the MN of ALS 
17418957TNFTNF-A1.2disease which has been shown to have elevated levels of TNF-_amp_#x3b1 in the spinal cord and serum 
17418957TNFTNF-A1.2necrosis which may require the presence of glial cells for TNF-_amp_#x3b1 to be effective 
17555556TNFATNF-A0.5substances such as nitric oxide superoxide and pro-inflammatory cytokines including TNF-A IL-1B and IL-6 
17555556TNFATNF-A0.5adult (60 60 days mSOD1 G93A microglia produced significantly more TNF-A and less IL-6 than wild-type microglia after LPS treatment 
17582695TNFTNF1.0Activation of p38 MAPK is associated with upregulation of TNF alpha receptors in the spinal motor neurons of mouse models 
17582695TNFTNF1.0Thus TNF alpha signalling is postulated to have a key role in 
17582695TNFalphaTNFalpha1.0Modest increases in multiple synergistic cytokines including TNFalpha TGFbeta1 and TGFbeta2 may produce a disproportionately severe activation of 
17597167TNFTNF-A0.3which interleukin-1 (IL-1), IL-1 IL-6 and tumour necrosis factor-_amp_#x3b1 (TNF-_amp_#x3b1;) TNF-_amp_#x3b1 are involved in the initial immune response help to drive 
17597167TNFTNF-A0.3The levels of IL-1_amp_#x3b2 IL-6 and TNF-_amp_#x3b1 in different brain regions of the Tg hsIL-1ra mice were 
17908040TNF-alphaTNF-alpha3.7TNF-alpha inhibition as a treatment strategy for neurodegenerative disorders new drug 
17908040TNF-alphaTNF-alpha3.7the potent pro-inflammatory / pro-apoptotic cytokine tumor necrosis factor-alpha (TNF-alpha) TNF-alpha 
17908040TNF-alphaTNF-alpha3.7TNF-alpha is secreted by the brain resident marcophage (the the microglial 
17908040TNF-alphaTNF-alpha3.7Recently agents that modulate the levels of circulating peripheral TNF-alpha protein have been shown to be worthwhile therapeutic agents with 
17908040TNF-alphaTNF-alpha3.7However thalidomide a small molecule drug can inhibit TNF-alpha protein synthesis and unlike larger molecules is readily capable of 
17908040TNF-alphaTNF-alpha3.7Consequently we have chosen to discuss the relevance of unregulated TNF-alpha expression in illnesses of the CNS and to an extent 
18040778TNFTNF1.2actively secrete both neurotoxins such as tumor necrosis factor (TNF)-A, TNF -A interleukin (IL)-1B, IL -1B CXCL8 glutamate quinolinic acid platelet 
18040778TNFATNF-A1.2benzodiazepines which cross the CNS bind to microglia inhibit LPS-induced TNF-A production suppress HIV-1 Tat protein-induced chemotaxis and also inhibit HIV-1 
18040778TNFATNF-A1.2microglia elicited robust amounts of several cytokines/chemokines, cytokines chemokines including TNF-A IL-6 IL-1B CCL2 CCL5 and CXCL10 
18040778TNFTNF1.2Lipopolysaccharide (LPS), LPS tumor necrosis factor (TNF)-A, TNF -A reactive oxygen intermediates (ROI), ROI reactive nitrogen intermediates (RNI), 
18040778TNFATNF-A1.2NO production as well as to suppress the production of TNF-A by LPS and AB peptide-stimulated microglia (Dheen Dheen et al. 
18040778TNFATNF-A1.2Although early studies have shown that microglia-derived TNF-A induces apoptosis of hippocampal progenitor cells (Cacci Cacci et al. 
18246426TNFATNF-A1.7We evaluated tumor necrosis factor-alpha (TNF-A), TNF-A interferon-G (IFN-G) IFN-G and nitric oxide (NO) NO levels in 
18246426TNFATNF-A1.7Serum TNF-A levels and IFN-G levels were significantly ( P _lt_ 0.001 
18246426TNFATNF-A1.7Since high levels of TNF-A are known to be cytotoxic it could be that a 
18246426TNFATNF-A1.7role of proinflammatory cytokines such as tumor necrosis factor-A (TNF-A) TNF-A and interferon-G (IFN-G) IFN-G as potential mediators during the progression 
18246426TNFATNF-A1.7TNF-A is essential to orchestrate the immune response in the brain 
18246426TNFATNF-A1.7The duration of the response and levels of TNF-A in the cerebral environment may be the critical factors for 
18246426TNFATNF-A1.7The detrimental effects of TNF-A in the CNS may also depend on the presence of 
18246426TNFATNF-A1.7Ag stimulated T cells have the ability to produce TNF-A along with IFN-G that acts in both innate and specific 
18246426TNFATNF-A1.7The mixture of both TNF-A and IFN-G may therefore be harmful to neuronal elements 
18246426TNFATNF-A1.7Fas-mediated apoptosis and this effect is augmented in presence of TNF-A 18 
18246426TNFATNF-A1.7of this study is to measure the systemic inflammatory markers TNF-A IFN-G and nitric oxide in ALS patients and evaluate their 
18246426TNFATNF-A1.7TNF-A and IFN-G assay The serum thus obtained was stored at 
18246426TNFATNF-A1.7obtained was stored at _amp_#8722 80C and was used for TNF-A and IFN-G estimation by ELISA 
18246426TNFATNF-A1.7Elisa kits for the estimation of TNF-A and IFN-G were obtained from R_amp_D Systems Minneapolis MN USA 
18246426TNFATNF-A1.7It may be noted that serum TNF-A levels in ALS patients were significantly higher ( P _lt_ 
18246426TNFATNF-A1.7Fig 1 Serum mean TNF-A (pg/ml pg ml SEM levels in ALS patients ( n 
18246426TNFATNF-A1.7Furthermore it can be seen that in ALS patients serum TNF-A IFN-G and NO levels (Figs Figs 4 -6 respectively started 
18246426TNFATNF-A1.7Fig 4 Second degree polynomial regression plot showing serum mean TNF-A (pg/ml pg ml SEM levels versus duration of illness in 
18246426TNFATNF-A1.7In the present study we observed significant elevation in serum TNF-A and IFN-G levels in ALS patients and also this increase 
18246426TNFATNF-A1.7Moreau et al 29 measured IL-6 and TNF-A in patients with ALS 
18246426TNFATNF-A1.7none of the patients including the five patients in whom TNF-A levels peaked at 24 months were having any significant respiratory 
18246426TNFATNF-A1.7The source for the increased serum TNF-A and IFN-G in the present study could be peripheral immune 
18246426TNFATNF-A1.7et al 30 did not find any correlation between blood TNF-A levels and duration of the disease in ALS patients 
18246426TNFATNF-A1.7Moreover Holmoy et al 31 could not detect TNF-A and IFN-G levels in the CSF of ALS patients using 
18246426TNFATNF-A1.7To conclude serum TNF-A and IFN-G levels peaked around 24 months from the onset 
18414597TNF-alphaTNF-alpha1.5Pro-inflammatory cytokines (TNF-alpha TNF-alpha and IL-1 secretory phospholipase A(2) A 2 IIA and lipoprotein-PLA(2) 
18414597TNF-alphaTNF-alpha1.5TNF-alpha and IL-1 alter lipid metabolism and stimulate production of eicosanoids 
18422522TNF-alphaTNF-alpha1.8by these cells was activated by tumour necrosis factor-alpha (TNF-alpha), TNF-alpha a proinflammatory cytokine that plays important roles in ALS2 and 
18422522TNF-alphaTNF-alpha-dependent1.8The TNF-alpha-dependent eNOS activation occurred through generation by sphingosine-kinase-1 of sphingosine-1-phosphate stimulation 
18422522TNF-alphaTNF-alpha1.8constructs specific for the enzymes and receptors eNOS activation by TNF-alpha conferred cytoprotection from excitotoxicity and neurotoxic cues such as reactive 
18436268TNFTNF-A1.2nitric oxide synthase (iNOS) iNOS and tumor necrosis factor-alpha (TNF-_amp_#x3b1;) TNF-_amp_#x3b1 in spinal cord 
18436268TNFTNF-A1.2of Hcy increased the expression of inflammatory factors such as TNF-_amp_#x3b1 and promoted reactive oxygen species (ROS) ROS as well as 
18436268TNFTNF-A1.2primary antibodies of iNOS (1:5000, 1 5000 Chemicon CA USA TNF-_amp_#x3b1 (1:1000, 1 1000 Cell signaling MA USA Bcl-2 (1:1000, 1 
18436268TNFTNF-A1.2in the_amp_#xa0 expression of inflammation-related factors such as iNOS and TNF-_amp_#x3b1 in SOD1 G93A transgenic mice ( Almer et_amp_#xa0 al. 1999 
18436268TNFTNF-A1.2our study we examined the protein levels of iNOS and TNF-_amp_#x3b1 in the spinal cord of the mice 
18436268TNFTNF-A1.2We_amp_#xa0 observed significant reduction of iNOS and TNF-_amp_#x3b1 in FA-SOD1 group or FA SOD1 group mice compared with 
18436268TNFTNF-A1.2suppress the production of inflammatory factors such as iNOS and TNF-_amp_#x3b1 and inhibit the activation of microglia and astrocytes 
18436268TNFTNF-A1.2that Hcy can enhance pro-inflammatory cytokines production such as interleukin-6 TNF-_amp_#x3b1 and C-reactive protein ( Holven et_amp_#xa0 al. 2006 
18436268TNFTNF-A1.2(2007) 2007 reported that Hcy could increase the expression of TNF-_amp_#x3b1 which plays a critical role in inflammatory responses and apoptosis 
18436268TNFTNF-A1.2Furthermore TNF-_amp_#x3b1 can switch resting murine astrocytes to active state and up-regulate 
18436268TNFTNF-A1.2glial activation as well as the expression of iNOS and TNF-_amp_#x3b1 in the spinal cord of SOD1 G93A mice at the 
18436268TNFTNF-A1.2possessed anti-inflammatory effects through inhibiting the expression of iNOS and TNF-_amp_#x3b1 and suppressing the activation of microglia and astrocytes 
18436268TNFTNF-A1.2(A) A Western blot of iNOS and TNF-_amp_#x3b1 from spinal cord samples of G93A transgenic mice in five 
18436268TNFTNF-A1.2(C_amp_#x2013;G) C_amp_#x2013 G Quantitative data of the expression of iNOS TNF-_amp_#x3b1 Bcl-2 cleaved caspase-3 and cleaved PARP in five groups 
18464922TNFTNF-A1.2like inducible nitric oxide synthase (iNOS), iNOS tumor necrosis factor-_amp_#x003b1 TNF-_amp_#x003b1 and matrix metalloproteinase-9 (MMP-9) MMP-9 in macrophages 26 and are 
18464925TNFTNF-A0.3inhibit the production of nitric oxide (NO), NO IL-6 and TNF-_amp_#x003b1 as well as expression of the inducible enzymes iNOS and 
18464925TNFTNF-A0.3authors then demonstrated that 15d-PGJ 2 decreases the production of TNF-_amp_#x003b1 IL-1 _amp_#x003b2 and the expression of COX-2 in the same 
18464925TNFTNF-A0.3primary microglial cultures 15d-PGJ 2 prevented LPS-induced iNOS expression and TNF-_amp_#x003b1 production as well as IFN-_amp_#x003b3 -induced expression of major histocompatibility 
18464925TNFTNF-A0.3either by LPS alone or in combination with IFN-_amp_#x003b3 or TNF-_amp_#x003b1 63 77 15d-PGJ 2 attenuated microglial activation also when elicited 
18464925TNFTNF-A0.3These effects were paralleled by a transient reduction of TNF-_amp_#x003b1 and NO production and a protracted inhibition of IL-1 _amp_#x003b2 
18513389TNFTNF2.2NcoI - CETP-631C/A, CETP-631C A -629 C/A, C A ile405val TNF beta thr26asn MTHFR 677 C/T, C T NOS3 -922 A/G, 
18513389TNFTNF2.2G/A, G A ITGB3 leu33pro SELE ser128arg leu554phe ICAM gly214arg TNF alpha -376 G/A, G A -308G/A, -308G A -244 G/A, 
18513389TNFTNF2.2The marker TNF beta thr26asn is twice present in the arrays as a 
18513389TNFTNF2.2procedure (multiplex multiplex and hybridization steps was checked by the TNF beta thr26asn polymorphism that gave the same results in both 
18513389TNFTNF2.2PON2 ser311cys (chromosome chromosome 7q21.3 tumor necrosis factor beta (TNF TNF beta thr26 asn (chrom chrom 6p21.3 methylenetetrahydrofolate reductase (MTHFR) MTHFR 
18513389TNFalphaTNFalpha2.2ins/del, ins del SELE leu554phe Tumor Necrosis Factor alpha (TNFalpha) TNFalpha -376 G/A G A and -308 G/A G A (chromosome 
18513389TNFTNF2.2The TNF beta thr26asn was used as further control 
18513389TNFTNF2.2fibrinogen (FGB) FGB -455 G/A G A (chromosome chromosome 4q28 TNF alfa -238 G/A G A and TNF beta thr26asn 
18513389TNFTNF2.2(chromosome chromosome 4q28 TNF alfa -238 G/A G A and TNF beta thr26asn 
18513389TNFTNF2.2previously validated by ourselves 17 and others 26 and contains TNF beta as the internal control 
18513389TNFTNF2.2In addition we noticed for example that in the same TNF locus 6p21.3 lies also the HFE gene for hemocromatosis and 
18513389TNFTNF2.2picked up by the systems e.g for PON1 NOS and TNF 
18513389TNFTNF2.2as well as angiogenesis (NOS) NOS and immune response (TNF) TNF pathways 
18751914TNFTNF-_amp_#9450.1Pro-inflammatory cytokines (TNF-_amp_#945; TNF-_amp_#945 and IL-1 secretory phospholipase A 2 IIA and lipoprotein-PLA 2 
18751914TNFTNF-_amp_#9450.1TNF-_amp_#945 and IL-1 alter lipid metabolism and stimulate production of eicosanoids 
11173059tumor necrosis factortumor necrosis factor1.0activated microglia and astrocytosis as well as increased amounts of inflammatory cytokines such as interleukin 1_amp_#x3b2; interferon _amp_#x3b3; and tumor necrosis factor are detected in the parkinsonian substantia nigra marsden and hirsch .  
11796754tnf alphatnf alpha1.0n decreased. cdna microarray analysis to monitor gene expression during neurodegeneration revealed an up regulation of genes related to an inflammatory process such as the tumor necrosis factor alpha tnf alpha gene resulting from glial cell activation together with the change in apoptosis related gene expression such as caspase 1.  
11796754tumor necrosis factor alphatumor necrosis factor alpha1.0e 30 being elevated and seven decreased. cdna microarray analysis to monitor gene expression during neurodegeneration revealed an up regulation of genes related to an inflammatory process such as the tumor necrosis factor alpha tnf alpha gene resulting from glial cell activation together with the change in apoptosis related gene expression such as caspase 1.  
11847479tumor necrosis factortumor necrosis factor1.0tumor necrosis factor and motoneuronal degeneration: an open problem.  
11847479tumor necrosis factortumor necrosis factor1.0tumor necrosis factor tnf has been implicated in the pathogenesis of various central nervous system diseases with an inflammatory component.  
11847479tumor necrosis factor alphatumor necrosis factor alpha1.0antibodies monoclonal|nf kappa b|nerve growth factors|neuroprotective agents|receptors tumor necrosis factor|tumor necrosis factor alpha|superoxide dismutase|  
12124437tnf alphatnf alpha1.0osis related genes were generally unaffected at 80 days but multiple caspases and death receptor components were up regulated at 120 days; the only exceptions being fadd and the tumor necrosis factor tnf alpha receptor p55 which was up regulated at 80 days and increased further at 120 days.  
12124437tumor necrosis factortumor necrosis factor1.0apoptosis related genes were generally unaffected at 80 days but multiple caspases and death receptor components were up regulated at 120 days; the only exceptions being fadd and the tumor necrosis factor tnf alpha receptor p55 which was up regulated at 80 days and increased further at 120 days.  
12124437tumor necrosis factortumor necrosis factor1.0tor proteins signal transducing|antigens cd|carrier proteins|cytokines|fadd protein human|fadd protein mouse|fas associated death domain protein|lymphokines|monokines|proteins|rna messenger|receptors tumor necrosis factor|receptors tumor necrosis factor type i|sod1 g93a protein|superoxide dismutase|caspases|  
12124437tumor necrosis factortumor necrosis factor1.0|receptors tumor necrosis factor type i|sod1 g93a protein|superoxide dismutase|caspases|  
14960605tnf alphatnf alpha1.0rt of the spinal cord are microglial cells see fig 3 laflamme et al. 2001 kappab alpha [inhibitory protein of nuclear factor kappab nf kappab ] index of nf kappab activity tumor necrosis factor alpha tnf alpha and cd14 data not shown .  
14960605tumor necrosis factor alphatumor necrosis factor alpha1.0n l5 segment and cervical part of the spinal cord are microglial cells see fig 3 laflamme et al. 2001 kappab alpha [inhibitory protein of nuclear factor kappab nf kappab ] index of nf kappab activity tumor necrosis factor alpha tnf alpha and cd14 data not shown .  
14960605tnf alphatnf alpha1.0the proapoptotic cytokine tnf alpha is likely to play a determinant role in this model.  
14960605tnf alphatnf alpha1.0the endotoxin lps is able to trigger transcriptional activation of the gene encoding tnf alpha in microglial cells across the cns and tnf alpha gene expression progressively increased in the spinal cord of sod1 mice nadeau and rivest 2000 alpha levels are also found in the csf of als patients poloni et al. 2000 kappab pathway which is critic 
14960605tnf alphatnf alpha1.0the bright field b.f. and dark field photomicrographs depict representative examples of the hybridization signal for tnf alpha b il 12 c and tlr2 d mrna in the reticular formation just above the olivary complex.  
14960605tnf alphatnf alpha1.0the bright field b.f. and dark field photomicrographs depict representative examples of the hybridization signal for tnf alpha il 12 and tlr2 mrna in the l5 segment of the spinal cord a .  
14960605tnf alphatnf alpha1.0we next assessed the transcriptional activation of the receptor of innate immunity tlr2 and the proapoptotic cytokine tnf alpha in the sod1 mice challenged chronically with lps.  
14960605tnf alphatnf alpha1.0the robust expression of tlr2 mrna fig 3 d g is associated with strong hybridization signals for the genes encoding the proapoptotic cytokines tnf alpha andinterleukin 12 il 12 in degenerating efferent fiber tracts of the brain fig 3 b c and in degenerating ventral spinal horns fig 4 a rows 2 4 .  
14960605tnf alphatnf alpha1.0isera dr. a. israel institut pasteur paris france for the mouse i kappab alpha cdna dr. d. radzioch mcgill university montr_amp_eacute;al qu_amp_eacute;bec canada for the plasmid containing the mouse tnf alpha cdna dr. i. campbell the scripps research institute la jolla ca for the mouse ifn gamma cdna dr. k. pahan university of nebraska lincoln ne for the mouse il 12p40 cdna and dr. li huei tsai for hostin 
15081582tumor necrosis factortumor necrosis factor1.0many cellular factors induce cox 2 expression including multiple growth factors cytokines interleukin il 1_amp_#x3b2; tumor necrosis factor tnf lipopolysaccharide lps phorbol ester and elevated intracellular calcium concentration.  
15649489tumor necrosis factortumor necrosis factor1.0il 1_amp_#x3b2; tumor necrosis factor and inos levels are increased in transgenic mouse models of als almer et al. 1999 elliott 2001 ghezzi et al. 1998 and li et al. 2000 .  
15649489tumor necrosis factortumor necrosis factor1.0transcription profiling of the spinal cords of mice with g93a sod1 mutations showed up regulation of tumor necrosis factor cd68 and caspase 1 mrna at 11 weeks of age prior to motor neuron death yoshihara et al. 2002 .  
15657392tnf alphatnf alpha1.0 c rt pcr analysis of tnf alpha and _amp_#223; actin of wt lane 1 mlc/migf 1 lane 2 sod1 lane 3 and sod1 /migf 1 lane 4 transgenic mice at 123 d old.  
15657392tnf alphatnf alpha1.0lane 6 identifies the rna positive control pc for tnf alpha obtained from spleen.  
15657392tnf alphatnf alpha1.0the activation of astroglia can be correlated with the expression of certain cytokines such as tnf alpha which enhance the response to inflammatory states and contribute to the progression of neurological dysfunction in sod1 mice elliott 2001 .  
15657392tnf alphatnf alpha1.0although tnf alpha expression was normally undetectable in the cns of healthy mice fig 5 c lanes 1 and 2 it accumulated in the spinal cord of sod1 mice at paralysis stage 123 d; fig 5 c lane 3 .  
15657392tnf alphatnf alpha1.0in contrast tnf alpha expression was not apparent in the spinal cord of sod1 /migf 1 transgenic mice fig 5 c lane 4 . migf 1 hypertrophic muscle therefore functions as a protective tissue for the cns modulating reactive a 
15657392tnf alphatnf alpha1.0the following oligonucleotides were used: tnf alpha sense 5' cccagaccctcacacactcagat 3' and anti sense 5' ttgtcccttgaagagaacctg 3'; _amp_#223; actin sense 5' gtgggccgctctaggcacaa 3' and anti sense 5' ctctttgatgtcacgcacgatttc 3'.  
15681814tnf alphatnf alpha1.0new therapeutic strategies and drug candidates for neurodegenerative diseases: p53 and tnf alpha inhibitors and glp 1 receptor agonists.  
15681814tnf alphatnf alpha1.0such targets include tnf alpha p53 and glp 1 receptor.  
15681814tnf alphatnf alpha1.0the cytokine tnf alpha is elevated in alzheimer's disease parkinson's disease stroke and amyotrophic lateral sclerosis.  
15681814tumor necrosis factortumor necrosis factor1.0neoplasm proteins|receptors glucagon|receptors tumor necrosis factor type ii|tumor necrosis factor decoy receptors|tumor suppressor protein p53|glucagon like peptide receptor|  
16380619tnf alphatnf alpha1.0the authors compared il 6 and tumor necrosis factor alpha tnf alpha levels in csf and sera from 10 hypoxemics and 10 normoxemics patients with als to those of 10 hypoxemics and 10 normoxemics neurologic controls.  
16380619tumor necrosis factor alphatumor necrosis factor alpha1.0the authors compared il 6 and tumor necrosis factor alpha tnf alpha levels in csf and sera from 10 hypoxemics and 10 normoxemics patients with als to those of 10 hypoxemics and 10 normoxemics neurologic controls.  
16380619tnf alphatnf alpha1.0an excessive production of tumor necrosis factor alpha tnf alpha with lower csf levels of interleukin il 6 was demonstrated in a sod 1 mouse model suggesting an increase cytotoxic potential of microglia.  
16380619tumor necrosis factor alphatumor necrosis factor alpha1.0an excessive production of tumor necrosis factor alpha tnf alpha with lower csf levels of interleukin il 6 was demonstrated in a sod 1 mouse model suggesting an increase cytotoxic potential of microglia.  
16380619tnf alphatnf alpha1.0tnf alpha could act as a principal driver for neuroinflammation because its receptors are elevated in the presymptomatic phases of the disease while several costimulating cytokines il 1_amp_#223; il 6 and chem 
16380619tnf alphatnf alpha1.0however there were conflicting results: either no difference in il 6 tnf alpha or il 12 was found in patients with als and healthy and inflammatory controls or elevated levels of il 6 and il 1_amp_#223; in the csf spinal cords and sera of patients with als.  
16380619tnf alphatnf alpha1.0in light of the inflammatory hypothesis we investigated the role of hypoxemia in the regulation of cytokines by studying tnf alpha and il 6 in the sera and csf of hypoxemic and normoxemic patients with als and neurologic controls.  
16380619tnf alphatnf alpha1.0il 6 and tnf alpha levels in csf and sera were determined using a chemiluminescent assay quantiglo r_amp_d systems and an elisa test quantikine r_amp_d systems .  
16380619tnf alphatnf alpha1.0we found higher levels of il 6 in csf z = 2.7; p = 0.02 in serum z = 2.1; p = 0.04 and tnf alpha in serum z = 2.5; p = 0.01 in hypoxemic vs normoxemic patients with als figure 1 .  
16380619tnf alphatnf alpha1.0a correlation exists between pao 2 and levels of csf il 6 p = 0.0001 r = 0.7 serum il 6 p = 0.007 r = 0.6 serum tnf alpha p = 0.001 r = 0.7 in patients with als.  
16380619tnf alphatnf alpha1.0in neurologic controls we found higher levels of il 6 in csf z = 2.8; p = 0.02 in serum z = 2.3; p = 0.02 and tnf alpha in serum z = 2.0; p = 0.05 in hypoxemic controls vs normoxemic ones figure 2 .  
16380619tnf alphatnf alpha1.0there were correlations between pao 2 and csf il 6 p = 0.01 r = 0.5 serum il 6 p = 0.01 r = 0.5 and serum tnf alpha levels p = 0.01 r = 0.5 in neurologic controls.  
16380619tnf alphatnf alpha1.0tnf alpha was undetectable in csf.  
16380619tnf alphatnf alpha1.0we found no correlation between il 6 or tnf alpha levels in plasma and those in csf.  
16380619tnf alphatnf alpha1.0il 6 and tnf alpha levels did not correlate with age clinical presentation or disease duration.  
16380619tnf alphatnf alpha1.0we found an increase in il 6 levels in csf and sera and tnf alpha in sera in hypoxemic patients with als and hypoxemic neurologic controls vs normoxemic ones but no difference between patients with als and controls.  
16380619tnf alphatnf alpha1.0on the other hand hypoxia stimulates the proinflammatory cytokines such as tnf alpha and il 6 mediated by others transcriptional factors: nuclear factor kappab ap 1 and sp 1.  
16380619tnf alphatnf alpha1.0hypoxemia episodes cause early microglia activation followed by the release of a variety of neurotoxic products including excitatory amino acid nitric oxide and proinflammatory cytokines such as il 6 tnf alpha and il 1_amp_#223;.  
16380619tnf alphatnf alpha1.0higher il 6 and tnf alpha levels could therefore correspond to a normal response to hypoxemia probably via nf kappab.  
16380619tnf alphatnf alpha1.0our findings suggest that increased levels of il 6 tnf alpha pge 2. and cox 2 observed in patients with als parallel motor neuronal loss and could correspond to a natural response to hypoxemia.  
16380619tumor necrosis factor alphatumor necrosis factor alpha1.0csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in patients with als according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and the normoxemic groups.  
16380619tumor necrosis factor alphatumor necrosis factor alpha1.0csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in neurologic controls according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and the normoxemic groups.  
16436205tumor necrosis factortumor necrosis factor1.0tumor necrosis factor _amp_#x003b1; tnf_amp_#x003b1; and its principle receptor tnf ri are particularly elevated at pre and post symptomatic stages of disease [ 6 9 ] suggesting a rationale for the application of this cyt 
16510725tnf alphatnf alpha1.0important mediators of inflammation such as the cytokine tumor necrosis factor alpha tnf alpha and its superfamily member fibroblast associated cell surface ligand fasl have been implicated in apoptosis.  
16510725tumor necrosis factor alphatumor necrosis factor alpha1.0important mediators of inflammation such as the cytokine tumor necrosis factor alpha tnf alpha and its superfamily member fibroblast associated cell surface ligand fasl have been implicated in apoptosis.  
16510725tnf alphatnf alpha1.0we found increased tnf alpha and fasl immunoreactivity in lumbar spinal cord sections of als patients and g93a transgenic mice.  
16510725tnf alphatnf alpha1.0both increased tnf alpha and fasl immunostaining in the lumbar spinal cord of the g93a sod1 transgenic mice occurred at 40 60 d well before the onset of symptoms and loss of motor neurons.  
16510725tnf alphatnf alpha1.0we tested the neuroprotective effect of thalidomide and its analog lenalidomide pharmacological agents that inhibit the expression of tnf alpha and other cytokines by destabilizing their mrna.  
16510725tnf alphatnf alpha1.0treated g93a mice showed a reduction in tnf alpha and fasl immunoreactivity as well as their mrna in the lumbar spinal cord.  
16510725tnf alphatnf alpha1.0key words: g93a; sod1; thalidomide; lenalidomide; tnf alpha; fasl  
16510725tnf alphatnf alpha1.0tumor necrosis factor alpha tnf alpha is a major inflammatory cytokine that elicits a wide range of biological responses including neuronal apoptosis tewari and dixit 1996 alpha mediates its biological effects through activation of two d 
16510725tumor necrosis factor alphatumor necrosis factor alpha1.0tumor necrosis factor alpha tnf alpha is a major inflammatory cytokine that elicits a wide range of biological responses including neuronal apoptosis tewari and dixit 1996 alpha mediates its biological effects through activatio 
16510725tnf alphatnf alpha1.0in the present study we examined the temporal pattern of tnf alpha and fasl immunoreactivity in the lumbar spinal cord of g93a mice.  
16510725tnf alphatnf alpha1.0because previous work showed that the pro inflammatroy cytokines tnf alpha and fasl are elevated in both human and mouse models of als and play a role in the pathogenesis of als we tested the neuroprotective effects of thalidomide and lenalidomide two immunomodulatory agent 
16510725tnf alphatnf alpha1.0levated in both human and mouse models of als and play a role in the pathogenesis of als we tested the neuroprotective effects of thalidomide and lenalidomide two immunomodulatory agents that inhibit tnf alpha production corral et al. 1999 ; bartlett et al. 2004 .  
16510725tnf alphatnf alpha1.0the primers used were as follows: tnf alpha sense 5' gacccagtgtgggaag 3' and antisense 5' ggttcagtgatgt agcga 3'; glyceraldehyde 3 phosphate dehydrogenase gapdh sense 5' ccatggagaaggctggg 3' and antisense 5' caaaa gttgtcatggatgacc 3'.  
16510725tnf alphatnf alpha1.0the amounts of tnf alpha and gapdh cdna were calculated using linear regression analysis from standard curves for both tnf alpha and gapdh and the amount of tnf alpha cdna was expressed as a percentage of gapdh.  
16510725tnf alphatnf alpha1.0the sections were immunostained with antibodies to tnf alpha serotec raleigh nc fasl santa cruz biotechnology santa cruz ca cd40 serotec oxford uk and glial fibrillary acid protein gfap; dako carpinteria ca using a modified avidin biotin peroxidase technique.  
16510725tnf alphatnf alpha1.0double immunofluorescence was performed to demonstrate the glial localization of tnf alpha and fasl.  
16510725tnf alphatnf alpha1.0sections were incubated for 18 h in the primary antibody mixture containing anti tnf alpha or anti fasl and the astrocyte marker anti gfap.  
16510725tnf alphatnf alpha1.0paraffin sections 7 microm thick were prepared and processed for tnf alpha or fasl immunohistochemistry as described above.  
16510725tnf alphatnf alpha1.0tnf alpha and fasl immunoreactivity in g93a sod1 mouse model of als  
16510725tnf alphatnf alpha1.0we investigated the temporal pattern of tnf alpha and fasl immunoreactivity in g93a sod1 mice at 40 and 60 d asymptomatic 90 d early symptomatic 110 d fully symptomatic and end stage 120 135 d in the ventral horn of the lumbar spinal cords.  
16510725tnf alphatnf alpha1.0immunohistochemical analysis showed little tnf alpha immunoreactivity at 40 d which appeared similar to controls in the motor neurons of the ventral horn in the lumbar spinal cord.  
16510725tnf alphatnf alpha1.0at 60 d motor neurons from g93a mice with a healthy appearance were stained with tnf alpha moderately and immunoreactivity became more intense at 90 and 110 d.  
16510725tnf alphatnf alpha1.0tnf alpha colocalized with the motor neuron marker smi 32 kiaei et al. 2006 alpha staining also occurred in actrocytes at 110 d of age as demonstrated by colocalization with the astrocyte marker gfap by double 
16510725tnf alphatnf alpha1.0tnf alpha and fasl are important mediators of inflammation and they play a role in apoptosis.  
16510725tnf alphatnf alpha1.0studies performed in mouse models of als and patients with als show increases in tnf alpha.  
16510725tnf alphatnf alpha1.0in als patients antigenic tnf alpha and its soluble receptors measured by elisa were significantly higher in als patients than in healthy controls poloni et al. 2000 alpha mrna expression in spinal cords of g93a mice at 4 months of age 
16510725tnf alphatnf alpha1.0me weaker reaching a maximum at 7.5 8 months of age in low copy number g93a mice elliott 2001 alpha receptors was also present a study using rpas showed increased fas associated death domain fadd and tnf alpha receptor p55 at 80 d which increased further at 120 d in high expressing g93a mice hensley et al. 2002 alpha was increased in the lumbar spinal cord of g37r sod1 mice at 7 and 10 months of age and th 
16510725tnf alphatnf alpha1.0glial cells are the major source of tnf alpha expression in the cns.  
16510725tnf alphatnf alpha1.0we found that both lumbar spinal cord motor neurons and glia from g93a sod1 mice express high levels of tnf alpha and this occurs at 60 d well before the onset of symptoms.  
16510725tnf alphatnf alpha1.0an increase in tnf alpha mrna was confirmed by real time rt pcr in g93a mice at 110 d.  
16510725tnf alphatnf alpha1.0double labeling of tnf alpha with gfap confirmed expression of tnf alpha in astrocytes fig 1 .  
16510725tnf alphatnf alpha1.0this is consistent with a previous study in which tnf alpha immunoreactivity was increased at 17 weeks of age in microglia and motor neurons of g93a sod1 mice yoshihara et al. 2002 .  
16510725tnf alphatnf alpha1.0and p38 as well as the fadd/caspase 8 pathway raoul et al. 2002 alpha upregulates fasl pinkoski et al. 2002 alpha immunostaining was found in the neurons of adjacent sections suggesting that fasl and tnf alpha are coexpressed in these neurons fig 3 .  
16510725tnf alphatnf alpha1.0because both tnf alpha and fasl immunostaining were increased in g93a mice we examined the effects of thalidomide and its analog lenalidomide which inhibits the stability of tnf alpha mrna moreira et al. 1993 alpha and fasl expression in motor neurons of g93a mice there was a delay of disease onset and a significant attenuation of disease progression in g93a sod1 mice figs 4 6 .  
16510725tnf alphatnf alpha1.0quantitative rt pcr showed that both thalidomide and lenalidomide significantly reduced tnf alpha mrna levels at 110 d of age.  
16510725tnf alphatnf alpha1.0our findings provide additional evidence for a role of pro inflammatory cytokines in als and suggest that tnf alpha and fasl and related cytokines have important triggering roles in the pathogenesis of als in initiating a cell death pathway s .  
16510725tnf alphatnf alpha1.0tnf alpha binds to tnf receptor 1 and activates it to ligate with tnf alpha receptor associated death domain tradd forming the disc that leads to activation of caspase 8 resulting in bid cleavage and the activation of executioner caspases 3 6 and 7.  
16510725tnf alphatnf alpha1.0lenalidomide inhibited tnf alpha with less potency compared with thalidomide; in contrast lenalidomide was more potent in inhibiting other cytokines such as il 12p40 il 1 alpha and il 1 beta.  
16510725tnf alphatnf alpha1.0in both erythema nodosum leprosum and myelodysplastic syndromes upregulation of tnf alpha production is postulated to contribute to disease pathogenesis.  
16510725tnf alphatnf alpha1.0the suppression of spinal cord tnf alpha mrna in our study by thalidomide and lenalidomide hence extension of survival in g93a mice suggests that this class of immunomodulatory agents may have efficacy in diseases of the cns associated with 
16510725tnf alphatnf alpha1.0tnf alpha immunoreactivity in g93a sod1 and control mice.  
16510725tnf alphatnf alpha1.0tnf alpha immunoreactivity was examined in the spinal cords of transgenic g93a sod1 mice at 40 60 90 and 110 d of age and in 110 d old transgenic wild type hsod1 n1029 control mice.  
16510725tnf alphatnf alpha1.0tnf alpha immunoreactivity is seen in the anterior horn motor neurons arrows with heavy staining in the cytoplasm and nucleus of motor neurons.  
16510725tnf alphatnf alpha1.0thalidomide treatment reduced tnf alpha immunoreactivity middle row left panel .  
16510725tnf alphatnf alpha1.0tnf alpha double immunofluorescence with gfap showed that tnf alpha colocalizes with gfap in astrocytes.  
16510725tnf alphatnf alpha1.0the white arrowhead points to an astrocyte labeled with tnf alpha green and gfap red and colocalization of tnf alpha and gfap yellow .  
16510725tnf alphatnf alpha1.0tnf alpha and fasl immunoreactivity in human als and controls.  
16510725tnf alphatnf alpha1.0fasl top panels and tnf alpha bottom panels immunoreactivities in the lumbar ventral horn of the spinal cord of human als and control patients.  
16510725tnf alphatnf alpha1.0we found tnf alpha and fasl immunoreactive neurons in the lumbar spinal cord sections of a familial als patient with sod1 mutation i113t and sporadic als patients.  
16510725tnf alphatnf alpha1.0intense tnf alpha and fasl immunoreactivity occurred predominantly in neurons of als patients.  
16510725tnf alphatnf alpha1.0coexistence of tnf alpha and fasl occurred in the same neurons in adjacent sections of als patients.  
16510725tnf alphatnf alpha1.0real time rt pcr for tnf alpha expression in the spinal cord tissue of g93a sod1 control mice and g93a mice treated with thalidomide or lenalidomide.  
16510725tnf alphatnf alpha1.0the amount of tnf alpha cdna was measured in the total cdna made from total mrna isolated from spinal cord tissue of 110 d old n1029/b6sjl controls and g93a sod1 mice treated with vehicle thalidomide or lenalidomide.  
16510725tnf alphatnf alpha1.0tnf alpha cdna amount in different samples was normalized against gapdh cdna and expressed as a percentage of gapdh cdna ** p _lt_ 0.01; *** p _lt_ 0.0005; mann whitney test .  
16510725tnf alphatnf alpha1.0both tnf alpha and fasl immunoreactivity persisted relatively strong in the lumbar spinal cord sections of g93a mice at end stage data not shown .  
16510725tnf alphatnf alpha1.0fasl immunoreactivity colocalized with gfap indicating that fasl immunostaining was found in both neurons and astrocytes similar to tnf alpha.  
16510725tnf alphatnf alpha1.0tnf alpha and fasl immunoreactivity in human als  
16510725tnf alphatnf alpha1.0consistent with the immunohistochemical findings in als transgenic mice intense tnf alpha and fasl immunoreactivity occurred in the lumbar spinal cord sections from an als patient with a sod1 mutation i113t as well as sporadic als patients whereas control tissues showed very little or no  
16510725tnf alphatnf alpha1.0 and fasl immunoreactivity occurred in the lumbar spinal cord sections from an als patient with a sod1 mutation i113t as well as sporadic als patients whereas control tissues showed very little or no tnf alpha and fasl immunoreactivity fig 3 .  
16510725tnf alphatnf alpha1.0tnf alpha and fasl coexisted in the motor neurons.  
16510725tnf alphatnf alpha1.0histological analysis revealed that the increase in survival was associated with a marked dose dependent decrease in tnf alpha immunoreactivity in the motor neurons and glial cells in the spinal cord lumbar regions of g93a mice compared with saline treated controls data not shown .  
16510725tnf alphatnf alpha1.0we show that thalidomide treatment reduced tnf alpha and fasl immunoreactivity in the spinal cords of g93a mice figs 1 2 .  
16510725tnf alphatnf alpha1.0tnf alpha mrna in g93a mice  
16510725tnf alphatnf alpha1.0to determine whether tnf alpha mrna is upregulated and whether thalidomide and lenalidomide can block its mrna elevation in the spinal cord of g93a mice real time quantitative pcr was performed using cdna synthesized from total rn 
16510725tnf alphatnf alpha1.0tnf alpha mrna was increased 10 fold in g93a sod1 mice compared with control littermates p _lt_ 0.005 fig 7 .  
16510725tnf alphatnf alpha1.0thalidomide and lenalidomide treatment reduced tnf alpha mrna significantly p _lt_ 0.01 .  
16647138tumor necrosis factortumor necrosis factor1.0the d class resolvins block tumor necrosis factor _amp_#x3b1; induced interleukin il 1_amp_#x3b2; transcripts and are potent regulators of pmn infiltration in brain serhan et al. 2004 .  
16909005tnf alphatnf alpha1.0celastrol treatment reduced tnf alpha inos cd40 and gfap immunoreactivity in the lumbar spinal cord sections of celastrol treated g93a mice compared to untreated g93a mice.  
16909005tnf alphatnf alpha1.0tnf alpha immunoreactivity co localized with smi 32 neuronal marker and gfap astrocyte marker .  
17008387tumor necrosis factor alphatumor necrosis factor alpha1.0y inhibiting the activation of transcription factor nf kappab serving as a strong antioxidant or by activating akt gsk3 beta pathway cuzzocrea et al. 2002 kappab driven genes such as cyclooxygenase 2 tumor necrosis factor alpha and interleukin 1 beta drachman et al. 2002 beta pathway reduced mutant sod1 mediated motor neuron cell death in vitro koh et al. 2005 we found that pdtc treatment does not provide protection but ins 
17015226tumor necrosis factortumor necrosis factor1.0one particularly interesting cytokine upregulated in mutant sod1 mouse spinal cords which could play a role in motor neuron degeneration is tumor necrosis factor _amp_#x3b1; tnf_amp_#x3b1; .  
17018025tumor necrosis factor alphatumor necrosis factor alpha1.0il 4 has also been shown to reduce the production of pro inflammatory cytokines such as il 6 il 8 tumor necrosis factor alpha tnf a mip 1a and rantes in glial cultures treated with lipopolysaccharide or il 1 ledeboer et al 2000 ; ehrlich et al 1998 .  
17034351tnf alphatnf alpha1.0 genes including arachidonic acid metabolizing enzymes [e.g. cyclooxygenase ii cox ii and 5 lipoxygenase 5lox ]; nitric oxide synthase nos isoforms; cytokines particularly tumor necrosis factor alpha tnf alpha ; chemokines; and immunoglobulin fc receptors fcgammars .  
17034351tumor necrosis factor alphatumor necrosis factor alpha1.0egulation of proinflammatory genes including arachidonic acid metabolizing enzymes [e.g. cyclooxygenase ii cox ii and 5 lipoxygenase 5lox ]; nitric oxide synthase nos isoforms; cytokines particularly tumor necrosis factor alpha tnf alpha ; chemokines; and immunoglobulin fc receptors fcgammars .  
17350694tumor necrosis factortumor necrosis factor1.0in addition microglia and macrophages activated by hiv seem to damage neurons through the release of neurotoxins such as arachidonic acid glutamate tumor necrosis factor _amp_#x3b1; and interleukin 1 [25] .  
17350694tumor necrosis factortumor necrosis factor1.0tic level followed by inhibition of subsequent noxious cascades; iii antioxidant activity mainly owing to the phenol group of various resorcinol type cannabinoids; iv suppression of the production of tumor necrosis factor _amp_#x3b1;; v activation of the phosphatidylinositol 3 kinase and protein kinase b pathway; vi induction of phosphorylation of extracellular regulated kinases; and vii induction of the expression of 
17418957tumor necrosis factor alphatumor necrosis factor alpha1.0motor neuron mn mitochondrial abnormalities and elevation in spinal fluid levels of the inflammatory cytokine tumor necrosis factor alpha tnf _amp_#x3b1; have been implicated in the pathogenesis of amyotrophic lateral sclerosis als .  
17418957tumor necrosis factor alphatumor necrosis factor alpha1.0serum levels of the cytokine tumor necrosis factor alpha tnf _amp_#x3b1; and its soluble receptors have been reported to be elevated in als patients as compared with healthy controls poloni et al 2000 and strong 2003 .  
17418957tumor necrosis factor alphatumor necrosis factor alpha1.0tumor necrosis factor alpha|  
17569578tumor necrosis factortumor necrosis factor1.0several cytokines including tumor necrosis factor _amp_#x3b1;_amp_#xa0; tnf_amp_#x3b1; interferon _amp_#x3b3;_amp_#xa0; ifn_amp_#x3b3; and interleukin 6 il 6 are regularly found in multiple sclerosis brain lesions and in spinal cord infiltrates of e 
17582695tnf alphatnf alpha1.0activation of p38 mapk is associated with upregulation of tnf alpha receptors in the spinal motor neurons of mouse models of familial als [38] .  
17582695tnf alphatnf alpha1.0thus tnf alpha signalling is postulated to have a key role in als [39] .  
17908040tnf alphatnf alpha1.0tnf alpha inhibition as a treatment strategy for neurodegenerative disorders: new drug candidates and targets.  
17908040tnf alphatnf alpha1.0one strong candidate trigger protein and thus a potential target for therapeutic manipulation is the potent pro inflammatory / pro apoptotic cytokine tumor necrosis factor alpha tnf alpha .  
17908040tumor necrosis factor alphatumor necrosis factor alpha1.0one strong candidate trigger protein and thus a potential target for therapeutic manipulation is the potent pro inflammatory / pro apoptotic cytokine tumor necrosis factor alpha tnf alpha .  
17908040tnf alphatnf alpha1.0tnf alpha is secreted by the brain resident marcophage the microglial cell in response to various stimuli.  
17908040tnf alphatnf alpha1.0recently agents that modulate the levels of circulating peripheral tnf alpha protein have been shown to be worthwhile therapeutic agents with the use of enbrel etanercept and remicade infliximab both of which display beneficial properties against rheumatoid arthritis and othe 
17908040tnf alphatnf alpha1.0however thalidomide a small molecule drug can inhibit tnf alpha protein synthesis and unlike larger molecules is readily capable of crossing the blood brain barrier.  
17908040tnf alphatnf alpha1.0thus thalidomide and its analogs are excellent candidate agents for use in determining the potential value of anti tnf alpha therapies in a variety of diseases underpinned by inflammation within the nervous system.  
17908040tnf alphatnf alpha1.0consequently we have chosen to discuss the relevance of unregulated tnf alpha expression in illnesses of the cns and to an extent the peripheral nervous system.  
17908040tnf alphatnf alpha1.0additionally we consider the utilization of thalidomide derived agents as anti tnf alpha therapeutics in the setting of neuroinflammation.  
18040778tumor necrosis factortumor necrosis factor1.0indeed it is now recognized that hiv 1 infected microglia and other brain macrophages actively secrete both neurotoxins such as tumor necrosis factor tnf a interleukin il 1b cxcl8 glutamate quinolinic acid platelet activating factor eicosanoids and nitric oxide no as well as neurotoxic viral proteins such as tat gp120 and gp41.  
18040778tumor necrosis factortumor necrosis factor1.0lipopolysaccharide lps tumor necrosis factor tnf a reactive oxygen intermediates roi reactive nitrogen intermediates rni quinolinic acid qa multiple sclerosis ms alzheimer's disease ad parkinson's disease pd amyotrophic lateral sclerosis als .  
18246426tumor necrosis factor alphatumor necrosis factor alpha1.0we evaluated tumor necrosis factor alpha tnf a interferon g ifn g and nitric oxide no levels in the serum of 22 als patients and 20 controls.  
18246426tumor necrosis factortumor necrosis factor1.0keywords amyotrophic lateral sclerosis tumor necrosis factor a interferon g nitric oxide inflammation  
18246426tumor necrosis factortumor necrosis factor1.0the role of proinflammatory cytokines such as tumor necrosis factor a tnf a and interferon g ifn g as potential mediators during the progression of brain injury is not clear.  
18375019tumor necrosis factor alphatumor necrosis factor alpha1.0other powerful inflammatory stimulants such as lipopolysaccharide 0.5mug/ml tumor necrosis factor alpha 10ng/ml and interleukin 1beta 10ng/ml alone or in combination were without effect.  
18414597tnf alphatnf alpha1.0pro inflammatory cytokines tnf alpha and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation.  
18414597tnf alphatnf alpha1.0tnf alpha and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders.  
18422522tnf alphatnf alpha1.0we found that enos which is endogenously expressed by these cells was activated by tumour necrosis factor alpha tnf alpha a proinflammatory cytokine that plays important roles in als2 and several neurodegenerative diseases.  
18422522tnf alphatnf alpha1.0the tnf alpha dependent enos activation occurred through generation by sphingosine kinase 1 of sphingosine 1 phosphate stimulation of its membrane receptors and activation of akt as determined using small interfer 
18422522tnf alphatnf alpha1.0hate stimulation of its membrane receptors and activation of akt as determined using small interference rna and dominant negative constructs specific for the enzymes and receptors. enos activation by tnf alpha conferred cytoprotection from excitotoxicity and neurotoxic cues such as reactive oxygen species endoplasmic reticulum stress dna damage and mutated alsin itself.  
18436268tumor necrosis factor alphatumor necrosis factor alpha1.0t fa or fa + b12 treatment significantly attenuated the plasma hcy level suppressed the activation of microglia and astrocytes and inhibited the expression of inducible nitric oxide synthase inos and tumor necrosis factor alpha tnf _amp_#x3b1; in spinal cord.  
18464922tumor necrosis factortumor necrosis factor1.0tzds inhibit the expression of various inflammatory proteins like inducible nitric oxide synthase inos tumor necrosis factor _amp_#x003b1; tnf _amp_#x003b1; and matrix metalloproteinase 9 mmp 9 in macrophages [ 26 ] and are beneficial in disorders such as inflammatory bowel disease [ 27 ].  
18513389tnf alphatnf alpha1.0gly adrb2 gln27glu mmp3 1171 5a/6a fii 20210 g/a fv arg506gln fvii 230 10 bp del/ins arg353glu pai 675 g5/g4 11053 g/t fgb 455 g/a itga2 873 g/a itgb3 leu33pro sele ser128arg leu554phe icam gly214arg tnf alpha 376 g/a 308g/a 244 g/a 238 g/a.  
18513389tumor necrosis factor alphatumor necrosis factor alpha1.0 receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromosome 12p13 fvii 232 ins/del sele leu554phe tumor necrosis factor alpha tnfalpha 376 g/a and 308 g/a chromosome 6p21.3 .