Document Information


PMID 15657392  (  )
Title Muscle expression of a local Igf-1 isoform protects motor neurons in an ALS mouse model.
Abstract Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease characterized by a selective degeneration of motor neurons, atrophy, and paralysis of skeletal muscle. Although a significant proportion of familial ALS results from a toxic gain of function associated with dominant SOD1 mutations, the etiology of the disease and its specific cellular origins have remained difficult to define. Here, we show that muscle-restricted expression of a localized insulin-like growth factor (Igf) -1 isoform maintained muscle integrity and enhanced satellite cell activity in SOD1(G93A) transgenic mice, inducing calcineurin-mediated regenerative pathways. Muscle-specific expression of local Igf-1 (mIgf-1) isoform also stabilized neuromuscular junctions, reduced inflammation in the spinal cord, and enhanced motor neuronal survival in SOD1(G93A) mice, delaying the onset and progression of the disease. These studies establish skeletal muscle as a primary target for the dominant action of inherited SOD1 mutation and suggest that muscle fibers provide appropriate factors, such as mIgf-1, for neuron survival. Interuniversity Institute of Myology, University of Rome "La Sapienza", 14 00161 Rome, Italy.

NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.



Targets by SciMiner Summary

HUGO ID Symbol Target Name #Occur ActualStr
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))146hSOD | SOD1 | superoxide dismutase1 | SOD |
5464IGF1insulin-like growth factor 1 (somatomedin C)26insulin like growth factor 1 | Igf-1 |
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscle19MLC |
4235GFAPglial fibrillary acidic protein13glial fibrillary acidic protein | GFAP |
11892TNFtumor necrosis factor (TNF superfamily, member 2)12TNF-alpha | tnf alpha |
329AGRNagrin4agrin | Agrin |
7612MYOGmyogenin (myogenic factor 4)4myogenin |
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)3MyHC |
2770DESdesmin3desmin |
6081INSinsulin2insulin |
7577MYH7myosin, heavy chain 7, cardiac muscle, beta2myosin heavy chain |
23212MYH14myosin, heavy chain 142myosin |
14079CHRNA9cholinergic receptor, nicotinic, alpha 92acetylcholine receptor |
18809TUBA1Btubulin, alpha 1b1alpha tubulin |
8621PAX7paired box 71Pax7 |

 


Targets by SciMiner Full list

HUGO ID Symbol Name ActualStr Score FlankingText
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5results from a toxic gain of function associated with dominant SOD1 mutations the etiology of the disease and its specific cellular
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5isoform maintained muscle integrity and enhanced satellite cell activity in SOD1 transgenic mice inducing calcineurin-mediated regenerative pathways
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5Muscle-specific expression of local Igf-1 (mIgf-1) mIgf-1 isoform also stabilized neuromuscular junctions reduced inflammation in
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5in the spinal cord and enhanced motor neuronal survival in SOD1 mice delaying the onset and progression of the disease
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5as a primary target for the dominant action of inherited SOD1 mutation and suggest that muscle fibers provide appropriate factors such
4235GFAPglial fibrillary acidic proteinGFAP2.5paper AChR acetylcholine receptor ALS amyotrophic lateral sclerosis CnA calcineurin GFAP glial fibrillary acidic protein Igf insulin-like growth factor mIgf-1 local
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5acidic protein Igf insulin-like growth factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)MyHC2.5protein Igf insulin-like growth factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type
23212MYH14myosin, heavy chain 14myosin2.2Igf insulin-like growth factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Transgenic mice ubiquitously overexpressing human SOD1 mutants develop motor neuron disease resembling ALS ( Gurney et
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Notably restriction of SOD1 mutant expression selectively to post-natal motor neurons failed to produce
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Indeed analysis of chimeras generated between wild-type and SOD1 mutant mouse embryonic cells revealed that wild-type non neuronal cells
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5neuronal cells in adult chimeric animals extended the survival of SOD1 mutant motor neurons suggesting that the neurodegenerative action of mutant
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5mutant motor neurons suggesting that the neurodegenerative action of mutant SOD1 may operate through a dominant paracrine activity emanating from nonneuronal
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5is an untested component in the motor neurodegenerative effects of SOD1 mutations
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5Among these insulin-like growth factor 1 (Igf-1) Igf-1 has been implicated in anabolism of muscle and nerve tissues
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5In a recent study injection of SOD1 mutant mouse muscle with an adeno-associated virus carrying an Igf-1
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5SOD1 mutant mouse muscle with an adeno-associated virus carrying an Igf-1 gene prolonged life and delayed disease progression ( Kaspar et
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5However it is not clear from that study which Igf-1 isoform was used or whether the effects of Igf-1 expressed
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5which Igf-1 isoform was used or whether the effects of Igf-1 expressed in motor neurons were cell autonomous
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5Two major isoforms of Igf-1 originating from alternative splicing have been described differing in structure
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5as circulating (class class 2 and local (class class 1 Igf-1
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5Igf-1 class 2 transcripts predominate in the liver are highly growth
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5The contribution to more localized accumulation of Igf-1 class 1 seems due to the combination of exon 1
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5To assess the effects of supplemental Igf-1 directly on atrophic SOD1 skeletal muscle we exploited a transgenic
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5To assess the effects of supplemental Igf-1 directly on atrophic SOD1 skeletal muscle we exploited a transgenic mouse expressing a full-length
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5mouse expressing a full-length precursor of the local isoform of Igf-1 (mIgf-1) mIgf-1 that is normally induced transiently in response to
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6Muscle restricted mIgf-1 transgene (MLC/mIgf-1) MLC mIgf-1 exerts its effects in an autocrine/paracrine autocrine paracrine manner
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5autocrine paracrine manner circumventing the adverse side effects of systemic Igf-1 administration
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6Expression of the MLC/mIgf-1, MLC mIgf-1 delivered either as an inherited transgene or somatically on
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6ALS by showing that localized expression of the coinherited MLC/mIgf-1 MLC mIgf-1 transgene exclusively in the skeletal muscle of SOD1 mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5MLC/mIgf-1 MLC mIgf-1 transgene exclusively in the skeletal muscle of SOD1 mice counteracted the symptoms of ALS induced satellite cell activity
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5junctions and led to a reduction in astrocytosis in the SOD1 spinal cord
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5attenuation of motor neuronal degradation and underscore the importance of Igf-1 isoform selection when designing therapeutic strategies for ALS
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5the progression of the disease and enhances the survival of SOD1 mutant mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2(a) a Western blot analysis of human SOD transgenic protein in wild-type (lane lane 1 MLC/mIgf-1 MLC mIgf-1
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6human SOD transgenic protein in wild-type (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5wild-type (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic muscle
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6in skeletal muscle of wild-type (wt; wt lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(wt; wt lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic mice in brain and
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.64 transgenic mice in brain and spinal cord of MLC/mIgf-1 MLC mIgf-1 (lanes lanes 5 and 7 and SOD1 /mIgf-1 mIgf-1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5of MLC/mIgf-1 MLC mIgf-1 (lanes lanes 5 and 7 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 6 and 8 mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(c) c Age of onset of disease symptoms average onset SOD1 ( n = 30 = 111 _amp_#177 1.8 SOD1 /mIgf-1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5onset SOD1 ( n = 30 = 111 _amp_#177 1.8 SOD1 /mIgf-1 mIgf-1 ( n = 30 = 120.8 _amp_#177 1.0
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5of the progression of the disease average of disease duration SOD1 ( n = 30 =12 _amp_#177 0.6 SOD1 /mIgf-1 mIgf-1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5disease duration SOD1 ( n = 30 =12 _amp_#177 0.6 SOD1 /mIgf-1 mIgf-1 ( n = 30 = 32 _amp_#177 0.8
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5= 32 _amp_#177 0.8 (e) e survival analysis average survival SOD1 ( n = 30 = 123 _amp_#177 1.4 SOD1 /mIgf-1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5survival SOD1 ( n = 30 = 123 _amp_#177 1.4 SOD1 /mIgf-1 mIgf-1 ( n = 30 = 152.8 _amp_#177 1.4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5mIgf-1 expression attenuates muscle wasting and promotes regenerative pathways in SOD1 mice
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6(a) a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(a) a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age and stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(a) a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age and stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age and stage of disease
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5the quadriceps underscores the relative attenuation of muscle atrophy in SOD1 /mIgf-1 mIgf-1 compared with SOD1 mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5attenuation of muscle atrophy in SOD1 /mIgf-1 mIgf-1 compared with SOD1 mice
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6were obtained from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lanes lanes 3 and 5
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lanes lanes 3 and 5 and SOD1 /mIgf-1 mIgf-1 (lanes
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(lane lane 2 SOD1 (lanes lanes 3 and 5 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 4 and 6 transgenic mice at
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Immunofluorescence analysis of MyHC-fast performed on soleus muscles of wt SOD1 and SOD1 /mIgf-1 mIgf-1 before (80 80 d and after
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Immunofluorescence analysis of MyHC-fast performed on soleus muscles of wt SOD1 and SOD1 /mIgf-1 mIgf-1 before (80 80 d and after
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5of MyHC-fast performed on soleus muscles of wt SOD1 and SOD1 /mIgf-1 mIgf-1 before (80 80 d and after symptom onset
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(e) e Walk test of SOD1 (closed closed circles and SOD1 /mIgf-1 mIgf-1 (open open circles
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(e) e Walk test of SOD1 (closed closed circles and SOD1 /mIgf-1 mIgf-1 (open open circles transgenic mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Transgenic mIgf-1 expression induces chronic CnA-_amp_#223 1 expression in SOD1 mice
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6of CnA-_amp_#223 1 expression in wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5(c) c Immunofluorescence of transverse sections from quadriceps muscles of SOD1 and SOD /mIgf-1 mIgf-1 at paralysis stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2Immunofluorescence of transverse sections from quadriceps muscles of SOD1 and SOD /mIgf-1 mIgf-1 at paralysis stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Maintenance of the neuromuscular junction configuration in SOD1 /mIgf-1 mIgf-1 transgenic mice
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6Immunofluorescent analysis of transverse sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5of transverse sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123 d old
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5of transverse sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123 d old
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123 d old alpha-bungarotoxin antibody
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5d old alpha-bungarotoxin antibody identified diffusion of AChR expression in SOD1 muscle (yellow yellow arrow whereas SOD /mIgf-1 mIgf-1 muscle maintained
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2of AChR expression in SOD1 muscle (yellow yellow arrow whereas SOD /mIgf-1 mIgf-1 muscle maintained AChR clusters
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6RNA samples from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 4 and 5 transgenic muscles at
329AGRNagrinagrin1.0(c) c Western blot of agrin from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6of agrin from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic muscles
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5SOD1 and SOD1 /mIgf-1 mIgf-1 mice were analyzed at comparable end-stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5SOD1 and SOD1 /mIgf-1 mIgf-1 mice were analyzed at comparable end-stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5SOD1 and SOD1 /mIgf-1 mIgf-1 mice were analyzed at comparable end-stage disease
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5surviving motor neurons in the ventral spinal cord of wild-type SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages *P _lt_
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5surviving motor neurons in the ventral spinal cord of wild-type SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages *P _lt_
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5neurons in the ventral spinal cord of wild-type SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages *P _lt_ 0.001 **P
4235GFAPglial fibrillary acidic proteinGFAP2.5(b) b Immunofluorescence analysis identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Immunofluorescence analysis identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages A and
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Immunofluorescence analysis identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages A and
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages A and B 28
4235GFAPglial fibrillary acidic proteinGFAP2.5The intensity of the GFAP signal revealed progressive astrocytosis
4235GFAPglial fibrillary acidic proteinGFAP2.5Insert in D shows Western blot for GFAP in the spinal cord of SOD1 (lanes lanes 1 and
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5shows Western blot for GFAP in the spinal cord of SOD1 (lanes lanes 1 and 3 and SOD1 /mIgf-1 mIgf-1 (lanes
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5spinal cord of SOD1 (lanes lanes 1 and 3 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 2 and 4 mice at 28
11892TNFtumor necrosis factor (TNF superfamily, member 2)TNF-alpha1.7(c) c RT-PCR analysis of TNF-alpha and _amp_#223 -actin of wt (lane lane 1 MLC/mIgf-1 MLC
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6TNF-alpha and _amp_#223 -actin of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic mice at 123 d
11892TNFtumor necrosis factor (TNF superfamily, member 2)TNF-alpha1.7Lane 6 identifies the RNA positive control (pc) pc for TNF-alpha obtained from spleen
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5progression of the disease and prolongs the life span of SOD1 mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5To evaluate the effects of mIgf-1 on the SOD1 neurodegenerative phenotype we compared double transgenic SOD1 and MLC/mIgf-1 MLC
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5mIgf-1 on the SOD1 neurodegenerative phenotype we compared double transgenic SOD1 and MLC/mIgf-1 MLC mIgf-1 transgenic mice to their SOD1 littermates
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6SOD1 neurodegenerative phenotype we compared double transgenic SOD1 and MLC/mIgf-1 MLC mIgf-1 transgenic mice to their SOD1 littermates
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5transgenic SOD1 and MLC/mIgf-1 MLC mIgf-1 transgenic mice to their SOD1 littermates
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1 transgenic mice
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1 transgenic mice were selected for
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1 transgenic mice were selected for same expression level
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6transgene was selectively expressed in skeletal muscle of both MLC/mIgf-1 MLC mIgf-1 and SOD1 /mIgf-1 mIgf-1 mice ( Fig 1 b
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5expressed in skeletal muscle of both MLC/mIgf-1 MLC mIgf-1 and SOD1 /mIgf-1 mIgf-1 mice ( Fig 1 b lanes 2 and
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2b lanes 5-8 or in skeletal muscle of wild-type and SOD mice ( Fig 1 b lanes 1 and 3
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.51.8 d old disease onset was observed in the mutant SOD1 transgenic mice ( n = 30 Fig 1 c
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Notably the SOD1 mice died within 10 d _amp_#177 0.6 of clinical disease
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5( Fig 1 d of disease increasing the survival of SOD1 /mIgf-1 mIgf-1 mice ( n = 30 by ~30 d
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Differences between SOD1 and SOD1 /mIgf-1 mIgf-1 were significantly relevant for onset (
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Differences between SOD1 and SOD1 /mIgf-1 mIgf-1 were significantly relevant for onset (
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Differences between SOD1 and SOD1 /mIgf-1 mIgf-1 were significantly relevant for onset ( LR =
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5mIgf-1 expression attenuates muscle atrophy increasing satellite cell activation in SOD1 mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5SOD1 ( n = 7 and SOD1 /mIgf-1 mIgf-1 ( n
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5SOD1 ( n = 7 and SOD1 /mIgf-1 mIgf-1 ( n = 7 transgenic mice were analyzed
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5At 123 d motor neuronal degeneration of SOD1 mice was accompanied by severe muscle atrophy ( Fig 2
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5In contrast at the same age SOD1 /mIgf-1 mIgf-1 transgenic mice did not show evident signs of
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Moreover muscle atrophy was substantially attenuated in SOD1 /mIgf-1 mIgf-1 offspring even after onset of denervation and paralysis
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2Pax-7 and desmin were increased to varying extents in affected SOD mice ( Fig 2 c whereas hallmarks of satellite cell
7612MYOGmyogenin (myogenic factor 4)myogenin1.0nuclei ( Fig 2 a yellow arrows Pax-7 isoforms desmin myogenin and neonatal myosin heavy chain (MyHC) MyHC expression were present
23212MYH14myosin, heavy chain 14myosin2.22 a yellow arrows Pax-7 isoforms desmin myogenin and neonatal myosin heavy chain (MyHC) MyHC expression were present exclusively in the
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)MyHC2.5Pax-7 isoforms desmin myogenin and neonatal myosin heavy chain (MyHC) MyHC expression were present exclusively in the SOD1 /mIgf-1 mIgf-1 muscles
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5heavy chain (MyHC) MyHC expression were present exclusively in the SOD1 /mIgf-1 mIgf-1 muscles at all stages of disease including at
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.52 d revealed that fiber type composition was altered in SOD1 soleus muscle even before overt disease (80 80 d with
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5muscle fibers was maintained for a more extended period in SOD1 /mIgf-1 mIgf-1 mice which showed shifts in fiber composition only
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5there was not significant difference in fiber type composition between SOD1 and SOD1 /mIgf-1 mIgf-1 mice (not not depicted
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5there was not significant difference in fiber type composition between SOD1 and SOD1 /mIgf-1 mIgf-1 mice (not not depicted
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5not significant difference in fiber type composition between SOD1 and SOD1 /mIgf-1 mIgf-1 mice (not not depicted
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5The alteration in the heterogeneity of SOD1 muscle fibers indicate an alteration in motor neuron activity even
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5e performed at different ages revealed that at 112 d SOD1 mice ( n = 7 showed symptom onset without evident
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5The condition of SOD1 mice rapidly deteriorated at 117 d as shown by the
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5In contrast the pathological sign of disease were delayed in SOD1 /mIgf-1 mIgf-1 transgenic mice ( n = 7 as shown
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5_amp_#177 5.6 cm further when analyzed at same age as SOD1 mice and by their ability to move for a more
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5An activated calcineurin isoform is induced in SOD1 /mIgf-1 mIgf-1 muscle
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5low levels of CnA-_amp_#223 1 expression were not raised in SOD1 muscles ( Fig 3 a lane 3 Fig 3 b
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.65 Fig 3 c or in uninjured wild-type and MLC/mIgf-1 MLC mIgf-1 muscle ( Fig 3 a and b lanes 1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5( Fig 3 a and b lanes 1 and 2 SOD1 /mIgf-1 mIgf-1 regenerating muscle dramatically increased CnA-_amp_#223 1 transcripts (73
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Preservation of neuromuscular junctions in SOD1 /mIgf-1 mIgf-1 mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5neuron diseases also affect the configuration of neuromuscular junctions in SOD1 mice characterized by the diffusion of acetylcholine receptor (AChR) AChR
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5At 123 d SOD1 paralyzed muscle showed 56 _amp_#177 0.2% of diffuse AChR expression
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5( Fig 4 a were preserved in muscles of age-matched SOD1 /mIgf-1 mIgf-1 mice which showed only 3.3 _amp_#177 0.4% of
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5At comparable end-stage disease SOD1 /mIgf-1 mIgf-1 muscle displayed only 18 _amp_#177 0.4% of diffuse
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5analysis ( Fig 4 b high AChR expression levels in SOD1 muscle were reduced in SOD1 /mIgf-1 mIgf-1 mice at all
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5high AChR expression levels in SOD1 muscle were reduced in SOD1 /mIgf-1 mIgf-1 mice at all stages observed
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5( n = 6 revealed that AChR mRNA expression in SOD1 paralyzed muscle (123 123 d was 68 _amp_#177 2.4% higher
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.568 _amp_#177 2.4% higher than that observed in age matched SOD1 /mIgf-1 mIgf-1 mice whereas the increase in mRNA expression in
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5/mIgf-1 mIgf-1 mice whereas the increase in mRNA expression in SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5expression in SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1 /mIgf-1 mIgf-1 mice where analyzed at comparable end-stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5expression in SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1 /mIgf-1 mIgf-1 mice where analyzed at comparable end-stage
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1 /mIgf-1 mIgf-1 mice where analyzed at comparable end-stage disease
329AGRNagrinagrin1.0AChR clusters at the end plate requires the expression of agrin a large proteoglycan in the synaptic cleft that plays an
329AGRNagrinAgrin1.0Agrin expression was significantly down-regulated in paralyzed SOD1 compared with SOD
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Agrin expression was significantly down-regulated in paralyzed SOD1 compared with SOD /mIgf-1 mIgf-1 muscle ( Fig 4 c
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2Agrin expression was significantly down-regulated in paralyzed SOD1 compared with SOD /mIgf-1 mIgf-1 muscle ( Fig 4 c analyzed at comparable
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Muscle-restricted mIgf-1 prolongs motor neuronal function in SOD1 mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Histological analysis of the ventral spinal cord revealed that SOD1 mice ( n = 7 presented a progressive reduction in
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Specifically SOD1 mice showed a reduction of 37 and 55% in the
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5In contrast mIgf-1 expression induced motor neuron survival in SOD1 /mIgf-1 mIgf-1 mice ( n = 7 at all ages
4235GFAPglial fibrillary acidic proteinGFAP2.5Comparable patterns of glial fibrillary acidic protein (GFAP) GFAP immunoreactivity were found in spinal cords of SOD1 ( n
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5protein (GFAP) GFAP immunoreactivity were found in spinal cords of SOD1 ( n = 6 and SOD /mIgf-1 mIgf-1 ( n
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2in spinal cords of SOD1 ( n = 6 and SOD /mIgf-1 mIgf-1 ( n = 6 transgenic mice before the
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5at paralysis stage (123 123 d the spinal cord of SOD1 mice demonstrated a marked increase in astroglial activation ( Fig
4235GFAPglial fibrillary acidic proteinGFAP2.5activation ( Fig 5 b C with an increase in GFAP expression of ~55 _amp_#177 0.2% ( Fig 5 b D
4235GFAPglial fibrillary acidic proteinGFAP2.5Fig 5 b D insert lane 3 compared with the GFAP expression levels displayed in the spinal cord of age matched
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5expression levels displayed in the spinal cord of age matched SOD1 /mIgf-1 mIgf-1 transgenic mice ( Fig 5 b D and
4235GFAPglial fibrillary acidic proteinGFAP2.5At comparable end-stage disease there were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5disease there were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5disease there were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to express 13%
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to express 13% more GFAP as compared with
4235GFAPglial fibrillary acidic proteinGFAP2.5mIgf-1 mice although SOD1 mice continued to express 13% more GFAP as compared with SOD1 /mIgf-1 mIgf-1 mice (unpublished unpublished data
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5mice continued to express 13% more GFAP as compared with SOD1 /mIgf-1 mIgf-1 mice (unpublished unpublished data
11892TNFtumor necrosis factor (TNF superfamily, member 2)TNF-alpha1.7be correlated with the expression of certain cytokines such as TNF-alpha which enhance the response to inflammatory states and contribute to
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5states and contribute to the progression of neurological dysfunction in SOD1 mice ( Elliott 2001
11892TNFtumor necrosis factor (TNF superfamily, member 2)TNF-alpha1.7Although TNF-alpha expression was normally undetectable in the CNS of healthy mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.51 and 2 it accumulated in the spinal cord of SOD1 mice at paralysis stage (123 123 d Fig 5 c
11892TNFtumor necrosis factor (TNF superfamily, member 2)TNF-alpha1.7In contrast TNF-alpha expression was not apparent in the spinal cord of SOD1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5TNF-alpha expression was not apparent in the spinal cord of SOD1 /mIgf-1 mIgf-1 transgenic mice ( Fig 5 c lane 4
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5determined whether the dramatic prolongation of CNS tissue integrity in SOD1 /mIgf-1 mIgf-1 mice derives from the direct retrograde transport of
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5mIgf-1 or indirect action either through distal activation of endogenous Igf-1 expression or through other trophic factors secreted by SOD /mIgf-1
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2endogenous Igf-1 expression or through other trophic factors secreted by SOD /mIgf-1 mIgf-1 muscle
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5The Igf-1 cDNA used by Kaspar et al
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5The importance of Igf-1 isoform choice in designing therapeutic strategies cannot be overstressed because
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2SOD transgenic mice (Jackson Jackson Laboratory express a transgenic human mutant
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5transgenic mice (Jackson Jackson Laboratory express a transgenic human mutant SOD1 allele containing the Gly93 Ala (G93A) G93A substitution driven by
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5The SOD1 B6J mice were crossed with MLC/mIgf-1 MLC mIgf-1 FVB mice
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6The SOD1 B6J mice were crossed with MLC/mIgf-1 MLC mIgf-1 FVB mice ( Musar_amp_ograve et al. 2001 for seven
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5Musar_amp_ograve et al. 2001 for seven different generations to obtain SOD1 /mIgf-1 mIgf-1 B6J inbred transgenic mice
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)MyHC2.5RT and incubated overnight at 4degreeC with primary antibodies neonatal MyHC (neo-MyHC), neo-MyHC MyHC-fast Alexa Fluor 488-conjugated alpha-bungarotoxin CnA-_amp_#223 1 (from
4235GFAPglial fibrillary acidic proteinGFAP2.5(from from C Klee National Institutes of Health Bethesda MD GFAP
29823MYL6Bmyosin, light chain 6B, alkali, smooth muscle and non-muscleMLC0.6RNA was isolated from spinal cord of wild-type MLC/mIgf-1, MLC mIgf-1 and SOD and SOD1 /mIgf-1 mIgf-1 transgenic mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD2.2isolated from spinal cord of wild-type MLC/mIgf-1, MLC mIgf-1 and SOD and SOD1 /mIgf-1 mIgf-1 transgenic mice
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))SOD12.5spinal cord of wild-type MLC/mIgf-1, MLC mIgf-1 and SOD and SOD1 /mIgf-1 mIgf-1 transgenic mice
11892TNFtumor necrosis factor (TNF superfamily, member 2)TNF-alpha1.7The following oligonucleotides were used TNF-alpha sense 5'-CCCAGACCCTCACACACTCAGAT-3' and anti-sense 5'-TTGTCCCTTGAAGAGAACCTG-3' _amp_#223 -actin sense 5'-GTGGGCCGCTCTAGGCACAA-3' and
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))hSOD2.2Filters were blotted with antibodies against hSOD Pax7 myogenin desmin neo-MyHC (from from S Schiaffino University of
8621PAX7paired box 7Pax70.5Filters were blotted with antibodies against hSOD Pax7 myogenin desmin neo-MyHC (from from S Schiaffino University of Padova
7612MYOGmyogenin (myogenic factor 4)myogenin1.0Filters were blotted with antibodies against hSOD Pax7 myogenin desmin neo-MyHC (from from S Schiaffino University of Padova Padova
329AGRNagrinAgrin1.0neo-MyHC (from from S Schiaffino University of Padova Padova Italy Agrin GFAP
4235GFAPglial fibrillary acidic proteinGFAP2.5(from from S Schiaffino University of Padova Padova Italy Agrin GFAP
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5Organization of the Igf-1 gene
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5As its name implies Igf-1 is similar to insulin in structure
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5The mature Igf-1 is a single-chain protein of 70 aa and differs from
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5The rodent Igf-1 gene contains six exons separated by five introns (Fig Fig
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5to all isoforms as well as part of the mature Igf-1 peptide
5464IGF1insulin-like growth factor 1 (somatomedin C)Igf-13.5region of the E-peptide which is also common to all Igf-1 mRNAs
5464IGF1insulin-like growth factor 1 (somatomedin C)insulin like growth factor1.0here we show that muscle restricted expression of a localized insulin like growth factor igf 1 isoform maintained muscle integrity and enhanced satellite cell activity in sod1 transgenic mice inducing calcineurin mediated regenerative pathways.
5464IGF1insulin-like growth factor 1 (somatomedin C)insulin like growth factor1.0abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type.
14079CHRNA9cholinergic receptor, nicotinic, alpha 9acetylcholine receptor1.0abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dism
7577MYH7myosin, heavy chain 7, cardiac muscle, betamyosin heavy chain1.0 this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type.
4235GFAPglial fibrillary acidic proteinglial fibrillary acidic protein1.0abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type.
11179SOD1superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))superoxide dismutase11.0holine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type.
5464IGF1insulin-like growth factor 1 (somatomedin C)insulin like growth factor 11.0among these insulin like growth factor 1 igf 1 has been implicated in anabolism of muscle and nerve tissues inducing muscle hypertrophy and promoting neuronal survival musar_amp_ograve; and rosenthal 2002 .
18809TUBA1Btubulin, alpha 1balpha tubulin1.0immunoblotting for alpha tubulin served as a control for protein loading.
11892TNFtumor necrosis factor (TNF superfamily, member 2)tnf alpha1.0 c rt pcr analysis of tnf alpha and _amp_#223; actin of wt lane 1 mlc/migf 1 lane 2 sod1 lane 3 and sod1 /migf 1 lane 4 transgenic mice at 123 d old.
11892TNFtumor necrosis factor (TNF superfamily, member 2)tnf alpha1.0lane 6 identifies the rna positive control pc for tnf alpha obtained from spleen.
2770DESdesmindesmin1.0in addition markers of satellite cell activity such as pax 7 and desmin were increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desm
2770DESdesmindesmin1.0 were increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satel
7612MYOGmyogenin (myogenic factor 4)myogenin1.0re increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satellite cell
7577MYH7myosin, heavy chain 7, cardiac muscle, betamyosin heavy chain1.0g extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satellite cell activation is likely to contrib
14079CHRNA9cholinergic receptor, nicotinic, alpha 9acetylcholine receptor1.0alterations in motor neuronal activity typical of denervated muscle and motor neuron diseases also affect the configuration of neuromuscular junctions in sod1 mice characterized by the diffusion of acetylcholine receptor achr postsynaptic clusters fig 4 a yellow arrow .
4235GFAPglial fibrillary acidic proteinglial fibrillary acidic protein1.0comparable patterns of glial fibrillary acidic protein gfap immunoreactivity were found in spinal cords of sod1 n = 6 and sod /migf 1 n = 6 transgenic mice before the symptom onset 28 d; fig 5 b a b and d insert lanes 1 and 2 .
11892TNFtumor necrosis factor (TNF superfamily, member 2)tnf alpha1.0the activation of astroglia can be correlated with the expression of certain cytokines such as tnf alpha which enhance the response to inflammatory states and contribute to the progression of neurological dysfunction in sod1 mice elliott 2001 .
11892TNFtumor necrosis factor (TNF superfamily, member 2)tnf alpha1.0although tnf alpha expression was normally undetectable in the cns of healthy mice fig 5 c lanes 1 and 2 it accumulated in the spinal cord of sod1 mice at paralysis stage 123 d; fig 5 c lane 3 .
11892TNFtumor necrosis factor (TNF superfamily, member 2)tnf alpha1.0in contrast tnf alpha expression was not apparent in the spinal cord of sod1 /migf 1 transgenic mice fig 5 c lane 4 . migf 1 hypertrophic muscle therefore functions as a protective tissue for the cns modulating reactive a
11892TNFtumor necrosis factor (TNF superfamily, member 2)tnf alpha1.0the following oligonucleotides were used: tnf alpha sense 5' cccagaccctcacacactcagat 3' and anti sense 5' ttgtcccttgaagagaacctg 3'; _amp_#223; actin sense 5' gtgggccgctctaggcacaa 3' and anti sense 5' ctctttgatgtcacgcacgatttc 3'.
2770DESdesmindesmin1.0filters were blotted with antibodies against hsod pax7 myogenin desmin neo myhc from s schiaffino university of padova padova italy agrin gfap.
7612MYOGmyogenin (myogenic factor 4)myogenin1.0filters were blotted with antibodies against hsod pax7 myogenin desmin neo myhc from s schiaffino university of padova padova italy agrin gfap.
6081INSinsulininsulin1.0as its name implies igf 1 is similar to insulin in structure.
6081INSinsulininsulin1.0the mature igf 1 is a single chain protein of 70 aa and differs from insulin by retention of the c domain by a short extension of the a domain to include a novel domain d and by the presence of variable cooh terminal extension peptides e peptides; fig s1 .