| PMID |
15657392 ( ![]() ![]() ![]() ) |
|---|---|
| Title | Muscle expression of a local Igf-1 isoform protects motor neurons in an ALS mouse model. |
| Abstract | Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease characterized by a selective degeneration of motor neurons, atrophy, and paralysis of skeletal muscle. Although a significant proportion of familial ALS results from a toxic gain of function associated with dominant SOD1 mutations, the etiology of the disease and its specific cellular origins have remained difficult to define. Here, we show that muscle-restricted expression of a localized insulin-like growth factor (Igf) -1 isoform maintained muscle integrity and enhanced satellite cell activity in SOD1(G93A) transgenic mice, inducing calcineurin-mediated regenerative pathways. Muscle-specific expression of local Igf-1 (mIgf-1) isoform also stabilized neuromuscular junctions, reduced inflammation in the spinal cord, and enhanced motor neuronal survival in SOD1(G93A) mice, delaying the onset and progression of the disease. These studies establish skeletal muscle as a primary target for the dominant action of inherited SOD1 mutation and suggest that muscle fibers provide appropriate factors, such as mIgf-1, for neuron survival. Interuniversity Institute of Myology, University of Rome "La Sapienza", 14 00161 Rome, Italy. |
NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.
Targets by SciMiner Summary
| HUGO ID | Symbol | Target Name | #Occur | ActualStr |
|---|---|---|---|---|
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | 146 | hSOD | SOD1 | superoxide dismutase1 | SOD | |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | 26 | insulin like growth factor 1 | Igf-1 | |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | 19 | MLC | |
| 4235 | GFAP | glial fibrillary acidic protein | 13 | glial fibrillary acidic protein | GFAP | |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | 12 | TNF-alpha | tnf alpha | |
| 329 | AGRN | agrin | 4 | agrin | Agrin | |
| 7612 | MYOG | myogenin (myogenic factor 4) | 4 | myogenin | |
| 7576 | MYH6 | myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1) | 3 | MyHC | |
| 2770 | DES | desmin | 3 | desmin | |
| 6081 | INS | insulin | 2 | insulin | |
| 7577 | MYH7 | myosin, heavy chain 7, cardiac muscle, beta | 2 | myosin heavy chain | |
| 23212 | MYH14 | myosin, heavy chain 14 | 2 | myosin | |
| 14079 | CHRNA9 | cholinergic receptor, nicotinic, alpha 9 | 2 | acetylcholine receptor | |
| 18809 | TUBA1B | tubulin, alpha 1b | 1 | alpha tubulin | |
| 8621 | PAX7 | paired box 7 | 1 | Pax7 | |
Targets by SciMiner Full list
| HUGO ID | Symbol | Name | ActualStr | Score | FlankingText |
|---|---|---|---|---|---|
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | results from a toxic gain of function associated with dominant SOD1 mutations the etiology of the disease and its specific cellular |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | isoform maintained muscle integrity and enhanced satellite cell activity in SOD1 transgenic mice inducing calcineurin-mediated regenerative pathways |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | Muscle-specific expression of local Igf-1 (mIgf-1) mIgf-1 isoform also stabilized neuromuscular junctions reduced inflammation in |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | in the spinal cord and enhanced motor neuronal survival in SOD1 mice delaying the onset and progression of the disease |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | as a primary target for the dominant action of inherited SOD1 mutation and suggest that muscle fibers provide appropriate factors such |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | paper AChR acetylcholine receptor ALS amyotrophic lateral sclerosis CnA calcineurin GFAP glial fibrillary acidic protein Igf insulin-like growth factor mIgf-1 local |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | acidic protein Igf insulin-like growth factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type |
| 7576 | MYH6 | myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1) | MyHC | 2.5 | protein Igf insulin-like growth factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type |
| 23212 | MYH14 | myosin, heavy chain 14 | myosin | 2.2 | Igf insulin-like growth factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | factor mIgf-1 local isoform of Igf-1 MyHC myosin heavy chain SOD1 superoxide dismutase1 wt wild-type |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Transgenic mice ubiquitously overexpressing human SOD1 mutants develop motor neuron disease resembling ALS ( Gurney et |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Notably restriction of SOD1 mutant expression selectively to post-natal motor neurons failed to produce |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Indeed analysis of chimeras generated between wild-type and SOD1 mutant mouse embryonic cells revealed that wild-type non neuronal cells |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | neuronal cells in adult chimeric animals extended the survival of SOD1 mutant motor neurons suggesting that the neurodegenerative action of mutant |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | mutant motor neurons suggesting that the neurodegenerative action of mutant SOD1 may operate through a dominant paracrine activity emanating from nonneuronal |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | is an untested component in the motor neurodegenerative effects of SOD1 mutations |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | Among these insulin-like growth factor 1 (Igf-1) Igf-1 has been implicated in anabolism of muscle and nerve tissues |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | In a recent study injection of SOD1 mutant mouse muscle with an adeno-associated virus carrying an Igf-1 |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | SOD1 mutant mouse muscle with an adeno-associated virus carrying an Igf-1 gene prolonged life and delayed disease progression ( Kaspar et |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | However it is not clear from that study which Igf-1 isoform was used or whether the effects of Igf-1 expressed |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | which Igf-1 isoform was used or whether the effects of Igf-1 expressed in motor neurons were cell autonomous |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | Two major isoforms of Igf-1 originating from alternative splicing have been described differing in structure |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | as circulating (class class 2 and local (class class 1 Igf-1 |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | Igf-1 class 2 transcripts predominate in the liver are highly growth |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | The contribution to more localized accumulation of Igf-1 class 1 seems due to the combination of exon 1 |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | To assess the effects of supplemental Igf-1 directly on atrophic SOD1 skeletal muscle we exploited a transgenic |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | To assess the effects of supplemental Igf-1 directly on atrophic SOD1 skeletal muscle we exploited a transgenic mouse expressing a full-length |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | mouse expressing a full-length precursor of the local isoform of Igf-1 (mIgf-1) mIgf-1 that is normally induced transiently in response to |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | Muscle restricted mIgf-1 transgene (MLC/mIgf-1) MLC mIgf-1 exerts its effects in an autocrine/paracrine autocrine paracrine manner |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | autocrine paracrine manner circumventing the adverse side effects of systemic Igf-1 administration |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | Expression of the MLC/mIgf-1, MLC mIgf-1 delivered either as an inherited transgene or somatically on |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | ALS by showing that localized expression of the coinherited MLC/mIgf-1 MLC mIgf-1 transgene exclusively in the skeletal muscle of SOD1 mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | MLC/mIgf-1 MLC mIgf-1 transgene exclusively in the skeletal muscle of SOD1 mice counteracted the symptoms of ALS induced satellite cell activity |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | junctions and led to a reduction in astrocytosis in the SOD1 spinal cord |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | attenuation of motor neuronal degradation and underscore the importance of Igf-1 isoform selection when designing therapeutic strategies for ALS |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | the progression of the disease and enhances the survival of SOD1 mutant mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | (a) a Western blot analysis of human SOD transgenic protein in wild-type (lane lane 1 MLC/mIgf-1 MLC mIgf-1 |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | human SOD transgenic protein in wild-type (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | wild-type (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic muscle |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | in skeletal muscle of wild-type (wt; wt lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (wt; wt lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic mice in brain and |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | 4 transgenic mice in brain and spinal cord of MLC/mIgf-1 MLC mIgf-1 (lanes lanes 5 and 7 and SOD1 /mIgf-1 mIgf-1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | of MLC/mIgf-1 MLC mIgf-1 (lanes lanes 5 and 7 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 6 and 8 mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (c) c Age of onset of disease symptoms average onset SOD1 ( n = 30 = 111 _amp_#177 1.8 SOD1 /mIgf-1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | onset SOD1 ( n = 30 = 111 _amp_#177 1.8 SOD1 /mIgf-1 mIgf-1 ( n = 30 = 120.8 _amp_#177 1.0 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | of the progression of the disease average of disease duration SOD1 ( n = 30 =12 _amp_#177 0.6 SOD1 /mIgf-1 mIgf-1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | disease duration SOD1 ( n = 30 =12 _amp_#177 0.6 SOD1 /mIgf-1 mIgf-1 ( n = 30 = 32 _amp_#177 0.8 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | = 32 _amp_#177 0.8 (e) e survival analysis average survival SOD1 ( n = 30 = 123 _amp_#177 1.4 SOD1 /mIgf-1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | survival SOD1 ( n = 30 = 123 _amp_#177 1.4 SOD1 /mIgf-1 mIgf-1 ( n = 30 = 152.8 _amp_#177 1.4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | mIgf-1 expression attenuates muscle wasting and promotes regenerative pathways in SOD1 mice |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | (a) a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (a) a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age and stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (a) a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age and stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | a Histological analysis of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 muscle at different age and stage of disease |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | the quadriceps underscores the relative attenuation of muscle atrophy in SOD1 /mIgf-1 mIgf-1 compared with SOD1 mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | attenuation of muscle atrophy in SOD1 /mIgf-1 mIgf-1 compared with SOD1 mice |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | were obtained from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lanes lanes 3 and 5 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lanes lanes 3 and 5 and SOD1 /mIgf-1 mIgf-1 (lanes |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (lane lane 2 SOD1 (lanes lanes 3 and 5 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 4 and 6 transgenic mice at |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Immunofluorescence analysis of MyHC-fast performed on soleus muscles of wt SOD1 and SOD1 /mIgf-1 mIgf-1 before (80 80 d and after |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Immunofluorescence analysis of MyHC-fast performed on soleus muscles of wt SOD1 and SOD1 /mIgf-1 mIgf-1 before (80 80 d and after |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | of MyHC-fast performed on soleus muscles of wt SOD1 and SOD1 /mIgf-1 mIgf-1 before (80 80 d and after symptom onset |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (e) e Walk test of SOD1 (closed closed circles and SOD1 /mIgf-1 mIgf-1 (open open circles |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (e) e Walk test of SOD1 (closed closed circles and SOD1 /mIgf-1 mIgf-1 (open open circles transgenic mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Transgenic mIgf-1 expression induces chronic CnA-_amp_#223 1 expression in SOD1 mice |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | of CnA-_amp_#223 1 expression in wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | (c) c Immunofluorescence of transverse sections from quadriceps muscles of SOD1 and SOD /mIgf-1 mIgf-1 at paralysis stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | Immunofluorescence of transverse sections from quadriceps muscles of SOD1 and SOD /mIgf-1 mIgf-1 at paralysis stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Maintenance of the neuromuscular junction configuration in SOD1 /mIgf-1 mIgf-1 transgenic mice |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | Immunofluorescent analysis of transverse sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | of transverse sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123 d old |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | of transverse sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123 d old |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | sections from muscles of wt MLC/mIgf-1, MLC mIgf-1 SOD1 and SOD1 /mIgf-1 mIgf-1 transgenic mice at 123 d old alpha-bungarotoxin antibody |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | d old alpha-bungarotoxin antibody identified diffusion of AChR expression in SOD1 muscle (yellow yellow arrow whereas SOD /mIgf-1 mIgf-1 muscle maintained |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | of AChR expression in SOD1 muscle (yellow yellow arrow whereas SOD /mIgf-1 mIgf-1 muscle maintained AChR clusters |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | RNA samples from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 4 and 5 transgenic muscles at |
| 329 | AGRN | agrin | agrin | 1.0 | (c) c Western blot of agrin from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | of agrin from quadriceps of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic muscles |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | SOD1 and SOD1 /mIgf-1 mIgf-1 mice were analyzed at comparable end-stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | SOD1 and SOD1 /mIgf-1 mIgf-1 mice were analyzed at comparable end-stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | SOD1 and SOD1 /mIgf-1 mIgf-1 mice were analyzed at comparable end-stage disease |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | surviving motor neurons in the ventral spinal cord of wild-type SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages *P _lt_ |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | surviving motor neurons in the ventral spinal cord of wild-type SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages *P _lt_ |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | neurons in the ventral spinal cord of wild-type SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages *P _lt_ 0.001 **P |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | (b) b Immunofluorescence analysis identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Immunofluorescence analysis identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages A and |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Immunofluorescence analysis identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages A and |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | identify GFAP positive astrocytes in ventral horn of SOD1 and SOD1 /mIgf-1 mIgf-1 mice at different ages A and B 28 |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | The intensity of the GFAP signal revealed progressive astrocytosis |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | Insert in D shows Western blot for GFAP in the spinal cord of SOD1 (lanes lanes 1 and |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | shows Western blot for GFAP in the spinal cord of SOD1 (lanes lanes 1 and 3 and SOD1 /mIgf-1 mIgf-1 (lanes |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | spinal cord of SOD1 (lanes lanes 1 and 3 and SOD1 /mIgf-1 mIgf-1 (lanes lanes 2 and 4 mice at 28 |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 1.7 | (c) c RT-PCR analysis of TNF-alpha and _amp_#223 -actin of wt (lane lane 1 MLC/mIgf-1 MLC |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | TNF-alpha and _amp_#223 -actin of wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | wt (lane lane 1 MLC/mIgf-1 MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | MLC mIgf-1 (lane lane 2 SOD1 (lane lane 3 and SOD1 /mIgf-1 mIgf-1 (lane lane 4 transgenic mice at 123 d |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 1.7 | Lane 6 identifies the RNA positive control (pc) pc for TNF-alpha obtained from spleen |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | progression of the disease and prolongs the life span of SOD1 mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | To evaluate the effects of mIgf-1 on the SOD1 neurodegenerative phenotype we compared double transgenic SOD1 and MLC/mIgf-1 MLC |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | mIgf-1 on the SOD1 neurodegenerative phenotype we compared double transgenic SOD1 and MLC/mIgf-1 MLC mIgf-1 transgenic mice to their SOD1 littermates |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | SOD1 neurodegenerative phenotype we compared double transgenic SOD1 and MLC/mIgf-1 MLC mIgf-1 transgenic mice to their SOD1 littermates |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | transgenic SOD1 and MLC/mIgf-1 MLC mIgf-1 transgenic mice to their SOD1 littermates |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1 transgenic mice |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1 transgenic mice were selected for |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | The SOD and SOD1 x MLC/mIgf-1 MLC mIgf-1 (SOD1 SOD1 /mIgf-1) mIgf-1 transgenic mice were selected for same expression level |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | transgene was selectively expressed in skeletal muscle of both MLC/mIgf-1 MLC mIgf-1 and SOD1 /mIgf-1 mIgf-1 mice ( Fig 1 b |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | expressed in skeletal muscle of both MLC/mIgf-1 MLC mIgf-1 and SOD1 /mIgf-1 mIgf-1 mice ( Fig 1 b lanes 2 and |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | b lanes 5-8 or in skeletal muscle of wild-type and SOD mice ( Fig 1 b lanes 1 and 3 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | 1.8 d old disease onset was observed in the mutant SOD1 transgenic mice ( n = 30 Fig 1 c |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Notably the SOD1 mice died within 10 d _amp_#177 0.6 of clinical disease |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | ( Fig 1 d of disease increasing the survival of SOD1 /mIgf-1 mIgf-1 mice ( n = 30 by ~30 d |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Differences between SOD1 and SOD1 /mIgf-1 mIgf-1 were significantly relevant for onset ( |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Differences between SOD1 and SOD1 /mIgf-1 mIgf-1 were significantly relevant for onset ( |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Differences between SOD1 and SOD1 /mIgf-1 mIgf-1 were significantly relevant for onset ( LR = |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | mIgf-1 expression attenuates muscle atrophy increasing satellite cell activation in SOD1 mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | SOD1 ( n = 7 and SOD1 /mIgf-1 mIgf-1 ( n |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | SOD1 ( n = 7 and SOD1 /mIgf-1 mIgf-1 ( n = 7 transgenic mice were analyzed |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | At 123 d motor neuronal degeneration of SOD1 mice was accompanied by severe muscle atrophy ( Fig 2 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | In contrast at the same age SOD1 /mIgf-1 mIgf-1 transgenic mice did not show evident signs of |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Moreover muscle atrophy was substantially attenuated in SOD1 /mIgf-1 mIgf-1 offspring even after onset of denervation and paralysis |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | Pax-7 and desmin were increased to varying extents in affected SOD mice ( Fig 2 c whereas hallmarks of satellite cell |
| 7612 | MYOG | myogenin (myogenic factor 4) | myogenin | 1.0 | nuclei ( Fig 2 a yellow arrows Pax-7 isoforms desmin myogenin and neonatal myosin heavy chain (MyHC) MyHC expression were present |
| 23212 | MYH14 | myosin, heavy chain 14 | myosin | 2.2 | 2 a yellow arrows Pax-7 isoforms desmin myogenin and neonatal myosin heavy chain (MyHC) MyHC expression were present exclusively in the |
| 7576 | MYH6 | myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1) | MyHC | 2.5 | Pax-7 isoforms desmin myogenin and neonatal myosin heavy chain (MyHC) MyHC expression were present exclusively in the SOD1 /mIgf-1 mIgf-1 muscles |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | heavy chain (MyHC) MyHC expression were present exclusively in the SOD1 /mIgf-1 mIgf-1 muscles at all stages of disease including at |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | 2 d revealed that fiber type composition was altered in SOD1 soleus muscle even before overt disease (80 80 d with |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | muscle fibers was maintained for a more extended period in SOD1 /mIgf-1 mIgf-1 mice which showed shifts in fiber composition only |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | there was not significant difference in fiber type composition between SOD1 and SOD1 /mIgf-1 mIgf-1 mice (not not depicted |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | there was not significant difference in fiber type composition between SOD1 and SOD1 /mIgf-1 mIgf-1 mice (not not depicted |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | not significant difference in fiber type composition between SOD1 and SOD1 /mIgf-1 mIgf-1 mice (not not depicted |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | The alteration in the heterogeneity of SOD1 muscle fibers indicate an alteration in motor neuron activity even |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | e performed at different ages revealed that at 112 d SOD1 mice ( n = 7 showed symptom onset without evident |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | The condition of SOD1 mice rapidly deteriorated at 117 d as shown by the |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | In contrast the pathological sign of disease were delayed in SOD1 /mIgf-1 mIgf-1 transgenic mice ( n = 7 as shown |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | _amp_#177 5.6 cm further when analyzed at same age as SOD1 mice and by their ability to move for a more |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | An activated calcineurin isoform is induced in SOD1 /mIgf-1 mIgf-1 muscle |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | low levels of CnA-_amp_#223 1 expression were not raised in SOD1 muscles ( Fig 3 a lane 3 Fig 3 b |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | 5 Fig 3 c or in uninjured wild-type and MLC/mIgf-1 MLC mIgf-1 muscle ( Fig 3 a and b lanes 1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | ( Fig 3 a and b lanes 1 and 2 SOD1 /mIgf-1 mIgf-1 regenerating muscle dramatically increased CnA-_amp_#223 1 transcripts (73 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Preservation of neuromuscular junctions in SOD1 /mIgf-1 mIgf-1 mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | neuron diseases also affect the configuration of neuromuscular junctions in SOD1 mice characterized by the diffusion of acetylcholine receptor (AChR) AChR |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | At 123 d SOD1 paralyzed muscle showed 56 _amp_#177 0.2% of diffuse AChR expression |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | ( Fig 4 a were preserved in muscles of age-matched SOD1 /mIgf-1 mIgf-1 mice which showed only 3.3 _amp_#177 0.4% of |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | At comparable end-stage disease SOD1 /mIgf-1 mIgf-1 muscle displayed only 18 _amp_#177 0.4% of diffuse |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | analysis ( Fig 4 b high AChR expression levels in SOD1 muscle were reduced in SOD1 /mIgf-1 mIgf-1 mice at all |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | high AChR expression levels in SOD1 muscle were reduced in SOD1 /mIgf-1 mIgf-1 mice at all stages observed |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | ( n = 6 revealed that AChR mRNA expression in SOD1 paralyzed muscle (123 123 d was 68 _amp_#177 2.4% higher |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | 68 _amp_#177 2.4% higher than that observed in age matched SOD1 /mIgf-1 mIgf-1 mice whereas the increase in mRNA expression in |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | /mIgf-1 mIgf-1 mice whereas the increase in mRNA expression in SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | expression in SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1 /mIgf-1 mIgf-1 mice where analyzed at comparable end-stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | expression in SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1 /mIgf-1 mIgf-1 mice where analyzed at comparable end-stage |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | SOD1 mice was of 32 _amp_#177 1.9% when SOD1 and SOD1 /mIgf-1 mIgf-1 mice where analyzed at comparable end-stage disease |
| 329 | AGRN | agrin | agrin | 1.0 | AChR clusters at the end plate requires the expression of agrin a large proteoglycan in the synaptic cleft that plays an |
| 329 | AGRN | agrin | Agrin | 1.0 | Agrin expression was significantly down-regulated in paralyzed SOD1 compared with SOD |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Agrin expression was significantly down-regulated in paralyzed SOD1 compared with SOD /mIgf-1 mIgf-1 muscle ( Fig 4 c |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | Agrin expression was significantly down-regulated in paralyzed SOD1 compared with SOD /mIgf-1 mIgf-1 muscle ( Fig 4 c analyzed at comparable |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Muscle-restricted mIgf-1 prolongs motor neuronal function in SOD1 mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Histological analysis of the ventral spinal cord revealed that SOD1 mice ( n = 7 presented a progressive reduction in |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Specifically SOD1 mice showed a reduction of 37 and 55% in the |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | In contrast mIgf-1 expression induced motor neuron survival in SOD1 /mIgf-1 mIgf-1 mice ( n = 7 at all ages |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | Comparable patterns of glial fibrillary acidic protein (GFAP) GFAP immunoreactivity were found in spinal cords of SOD1 ( n |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | protein (GFAP) GFAP immunoreactivity were found in spinal cords of SOD1 ( n = 6 and SOD /mIgf-1 mIgf-1 ( n |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | in spinal cords of SOD1 ( n = 6 and SOD /mIgf-1 mIgf-1 ( n = 6 transgenic mice before the |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | at paralysis stage (123 123 d the spinal cord of SOD1 mice demonstrated a marked increase in astroglial activation ( Fig |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | activation ( Fig 5 b C with an increase in GFAP expression of ~55 _amp_#177 0.2% ( Fig 5 b D |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | Fig 5 b D insert lane 3 compared with the GFAP expression levels displayed in the spinal cord of age matched |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | expression levels displayed in the spinal cord of age matched SOD1 /mIgf-1 mIgf-1 transgenic mice ( Fig 5 b D and |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | At comparable end-stage disease there were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | disease there were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | disease there were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | were no significant differences in GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to express 13% |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | GFAP expression between SOD1 and SOD1 /mIgf-1 mIgf-1 mice although SOD1 mice continued to express 13% more GFAP as compared with |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | mIgf-1 mice although SOD1 mice continued to express 13% more GFAP as compared with SOD1 /mIgf-1 mIgf-1 mice (unpublished unpublished data |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | mice continued to express 13% more GFAP as compared with SOD1 /mIgf-1 mIgf-1 mice (unpublished unpublished data |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 1.7 | be correlated with the expression of certain cytokines such as TNF-alpha which enhance the response to inflammatory states and contribute to |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | states and contribute to the progression of neurological dysfunction in SOD1 mice ( Elliott 2001 |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 1.7 | Although TNF-alpha expression was normally undetectable in the CNS of healthy mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | 1 and 2 it accumulated in the spinal cord of SOD1 mice at paralysis stage (123 123 d Fig 5 c |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 1.7 | In contrast TNF-alpha expression was not apparent in the spinal cord of SOD1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | TNF-alpha expression was not apparent in the spinal cord of SOD1 /mIgf-1 mIgf-1 transgenic mice ( Fig 5 c lane 4 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | determined whether the dramatic prolongation of CNS tissue integrity in SOD1 /mIgf-1 mIgf-1 mice derives from the direct retrograde transport of |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | mIgf-1 or indirect action either through distal activation of endogenous Igf-1 expression or through other trophic factors secreted by SOD /mIgf-1 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | endogenous Igf-1 expression or through other trophic factors secreted by SOD /mIgf-1 mIgf-1 muscle |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | The Igf-1 cDNA used by Kaspar et al |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | The importance of Igf-1 isoform choice in designing therapeutic strategies cannot be overstressed because |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | SOD transgenic mice (Jackson Jackson Laboratory express a transgenic human mutant |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | transgenic mice (Jackson Jackson Laboratory express a transgenic human mutant SOD1 allele containing the Gly93 Ala (G93A) G93A substitution driven by |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | The SOD1 B6J mice were crossed with MLC/mIgf-1 MLC mIgf-1 FVB mice |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | The SOD1 B6J mice were crossed with MLC/mIgf-1 MLC mIgf-1 FVB mice ( Musar_amp_ograve et al. 2001 for seven |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | Musar_amp_ograve et al. 2001 for seven different generations to obtain SOD1 /mIgf-1 mIgf-1 B6J inbred transgenic mice |
| 7576 | MYH6 | myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1) | MyHC | 2.5 | RT and incubated overnight at 4degreeC with primary antibodies neonatal MyHC (neo-MyHC), neo-MyHC MyHC-fast Alexa Fluor 488-conjugated alpha-bungarotoxin CnA-_amp_#223 1 (from |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | (from from C Klee National Institutes of Health Bethesda MD GFAP |
| 29823 | MYL6B | myosin, light chain 6B, alkali, smooth muscle and non-muscle | MLC | 0.6 | RNA was isolated from spinal cord of wild-type MLC/mIgf-1, MLC mIgf-1 and SOD and SOD1 /mIgf-1 mIgf-1 transgenic mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | isolated from spinal cord of wild-type MLC/mIgf-1, MLC mIgf-1 and SOD and SOD1 /mIgf-1 mIgf-1 transgenic mice |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 2.5 | spinal cord of wild-type MLC/mIgf-1, MLC mIgf-1 and SOD and SOD1 /mIgf-1 mIgf-1 transgenic mice |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 1.7 | The following oligonucleotides were used TNF-alpha sense 5'-CCCAGACCCTCACACACTCAGAT-3' and anti-sense 5'-TTGTCCCTTGAAGAGAACCTG-3' _amp_#223 -actin sense 5'-GTGGGCCGCTCTAGGCACAA-3' and |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | hSOD | 2.2 | Filters were blotted with antibodies against hSOD Pax7 myogenin desmin neo-MyHC (from from S Schiaffino University of |
| 8621 | PAX7 | paired box 7 | Pax7 | 0.5 | Filters were blotted with antibodies against hSOD Pax7 myogenin desmin neo-MyHC (from from S Schiaffino University of Padova |
| 7612 | MYOG | myogenin (myogenic factor 4) | myogenin | 1.0 | Filters were blotted with antibodies against hSOD Pax7 myogenin desmin neo-MyHC (from from S Schiaffino University of Padova Padova |
| 329 | AGRN | agrin | Agrin | 1.0 | neo-MyHC (from from S Schiaffino University of Padova Padova Italy Agrin GFAP |
| 4235 | GFAP | glial fibrillary acidic protein | GFAP | 2.5 | (from from S Schiaffino University of Padova Padova Italy Agrin GFAP |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | Organization of the Igf-1 gene |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | As its name implies Igf-1 is similar to insulin in structure |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | The mature Igf-1 is a single-chain protein of 70 aa and differs from |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | The rodent Igf-1 gene contains six exons separated by five introns (Fig Fig |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | to all isoforms as well as part of the mature Igf-1 peptide |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | Igf-1 | 3.5 | region of the E-peptide which is also common to all Igf-1 mRNAs |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | insulin like growth factor | 1.0 | here we show that muscle restricted expression of a localized insulin like growth factor igf 1 isoform maintained muscle integrity and enhanced satellite cell activity in sod1 transgenic mice inducing calcineurin mediated regenerative pathways. |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | insulin like growth factor | 1.0 | abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. |
| 14079 | CHRNA9 | cholinergic receptor, nicotinic, alpha 9 | acetylcholine receptor | 1.0 | abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dism |
| 7577 | MYH7 | myosin, heavy chain 7, cardiac muscle, beta | myosin heavy chain | 1.0 | this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. |
| 4235 | GFAP | glial fibrillary acidic protein | glial fibrillary acidic protein | 1.0 | abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase1 | 1.0 | holine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. |
| 5464 | IGF1 | insulin-like growth factor 1 (somatomedin C) | insulin like growth factor 1 | 1.0 | among these insulin like growth factor 1 igf 1 has been implicated in anabolism of muscle and nerve tissues inducing muscle hypertrophy and promoting neuronal survival musar_amp_ograve; and rosenthal 2002 . |
| 18809 | TUBA1B | tubulin, alpha 1b | alpha tubulin | 1.0 | immunoblotting for alpha tubulin served as a control for protein loading. |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | c rt pcr analysis of tnf alpha and _amp_#223; actin of wt lane 1 mlc/migf 1 lane 2 sod1 lane 3 and sod1 /migf 1 lane 4 transgenic mice at 123 d old. |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | lane 6 identifies the rna positive control pc for tnf alpha obtained from spleen. |
| 2770 | DES | desmin | desmin | 1.0 | in addition markers of satellite cell activity such as pax 7 and desmin were increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desm |
| 2770 | DES | desmin | desmin | 1.0 | were increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satel |
| 7612 | MYOG | myogenin (myogenic factor 4) | myogenin | 1.0 | re increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satellite cell |
| 7577 | MYH7 | myosin, heavy chain 7, cardiac muscle, beta | myosin heavy chain | 1.0 | g extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satellite cell activation is likely to contrib |
| 14079 | CHRNA9 | cholinergic receptor, nicotinic, alpha 9 | acetylcholine receptor | 1.0 | alterations in motor neuronal activity typical of denervated muscle and motor neuron diseases also affect the configuration of neuromuscular junctions in sod1 mice characterized by the diffusion of acetylcholine receptor achr postsynaptic clusters fig 4 a yellow arrow . |
| 4235 | GFAP | glial fibrillary acidic protein | glial fibrillary acidic protein | 1.0 | comparable patterns of glial fibrillary acidic protein gfap immunoreactivity were found in spinal cords of sod1 n = 6 and sod /migf 1 n = 6 transgenic mice before the symptom onset 28 d; fig 5 b a b and d insert lanes 1 and 2 . |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | the activation of astroglia can be correlated with the expression of certain cytokines such as tnf alpha which enhance the response to inflammatory states and contribute to the progression of neurological dysfunction in sod1 mice elliott 2001 . |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | although tnf alpha expression was normally undetectable in the cns of healthy mice fig 5 c lanes 1 and 2 it accumulated in the spinal cord of sod1 mice at paralysis stage 123 d; fig 5 c lane 3 . |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | in contrast tnf alpha expression was not apparent in the spinal cord of sod1 /migf 1 transgenic mice fig 5 c lane 4 . migf 1 hypertrophic muscle therefore functions as a protective tissue for the cns modulating reactive a |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | the following oligonucleotides were used: tnf alpha sense 5' cccagaccctcacacactcagat 3' and anti sense 5' ttgtcccttgaagagaacctg 3'; _amp_#223; actin sense 5' gtgggccgctctaggcacaa 3' and anti sense 5' ctctttgatgtcacgcacgatttc 3'. |
| 2770 | DES | desmin | desmin | 1.0 | filters were blotted with antibodies against hsod pax7 myogenin desmin neo myhc from s schiaffino university of padova padova italy agrin gfap. |
| 7612 | MYOG | myogenin (myogenic factor 4) | myogenin | 1.0 | filters were blotted with antibodies against hsod pax7 myogenin desmin neo myhc from s schiaffino university of padova padova italy agrin gfap. |
| 6081 | INS | insulin | insulin | 1.0 | as its name implies igf 1 is similar to insulin in structure. |
| 6081 | INS | insulin | insulin | 1.0 | the mature igf 1 is a single chain protein of 70 aa and differs from insulin by retention of the c domain by a short extension of the a domain to include a novel domain d and by the presence of variable cooh terminal extension peptides e peptides; fig s1 . |