HUGO ID Detailed Result 7872

PMID	Match String	Actual String	Score	Flanking text	Edited by	Edit
10643818	NOS	NOS	0.9	AA arachidonic acid PKC protein kinase C GPX glutathione peroxidase NOS NO synthetase LTP long-term potentiation
10930589	NOS	NOS	1.2	ascorbic acid -nitroarginine an inhibitor of nitric oxide synthase (NOS) NOS 27 did not affect the C-DCF fluorescence in resting cells
10930589	NOS	NOS	1.2	all groups with -nitroarginine treatment suggesting a protective role of NOS in menadione stressed cells
10930589	NOS	NOS	1.2	vitamin C and the flavinoid quercetin but not inhibitor of NOS supports the conclusion that C-DCDHF was oxidized by H 2
10930589	NOS	NOS	1.2	biological membranes against lipid peroxidation and -nitroarginine (inhibitor inhibitor of NOS showed no effect in ROS levels of all groups tested
11223912	nNOS	nNOS	2.2	molecules such as calmodulin and neuronal nitric oxide synthase (nNOS), nNOS in the cytoplasm
11978481	nNOS	nNOS	2.7	isoforms of nitric oxide synthase neuronal nitric oxide synthase (nNOS), nNOS endothelial nitric oxide synthase (eNOS), eNOS and inducible nitric oxide
11978481	NOS	NOS	2.7	3-nitrotyrosine generation are also attenuated in mice deficient in inducible NOS 48
11978481	nNOS	nNOS	2.7	An increase in neuronal nitric oxide synthase (nNOS) nNOS was found in motor neurons in one study 65 66
11978481	nNOS	nNOS	2.7	Other recent studies showed no alteration in nNOS in motor neurons but showed an increase in nNOS in
11978481	nNOS	nNOS	2.7	in nNOS in motor neurons but showed an increase in nNOS in reactive astrocytes in ALS spinal cord and subcortical white
12753090	nNOS	nNOS	2.7	Proteasome activation and nNOS down-regulation in neuroblastoma cells expressing a Cu Zn superoxide dismutase
12753090	nNOS	nNOS	2.7	oxide production and down-regulation of neuronal nitric oxide synthase (nNOS) nNOS level were detected
12753090	nNOS	nNOS	2.7	The nNOS down-regulation was correlated to increased proteolytic degradation by proteasome because
12753090	nNOS	nNOS	2.7	to increased proteolytic degradation by proteasome because comparable levels of nNOS were detected in G93A and parental cells upon treatment with
12753090	nNOS	nNOS	2.7	rate of proteolysis observed in G93A cells was specific for nNOS as Cu Zn superoxide dismutase (Cu,Zn Cu Zn SOD degradation
12909279	NOS	NOS	1.2	expression of several proteins such as nitric oxide synthase (NOS) NOS 93 and COX2 70 that might be involved in mechanisms
12909279	NOS	NOS	1.2	Indeed COX2 and NOS activity are dramatically increased in post-mortem spinal cord samples from
14739060	nNOS	nNOS	1.9	account for NO production and include neuronal NO synthase (nNOS; nNOS type I inducible NO synthase (iNOS; iNOS typeII which is
14739060	nNOS	nNOS	1.9	endothelial NO synthase (eNOS; eNOS type III In the CNS nNOS whose expression is regulated by both physiological and pathophysiological stimuli
14739060	nNOS	nNOS	1.9	series of enzymes including protein kinase C proteases phosphatases phospholipases nNOS and xanthine oxidase 32
15896810	NOS	NOS	2.7	Accordingly as cytokines promote the induction of NOS in brain a possible role for a glial-derived NO_amp_#xb7 in
15896810	NOS	NOS	2.7	study in which NADPH diaphorase (a a cytochemical marker of NOS activity positive glial cells have been identified in the substantia
15896810	nNOS	nNOS	2.7	this it has been reported that the selective inhibition of nNOS prevents 1-methyl-4-phenyl-1 2 3 6-tetrahydropyridine (MPTP)-induced MPTP -induced Parkinsonism in
15896810	NOS	NOS	2.7	Role of NOS and NO in brain pathophysiology
15896810	NOS	NOS	2.7	responsible for NO synthesis is the nitric oxide synthase (NOS) NOS family of enzymes which catalyse the conversion of arginine to
15896810	NOS	NOS	2.7	NOS localized in the CNS and in the periphery 91 is
15896810	NOS	NOS	2.7	is present in three well characterized isoforms (a) a neuronal NOS (nNOS, nNOS type I (b) b endothelial NOS (eNOS; eNOS
15896810	nNOS	nNOS	2.7	in three well characterized isoforms (a) a neuronal NOS (nNOS, nNOS type I (b) b endothelial NOS (eNOS; eNOS type III
15896810	NOS	NOS	2.7	a neuronal NOS (nNOS, nNOS type I (b) b endothelial NOS (eNOS; eNOS type III and (c) c inducible NOS (iNOS,
15896810	NOS	NOS	2.7	endothelial NOS (eNOS; eNOS type III and (c) c inducible NOS (iNOS, iNOS type II
15896810	NOS	NOS	2.7	Activation of different isoforms of NOS requires various factors and co-factors
15896810	NOS	NOS	2.7	complexes is a prerequisite before the functional active dimer exhibits NOS activity which depends also on cofactors such as tetrahydrobiopterin (BH
15896810	nNOS	nNOS	2.7	In contrast to nNOS and eNOS iNOS can bind to calmodulin even at very
17174478	NOS	NOS	2.7	Fig 2 Proposed holo -NOS
17174478	nNOS	nNOS	2.7	a The modular structure of nNOS
17174478	nNOS	nNOS	2.7	This schematic representation shows the domain organization of nNOS indicated above the regions binding the substrate and cofactors below
17174478	NOS	NOS	2.7	Fig 3 Proposed holo -NOS assembly and domain movements
17174478	NOS	NOS	2.7	a Three possible models for dimeric holo -NOS dimeric NOSox and NOSred modules are represented by pairs of
17174478	nNOS	nNOS	2.7	NER nucleotide excision repair NO nitric oxide e i or nNOS endothelial inducible or neuronal nitric oxide synthase NOSox NOS catalytic
17174478	NOS	NOS	2.7	or nNOS endothelial inducible or neuronal nitric oxide synthase NOSox NOS catalytic oxygenase module NOSred NOS reductase module NHEJ nonhomologous end
17174478	NOS	NOS	2.7	neuronal nitric oxide synthase NOSox NOS catalytic oxygenase module NOSred NOS reductase module NHEJ nonhomologous end joining ROS reactive oxygen species
17174478	NOS	NOS	2.7	(CCS)( CCS Kato et al. 2001 nitric oxide synthase (NOS) NOS and phosphorylated neurofilaments ( Chou et al. 1996
17174478	NOS	NOS	2.7	at the synthesis level by the nitric oxide synthase (NOS) NOS enzymes
17174478	NOS	NOS	2.7	The NOS enzymes produce NO through the conversion of arginine to citrulline
17174478	NOS	NOS	2.7	In mammals there are three NOS isoforms which have been named after the activity or tissue
17174478	NOS	NOS	2.7	These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS
17174478	NOS	NOS	2.7	These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS)
17174478	nNOS	nNOS	2.7	These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS
17174478	NOS	NOS	2.7	These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS
17174478	NOS	NOS	2.7	neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS are constitutively expressed isozymes controlling
17174478	nNOS	nNOS	2.7	nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS are constitutively expressed isozymes controlling basal NO levels
17174478	NOS	NOS	2.7	Functional NOS isozymes are homodimers and each isozyme subunit contains an N-terminal
17174478	NOS	NOS	2.7	two tetrahydrobiopterin cofactors and a zinc ion that stabilize the NOS dimer interface ( Crane et al. 1998 Raman et al.
17174478	nNOS	nNOS	2.7	biochemistry data elucidated from a fully assembled reductase dimer of nNOS ( Fig 2b c provided critical insights into this domain's
17174478	NOS	NOS	2.7	regulatory element the C-terminal tail and phosphorylation function to regulate NOS activity which is exquisitely tuned to control NO production (
17174478	nNOS	nNOS	2.7	In addition eNOS and nNOS contain the 42_amp_#x02013 45-residue auto-inhibitory helix (AH) AH within the
17174478	nNOS	nNOS	2.7	protruding _amp_#x003b2 -finger present in the CD of eNOS and nNOS plays an autoinhibitory role in the control of NO by
17174478	nNOS	nNOS	2.7	The upregulation of eNOS and nNOS activity is controlled by phosphorylation of both the CT and
17174478	NOS	NOS	2.7	An experimentally determined structure of full-length NOS remains elusive perhaps due to the required flexibility of its
17174478	nNOS	nNOS	2.7	dimer provided a template for a model of the holo -nNOS enzyme assembly ( Garcin et al. 2004
17174478	NOS	NOS	2.7	The NOS model was built by connecting the dimeric NOSox modules and
17174478	NOS	NOS-peptide	2.7	built by connecting the dimeric NOSox modules and a CaM NOS-peptide complex ( Aoyagi et al. 2003 to the NOSred structure
17174478	NOS	NOS	2.7	The flexible hinge region in NOS would serve as the pivot point for this motion (
17174478	NOS	NOS	2.7	account for the slow rate of inter-module electron transfer in NOS
17174478	NOS	NOS	2.7	The dimerization NOS would provide a means for fine-tuning this electron transfer mechanism
17174478	NOS	NOS	2.7	Koedel and Pfister 1999 through the calcium-mediated activation of neuronal NOS ( Aoyagi et al. 2003
17174478	NOS	NOS	2.7	accentuated by NO used in signaling and by stimulation of NOS by calcium burst during invasion
17174478	NOS	NOS	2.7	significant example is the fine control of activities of the NOS holo-enzyme suggested to occur through either promoting or inhibiting a
17174478	NOS	NOS	2.7	The NOS isoforms also have multiple functions that may be targets for
17368952	NOS	NOS	1.2	Expression of inducible _amp_#xb7 nitric oxide synthase (NOS) NOS increases during the development of ALS in the G93A transgenic
17368952	NOS	NOS	1.2	al. 2002 and pharmacological inhibition or genetic manipulation of neuronal NOS does not alter the course of ALS ( Facchinetti et
17368952	NOS	NOS	1.2	SOD1 and NOS were colocalized at the foci of NF accumulation in motor
17368952	NOS	NOS	1.2	using a NO-selective electrode ( Liu et al. 2000 measuring NOS immuno-reactivity as an indicator of possible _amp_#xb7 NO synthesis by
17368952	NOS	NOS	1.2	Recent progress indicates that neuronal NOS is involved in a motoneuron-specific programmed cell death pathway (
17368952	NOS	NOS	1.2	et al 2004 and Holasek et al 2005 and inducible NOS and _amp_#xb7 NO act as inflammatory markers in ALS (
17496232	nNOS	nNOS	3.7	Transcriptional increase of neuronal nitric oxide synthase (nNOS) nNOS determines extensive binding to complex I and IV and contributes
17496232	nNOS	nNOS	3.7	3 3' 5-triiodothyronine (T T 3 levels there is increased nNOS transcription translation and translocation into mitochondria resulting in high mitochondrial
17496232	NOS	NOS	2.7	transcription translation and translocation into mitochondria resulting in high mitochondrial NOS (mtNOS) mtNOS activity and increased nitric oxide (NO), NO ONOO
17496232	NOS	NOS	2.7	and O 2 is catalyzed by nitric oxide synthases (NOS) NOS ( 92
17496232	NOS	NOS	2.7	There exist three canonical isoforms neuronal (NOS NOS I or nNOS inducible (NOS NOS II and endothelial (NOS
17496232	nNOS	nNOS	3.7	There exist three canonical isoforms neuronal (NOS NOS I or nNOS inducible (NOS NOS II and endothelial (NOS NOS III and
17496232	NOS	NOS	2.7	canonical isoforms neuronal (NOS NOS I or nNOS inducible (NOS NOS II and endothelial (NOS NOS III and a significant number
17496232	NOS	NOS	2.7	I or nNOS inducible (NOS NOS II and endothelial (NOS NOS III and a significant number of spliced and posttranslationally modified
17496232	NOS	NOS	2.7	In addition new isoforms or mitochondrial variants of NOS (mtNOS) mtNOS were recently described in rat liver ( 60
17496232	NOS	NOS	2.7	as extreme hypoxia mitochondrial NO could come either from stimulated NOS ( 116 142 or from the reduction of nitrite by
17496232	NOS	NOS	2.7	NOS I and III ( 45 82 are constitutively expressed in
17496232	NOS	NOS	2.7	caveolin-NOS enzyme activity 2 modified subcellular traffic (dystrophin dystrophin impedes NOS I traffic to mitochondria ( 76 and 3 participation in
17496232	NOS	NOS	2.7	Constitutive NOS are activated by Ca pulses after activation of cell surface
17496232	NOS	NOS	2.7	surface receptors by effectors like bradykinin or acetylcholine (endothelial endothelial NOS III or excitatory amino acids like glutamate (neuronal neuronal synaptic
17496232	NOS	NOS	2.7	III or excitatory amino acids like glutamate (neuronal neuronal synaptic NOS I ( 45
17496232	NOS	NOS	2.7	NOS I and III are characterized by fast and transient responses
17496232	NOS	NOS	2.7	In contrast NOS II is not constitutive and does not depend on Ca
17496232	NOS	NOS	2.7	is not constitutive and does not depend on Ca concentration NOS II gene expression is modulated by inflammatory mediators like cytokines
17496232	NOS	NOS	2.7	The activities of classic NOS isoforms are able to sustain NO cytosolic concentrations large enough
17496232	NOS	NOS	2.7	Therefore mitochondrial NO coming from classic cytosolic NOS results in a considerably lower concentration ~20-100 nM ( 18
17496232	NOS	NOS	2.7	however it may increase by fivefold after induction of inducible NOS in endotoxemia ( 14
17496232	NOS	NOS	2.7	is noteworthy that changes in the expression and activities of NOS isoforms particularly of intra-mtNOS will be followed by significant variations
17496232	NOS	NOS	2.7	Our underlying proposal is that grading expression and activities of NOS isoforms and the concentration of matrix NO modulate H 2
17496232	NOS	NOS	2.7	process including the concentration and activities of mtNOS cytosolic classic NOS isoforms MnSOD catalase and peroxidases
17496232	nNOS	nNOS	3.7	levels of 3 3' 5-triiodothyronine (T T 3 in hypothyroidism nNOS mRNA increased by threefold and nNOS translocation to mitochondria was
17496232	nNOS	nNOS	3.7	T 3 in hypothyroidism nNOS mRNA increased by threefold and nNOS translocation to mitochondria was favored with concomitant increase of mtNOS
17496232	nNOS	nNOS	3.7	Two effects emerged from nNOS confinement
17496232	NOS	NOS	2.7	consumption was more sensitive to L -arginine and to the NOS inhibitor N -monomethyl-L -arginine indicating the modulation of O 2
17496232	NOS	NOS	2.7	A similar effect of a NOS inhibitor N -nitro-L -arginine methyl ester ( L -NAME or
17496232	nNOS	nNOS	3.7	of complex I inhibition by NO-ONOO overproduced by increased translocated nNOS (mtNOS) mtNOS
17496232	nNOS	nNOS	3.7	It is interesting that lack of T 3 stimulates nNOS gene expression suggesting the existence of a tonic gene inhibition
17496232	NOS	NOS	2.7	2 O 2 levels by controlled treatment with scavengers or NOS inhibitors like N -acetylcysteine glutathione or L -NAME increased proliferation
17496232	NOS	NOS	2.7	In this way increased inducible NOS expression and NO production act as a negative regulatory feedback
17496232	NOS	NOS	2.7	the mitochondrial field we previously reported the existence of defective NOS and mtNOS in mitochondria from tumor cells ( 58
17634371	nNOS	nNOS	3.7	and 5'-AAACACGCCTTCCTTCCCATTG-3' (186 186 bp neuronal nitric oxide synthase (nNOS), nNOS 5'-CCACACCAACGGGAATCAGGAG-3' and 5'-TCCTCCAGCACCTCCACCATTG-3' (405 405 bp actin 5'-CATGAAGATCCTGACCGAGCGTG-3' and 5'-TCTGCTGGAAGGTGGACAGTGAGG-3'
17634371	nNOS	nNOS	3.7	transgenic motor neurons requires endogenous production of nitric oxide by nNOS because apoptosis is prevented by nNOS inhibitors
17634371	nNOS	nNOS	3.7	of nitric oxide by nNOS because apoptosis is prevented by nNOS inhibitors
17634371	nNOS	nNOS	3.7	apoptosis was not mediated by increased expression of p75 or nNOS mRNA
17634371	NOS	NOS	2.7	nitric oxide production may still result from activation of endogenous NOS enzymatic activity
17634371	nNOS	nNOS	3.7	and trophic factor deprivation (Est_amp_eacute;vez Est_amp_eacute vez et al. 1998 nNOS regulation in motor neurons occurs at the transcriptional level
17634371	NOS	NOS	2.7	(1 1 m M a general nitric oxide synthase (NOS) NOS inhibitor and 1-(2-trifluoromethylphenyl)imidazole 1- 2-trifluoromethylphenyl imidazole (TRIM) TRIM (10 10
17634371	NOS	NOS	2.7	micro M a specific inhibitor of the neuronal isoform of NOS prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3
17634371	nNOS	nNOS	3.7	in SOD1 motor neurons required endogenous nitric oxide production by nNOS activation
17634371	nNOS	nNOS	3.7	could not be explained by differential expression of p75 or nNOS
17634371	nNOS	nNOS	3.7	No significant difference was observed in p75 and nNOS mRNA expression levels between nontransgenic and SOD1 motor neurons as
11223912	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	mitochondrial uptake of ca 2+ has recently been found to play an important role in glutamate induced neurotoxicity gnt as well as in the activation of ca 2+ dependent molecules such as calmodulin and neuronal nitric oxide synthase nnos in the cytoplasm.
11978481	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	the generation of no _amp_#x2022; is catalyzed by three isoforms of nitric oxide synthase neuronal nitric oxide synthase nnos endothelial nitric oxide synthase enos and inducible nitric oxide synthase inos .
11978481	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	we and others showed that inhibitors of neuronal nitric oxide synthase blocked mptp induced dopaminergic toxicity in mice and that mptp neurotoxicity was attenuated in mice deficient in neuronal nitric oxide synthase [ 45 and 46 ].
11978481	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	we subsequently showed that neuronal nitric oxide synthase inhibitors blocked mptp neurotoxicity in baboons and this was accompanied by an inhibition of 3 nitrotyrosine staining [ 47 ].
11978481	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	an increase in neuronal nitric oxide synthase nnos was found in motor neurons in one study [ 65 66 and 67 ].
12753090	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	nitrosative stress was not involved in the oxidative unbalance as a decrease in neuronal nitric oxide production and down regulation of neuronal nitric oxide synthase nnos level were detected.
17174478	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	tion repair hrdc helicase rnase d conserved domain mmr mismatch repair mrn mre11/rad50/nbs1 mtdna mitochondrial dna ner nucleotide excision repair no nitric oxide e i or nnos endothelial inducible or neuronal nitric oxide synthase nosox nos catalytic oxygenase module nosred nos reductase module nhej nonhomologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription cou
17496232	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	transcriptional increase of neuronal nitric oxide synthase nnos determines extensive binding to complex i and iv and contributes to hypothyroid phenotype.
17634371	neuronal nitric oxide synthase	neuronal nitric oxide synthase	1.0	gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaagatcctgaccgagcgtg 3' and 5' tctgctggaaggtggacagtgagg 3' 497 bp . p75 primers were from promega madison wi .