)| PMID |
17634371 ( ) |
|---|---|
| Title | Mitochondrial superoxide production and nuclear factor erythroid 2-related factor 2 activation in p75 neurotrophin receptor-induced motor neuron apoptosis. |
| Abstract | Nerve growth factor (NGF) can induce apoptosis by signaling through the p75 neurotrophin receptor (p75(NTR)) in several nerve cell populations. Cultured embryonic motor neurons expressing p75(NTR) are not vulnerable to NGF unless they are exposed to an exogenous flux of nitric oxide (*NO). In the present study, we show that p75(NTR)-mediated apoptosis in motor neurons involved neutral sphingomyelinase activation, increased mitochondrial superoxide production, and cytochrome c release to the cytosol. The mitochondria-targeted antioxidants mitoQ and mitoCP prevented neuronal loss, further evidencing the role of mitochondria in NGF-induced apoptosis. In motor neurons overexpressing the amyotrophic lateral sclerosis (ALS)-linked superoxide dismutase 1(G93A) (SOD1(G93A)) mutation, NGF induced apoptosis even in the absence of an external source of *NO. The increased susceptibility of SOD1(G93A) motor neurons to NGF was associated to decreased nuclear factor erythroid 2-related factor 2 (Nrf2) expression and downregulation of the enzymes involved in glutathione biosynthesis. In agreement, depletion of glutathione in nontransgenic motor neurons reproduced the effect of SOD1(G93A) expression, increasing their sensitivity to NGF. In contrast, rising antioxidant defenses by Nrf2 activation prevented NGF-induced apoptosis. Together, our data indicate that p75(NTR)-mediated motor neuron apoptosis involves ceramide-dependent increased mitochondrial superoxide production. This apoptotic pathway is facilitated by the expression of ALS-linked SOD1 mutations and critically modulated by Nrf2 activity. Investigaciones Biologicas Clemente Estable, Montevideo 11600, Uruguay. Neuroscience |
NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.
Targets by SciMiner Summary
| HUGO ID | Symbol | Target Name | #Occur | ActualStr |
|---|---|---|---|---|
| 7808 | NGF | nerve growth factor (beta polypeptide) | 99 | nerve growth factor | NGF-induced | NGF-mediated | |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | 63 | p75 | |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | 60 | superoxide dismutase 1 | SOD1-associated | hSOD1 | |
| 4232 | GDNF | glial cell derived neurotrophic factor | 35 | GDNF | glial cell line derived neurotrophic factor | |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | 25 | Nrf2 | |
| 19986 | CYCS | cytochrome c, somatic | 20 | cytochrome c | |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | 12 | NOS | nNOS | neuronal nitric oxide synthase | |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | 10 | nSMase | |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | 9 | glutamate cysteine ligase catalytic subunit | GCLC | |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | 8 | Fas | Fas-apoptotic | |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | 7 | glutamate cysteine ligase modifier subunit | GCLM | GCL | |
| 11936 | FASLG | Fas ligand (TNF superfamily, member 6) | 4 | fas ligand | |
| 8031 | NTRK1 | neurotrophic tyrosine kinase, receptor, type 1 | 3 | tyrosine kinase receptor | TrkA | |
| 6782 | MAFK | v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) | 2 | nuclear factor erythroid 2 | |
| 6881 | MAPK8 | mitogen-activated protein kinase 8 | 2 | JNK | |
| 6204 | JUN | jun oncogene | 2 | c jun | c-Jun | |
| 1033 | BDNF | brain-derived neurotrophic factor | 2 | neurotrophin | |
| 8023 | NTF3 | neurotrophin 3 | 1 | ngf 2 | |
| 25079 | CCDC34 | coiled-coil domain containing 34 | 1 | L15 | |
| 11919 | CD40 | CD40 molecule, TNF receptor superfamily member 5 | 1 | tumor necrosis factor receptor superfamily | |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | 1 | nitric oxide synthase | |
| 4624 | GSS | glutathione synthetase | 1 | glutathione synthetase | |
Targets by SciMiner Full list
| HUGO ID | Symbol | Name | ActualStr | Score | FlankingText |
|---|---|---|---|---|---|
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Nerve growth factor (NGF) NGF can induce apoptosis by signaling through the p75 neurotrophin receptor |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | factor (NGF) NGF can induce apoptosis by signaling through the p75 neurotrophin receptor (p75 p75 in several nerve cell populations |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | induce apoptosis by signaling through the p75 neurotrophin receptor (p75 p75 in several nerve cell populations |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Cultured embryonic motor neurons expressing p75 are not vulnerable to NGF unless they are exposed to |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Cultured embryonic motor neurons expressing p75 are not vulnerable to NGF unless they are exposed to an exogenous flux of nitric |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | In the present study we show that p75 -mediated apoptosis in motor neurons involved neutral sphingomyelinase activation increased |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | prevented neuronal loss further evidencing the role of mitochondria in NGF-induced apoptosis |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | amyotrophic lateral sclerosis (ALS)-linked ALS -linked superoxide dismutase 1 (SOD1 SOD1 mutation NGF induced apoptosis even in the absence of an |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | sclerosis (ALS)-linked ALS -linked superoxide dismutase 1 (SOD1 SOD1 mutation NGF induced apoptosis even in the absence of an external source |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | The increased susceptibility of SOD1 motor neurons to NGF was associated to decreased nuclear factor |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | The increased susceptibility of SOD1 motor neurons to NGF was associated to decreased nuclear factor erythroid 2-related factor 2 |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | associated to decreased nuclear factor erythroid 2-related factor 2 (Nrf2) Nrf2 expression and downregulation of the enzymes involved in glutathione biosynthesis |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | of glutathione in nontransgenic motor neurons reproduced the effect of SOD1 expression increasing their sensitivity to NGF |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | reproduced the effect of SOD1 expression increasing their sensitivity to NGF |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | In contrast rising antioxidant defenses by Nrf2 activation prevented NGF-induced apoptosis |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | In contrast rising antioxidant defenses by Nrf2 activation prevented NGF-induced apoptosis |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Together our data indicate that p75 -mediated motor neuron apoptosis involves ceramide-dependent increased mitochondrial superoxide production |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | This apoptotic pathway is facilitated by the expression of ALS-linked SOD1 mutations and critically modulated by Nrf2 activity |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | the expression of ALS-linked SOD1 mutations and critically modulated by Nrf2 activity |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | words amyotrophic lateral sclerosis mitochondria motor neurons nerve growth factor Nrf2 p75 superoxide |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | amyotrophic lateral sclerosis mitochondria motor neurons nerve growth factor Nrf2 p75 superoxide |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Nerve growth factor (NGF) NGF has a key role on the development and function of |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | In addition to promoting neuronal differentiation and survival NGF can induce apoptosis of neurons during development and may also |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | NGF exerts its actions through two nonhomologous transmembrane receptors the tyrosine |
| 8031 | NTRK1 | neurotrophic tyrosine kinase, receptor, type 1 | TrkA | 1.9 | actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | nonhomologous transmembrane receptors the tyrosine kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a member of the |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | tyrosine kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a member of the tumor necrosis factor receptor |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a member of the tumor necrosis factor receptor superfamily |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Adult motor neurons had been thought to be unresponsive to NGF because they lack both TrkA and p75 receptors (Henderson Henderson |
| 8031 | NTRK1 | neurotrophic tyrosine kinase, receptor, type 1 | TrkA | 1.9 | thought to be unresponsive to NGF because they lack both TrkA and p75 receptors (Henderson Henderson et al. 1993 Yan et |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | be unresponsive to NGF because they lack both TrkA and p75 receptors (Henderson Henderson et al. 1993 Yan et al. 1993 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | However adult motor neurons can reexpress p75 after nerve injury (Koliatsos Koliatsos et al. 1991 Rende et |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Induction of p75 renders motor neurons vulnerable to NGF-induced apoptosis p75 has been |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Induction of p75 renders motor neurons vulnerable to NGF-induced apoptosis p75 has been implicated in motor neuron death occurring |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Induction of p75 renders motor neurons vulnerable to NGF-induced apoptosis p75 has been implicated in motor neuron death occurring in transgenic |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | occurring in transgenic mice overexpressing mutant Cu-Zn superoxide dismutase (SOD1) SOD1 (Lowry Lowry et al. 2001b Copray et al. 2003 Kust |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Pure motor neuron cultures expressing p75 are sensitive to NGF-induced apoptosis only when physiological concentrations of |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Pure motor neuron cultures expressing p75 are sensitive to NGF-induced apoptosis only when physiological concentrations of exogenous nitric oxide ( |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | These motor neurons also become immunoreactive for nitrotyrosine suggesting that p75 activation may be inducing a source of superoxide that converts |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Astrocytes can protect motor neurons against p75 -induced apoptosis by the activation of the transcription factor nuclear |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), Nrf2 which increases antioxidant defenses (Vargas Vargas et al. 2006 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Thus the signaling pathway induced by p75 and its final outcome differs depending on the cell type |
| 6204 | JUN | jun oncogene | c-Jun | 1.3 | is not completely elucidated but is associated with activation of c-Jun N-terminal kinase (JNK), JNK release of cytochrome c from mitochondria |
| 6881 | MAPK8 | mitogen-activated protein kinase 8 | JNK | 0.6 | but is associated with activation of c-Jun N-terminal kinase (JNK), JNK release of cytochrome c from mitochondria and subsequent activation of |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Ceramide production may also be a mediator of p75 -induced apoptosis (Dobrowsky Dobrowsky et al. 1994 Casaccia-Bonnefil et al. |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | We have previously shown that p75 -induced motor neuron death involves increased production of ROS and |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | However the source of the increased ROS production induced by p75 activation in motor neurons is currently unknown |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | the present study we investigated the apoptotic pathway mediated by p75 in motor neurons and the impact of ALS-linked SOD1 expression |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | by p75 in motor neurons and the impact of ALS-linked SOD1 expression |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | We show that this pathway involved neutral sphingomyelinase (nSMase) nSMase activation and increased mitochondrial superoxide production |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Motor neurons overexpressing ALS-linked SOD1 mutation showed greater susceptibility to the p75 -activated apoptotic pathway |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | neurons overexpressing ALS-linked SOD1 mutation showed greater susceptibility to the p75 -activated apoptotic pathway which was associated to decreased Nrf2 expression |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | the p75 -activated apoptotic pathway which was associated to decreased Nrf2 expression and the consequent reduction in antioxidant defenses |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Mouse NGF (2.5S) 2.5S was obtained from Harlan (Madison, Madison WI recombinant |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas | 0.3 | was obtained from Harlan (Madison, Madison WI recombinant human soluble Fas ligand and tert -butylhydroquinone (tBHQ) tBHQ from Alexis (San San |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Blocking antibodies to NGF and p75 were from Chemicon (Temecula, Temecula CA |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Blocking antibodies to NGF and p75 were from Chemicon (Temecula, Temecula CA |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | gradient centrifugation and immunopanning with the monoclonal antibody IgG192 against p75 as described previously (Henderson Henderson et al. 1995 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Transgenic SOD1 and nontransgenic motor neurons were prepared in the same way |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Sprague Dawley SOD1 L26H rats were kindly provided by Dr David S Howland |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | by the addition of glial cell line-derived neurotrophic factor (GDNF) GDNF (1 1 ng/ml; ng ml Sigma to the culture media |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | neuron death induced by trophic factor deprivation (NONE; NONE without GDNF was determined in all experiments as a control and never |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | As a control the expression of human SOD1 was determined in the spinal cord of E15 embryos and |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Anti-SOD1 antibodies were developed in rabbit using recombinant pure human SOD1 as immunogen (kindly kindly provided by Dr M Marin University |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Treatments with NGF and inhibitors were performed 3 h after motor neuron plating |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas | 0.3 | Soluble Fas ligand was added in the presence of enhancer antibody (1 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Treatment with antisense oligonucleotides to downregulate p75 expression in motor neurons was performed as described previously (Pehar |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | To determine the efficiency of uptake cultures were incubated with p75 antisense oligonucleotides with a 5' 56-FAM fluorescent label |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Sequences used were as follows p75 antisense 5'-ACCTGCCCTCCTCATTGCA-3' and p75 missense 5'-CTCCCACTCGTCATTCGAC-3' (Florez-McClure Florez-McClure et al. |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Sequences used were as follows p75 antisense 5'-ACCTGCCCTCCTCATTGCA-3' and p75 missense 5'-CTCCCACTCGTCATTCGAC-3' (Florez-McClure Florez-McClure et al. 2004 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | sequence has previously been shown to be effective at inhibiting p75 -induced apoptosis in motor neurons both in vivo and in |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | PCR primers specific to each gene are as follows Nrf2 5'-TTCCTCTGCTGCCATTAGTCAGTC-3' and 5'-GCTCTTCCATTTCCGAGTCACTG-3' (242 242 bp glutamate-cysteine ligase modifier subunit |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | GCLM | 3.0 | and 5'-GCTCTTCCATTTCCGAGTCACTG-3' (242 242 bp glutamate-cysteine ligase modifier subunit (GCLM), GCLM 5'-AATCTTGCCTCCTGCTGTGTGATG-3' and 5'-GGCTTCAATGTCAGGGATGCTTTC-3' (153 153 bp glutamate-cysteine ligase catalytic subunit |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | GCLC | 2.5 | and 5'-GGCTTCAATGTCAGGGATGCTTTC-3' (153 153 bp glutamate-cysteine ligase catalytic subunit (GCLC), GCLC 5'-ATGAAAGTGGCACAGGAGCGAG-3' and 5'-AAACACGCCTTCCTTCCCATTG-3' (186 186 bp neuronal nitric oxide synthase |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | and 5'-AAACACGCCTTCCTTCCCATTG-3' (186 186 bp neuronal nitric oxide synthase (nNOS), nNOS 5'-CCACACCAACGGGAATCAGGAG-3' and 5'-TCCTCCAGCACCTCCACCATTG-3' (405 405 bp actin 5'-CATGAAGATCCTGACCGAGCGTG-3' and 5'-TCTGCTGGAAGGTGGACAGTGAGG-3' |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | (405 405 bp actin 5'-CATGAAGATCCTGACCGAGCGTG-3' and 5'-TCTGCTGGAAGGTGGACAGTGAGG-3' (497 497 bp p75 primers were from Promega (Madison, Madison WI |
| 25079 | CCDC34 | coiled-coil domain containing 34 | L15 | 0.6 | mito-HE for 15 min and after washing incubated in supplemented L15 (Pehar Pehar et al. 2004 without phenol red |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | mito-HE incubation cells were treated with 100 ng/ml ng ml NGF and then imaged every 15 min |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | To test monochlorobimane fluorescence emission motor neurons maintained with GDNF (1 1 ng/ml) ng ml were treated with buthionine-sulfoximine (BSO) |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Nontransgenic and SOD1 motor neuron cultures were maintained for 16 h in the |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | cultures were maintained for 16 h in the presence of GDNF (1 1 ng/ml) ng ml and then treated with NGF |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | GDNF (1 1 ng/ml) ng ml and then treated with NGF (100 100 ng/ml) ng ml in the presence or absence |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | as a central component of the apoptotic pathway mediated by p75 in other cell types we examined its role in p75 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | p75 in other cell types we examined its role in p75 -mediated motor neuron apoptosis |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Consistent with our previous results (Pehar Pehar et al. 2004 NGF reduced motor neuron survival by 40% only in the presence |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | The extent of NGF-induced reduction in motor neuron survival was similar to that induced |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | NGF-induced motor neuron death was blocked by manumycin A (10 10 |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | M and GW4869 (100 100 n M specific inhibitors of nSMase (Arenz Arenz et al. 2001 Luberto et al. 2002 ( |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | These results indicate the involvement of ceramide production by nSMase activation in p75 -mediated motor neuron apoptosis |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | indicate the involvement of ceramide production by nSMase activation in p75 -mediated motor neuron apoptosis |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Reexpression of p75 under pathological conditions renders motor neurons vulnerable to NGF (Ferri |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | of p75 under pathological conditions renders motor neurons vulnerable to NGF (Ferri Ferri et al. 1998 Wiese et al. 1999 Lowry |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | In the present study we show that the NGF/p75 NGF p75 -mediated motor neuron apoptosis involved increased production of mitochondrial |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | In the present study we show that the NGF/p75 NGF p75 -mediated motor neuron apoptosis involved increased production of mitochondrial superoxide |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Moreover ALS-linked SOD1 overexpression increases motor neuron vulnerability to NGF-mediated apoptosis by reducing |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-mediated | 1.2 | Moreover ALS-linked SOD1 overexpression increases motor neuron vulnerability to NGF-mediated apoptosis by reducing antioxidant defenses |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | effect could be explained not only by the expression of SOD1 with aberrant redox properties (Beckman Beckman et al. 2001 but |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | properties (Beckman Beckman et al. 2001 but also by reduced Nrf2 expression which leads to a downregulation of the key enzymes |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | In accordance pharmacological activation of Nrf2 prevented NGF/p75 NGF p75 -induced motor neuron apoptosis suggesting a |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | In accordance pharmacological activation of Nrf2 prevented NGF/p75 NGF p75 -induced motor neuron apoptosis suggesting a potential target to |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | In accordance pharmacological activation of Nrf2 prevented NGF/p75 NGF p75 -induced motor neuron apoptosis suggesting a potential target to counteract |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | -induced motor neuron apoptosis suggesting a potential target to counteract p75 -mediated motor neuron death occurring in pathological conditions |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | p75 induces cell death by activating different signaling pathways depending on |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas | 0.3 | observed for other apoptotic stimuli including trophic factor deprivation and Fas (Est_amp_eacute;vez Est_amp_eacute vez et al 1998 Raoul et al. 2002 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | et al 1998 Raoul et al. 2002 the mechanism of p75 -induced apoptosis in motor neurons involves downstream production of nitric |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | In the present study we found that the p75 apoptotic pathway in motor neurons involved increased ceramide production and |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Hertel 1998 Brann et al. 2002 Bhakar et al. 2003 p75 -induced ceramide generation in motor neurons was mediated by activation |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | A similar p75 -mediated apoptotic pathway was described previously in hippocampal neurons involving |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | -mediated apoptotic pathway was described previously in hippocampal neurons involving nSMase activation increased ceramide generation and subsequent JNK activation (Brann Brann |
| 6881 | MAPK8 | mitogen-activated protein kinase 8 | JNK | 0.6 | hippocampal neurons involving nSMase activation increased ceramide generation and subsequent JNK activation (Brann Brann et al. 2002 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | However in p75 -expressing NIH-3T3 and PC12 cell lines the acid isoform of |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | of SMase has been implicated in ceramide production induced by p75 signaling (Dobrowsky Dobrowsky and Carter 1998 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Thus it seems that p75 is able to activate different SMases depending on the cell |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Interestingly the spinal cord of ALS patients and SOD1 mice exhibit a remarkable increase in ceramides and cholesterol esters |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Therefore NGF signaling through p75 and the subsequent increase in ceramide production |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Therefore NGF signaling through p75 and the subsequent increase in ceramide production may also modulate |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | In motor neurons ceramide generation induced by p75 signaling increased superoxide production by mitochondria as evidenced by oxidation |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | an important source of superoxide in motor neurons exposed to NGF |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | and peroxynitrite scavengers completely prevent motor neuron death induced by NGF through p75 (Pehar Pehar et al. 2004 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | scavengers completely prevent motor neuron death induced by NGF through p75 (Pehar Pehar et al. 2004 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-mediated | 1.2 | (mitoCP) mitoCP supports a role for mitochondrial oxidative damage in NGF-mediated apoptosis |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | prevent mitochondrial oxidative damage and neuronal death induced by NGF/p75 NGF p75 -signaling in vivo |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | mitochondrial oxidative damage and neuronal death induced by NGF/p75 NGF p75 -signaling in vivo |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | It was previously shown that motor neurons overexpressing ALS-linked SOD1 mutations (G37R, G37R G85R or G93A display increased susceptibility to |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas | 0.3 | G37R G85R or G93A display increased susceptibility to activation of Fas apoptotic pathway but not to trophic factor deprivation or excitotoxic |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | We show here that transgenic SOD1 motor neurons also show increased susceptibility to p75 -mediated apoptosis |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | that transgenic SOD1 motor neurons also show increased susceptibility to p75 -mediated apoptosis |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | In contrast to nontransgenic motor neurons SOD1 motor neurons are sensitive to NGF-mediated apoptosis in the absence |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-mediated | 1.2 | to nontransgenic motor neurons SOD1 motor neurons are sensitive to NGF-mediated apoptosis in the absence of exogenous nitric oxide |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Although an external source of nitric oxide is not required NGF-induced apoptosis in SOD1 transgenic motor neurons requires endogenous production of |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | source of nitric oxide is not required NGF-induced apoptosis in SOD1 transgenic motor neurons requires endogenous production of nitric oxide by |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | transgenic motor neurons requires endogenous production of nitric oxide by nNOS because apoptosis is prevented by nNOS inhibitors |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | of nitric oxide by nNOS because apoptosis is prevented by nNOS inhibitors |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | the execution of a similar apoptotic pathway in nontransgenic and SOD1 motor neurons |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | The increased susceptibility of SOD1 motor neurons to NGF-induced apoptosis was not mediated by increased |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | The increased susceptibility of SOD1 motor neurons to NGF-induced apoptosis was not mediated by increased expression of p75 or |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | to NGF-induced apoptosis was not mediated by increased expression of p75 or nNOS mRNA |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | apoptosis was not mediated by increased expression of p75 or nNOS mRNA |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | NOS | 2.7 | nitric oxide production may still result from activation of endogenous NOS enzymatic activity |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas | 0.3 | Nevertheless for other apoptotic stimuli including Fas (Raoul Raoul et al. 2002 and trophic factor deprivation (Est_amp_eacute;vez |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | and trophic factor deprivation (Est_amp_eacute;vez Est_amp_eacute vez et al. 1998 nNOS regulation in motor neurons occurs at the transcriptional level |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-mediated | 1.2 | nitric oxide production was counteracted by endogenous antioxidant defenses and NGF-mediated apoptosis only proceeds in the presence of an exogenous source |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | The expression of mutant SOD1 leads to decreased antioxidant defenses thereby potentiating the detrimental stress |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Together our results suggest a critical modulation of the p75 -apoptotic pathway in motor neurons that is specifically regulated by |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-mediated | 1.2 | NGF-mediated apoptosis will be executed only in the presence of surrounding |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | GCLC | 2.5 | step in GSH biosynthesis and both subunits of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | GCLM | 3.0 | GSH biosynthesis and both subunits of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription factor and |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription factor and member of the Cap'n'Collar/basic-leucine Cap'n'Collar |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Compared with nontransgenic motor neurons SOD1 motor neurons showed reduced Nrf2 mRNA expression which correlated with |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | Compared with nontransgenic motor neurons SOD1 motor neurons showed reduced Nrf2 mRNA expression which correlated with a decreased transcription of GCLC |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | GCLC | 2.5 | Nrf2 mRNA expression which correlated with a decreased transcription of GCLC and GCLM |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | GCLM | 3.0 | expression which correlated with a decreased transcription of GCLC and GCLM |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | A similar reduction in Nrf2 expression was previously observed in a motor neuron-like NSC34 cell |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | a motor neuron-like NSC34 cell line transfected with a mutant SOD1 expression vector and in motor neurons from SOD1-associated familial ALS |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1-associated | 1.7 | a mutant SOD1 expression vector and in motor neurons from SOD1-associated familial ALS cases (Kirby Kirby et al. 2005 |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | This reduction in Nrf2 expression could explain the increased susceptibility of SOD1 motor neurons |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | reduction in Nrf2 expression could explain the increased susceptibility of SOD1 motor neurons not only to NGF but also to Fas-mediated |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | the increased susceptibility of SOD1 motor neurons not only to NGF but also to Fas-mediated apoptosis which also involves ROS and |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | has been established to strongly activate gene expression mediated by Nrf2 and to subsequently increase GSH content by induction of GCL |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | induction of GCL tBHQ causes increased GCL expression only when Nrf2 is present but it does not in Nrf2 knock-out cells |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | only when Nrf2 is present but it does not in Nrf2 knock-out cells (Lee Lee et al. 2003 |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | Accordingly pharmacological activation of Nrf2 by tBHQ treatment completely prevented NGF- and Fas-mediated motor neuron |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF- | 1.2 | Accordingly pharmacological activation of Nrf2 by tBHQ treatment completely prevented NGF- and Fas-mediated motor neuron apoptosis in nontransgenic and SOD1 motor |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | prevented NGF- and Fas-mediated motor neuron apoptosis in nontransgenic and SOD1 motor neurons |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | Thus Nrf2 manipulation may be a target in the prevention of motor |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | of motor neuron death occurring in neuropathological conditions involving either p75 - or Fas-apoptotic signaling |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas-apoptotic | 0.3 | death occurring in neuropathological conditions involving either p75 - or Fas-apoptotic signaling |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | NGF-induced apoptosis in motor neurons involves nSMase activation and triggers cytochrome |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | NGF-induced apoptosis in motor neurons involves nSMase activation and triggers cytochrome c release from mitochondria |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | A Pure motor neuron cultures maintained with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 100 ng/ml) ng ml plus 10 micro M DETA-NONOate |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | SMase inhibitors were added 1 h before NGF and DETA-NONOate |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | represent the SD of trophic factor deprivation (NONE; NONE without GDNF as a control for maximum cell death observed |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | microphotographs showing cytochrome c immunoreactivity in motor neurons maintained with GDNF (control) control or exposed to NGF plus DETA-NONOate (NGF+NO) NGF |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | motor neurons maintained with GDNF (control) control or exposed to NGF plus DETA-NONOate (NGF+NO) NGF NO |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | GDNF (control) control or exposed to NGF plus DETA-NONOate (NGF+NO) NGF NO |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | In the absence of NGF motor neurons showed a punctuate (mitochondrial) mitochondrial labeling of cytochrome |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | labeling of cytochrome c whereas 12 h after treatment with NGF NO motor neurons showed a diffuse cytoplasmic labeling |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | 100 n M GW prevented cytochrome c release induced by NGF NO |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Motor neurons maintained with GDNF (1 1 ng/ml) ng ml were exposed to vehicle (Ctrl), |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | 1 ng/ml) ng ml were exposed to vehicle (Ctrl), Ctrl NGF (100 100 ng/ml), ng ml DETA-NONOate (10 10 micro M |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | NGF increases superoxide production by mitochondria |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | 0.1 micro M mito-HE and after washing were exposed to NGF (100 100 ng/ml) ng ml |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | fluorescence emission of mito-HE ( exc 405 nm immediately after NGF addition ( t = 0 min and 40 min later |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | did not change after 40 min in cultures maintained with GDNF in the absence of NGF (data data not shown |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | min in cultures maintained with GDNF in the absence of NGF (data data not shown |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | The increased mito-HE fluorescence emission induced by NGF was not observed in cultures preincubated for 24 h with |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | cultures preincubated for 24 h with antisense oligonucleotides to downregulate p75 expression or GW4869 (100 100 n M |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Preincubation with missense oligonucleotides did not prevent the effect of NGF |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | B Motor neuron cultures maintained with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 100 ng/ml) ng ml plus DETA-NONOate (10 10 micro |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | ng/ml) ng ml plus DETA-NONOate (10 10 micro M (NGF+NO) NGF NO in the presence of vehicle (white white bar or |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | The dashed lines represent the SD of GDNF |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | mean _amp_#177 SD * p _lt_ 0.05 significantly different from NGF NO |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Motor neurons overexpressing SOD1 show increase susceptibility to NGF-induced apoptosis |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Motor neurons overexpressing SOD1 show increase susceptibility to NGF-induced apoptosis |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | A Motor neurons isolated from SOD1 or nontransgenic (Non-Tg) Non-Tg E15 embryos were maintained in the |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | (Non-Tg) Non-Tg E15 embryos were maintained in the presence of GDNF (1 1 ng/ml) ng ml and exposed to increasing concentrations |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | 1 ng/ml) ng ml and exposed to increasing concentrations of NGF |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | gray bars represent motor neuron survival in cultures exposed to NGF (100 100 ng/ml) ng ml in the presence of DETA-NONOate |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of its respective GDNF condition (mean mean _amp_#177 SD * p _lt_ 0.05 significantly |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | B SOD1 transgenic motor neurons were exposed to NGF in the presence |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | B SOD1 transgenic motor neurons were exposed to NGF in the presence of vehicle GW4869 (100 100 n M |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | The dashed lines represent the SD of GDNF |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | mean _amp_#177 SD * p _lt_ 0.05 significantly different from NGF |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | C Fluorescence microphotographs showing cytochrome c immunoreactivity in SOD1 motor neurons maintained with GDNF and exposed to vehicle (control) |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | showing cytochrome c immunoreactivity in SOD1 motor neurons maintained with GDNF and exposed to vehicle (control) control or NGF (100 100 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | maintained with GDNF and exposed to vehicle (control) control or NGF (100 100 ng/ml) ng ml |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | In the absence of NGF motor neurons showed a punctuate labeling of cytochrome c and |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | labeling of cytochrome c and 12 h after treatment with NGF a diffuse labeling was observed in affected motor neurons |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | the fluorescence emission of mito-HE ( exc 405 nm in SOD1 motor neurons immediately after NGF addition ( t = 0 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | ( exc 405 nm in SOD1 motor neurons immediately after NGF addition ( t = 0 min and 40 min later |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | E SOD1 transgenic motor neurons were exposed to NGF in the presence |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | E SOD1 transgenic motor neurons were exposed to NGF in the presence of vehicle mitoQ (10 10 p M |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | The dashed lines represent the SD of GDNF |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | mean _amp_#177 SD * p _lt_ 0.05 significantly different from NGF |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | F Western blot showing the expression of human mutant SOD1 (hSOD1) hSOD1 in the spinal cord and isolated motor neurons |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | hSOD1 | 1.7 | Western blot showing the expression of human mutant SOD1 (hSOD1) hSOD1 in the spinal cord and isolated motor neurons from transgenic |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Only the endogenous rat SOD1 (rSOD1) rSOD1 was detected in either the spinal cord or |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Reduced antioxidant defenses in SOD1 motor neurons |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | SOD1 and nontransgenic (Non-Tg) Non-Tg motor neuron cultures were maintained with |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | and nontransgenic (Non-Tg) Non-Tg motor neuron cultures were maintained with GDNF (1 1 ng/ml) ng ml for 24 h and the |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | ng ml for 24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | GCLC | 2.5 | ml for 24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR as |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | GCLM | 3.0 | 24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR as described in |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Glutathione levels modulate NGF-induced motor neuron apoptosis |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | 10 n M and 24 h later were exposed to NGF (100 100 ng/ml) ng ml |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Motor neuron survival was determined 48 h after NGF treatment |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | NGF did not affect motor neuron survival in cultures preincubated with |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of GDNF (mean mean _amp_#177 SD *p _lt_ 0.05 significantly different from |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | (mean mean _amp_#177 SD *p _lt_ 0.05 significantly different from GDNF |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | top panel shows monochlorobimane fluorescence emission from cultures maintained with GDNF (1 1 ng/ml) ng ml and treated for 24 h |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | vehicle (control) control tBHQ prevented motor neuron death induced by NGF (100 100 ng/ml) ng ml plus DETA-NONOate (10 10 micro |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | 100 ng/ml) ng ml plus DETA-NONOate (10 10 micro M NGF NO |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of GDNF (mean mean _amp_#177 SD |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | SD of NONE * p _lt_ 0.05 significantly different from GDNF |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | Increased Nrf2 activation prevents SOD1 motor neuron death induced by NGF or |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Increased Nrf2 activation prevents SOD1 motor neuron death induced by NGF or sFasL |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Increased Nrf2 activation prevents SOD1 motor neuron death induced by NGF or sFasL |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | A SOD1 motor neuron cultures maintained with GDNF (1 1 ng/ml) ng |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | A SOD1 motor neuron cultures maintained with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 100 ng/ml) ng ml in the presence of vehicle |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | B SOD1 or nontransgenic (Non-Tg) Non-Tg motor neuron cultures were maintained in |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Non-Tg motor neuron cultures were maintained in the presence of GDNF (1 1 ng/ml) ng ml and exposed to increasing concentrations |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | Data are expressed as percentage of its respective GDNF condition (mean mean _amp_#177 SD * p _lt_ 0.05 significantly |
| 4232 | GDNF | glial cell derived neurotrophic factor | GDNF | 1.2 | mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | Immunofluorescence studies revealed that nSMase activation was followed by cytochrome c release from mitochondria ( |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | In the absence of NGF motor neurons showed a punctate pattern of cytochrome c immunoreactivity |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | NGF (100 100 ng/ml) ng ml or DETA-NONOate (10 10 micro |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | In contrast after 12 h of NGF treatment in the presence of DETA-NONOate ~27% of motor neurons |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | Cytochrome c release induced by NGF in the presence of nitric oxide was prevented by the |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | of nitric oxide was prevented by the addition of the nSMase inhibitor GW4869 ( Fig 1 C indicating that cytochrome c |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-mediated | 1.2 | tested for the potential involvement of mitochondrial ROS production in NGF-mediated motor neuron death |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | NGF (100 100 ng/ml) ng ml treatment induced a 1.7 _amp_#177 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | increase in mito-HE fluorescence emission was prevented by downregulation of p75 expression by antisense treatment or preincubation of motor neurons with |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | by antisense treatment or preincubation of motor neurons with the nSMase inhibitor GW4869 (100 100 n M ( Fig 2 A |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Fig 2 A suggesting that increased production by mitochondria follows p75 and nSMase activation |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | A suggesting that increased production by mitochondria follows p75 and nSMase activation |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Kelso et al. 2001 Dhanasekaran et al. 2005 also blocked NGF-induced motor neuron death ( Fig 2 B strengthening the role |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | B strengthening the role of ROS production by mitochondria in p75 -mediated motor neuron apoptosis |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | In contrast to nontransgenic motor neurons SOD1 -expressing motor neurons were sensitive to NGF-induced apoptosis in the |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | nontransgenic motor neurons SOD1 -expressing motor neurons were sensitive to NGF-induced apoptosis in the absence of the nitric oxide donor DETA-NONOate |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | donor DETA-NONOate even at concentrations of 10 ng/ml ng ml NGF ( Fig 3 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | The expression of SOD1 in transgenic motor neurons under our culture conditions was confirmed |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | and found to be significantly higher than the endogenous rat SOD1 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | 10 micro M which renders nontransgenic motor neurons sensitive to NGF-induced apoptosis did not further decrease the survival of SOD1 -expressing |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | to NGF-induced apoptosis did not further decrease the survival of SOD1 -expressing motor neurons ( Fig 3 A |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | NGF-induced apoptosis in SOD1 -expressing motor neurons was prevented by blocking |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | NGF-induced apoptosis in SOD1 -expressing motor neurons was prevented by blocking antibodies to p75 |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | SOD1 -expressing motor neurons was prevented by blocking antibodies to p75 (93 93 _amp_#177 6% of control |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | The effectiveness of the p75 blocking antibodies to prevent signaling through p75 in motor neuron |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | effectiveness of the p75 blocking antibodies to prevent signaling through p75 in motor neuron cultures has been previously established (Pehar Pehar |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | Moreover p75 -mediated apoptosis in SOD1 motor neurons was prevented by nSMase |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Moreover p75 -mediated apoptosis in SOD1 motor neurons was prevented by nSMase inhibitors ( Fig 3 |
| 11121 | SMPD2 | sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) | nSMase | 1.9 | p75 -mediated apoptosis in SOD1 motor neurons was prevented by nSMase inhibitors ( Fig 3 B and involved mitochondrial production and |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | p M and mitoCP (1 1 n M also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | mitoCP (1 1 n M also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | an exogenous source of nitric oxide is not required for NGF to induce SOD1 motor neuron death N -nitro-L -arginine methyl |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | of nitric oxide is not required for NGF to induce SOD1 motor neuron death N -nitro-L -arginine methyl ester (NAME) NAME |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | NOS | 2.7 | (1 1 m M a general nitric oxide synthase (NOS) NOS inhibitor and 1-(2-trifluoromethylphenyl)imidazole 1- 2-trifluoromethylphenyl imidazole (TRIM) TRIM (10 10 |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | NOS | 2.7 | micro M a specific inhibitor of the neuronal isoform of NOS prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | a specific inhibitor of the neuronal isoform of NOS prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | of the neuronal isoform of NOS prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | These results indicate that the apoptotic pathway induced by NGF in SOD1 motor neurons required endogenous nitric oxide production by |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | results indicate that the apoptotic pathway induced by NGF in SOD1 motor neurons required endogenous nitric oxide production by nNOS activation |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | in SOD1 motor neurons required endogenous nitric oxide production by nNOS activation |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | The increased sensitivity of SOD1 motor neurons to NGF could not be explained by differential |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | The increased sensitivity of SOD1 motor neurons to NGF could not be explained by differential expression of p75 or |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | to NGF could not be explained by differential expression of p75 or nNOS |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | could not be explained by differential expression of p75 or nNOS |
| 11917 | TNFRSF1B | tumor necrosis factor receptor superfamily, member 1B | p75 | 2.1 | No significant difference was observed in p75 and nNOS mRNA expression levels between nontransgenic and SOD1 motor |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | nNOS | 3.7 | No significant difference was observed in p75 and nNOS mRNA expression levels between nontransgenic and SOD1 motor neurons as |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | in p75 and nNOS mRNA expression levels between nontransgenic and SOD1 motor neurons as determined by RT-PCR (data data not shown |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | a ~30% decrease in the expression of the transcription factor Nrf2 was observed in SOD1 motor neurons compared with nontransgenic ones |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | the expression of the transcription factor Nrf2 was observed in SOD1 motor neurons compared with nontransgenic ones ( Fig 4 |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | The decrease in Nrf2 expression correlated with a decrease in the expression of Nrf2 |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | Nrf2 expression correlated with a decrease in the expression of Nrf2 regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | GCLC | 2.5 | regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) GSH |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | GCLM | 3.0 | including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) GSH biosynthesis ( |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | GCL | 0.2 | Nrf2 regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | n M increased the sensitivity of nontransgenic motor neurons to NGF ( Fig 5 A |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Nontransgenic motor neurons previously exposed to BSO were sensitive to NGF-induced apoptosis even in the absence of DETA-NONOate ( Fig 5 |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | In contrast tBHQ treatment a well known Nrf2 activator in neurons (Johnson Johnson et al. 2002 completely prevented |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF | 1.2 | et al. 2002 completely prevented motor neuron death induced by NGF in the presence of NO ( Fig 5 B |
| 7782 | NFE2L2 | nuclear factor (erythroid-derived 2)-like 2 | Nrf2 | 3.1 | Nrf2 activation by tBHQ also prevented NGF-induced apoptosis in SOD1 motor |
| 7808 | NGF | nerve growth factor (beta polypeptide) | NGF-induced | 1.2 | Nrf2 activation by tBHQ also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 6 A |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Nrf2 activation by tBHQ also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 6 A |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas | 0.3 | we analyzed the effect of tBHQ on apoptosis induced by Fas ligand in SOD1 -expressing motor neurons |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | effect of tBHQ on apoptosis induced by Fas ligand in SOD1 -expressing motor neurons |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | Rat SOD1 motor neurons also displayed increased sensitivity to Fas-mediated apoptosis ( |
| 11920 | FAS | Fas (TNF receptor superfamily, member 6) | Fas | 0.3 | The soluble extracellular domain of Fas ligand (sFasL) sFasL in the presence of an enhancer antibody |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 1.7 | of motor neuron survival induced by sFasL was higher in SOD1 cultures than in nontransgenic reaching a plateau at concentrations >0.5 |
| 1033 | BDNF | brain-derived neurotrophic factor | neurotrophin | 1.0 | nerve growth factor ngf can induce apoptosis by signaling through the p75 neurotrophin receptor p75 in several nerve cell populations. |
| 7808 | NGF | nerve growth factor (beta polypeptide) | nerve growth factor | 1.0 | nerve growth factor ngf can induce apoptosis by signaling through the p75 neurotrophin receptor p75 in several nerve cell populations. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | in the present study we show that p75 mediated apoptosis in motor neurons involved neutral sphingomyelinase activation increased mitochondrial superoxide production and cytochrome c release to the cytosol. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase 1 | 1.0 | in motor neurons overexpressing the amyotrophic lateral sclerosis als linked superoxide dismutase 1 sod1 mutation ngf induced apoptosis even in the absence of an external source of no. |
| 6782 | MAFK | v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) | nuclear factor erythroid 2 | 1.0 | the increased susceptibility of sod1 motor neurons to ngf was associated to decreased nuclear factor erythroid 2 related factor 2 nrf2 expression and downregulation of the enzymes involved in glutathione biosynthesis. |
| 7808 | NGF | nerve growth factor (beta polypeptide) | nerve growth factor | 1.0 | key words: amyotrophic lateral sclerosis; mitochondria; motor neurons; nerve growth factor; nrf2; p75 ; superoxide |
| 7808 | NGF | nerve growth factor (beta polypeptide) | nerve growth factor | 1.0 | nerve growth factor ngf has a key role on the development and function of the nervous system snider 1994 ; chao 2003 . |
| 1033 | BDNF | brain-derived neurotrophic factor | neurotrophin | 1.0 | ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 |
| 8031 | NTRK1 | neurotrophic tyrosine kinase, receptor, type 1 | tyrosine kinase receptor | 1.0 | ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barr |
| 11919 | CD40 | CD40 molecule, TNF receptor superfamily member 5 | tumor necrosis factor receptor superfamily | 1.0 | ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 . |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | induction of p75 renders motor neurons vulnerable to ngf induced apoptosis. p75 has been implicated in motor neuron death occurring in transgenic mice overexpressing mutant cu zn superoxide dismutase sod1 lowry et al. 2001b ; copray et al. 2003 ; kust et al. 2003 ; turner et al. 2003a b or after axotomy ferri et al. 1998 ; wiese et al. 1999 ; lowry et al. 2001a . |
| 6782 | MAFK | v-maf musculoaponeurotic fibrosarcoma oncogene homolog K (avian) | nuclear factor erythroid 2 | 1.0 | astrocytes can protect motor neurons against p75 induced apoptosis by the activation of the transcription factor nuclear factor erythroid 2 related factor 2 nrf2 which increases antioxidant defenses vargas et al. 2006 . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | the death pathway is not completely elucidated but is associated with activation of c jun n terminal kinase jnk release of cytochrome c from mitochondria and subsequent activation of caspases 9 6 and 3 casaccia bonnefil et al. 1996 ; yoon et al. 1998 ; wang et al. 2001 ; bhakar et al. 2003 . |
| 6204 | JUN | jun oncogene | c jun | 1.0 | the death pathway is not completely elucidated but is associated with activation of c jun n terminal kinase jnk release of cytochrome c from mitochondria and subsequent activation of caspases 9 6 and 3 casaccia bonnefil et al. 1996 ; yoon et al. 1998 ; wang et al. 2001 ; bhakar et al. 200 |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | ceramide could be a mediator of apoptosis by acting directly or indirectly on mitochondria where it can dissipate the membrane potential promote cytochrome c release and induce reactive oxygen species ros production garcia ruiz et al. 1997 ; gudz et al. 1997 ; quillet mary et al. 1997 ; mansat de mas et al. 1999 ; birbes et al. 2002 . |
| 8023 | NTF3 | neurotrophin 3 | ngf 2 | 1.0 | mouse ngf 2.5s was obtained from harlan madison wi recombinant human soluble fas ligand and tert butylhydroquinone tbhq from alexis san diego ca and primers from integrated dna technologies coralville ia . |
| 11936 | FASLG | Fas ligand (TNF superfamily, member 6) | fas ligand | 1.0 | mouse ngf 2.5s was obtained from harlan madison wi recombinant human soluble fas ligand and tert butylhydroquinone tbhq from alexis san diego ca and primers from integrated dna technologies coralville ia . |
| 4232 | GDNF | glial cell derived neurotrophic factor | glial cell line derived neurotrophic factor | 1.0 | motor neuron survival was maintained by the addition of glial cell line derived neurotrophic factor gdnf 1 ng/ml; sigma to the culture media. |
| 11936 | FASLG | Fas ligand (TNF superfamily, member 6) | fas ligand | 1.0 | soluble fas ligand was added in the presence of enhancer antibody 1 microg/ml 16 h after motor neuron plating. |
| 7872 | NOS1 | nitric oxide synthase 1 (neuronal) | neuronal nitric oxide synthase | 1.0 | gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaagatcctgaccgagcgtg 3' and 5' tctgctggaaggtggacagtgagg 3' 497 bp . p75 primers were from promega madison wi . |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | glutamate cysteine ligase | 1.0 | pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcc |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | glutamate cysteine ligase | 1.0 | modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | glutamate cysteine ligase catalytic subunit | 1.0 | f2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaag |
| 4312 | GCLM | glutamate-cysteine ligase, modifier subunit | glutamate cysteine ligase modifier subunit | 1.0 | pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | after 12 h cultures were fixed as described above and processed for cytochrome c immunolabeling using alexa fluor 488 cytochrome c apoptosis detection kit from invitrogen. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | in the present study we found that the p75 apoptotic pathway in motor neurons involved increased ceramide production and cytochrome c release into the cytosol as observed in other cell types casaccia bonnefil et al. 1996 ; kuner and hertel 1998 ; brann et al. 2002 ; bhakar et al. 2003 . p75 induced ceramide generation in motor neur |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | it is noteworthy that the increased superoxide production by mitochondria does not require nitric oxide whereas cytochrome c release does require the presence of an external source of nitric oxide such as the addition of deta nonoate. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | these results suggest that peroxynitrite a strong oxidant formed from the reaction of superoxide and nitric oxide disrupts mitochondrial function to promote cytochrome c release beckman and koppenol 1996 ; radi et al. 2002 . |
| 4624 | GSS | glutathione synthetase | glutathione synthetase | 1.0 | gsh is synthesized by the consecutive action of the enzymes gcl and glutathione synthetase. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | ngf induced apoptosis in motor neurons involves nsmase activation and triggers cytochrome c release from mitochondria. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | b fluorescence microphotographs showing cytochrome c immunoreactivity in motor neurons maintained with gdnf control or exposed to ngf plus deta nonoate ngf+no . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | in the absence of ngf motor neurons showed a punctuate mitochondrial labeling of cytochrome c whereas 12 h after treatment with ngf+no motor neurons showed a diffuse cytoplasmic labeling. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | c gw4869 100 n m ; gw prevented cytochrome c release induced by ngf+no. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | gw alone did not affect cytochrome c labeling data not shown . * p _lt_ 0.05 significantly different from control. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | c fluorescence microphotographs showing cytochrome c immunoreactivity in sod1 motor neurons maintained with gdnf and exposed to vehicle control or ngf 100 ng/ml . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | in the absence of ngf motor neurons showed a punctuate labeling of cytochrome c and 12 h after treatment with ngf a diffuse labeling was observed in affected motor neurons. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | immunofluorescence studies revealed that nsmase activation was followed by cytochrome c release from mitochondria fig 1 b . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | in the absence of ngf motor neurons showed a punctate pattern of cytochrome c immunoreactivity indicative of mitochondrial localization. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | ngf 100 ng/ml or deta nonoate 10 micro m treatment alone did not affect cytochrome c localization fig 1 c . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | in contrast after 12 h of ngf treatment in the presence of deta nonoate ~27% of motor neurons displayed a diffuse pattern of cytochrome c immunoreactivity indicating release into the cytoplasm fig 1 b c . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | cytochrome c release induced by ngf in the presence of nitric oxide was prevented by the addition of the nsmase inhibitor gw4869 fig 1 c indicating that cytochrome c release required ceramide production. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | moreover p75 mediated apoptosis in sod1 motor neurons was prevented by nsmase inhibitors fig 3 b and involved mitochondrial production and cytochrome c release fig 3 c d . |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | nitric oxide synthase | 1.0 | although an exogenous source of nitric oxide is not required for ngf to induce sod1 motor neuron death n nitro l arginine methyl ester name 1 m m a general nitric oxide synthase nos inhibitor and 1 2 trifluoromethylphenyl imidazole trim 10 micro m a specific inhibitor of the neuronal isoform of nos prevented ngf induced apoptosis in sod1 motor neurons fig 3 e . |
| 4311 | GCLC | glutamate-cysteine ligase, catalytic subunit | glutamate cysteine ligase | 1.0 | the decrease in nrf2 expression correlated with a decrease in the expression of nrf2 regulated genes including both subunits of glutamate cysteine ligase gcl gclc and gclm the rate limiting enzyme in reduced glutathione gsh biosynthesis fig 4 . |
| 11936 | FASLG | Fas ligand (TNF superfamily, member 6) | fas ligand | 1.0 | to determine whether augmented antioxidant defenses also protect neurons from apoptosis triggered by other death receptors we analyzed the effect of tbhq on apoptosis induced by fas ligand in sod1 expressing motor neurons. |
| 11936 | FASLG | Fas ligand (TNF superfamily, member 6) | fas ligand | 1.0 | the soluble extracellular domain of fas ligand sfasl in the presence of an enhancer antibody significantly reduced the survival of motor neurons in a dose response manner whereas the enhancer antibody alone did not affect neuronal survival data n |
| 7808 | NGF | nerve growth factor (beta polypeptide) | nerve growth factor | 1.0 | enzyme inhibitors|nf e2 related factor 2|nfe2l2 protein rat|nitric oxide donors|nitroso compounds|oligodeoxyribonucleotides antisense|reactive oxygen species|receptor nerve growth factor|2 2'|cytochromes c|nerve growth factor|sod1 g93a protein|superoxide dismutase|sphingomyelin phosphodiesterase| |
| 7808 | NGF | nerve growth factor (beta polypeptide) | nerve growth factor | 1.0 | |2 2'|cytochromes c|nerve growth factor|sod1 g93a protein|superoxide dismutase|sphingomyelin phosphodiesterase| |