HUGO ID Detailed Result 5013

HUGO ID 5013
Symbol HMOX1
Name heme oxygenase (decycling) 1
#Occurrence 162
#Paper 7

 

PMID Match String Actual String Score Flanking text Edited by Edit
12614931HO-1HO-13.4Expression of heme oxygenase-1 (HO-1), HO-1 a marker of oxidative stress also increased 
12614931HO-1HO-13.4HO-1 mRNA 
12614931HO-1HO-13.4The heme oxygenase-1 (HO-1) HO-1 mRNA level was measured by Northern Blot analysis as previously 
12614931HO-1HO-13.4marker of oxidative stress we also measured the induction of HO-1 mRNA 
12614931HO-1HO-13.4Exposure to 100 _amp_#x3bc M EA promptly increased HO-1 mRNA with a massive rise 3 h after treatment (respectively 
12614931HO-1HO-13.4GSH depletion by EA induced expression of HO-1 which has been reported to be protective in different models 
12614931HO-1HO-13.4The end products of HO-1 enzymatic activity potentially act as antioxidants 45 and can thus 
12614931HO-1HO-13.4However the role of HO-1 in our model requires further investigation since proapoptotic signals prevailed 
12614931HO-1HO-13.4Interestingly increased immunoreactivity for HO-1 and p38MAPK were detected in human and mouse ALS 47 
12614931HO-1HO-13.4The heme oxygenase-1 (HO-1) HO-1 mRNA signal is shown 
12663085HO-1HO-11.0AGE coexisted with hemeoxygenase-1 (HO-1) HO-1 on neurofibrillary tangles 119 
12663085HO-1HO-11.0Since HO-1 is induced under oxidative stress it was speculated that reactive 
12663085HO-1HO-11.0by tau modified with AGE leading to the induction of HO-1 
15896810HO-1HO-12.9various HSPs HSP32 also known as heme oxygenase I (HO-1), HO-1 has received considerable attention as it has been recently demonstrated 
15896810HO-1HO-12.9received considerable attention as it has been recently demonstrated that HO-1 induction by generating the vasoactive molecule carbon monoxide and the 
15896810HO-1HO-12.9the known HSPs include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or HSP72 HSP90 and HSP100/105 
15896810HO-1HO-12.9There are three isoforms of heme oxygenase HO-1 or inducible isoform HO-2 or constitutive isoform and the recently 
15896810HO-1HO-12.9The iron released by HO-1 is bound by ferritin perhaps via a HO-1 chaperone function 
15896810HO-1HO-12.9released by HO-1 is bound by ferritin perhaps via a HO-1 chaperone function 155 
15896810HO-1HO-12.9Increasing evidence suggests that the HO-1 gene is redox regulated and contains in its promoter region 
15896810HO-1HO-12.9Significant increases in the levels of HO-1 have been observed in AD brains in association with neurofibrillary 
15896810HO-1HO-12.9in AD brains in association with neurofibrillary tangles 157 and HO-1 mRNA was found to be increased in AD neocortex and 
15896810HO-1HO-12.9HO-1 increase was not only in association with neurofibrillary tangles but 
15896810HO-1HO-12.9It is conceivable that the dramatic increase in HO-1 in AD may be a direct response to increased free 
15896810HO-1HO-12.9evidence has demonstrated that curcumin is a potent inducer of HO-1 in vascular endothelial cells 7 and 167 
15896810HO-1HO-12.9(CAPE), CAPE an active component of propolis as a novel HO-1 inducer 162 
17150307HO-1HO-11.0enhanced oxidative stress markers AP-1 transcriptional activation c-Jun c-Fos and HO-1 expression in NSC34 cells analyzed by a luciferase reporter western 
17150307HO-1HO-11.0The forward and reverse real-time PCR primers for amplification of HO-1 transcripts were 5_amp_#x02019 -CTCACTGGCAGGAAATCATCCC -3_amp_#x02019 and 5_amp_#x02019 -GAGAGGTCACCCAGGTAGCG respectively 
17150307HO-1HO-11.0Similarly GSH depletion also increased HO-1 expression as detected by quantitative real-time PCR reaction and western 
17150307HO-1HO-11.0( Figure 3 and secondary oxidative stress markers such as HO-1 expression ( Figure 4 
17191135HO-1HO-16.5Heme oxygenase-1 (HO-1), HO-1 also referred to as Hsp32 belongs to the Hsps family 
17191135HO-1HO-16.51 ( A Cellular stress response and the interplay between HO-1 and TRXr 
17191135HO-1HO-16.5antioxidant responsive element (ARE) ARE in the HO gene up-regulates HO-1 and TRXr thus counteracting nitrosative stress and NO-mediated neurotoxicity 
17191135HO-1HO-16.5OxS oxidative stress HO-1 heme oxygenase TRXr thioredoxin reductase 
17191135HO-1HO-16.5( B Regulation of HO-1 gene 
17191135HO-1HO-16.5of several genes related to the cellular stress response including HO-1 
17191135HO-1HO-16.5nucleus binds to antioxidant responsive elements (AREs), AREs and activates HO-1 gene This review will emphasize the role of free radicals 
17191135HO-1HO-16.5role played by members of the vitagene system such as HO-1 and Thioredoxin (Fig Fig 1 A in modulating the onset 
17191135HO-1HO-16.5the following findings (a) a NO and NO-related species induce HO-1 expression and increase heme oxygenase activity in human glioblastoma cells 
17191135HO-1HO-16.5and RNS can be directly involved in the modulation of HO-1 expression in eukaryotes is based on the evidence that different 
17191135HO-1HO-16.5on the evidence that different NO-releasing agents can markedly increase HO-1 and Hsp70 in a variety of tissues including brain cells 
17191135HO-1HO-16.5by enhancement of Hsp70 3 20 whereas the modulation of HO-1 mRNA expression by iNOS-derived NO following stimulation with LPS has 
17191135HO-1HO-16.5to low oxygen tension seems to precede the stimulation of HO-1 expression and activity an effect that appears to be finely 
17191135HO-1HO-16.5molecule which by triggering expression of cytoprotective genes such as HO-1 and Hsp70 may lead to adaptation and resistance of brain 
17191135HO-1HO-16.5sites within the promoter and distal enhancer regions of the HO-1 gene such as Fos/Jun Fos Jun activator protein-1 (AP-1)], AP-1 
17191135HO-1HO-16.5and complex IV inhibition an effect associated with up-regulation of HO-1 and nuclear translocation of the transcription factor Nrf-2 27 
17191135HO-1HO-16.5the known Hsps include ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 
17191135HO-1HO-16.5toxicity by acting at three different levels (i) i inducing HO-1 and Hsp72 proteins (ii) ii decreasing the neuronal 3-nitrotyrosine levels 
17191135HO-1HO-16.5heme oxygenase (HO) HO isoforms were described an inducible isoform HO-1 and a constitutive isoform HO-2 
17191135HO-1HO-16.5from the identity between the active centers of the enzyme HO-1 and HO-2 broadly differ in cell and tissue regulation and 
17191135HO-1HO-16.5Furthermore in cultured human cells HO-1 expression can be repressed by hypoxia or by the treatment 
17191135HO-1HO-16.5Although HO-1 and HO-2 catalyze the same reaction they play different roles 
17191135HO-1HO-16.5The current hypothesis suggests that HO-1 induction is one of the earlier cellular responses to tissue 
17191135HO-1HO-16.5The induction of HO-1 is regulated principally by two upstream enhancers E1 and E2 
17191135HO-1HO-16.5MafK MafF and MafG are directly involved in induction of HO-1 gene through these MAREs 53 
17191135HO-1HO-16.5Hence regulation of HO-1 gene expression by Bach1 and heme occurs through antagonism between 
17191135HO-1HO-16.5Under normal physiological conditions expression of HO-1 is repressed by Bach1/Maf Bach1 Maf complex while increased levels 
17191135HO-1HO-16.5activators (Nrf2), Nrf2 to interact with the transcriptional promotion of HO-1 33 
17191135HO-1HO-16.5the rat brain BVR is co-expressed in cells that display HO-1 and/or and or HO-2 under normal conditions as well as 
17191135HO-1HO-16.5cell types that have the potential to express heat shock-inducible HO-1 protein 57 
17191135HO-1HO-16.5This finding indicates that the activation of HO-1 and the following formation of CO can be induced by 
17191135HO-1HO-16.5also have beneficial effects during oxidative stress by transcriptionally upregulating HO-1 with important cytoprotective pleiotropic effects deriving from heme degradation biliverdin 
17191135HO-1HO-16.5Recently the involvement of HO-1 in the antidegenerative mechanisms operating in AD has received considerable 
17191135HO-1HO-16.5HO-1 induction which occurs together with the induction of other stress 
17191135HO-1HO-16.5Significant increases in the levels of HO-1 have been observed in AD brains in association with neurofibrillary 
17191135HO-1HO-16.5in AD brains in association with neurofibrillary tangles and also HO-1 mRNA was found increased in AD neocortex and cerebral vessels 
17191135HO-1HO-16.5HO-1 increase was not only in association with neurofibrillary tangles but 
17191135HO-1HO-16.5In addition Takeda et al explored the relationship between HO-1 and tau protein this latter being the major component of 
17191135HO-1HO-16.5In transfected neuroblastoma cells overexpressing HO-1 the activity of this enzyme was increased and conversely the 
17191135HO-1HO-16.5of tau protein was significantly decreased when compared with antisense HO-1 or vector transfected cells 93 
17191135HO-1HO-16.5(extracellular extracellular signal-regulated kinases were also decreased in cells overexpressing HO-1 although no changes in the expression of total ERKs were 
17191135HO-1HO-16.5AD patients of a significant increase in the expression of HO-1 and TRXr whereas this latter was not increased in the 
17191135HO-1HO-16.5lymphocytes showed an increased expression of inducible nitric oxide synthase HO-1 Hsp72 Hsp60 and TrxR 96 
17191135HO-1HO-16.5The protective role played by HO-1 in AD in fact raises new possibilities regarding the use 
17191135HO-1HO-16.5the use of natural substances which are able to increase HO-1 levels as potential drugs for the treatment of AD 
17191135HO-1HO-16.5In addition curcumin has been shown to significantly increase HO-1 in astrocytes and vascular endothelial cells 100 101 
17191135HO-1HO-16.5This latter effect on HO-1 can explain at least in part the strong antioxidant properties 
17191135HO-1HO-16.5modulate ARE-mediated expression of stress-inducible genes 107 -124 such as HO-1 G-glutamylcysteine synthetase Mn-SOD and glutathione S-transferase 
17191135HO-1HO-16.5phenolic compounds such as curcumin and ferulic acid can induce HO-1 and TRXr and thus reduce AD strongly indicates the therapeutic 
10643818heme oxygenase 1heme oxygenase 11.0two markers of oxidative stress in the central nervous system expression of heme oxygenase 1 and nuclear localization of nf kb p50 [ 13 ] are intimately associated with the outlined pathway because heme oxygenase 1 may activate cgmp kinase [ 7 ] while the nf kb proteins p50 and p49 are substrates for this enzyme weber unpublished results .  
11978481heme oxygenase 1heme oxygenase 11.0other evidence for oxidative damage to proteins in pd is increased expression of neural heme oxygenase 1 and increased immunostaining of glycosylated proteins [ 55 and 56 ].  
12614931ho 1ho 11.0expression of heme oxygenase 1 ho 1 a marker of oxidative stress also increased.  
12614931heme oxygenase 1heme oxygenase 11.0expression of heme oxygenase 1 ho 1 a marker of oxidative stress also increased.  
12614931ho 1ho 11.0ho 1 mrna  
12614931ho 1ho 11.0the heme oxygenase 1 ho 1 mrna level was measured by northern blot analysis as previously described [ 21 ] using total cellular rna 5 _amp_#x3bc;g from control or ea treated nsc 34 cells about 2.5_amp_#xd7;10 6 cells .  
12614931heme oxygenase 1heme oxygenase 11.0the heme oxygenase 1 ho 1 mrna level was measured by northern blot analysis as previously described [ 21 ] using total cellular rna 5 _amp_#x3bc;g from control or ea treated nsc 34 cells about 2.5_amp_#xd7;10 6 cells .  
12614931ho 1ho 11.0as a marker of oxidative stress we also measured the induction of ho 1 mrna.  
12614931ho 1ho 11.0exposure to 100 _amp_#x3bc;m ea promptly increased ho 1 mrna with a massive rise 3 h after treatment respectively 1.6 12 and 16 times the control level after 1 2 and 3 h of treatment; fig 5 .  
12614931ho 1ho 11.0gsh depletion by ea induced expression of ho 1 which has been reported to be protective in different models of oxidative stress induced neuronal injury [ 43 and 44 ].  
12614931ho 1ho 11.0the end products of ho 1 enzymatic activity potentially act as antioxidants [ 45 ] and can thus exert anti apoptotic effects with co acting in a dominant manner as an anti apoptotic messenger possibly through activation of t 
12614931ho 1ho 11.0however the role of ho 1 in our model requires further investigation since proapoptotic signals prevailed.  
12614931ho 1ho 11.0interestingly increased immunoreactivity for ho 1 and p38mapk were detected in human and mouse als [ 47 48 and 49 ].  
12614931heme oxygenase 1heme oxygenase 11.0effect of ethacrynic acid on heme oxygenase 1 expression in nsc 34 cells.  
12614931ho 1ho 11.0the heme oxygenase 1 ho 1 mrna signal is shown.  
12614931heme oxygenase 1heme oxygenase 11.0the heme oxygenase 1 ho 1 mrna signal is shown.  
12663085ho 1ho 11.0age coexisted with hemeoxygenase 1 ho 1 on neurofibrillary tangles [ 119 ].  
12663085ho 1ho 11.0since ho 1 is induced under oxidative stress it was speculated that reactive oxygen species were produced by tau modified with age leading to the induction of ho 1.  
15896810ho 1ho 11.0among the various hsps hsp32 also known as heme oxygenase i ho 1 has received considerable attention as it has been recently demonstrated that ho 1 induction by generating the vasoactive molecule carbon monoxide and the potent antioxidant bilirubin could represent a protective system potentially active against brain oxidative injury.  
15896810ho 1ho 11.0some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105.  
15896810ho 1ho 11.0there are three isoforms of heme oxygenase: ho 1 or inducible isoform ho 2 or constitutive isoform and the recently discovered ho 3 [149] [150] [151] [152] [153] and [154] .  
15896810ho 1ho 11.0the iron released by ho 1 is bound by ferritin perhaps via a ho 1 chaperone function [155] .  
15896810ho 1ho 11.0increasing evidence suggests that the ho 1 gene is redox regulated and contains in its promoter region the antioxidant responsive element are similar to other antioxidant enzymes.  
15896810ho 1ho 11.0significant increases in the levels of ho 1 have been observed in ad brains in association with neurofibrillary tangles [157] and ho 1 mrna was found to be increased in ad neocortex and cerebral vessels [158] .  
15896810ho 1ho 11.0ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [153] .  
15896810ho 1ho 11.0it is conceivable that the dramatic increase in ho 1 in ad may be a direct response to increased free heme associated with neurodegeneration and an attempt to convert the highly damaging heme into the antioxidants biliverdin and bilirubin.  
15896810heme oxygenase 1heme oxygenase 11.0heme oxygenase 1 is rapidly upregulated by oxidative and nitrosative stresses as well as by glutathione depletion.  
15896810ho 1ho 11.0remarkably recent evidence has demonstrated that curcumin is a potent inducer of ho 1 in vascular endothelial cells [7] and [167] .  
15896810ho 1ho 11.0we have also recently demonstrated in astroglial cells the role of caffeic acid phenylethyl ester cape an active component of propolis as a novel ho 1 inducer [162] .  
17150307ho 1ho 11.0in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively.  
17150307ho 1ho 11.0the forward and reverse real time pcr primers for amplification of ho 1 transcripts were 5_amp_#x02019; ctcactggcaggaaatcatccc 3_amp_#x02019; and 5_amp_#x02019; gagaggtcacccaggtagcg respectively.  
17150307ho 1ho 11.0similarly gsh depletion also increased ho 1 expression as detected by quantitative real time pcr reaction and western blotting analyses respectively figure 4 .  
17150307ho 1ho 11.0in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 .  
17191135heme oxygenase 1heme oxygenase 11.0heme oxygenase 1 an inducible and redox regulated enzyme has having an important role in cellular antioxidant defense.  
17191135ho 1ho 11.0heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin.  
17191135heme oxygenase 1heme oxygenase 11.0heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin.  
17191135ho 1ho 11.0fig. 1 a cellular stress response and the interplay between ho 1 and trxr.  
17191135ho 1ho 11.0acetylcarnitine through activation via acetylation of the redox sensitive transcription factor nrf2 and its consequent binding to the antioxidant responsive element are in the ho gene up regulates ho 1 and trxr thus counteracting nitrosative stress and no mediated neurotoxicity.  
17191135ho 1ho 11.0oxs oxidative stress; ho 1 heme oxygenase; trxr thioredoxin reductase.  
17191135ho 1ho 11.0 b regulation of ho 1 gene.  
17191135ho 1ho 11.0nuclear factor erythroid 2 related factor 2 nrf2 is a transcription factor responsible for the induction of several genes related to the cellular stress response including ho 1.  
17191135ho 1ho 11.0like ech associating protein 1 keap1 but upon exposure of cells to oxidative stress nrf2 dissociates from keap1 translocates to the nucleus binds to antioxidant responsive elements ares and activates ho 1 gene this review will emphasize the role of free radicals in the pathogenesis of neurodegenerative disorders.  
17191135ho 1ho 11.0in addition the key role played by members of the vitagene system such as ho 1 and thioredoxin fig 1 a in modulating the onset and progression of major neurodegenerative diseases such as ad and pd are discussed.  
17191135ho 1ho 11.0hat the antioxidant protein heme oxygenase could _amp_#8220;sense_amp_#8221; no and thus protect against ros and rns insults is supported by the following findings: a no and no related species induce ho 1 expression and increase heme oxygenase activity in human glioblastoma cells hepatocytes and aortic vascular cells; b cells pre treated with various no releasing molecules acquire increased resistance 
17191135ho 1ho 11.0the conception that no and rns can be directly involved in the modulation of ho 1 expression in eukaryotes is based on the evidence that different no releasing agents can markedly increase ho 1 and hsp70 in a variety of tissues including brain cells [ 19 20 ].  
17191135ho 1ho 11.0ls treatment with lipopolysaccaride lps and interferon g ifn g promotes a rapid increase in both inos expression and nitrite levels followed by enhancement of hsp70 [ 3 20 ] whereas the modulation of ho 1 mrna expression by inos derived no following stimulation with lps has also been reported in different brain regions particularly in the hippocampus and substantia nigra in an in vivo rat model of sep 
17191135ho 1ho 11.0moreover the early increase in inos protein levels observed in endothelial cells exposed to low oxygen tension seems to precede the stimulation of ho 1 expression and activity an effect that appears to be finely regulated by redox reactions involving glutathione [ 18 21 22 ].  
17191135ho 1ho 11.0taken together these findings point to a possible role of the no as a signaling molecule which by triggering expression of cytoprotective genes such as ho 1 and hsp70 may lead to adaptation and resistance of brain cells to subsequent more severe nitrosative and oxidative stress [ 21 23 ].  
17191135ho 1ho 11.0consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or ni 
17191135ho 1ho 11.0acetylcarnitine treatment of astrocytes exposed to cytokine induced nitrosative stress restores gsh/gssg ratio and complex iv inhibition an effect associated with up regulation of ho 1 and nuclear translocation of the transcription factor nrf 2 [ 27 ].  
17191135ho 1ho 11.0some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105.  
17191135ho 1ho 11.0in these conditions exogenous antioxidant treatment with ferulic acid ethyl ester faee afforded protection of cortical neurons from b amyloid toxicity by acting at three different levels: i inducing ho 1 and hsp72 proteins ii decreasing the neuronal 3 nitrotyrosine levels and therefore inducible nos activity; and iii by the well known direct free radical quenching activity [ 38 ] fig 1 a .  
17191135ho 1ho 11.0heme oxygenase system until 1997 two heme oxygenase ho isoforms were described: an inducible isoform ho 1 and a constitutive isoform ho 2.  
17191135ho 1ho 11.0apart from the identity between the active centers of the enzyme ho 1 and ho 2 broadly differ in cell and tissue regulation and distribution.  
17191135heme oxygenase 1heme oxygenase 11.0heme oxygenase 1 is induced by various stimuli including ros rns ischemia heat shock lps hemin and the neuroprotective agent neotrofin [ 41 44 46 ].  
17191135ho 1ho 11.0furthermore in cultured human cells ho 1 expression can be repressed by hypoxia or by the treatment with interferon g or desferrioxamine [ 47 ].  
17191135ho 1ho 11.0although ho 1 and ho 2 catalyze the same reaction they play different roles in protecting tissues against injuries.  
17191135ho 1ho 11.0the current hypothesis suggests that ho 1 induction is one of the earlier cellular responses to tissue damage and is responsible for the rapid transformation of the pro oxidant heme into carbon monoxide co and bilirubin br two molecules with 
17191135ho 1ho 11.0the induction of ho 1 is regulated principally by two upstream enhancers e1 and e2 [ 52 ].  
17191135ho 1ho 11.0there is now evidence to suggest that heterodimers of nf e2 related factors 2 nrf2 and one or another of the small maf proteins i.e mafk maff and mafg are directly involved in induction of ho 1 gene through these mares [ 53 ].  
17191135ho 1ho 11.0hence regulation of ho 1 gene expression by bach1 and heme occurs through antagonism between transcription activators and the repressor bach1.  
17191135ho 1ho 11.0under normal physiological conditions expression of ho 1 is repressed by bach1/maf complex while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with  
17191135ho 1ho 11.0x while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with the transcriptional promotion of ho 1 [ 33 ].  
17191135ho 1ho 11.0in the rat brain bvr is co expressed in cells that display ho 1 and/or ho 2 under normal conditions as well as in regions and cell types that have the potential to express heat shock inducible ho 1 protein [ 57 ].  
17191135heme oxygenase 1heme oxygenase 11.0heme oxygenase 1 is ubiquitary and particularly abundant in reticuloendothelial organs such as liver and spleen whereas ho 2 is localized in specific organs such as brain kidney and testis [ 44 ].  
17191135ho 1ho 11.0this finding indicates that the activation of ho 1 and the following formation of co can be induced by many noxious stimuli within the nuclei that are primarily involved in the central regulation of the stress response.  
17191135heme oxygenase 1heme oxygenase 11.0heme oxygenase 1 is also found within cells of glial lineage where its gene expression can be induced by oxidative stress [ 58 ].  
17191135ho 1ho 11.0 that beyond its ability to regulate the function of proteins through thiol disulfide exchange reactions trx may also have beneficial effects during oxidative stress by transcriptionally upregulating ho 1 with important cytoprotective pleiotropic effects deriving from heme degradation biliverdin and bilirubin formation as well as carbon monoxide generation [ 76 ].  
17191135ho 1ho 11.0recently the involvement of ho 1 in the antidegenerative mechanisms operating in ad has received considerable attention as it has been demonstrated that the amyloid precursor protein app decreases ho activity thus reducing the intra 
17191135ho 1ho 11.0ho 1 induction which occurs together with the induction of other stress proteins during various physiopathological conditions represents a strong protective system potentially active against brain oxidati 
17191135ho 1ho 11.0significant increases in the levels of ho 1 have been observed in ad brains in association with neurofibrillary tangles and also ho 1 mrna was found increased in ad neocortex and cerebral vessels [ 92 93 ].  
17191135ho 1ho 11.0ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [ 94 ].  
17191135ho 1ho 11.0in addition takeda et al. explored the relationship between ho 1 and tau protein this latter being the major component of intraneuronal neurofibrillary tangles in ad [ 93 ].  
17191135ho 1ho 11.0in transfected neuroblastoma cells overexpressing ho 1 the activity of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense ho 1 or vector transfected cells [ 93 ].  
17191135ho 1ho 11.0the activated forms of erks extracellular signal regulated kinases were also decreased in cells overexpressing ho 1 although no changes in the expression of total erks were observed [ 93 ].  
17191135ho 1ho 11.0consistently recent data from our laboratory has provided clear evidence in the inferior parietal brain of ad patients of a significant increase in the expression of ho 1 and trxr whereas this latter was not increased in the cerebellum of ad brains compared to controls [ 96 ].  
17191135ho 1ho 11.0in addition ad lymphocytes showed an increased expression of inducible nitric oxide synthase ho 1 hsp72 hsp60 and trxr [ 96 ].  
17191135ho 1ho 11.0the protective role played by ho 1 in ad in fact raises new possibilities regarding the use of natural substances which are able to increase ho 1 levels as potential drugs for the treatment of ad.  
17191135ho 1ho 11.0in addition curcumin has been shown to significantly increase ho 1 in astrocytes and vascular endothelial cells [ 100 101 ].  
17191135ho 1ho 11.0this latter effect on ho 1 can explain at least in part the strong antioxidant properties of curcumin in particular keeping in mind that ho 1 derived br has the ability to efficiently scavenge both ros and rns [ 8 11 13 99 ].  
17191135heme oxygenase 1heme oxygenase 11.0these results have shown for the first time that acetylcarnitine induces heme oxygenase 1 and hsp60 heat shock proteins with a mechanism involving activation and nuclear translocation of the transcription factor nrf2 [ 27 ].  
17191135ho 1ho 11.0 is conceivable that acetylcarnitine alone in unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase.  
17191135ho 1ho 11.0the evidence that phenolic compounds such as curcumin and ferulic acid can induce ho 1 and trxr and thus reduce ad strongly indicates the therapeutic potential of nutritional compounds against nd.