)| PMID |
17150307 ( ) |
|---|---|
| Title | Depletion of reduced glutathione enhances motor neuron degeneration in vitro and in vivo. |
| Abstract | The mechanism of selective and age-dependent motor neuron degeneration in human amyotrophic lateral sclerosis (ALS) has not been defined and the role of glutathione (GSH) in association with motor neuron death remains largely unknown. A motor neuron-like cell culture system and a transgenic mouse model were used to study the effect of cellular GSH alteration on motor neuron cell death. Exposure of NSC34 motor neuron-like cells to ethacrynic acid (EA) or l-buthionine sulfoximine (BSO) dramatically reduced the cellular GSH levels, and was accompanied by increased production of reactive oxygen species (ROS) measured by the dichlorofluorescin (DCF) fluorescent oxidation assay. In addition, GSH depletion enhanced oxidative stress markers, AP-1 transcriptional activation, c-Jun, c-Fos and heme oxygenase-1 (HO-1) expression in NSC34 cells analyzed by a luciferase reporter, Western blotting and quantitative PCR assays respectively. Furthermore, depletion of GSH decreased mitochondrial function, facilitated apoptosis inducing factor (AIF) translocation, cytochrome c release, and caspase 3 activation, and consequently led to motor neuron-like cell apoptosis. In an ALS-like transgenic mouse model overexpressing mutant G93A-Cu, Zn-superoxide dismutase (SOD1) gene, we showed that the reduction of GSH in the spinal cord and motor neuron cells is correlated with AIF translocation, caspase 3 activation, and motor neuron degeneration during ALS-like disease onset and progression. Taken together, the in vitro and in vivo data presented in the current report demonstrated that decreased GSH promotes multiple apoptotic pathways contributing, at least partially, to motor neuron degeneration in ALS. of Medicine, 501 North Columbia Road, Grand Forks, ND 58202, USA. |
NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.
Targets by SciMiner Summary
| HUGO ID | Symbol | Target Name | #Occur | ActualStr |
|---|---|---|---|---|
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | 21 | apoptosis inducing factor | AIF | |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | 9 | caspase 3 | |
| 19986 | CYCS | cytochrome c, somatic | 9 | cytochrome c | |
| 6204 | JUN | jun oncogene | 9 | AP-1 | c jun | c-Jun | |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | 8 | HO-1 | ho 1 | |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | 7 | SOD1 | SOD1-mediated | SOD | superoxide dismutase | |
| 3796 | FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | 6 | ap 1 | c fos | |
| 4624 | GSS | glutathione synthetase | 2 | glutathione synthetase | gsh synthetase | |
| 1516 | CAT | catalase | 1 | catalase | |
| 25806 | GSTCD | glutathione S-transferase, C-terminal domain containing | 1 | glutathione s transferase | |
| 4638 | GSTP1 | glutathione S-transferase pi | 1 | glutathione s transferase pi | |
| 2197 | COL1A1 | collagen, type I, alpha 1 | 1 | collagen | |
Targets by SciMiner Full list
| HUGO ID | Symbol | Name | ActualStr | Score | FlankingText |
|---|---|---|---|---|---|
| 6204 | JUN | jun oncogene | AP-1 | 2.8 | In addition GSH depletion enhanced oxidative stress markers AP-1 transcriptional activation c-Jun c-Fos and HO-1 expression in NSC34 cells |
| 6204 | JUN | jun oncogene | c-Jun | 2.8 | addition GSH depletion enhanced oxidative stress markers AP-1 transcriptional activation c-Jun c-Fos and HO-1 expression in NSC34 cells analyzed by a |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | HO-1 | 1.0 | enhanced oxidative stress markers AP-1 transcriptional activation c-Jun c-Fos and HO-1 expression in NSC34 cells analyzed by a luciferase reporter western |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | of GSH decreased mitochondrial function facilitated apoptosis inducing factor (AIF) AIF translocation cytochrome c release and caspase 3 activation and consequently |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | the spinal cord and motor neuron cells is correlated with AIF translocation caspase 3 activation and motor neuron degeneration during ALS-like |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 3.2 | Mutations of Cu Zn-superoxide dismutase (SOD1) SOD1 gene cause motor neuron degeneration and have linked to 2_amp_#x02013 |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 3.2 | culture model it has been shown that expression of mutant SOD1 gene decreased cellular levels of GSH suggesting the reduction in |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1-mediated | 2.2 | the reduction in GSH bioavailability may participate in the mutant SOD1-mediated motor neuron degeneration ( Lee et al. 2001 |
| 2197 | COL1A1 | collagen, type I, alpha 1 | collagen | 0.3 | Methods Adhesion assay Twenty four-well plates were coated with fibronectin collagen or laminin overnight in 1_amp_#x000d7 phosphate buffer solution (PBS) PBS |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | HO-1 | 1.0 | The forward and reverse real-time PCR primers for amplification of HO-1 transcripts were 5_amp_#x02019 -CTCACTGGCAGGAAATCATCCC -3_amp_#x02019 and 5_amp_#x02019 -GAGAGGTCACCCAGGTAGCG respectively |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | Western analysis was performed to analyze cytochrome c release and AIF translocation |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | incubated with specific antibodies overnight at 4 _amp_#x000b0 C (AIF, AIF cytochrome c and active caspase 3 antibodies were all at |
| 6204 | JUN | jun oncogene | AP-1 | 2.8 | EA treatment enhanced AP-1 transcriptional activation as detected by a luciferase reporter gene assay |
| 6204 | JUN | jun oncogene | c-Jun | 2.8 | detected by a luciferase reporter gene assay ( Figure 3A c-Jun ( Figure 3B and c-Fos expression (data data not shown |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | HO-1 | 1.0 | Similarly GSH depletion also increased HO-1 expression as detected by quantitative real-time PCR reaction and western |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | Results GSH depletion promoted AIF redistribution cytochrome c release caspase 3 activation and apoptotic cell |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | nuclear fractionations coupled with western analysis showed an increase of AIF translocation to nucleus following GSH depletion in NSC34 cells ( |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | Immunohistochemical staining confirmed the increase of AIF translocation to the nucleus from the mitochondria upon GSH depletion |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | Decreased GSH was associated with AIF nuclear translocation caspase 3 activation and motor neuron cell death |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | Reduction in GSH was associated with redistribution of AIF from mitochondria to nuclei 3 |
| 6204 | JUN | jun oncogene | c-Jun | 2.8 | depletion increased the expression of the early oxidative stress markers c-Jun c-Fos (data data not shown and AP-1 activation ( Figure |
| 6204 | JUN | jun oncogene | AP-1 | 2.8 | oxidative stress markers c-Jun c-Fos (data data not shown and AP-1 activation ( Figure 3 and secondary oxidative stress markers such |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | HO-1 | 1.0 | ( Figure 3 and secondary oxidative stress markers such as HO-1 expression ( Figure 4 |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | cell death mechanisms potentially induced by GSH depletion we assessed AIF redistribution and found that there was an increase in AIF |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | AIF redistribution and found that there was an increase in AIF translocation from mitochondria to nuclei upon GSH depletion ( Figure |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | AIF is a flavoprotein residing in mitochondrial intermembrane ( Cande et |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | Translocation of AIF initiates cell apoptosis by cleavage internucleosomal DNA to relative large |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | AIF nuclear translocation has been observed in a variety of cell |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | The AIF redistribution detected in EA treated cells and also observed in |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | coupled with increased oxidative stress by mutant G93A-SOD1 that facilitates AIF nuclear translocation may underlie some of the events linked to |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 2.2 | significantly treatment of ALS-like transgenic mice with antioxidants such as SOD and catalase mimetics ( Jung et al. 2001 DMPO ( |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | Figure 9 Redistribution of AIF and active caspase 3 in motor neuron cells of ALS-like |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | AIF | 0.6 | AIF Apoptosis Inducing Factor ALS Amyotrophic Lateral Sclerosis BSO L-Buthionine Sulfoximine |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD1 | 3.2 | Oxidized Glutathione MBM Monobromobimane PFA Paraformaldehyde ROS Reactive Oxygen Species SOD1 Cu Zn-Superoxide Dismutase TUNEL Terminal Deoxynucleotidyl Transferase-Mediated Nick End Labeling |
| 3796 | FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | ap 1 | 1.0 | in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. |
| 3796 | FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | c fos | 1.0 | in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. |
| 6204 | JUN | jun oncogene | c jun | 1.0 | in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | ho 1 | 1.0 | in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | apoptosis inducing factor | 1.0 | furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | in an als like transgenic mouse model overexpressing mutant g93a sod1 gene we showed that the reduction of gsh in the spinal cord and motor neuron cells is correlated with aif translocation caspase 3 activation and motor neuron degeneration during als like disease onset and progression. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | mutations of cu zn superoxide dismutase sod1 gene cause motor neuron degeneration and have linked to 2_amp_#x02013;5% of als cases rosen et al. 1994 ; rosen et al. 1993 . |
| 4624 | GSS | glutathione synthetase | gsh synthetase | 1.0 | gsh is synthesized in two sequential enzymatic reactions catalyzed by _amp_#x003b3; glutamylcysteine synthetase _amp_#x003b3; gcs and gsh synthetase. |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | ho 1 | 1.0 | the forward and reverse real time pcr primers for amplification of ho 1 transcripts were 5_amp_#x02019; ctcactggcaggaaatcatccc 3_amp_#x02019; and 5_amp_#x02019; gagaggtcacccaggtagcg respectively. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | after protein concentration measurement western blotting was performed to analyze cytochrome c release. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | western analysis was performed to analyze cytochrome c release and aif translocation. |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | after permeabilization with 0.2% triton x 100 in pbs and blocking with 10% goat serum cells were incubated with specific antibodies overnight at 4 _amp_#x000b0;c aif cytochrome c and active caspase 3 antibodies were all at 1:300 dilution; chemicon inc. . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | after permeabilization with 0.2% triton x 100 in pbs and blocking with 10% goat serum cells were incubated with specific antibodies overnight at 4 _amp_#x000b0;c aif cytochrome c and active caspase 3 antibodies were all at 1:300 dilution; chemicon inc. . |
| 3796 | FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | ap 1 | 1.0 | ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. |
| 3796 | FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | c fos | 1.0 | ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. |
| 6204 | JUN | jun oncogene | c jun | 1.0 | ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | ho 1 | 1.0 | similarly gsh depletion also increased ho 1 expression as detected by quantitative real time pcr reaction and western blotting analyses respectively figure 4 . |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | results gsh depletion promoted aif redistribution cytochrome c release caspase 3 activation and apoptotic cell death a biochemical assay and an immunohistochemical analysis were used to identify the molecular pathways of cell apoptosis by gsh depletion. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | results gsh depletion promoted aif redistribution cytochrome c release caspase 3 activation and apoptotic cell death a biochemical assay and an immunohistochemical analysis were used to identify the molecular pathways of cell apoptosis by gsh depletion. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | similarly mitochondrial and cytosolic fractionation coupled with western blotting analysis and immunohistochemistry showed that cytochrome c release was involved in nsc34 cell apoptosis caused by gsh depletion figure 6c 6d . |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | gsh depletion increased caspases 3 activation revealed by immunohistochemical staining with anti active caspase 3 antibody figure 7a_amp_#x02013;7c . |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | decreased gsh was associated with aif nuclear translocation caspase 3 activation and motor neuron cell death figure 9 in als like transgenic mice. |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | cytochrome c mediated caspase 3 activation elicited by gsh reduction also contributed to motor neuron cell death apoptosis . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | cytochrome c mediated caspase 3 activation elicited by gsh reduction also contributed to motor neuron cell death apoptosis . |
| 4624 | GSS | glutathione synthetase | glutathione synthetase | 1.0 | gsh is biosynthesized from l glutamate catalyzed by _amp_#x003b3; gcs and glutathione synthetase gs in the cytosol. |
| 3796 | FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | ap 1 | 1.0 | in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . |
| 3796 | FOS | v-fos FBJ murine osteosarcoma viral oncogene homolog | c fos | 1.0 | in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . |
| 6204 | JUN | jun oncogene | c jun | 1.0 | in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . |
| 5013 | HMOX1 | heme oxygenase (decycling) 1 | ho 1 | 1.0 | in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | the dramatic increase in cytochrome c release to cytosol detected by the fractionation assay and immunohistochemical analysis figure 6b and 6d most likely reflects the increased activation of caspase 3 and consequently contributes to the markedly increased of apoptosis elicited through the reduction of gsh in nsc34 cells figure 7 . |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | the dramatic increase in cytochrome c release to cytosol detected by the fractionation assay and immunohistochemical analysis figure 6b and 6d most likely reflects the increased activation of caspase 3 and consequently contributes to the |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | cytochrome c mediated caspase activation has also been shown to lead motor neuron degeneration in als like mouse and human als patients guegan et al. 2001 ; li et al. 2000 . |
| 25806 | GSTCD | glutathione S-transferase, C-terminal domain containing | glutathione s transferase | 1.0 | discussion decreased gsh is associated with motor neuron degeneration and als like disease onset and progression in the g93a sod1 transgenic mouse model more recently alterations of glutathione s transferase pi activity have been reported in als patients kuzma et al. 2006 ; usarek et al. 2005 . |
| 4638 | GSTP1 | glutathione S-transferase pi | glutathione s transferase pi | 1.0 | discussion decreased gsh is associated with motor neuron degeneration and als like disease onset and progression in the g93a sod1 transgenic mouse model more recently alterations of glutathione s transferase pi activity have been reported in als patients kuzma et al. 2006 ; usarek et al. 2005 . |
| 1516 | CAT | catalase | catalase | 1.0 | more significantly treatment of als like transgenic mice with antioxidants such as sod and catalase mimetics jung et al. 2001 dmpo liu et al. 2002 iron porphyrin wu et al. 2003 or manganese porphyrin crow et al. 2005 delays disease onset and extends survival. |
| 1504 | CASP3 | caspase 3, apoptosis-related cysteine peptidase | caspase 3 | 1.0 | figure 9 redistribution of aif and active caspase 3 in motor neuron cells of als like mice |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | apoptosis inducing factor | 1.0 | aif apoptosis inducing factor als amyotrophic lateral sclerosis bso l buthionine sulfoximine dcf dichlorofluorescin dmem dulbecco_amp_#x02019;s modified eagle_amp_#x02019;s medium ea ethacrynic acid fbs fetal bovine serum _amp_#x |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | etal bovine serum _amp_#x003b3; gcs _amp_#x003b3; glutamylcysteine synthetase gsh glutathione gssg oxidized glutathione mbm monobromobimane pfa paraformaldehyde ros reactive oxygen species sod1 cu zn superoxide dismutase tunel terminal deoxynucleotidyl transferase mediated nick end labeling |
| 8768 | AIFM1 | apoptosis-inducing factor, mitochondrion-associated, 1 | apoptosis inducing factor | 1.0 | apoptosis inducing factor|biological markers|enzyme inhibitors|reactive oxygen species|buthionine sulfoximine|ethacrynic acid|glutathione|superoxide dismutase 1|superoxide dismutase| |