HUGO ID Detailed Result 4312

PMID	Match String	Actual String	Score	Flanking text	Edited by	Edit
17634371	GCLM	GCLM	3.0	and 5'-GCTCTTCCATTTCCGAGTCACTG-3' (242 242 bp glutamate-cysteine ligase modifier subunit (GCLM), GCLM 5'-AATCTTGCCTCCTGCTGTGTGATG-3' and 5'-GGCTTCAATGTCAGGGATGCTTTC-3' (153 153 bp glutamate-cysteine ligase catalytic subunit
17634371	GCLM	GCLM	3.0	GSH biosynthesis and both subunits of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription factor and
17634371	GCLM	GCLM	3.0	expression which correlated with a decreased transcription of GCLC and GCLM
17634371	GCLM	GCLM	3.0	24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR as described in
17634371	GCLM	GCLM	3.0	including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) GSH biosynthesis (
17634371	GCL	GCL	0.2	Nrf2 regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH)	Junguk Hur
17634371	glutamate-cysteine ligase modifier subunit	glutamate cysteine ligase modifier subunit	1.0	pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ;