HUGO ID Detailed Result 4311

PMID	Match String	Actual String	Score	Flanking text	Edited by	Edit
17634371	GCLC	GCLC	2.5	and 5'-GGCTTCAATGTCAGGGATGCTTTC-3' (153 153 bp glutamate-cysteine ligase catalytic subunit (GCLC), GCLC 5'-ATGAAAGTGGCACAGGAGCGAG-3' and 5'-AAACACGCCTTCCTTCCCATTG-3' (186 186 bp neuronal nitric oxide synthase
17634371	GCLC	GCLC	2.5	step in GSH biosynthesis and both subunits of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription
17634371	GCLC	GCLC	2.5	Nrf2 mRNA expression which correlated with a decreased transcription of GCLC and GCLM
17634371	GCLC	GCLC	2.5	ml for 24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR as
17634371	GCLC	GCLC	2.5	regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) GSH
17634371	glutamate-cysteine ligase	glutamate cysteine ligase	1.0	pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcc
17634371	glutamate-cysteine ligase	glutamate cysteine ligase	1.0	modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp
17634371	glutamate-cysteine ligase, catalytic subunit	glutamate cysteine ligase catalytic subunit	1.0	f2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaag
17634371	glutamate-cysteine ligase	glutamate cysteine ligase	1.0	the decrease in nrf2 expression correlated with a decrease in the expression of nrf2 regulated genes including both subunits of glutamate cysteine ligase gcl gclc and gclm the rate limiting enzyme in reduced glutathione gsh biosynthesis fig 4 .