microRNA Secondary Strucutre Prediction

Query Summary

Query Type Family Accession Family ID miRBase ID1 miRBase ID2 # of members Conserved Structure
MI0004913 member_ID MIPF0000027 mir-23MI0004913 xtr-mir-23b 39 Structure

Stem-loop sequence(s) 
>xtr-mir-23b MI0004913 Xenopus tropicalis miR-23b stem-loop
CCGGUGUGGCUGUUUGGGUUCCUGGCAUGCUGAUUUGUGAGUUAAGAUUAAAAUCACAUU
GCCAGGGAUUACCACACAACCAUGUCCU
Mature sequence(s) 
>xtr-miR-23b MIMAT0003673 Xenopus tropicalis miR-23b
AUCACAUUGCCAGGGAUUACC
RNA structure prediction - By RNAfold in ViennaRNA package

Download: RNAfold.pdf RNAdot.pdf

Process completed for MI0004913

Question/Comment to Junguk Hur