microRNA Secondary Strucutre Prediction

Query Summary

Query	Type	Family Accession	Family ID	miRBase ID1	miRBase ID2	# of members	Conserved Structure
MI0004886	member_ID	MIPF0000002	let-7	MI0004886	xtr-let-7c	124	Structure

Stem-loop sequence(s)

>xtr-let-7c MI0004886 Xenopus tropicalis let-7c stem-loop
UGUGUGCAUCCAGGUUGAGGUAGUAGGUUGUAUGGUUUAGAAUGACACCCUGGGAGUUAA
CUGUACAACCUUCUAGCUUUCCUUGGAGCUCACU

Mature sequence(s)

>xtr-let-7c MIMAT0003644 Xenopus tropicalis let-7c
UGAGGUAGUAGGUUGUAUGGUU

RNA structure prediction - By RNAfold in ViennaRNA package

Download: RNAfold.pdf RNAdot.pdf

Process completed for MI0004886

Question/Comment to Junguk Hur