microRNA Secondary Strucutre Prediction

Query Summary

Query	Type	Family Accession	Family ID	miRBase ID1	miRBase ID2	# of members	Conserved Structure
MI0003208	member_ID	MIPF0000002	let-7	MI0003208	tni-let-7h	124	Structure

Stem-loop sequence(s)

>tni-let-7h MI0003208 Tetraodon nigroviridis let-7h stem-loop
AAUUGGCUUUGCUGUGGUGAGGUAGUAAGUUGUGUUGUUGUUGGGGAUCAAGAUUGUGCA
CCCUGUCAAGGAGAUAACUAUACAACUUACUGCCUUCCU

Mature sequence(s)

>tni-let-7h MIMAT0002893 Tetraodon nigroviridis let-7h
UGAGGUAGUAAGUUGUGUUGUU

RNA structure prediction - By RNAfold in ViennaRNA package

Download: RNAfold.pdf RNAdot.pdf

Process completed for MI0003208

Question/Comment to Junguk Hur