microRNA Secondary Strucutre Prediction

Query Summary

Query Type Family Accession Family ID miRBase ID1 miRBase ID2 # of members Conserved Structure
MI0002700 member_ID MIPF0000002 let-7MI0002700 age-mir-98 124 Structure

Stem-loop sequence(s) 
>age-mir-98 MI0002700 Ateles geoffroyi miR-98 stem-loop
GUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUAGGCCCCAAUUAGAAGAUAAC
UAUACAACUUACUACUUUCC
Mature sequence(s) 
>age-miR-98 MIMAT0002408 Ateles geoffroyi miR-98
UGAGGUAGUAAGUUGUAUUGUU
RNA structure prediction - By RNAfold in ViennaRNA package

Download: RNAfold.pdf RNAdot.pdf

Process completed for MI0002700

Question/Comment to Junguk Hur