microRNA Secondary Strucutre Prediction

Query Summary

Query	Type	Family Accession	Family ID	miRBase ID1	miRBase ID2	# of members	Conserved Structure
MI0002697	member_ID	MIPF0000002	let-7	MI0002697	ptr-mir-98	124	Structure

Stem-loop sequence(s)

>ptr-mir-98 MI0002697 Pan troglodytes miR-98 stem-loop
AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUA
GGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA

Mature sequence(s)

>ptr-miR-98 MIMAT0002405 Pan troglodytes miR-98
UGAGGUAGUAAGUUGUAUUGUU

RNA structure prediction - By RNAfold in ViennaRNA package

Download: RNAfold.pdf RNAdot.pdf

Process completed for MI0002697

Question/Comment to Junguk Hur