|
PMID
|
Match String
|
Actual String
|
Score
|
Flanking text
|
Edited by
|
Edit
|
| 16014720 | beta-actin | beta-actin | 0.3 | transcription-PCR analysis as described previously (Wu Wu et al. 2003 beta-actin were as follows MPO 5'-AGGATAGGACTGGATTGCCTG-3' (forward) forward and 5'-GTGGTGATGCCAGTGTTGTCA-3' (reverse); | |  |
| 16014720 | beta-actin | beta-actin | 0.3 | as follows MPO 5'-AGGATAGGACTGGATTGCCTG-3' (forward) forward and 5'-GTGGTGATGCCAGTGTTGTCA-3' (reverse); reverse beta-actin 5'-CTTTGATGTCACGCACGATTTC-3' (forward) forward and 5'-GGGCCGCTCTAGGCACCAA-3' (reverse) reverse | | |
| 16014720 | beta-actin | beta-actin | 0.3 | blot analysis as described previously (Wu Wu et al. 2003 beta-actin antibody (1:10,000; 1 10 000 Sigma St Louis MO | | |
| 16014720 | beta-actin | beta-actin | 0.3 | in mice there was no significant difference in MPO to beta-actin ratios in the striatum (PD, PD 1.1 _amp_#177 0.8 vs | | |
| 16014720 | beta-actin | beta-actin | 0.3 | tissues from stage 4 HD patients had higher GFAP to beta-actin ratios (HD, HD 0.7 _amp_#177 0.1 vs controls 0.1 _amp_#177 | | |
| 16014720 | beta-actin | beta-actin | 0.3 | _lt_ 0.01 n = 3-4 as well as MPO to beta-actin ratios (HD, HD 0.8 _amp_#177 0.2 vs controls 0.2 _amp_#177 | | |
| 16120782 | beta-actin | beta-actin | 0.3 | 5'-GAC-TCC-ACG-ACA-TAC-TCA-GC-3' were used as housekeeping control for SOCS-1 and 3 beta-actin forward 5'-CAC-AGC-TTC-TTT-GCA-GCT-CCT-T-3' and reverse 5'-TCA-GGA-TAC-CTC-TCT-TGC-TCT-GG-3' were used as housekeeping control | | |
| 16120782 | beta-actin | beta-actin | 0.3 | and human SOD1 transcripts the differences in C T between beta-actin and SOD1 were determined and expressed as x -fold difference | | |
| 16120782 | beta-actin | beta-actin | 0.3 | SOD1 were determined and expressed as x -fold difference from beta-actin expression using the following equation 2 | | |
| 18436268 | beta-actin | beta-actin | 0.3 | Afterwards the blots were stripped and stained with beta-actin antibody (1:4000, 1 4000 Cell signaling MA USA | | |
| 16014720 | beta actin | beta actin | 1.0 | total rna was extracted from selected brain regions and at selected time points after mptp and used for reverse transcription pcr analysis as described previously wu et al. 2003 beta actin were as follows: mpo 5' aggataggactggattgcctg 3' forward and 5' gtggtgatgccagtgttgtca 3' reverse ; beta actin 5' ctttgatgtcacgcacgatttc 3' forward and 5' gggccgctctaggcaccaa 3' reverse . | | |
| 16014720 | beta actin | beta actin | 1.0 | were as follows: mpo 5' aggataggactggattgcctg 3' forward and 5' gtggtgatgccagtgttgtca 3' reverse ; beta actin 5' ctttgatgtcacgcacgatttc 3' forward and 5' gggccgctctaggcaccaa 3' reverse . | | |
| 16014720 | beta actin | beta actin | 1.0 | mouse brain protein extracts from selected regions were prepared and used for western blot analysis as described previously wu et al. 2003 beta actin antibody 1:10 000; sigma st louis mo . | | |
| 16014720 | beta actin | beta actin | 1.0 | like in mice there was no significant difference in mpo to beta actin ratios in the striatum pd 1.1 _amp_#177; 0.8 vs controls 1.4 _amp_#177; 0.8; p > 0.05; n = 7 or cerebellum pd 0.8 _amp_#177; 0.2 vs controls 1.0 _amp_#177; 0.3; p > 0.05; n = 7 between the pd and con | | |
| 16014720 | beta actin | beta actin | 1.0 | conversely we found that caudate nucleus tissues from stage 4 hd patients had higher gfap to beta actin ratios hd 0.7 _amp_#177; 0.1 vs controls 0.1 _amp_#177; 0.1; p _lt_ 0.01; n = 3 4 as well as mpo to beta actin ratios hd 0.8 _amp_#177; 0.2 vs controls 0.2 _amp_#177; 0.1; p _lt_ 0.05; n = 5 6 . | | |
| 16014720 | beta actin | beta actin | 1.0 | ratios hd 0.7 _amp_#177; 0.1 vs controls 0.1 _amp_#177; 0.1; p _lt_ 0.01; n = 3 4 as well as mpo to beta actin ratios hd 0.8 _amp_#177; 0.2 vs controls 0.2 _amp_#177; 0.1; p _lt_ 0.05; n = 5 6 . | | |
| 16120782 | beta actin | beta actin | 1.0 | afterward the blots were stripped and stained with a monoclonal anti beta actin antibody at 1:10 000 dilution sigma aldrich taufkirchen germany . | | |
| 16120782 | beta actin | beta actin | 1.0 | glyceraldehyde 3 phosphate dehydrogenase forward 5' tca cca ggg ctg cca ttt gc 3' and reverse 5' gac tcc acg aca tac tca gc 3' were used as housekeeping control for socs 1 and 3; beta actin forward 5' cac agc ttc ttt gca gct cct t 3' and reverse 5' tca gga tac ctc tct tgc tct gg 3' were used as housekeeping control for mouse and human sod1. | | |
| 16120782 | beta actin | beta actin | 1.0 | for the calculation of the relative abundancies of mouse and human sod1 transcripts the differences in c t between beta actin and sod1 were determined and expressed as x fold difference from beta actin expression using the following equation: 2 . | | |
| 17008387 | beta actin | beta actin | 1.0 | easome 20s lmp7 dilution 1:1000; abcam cambridge uk rabbit polyclonal anti proteasome 20s x dilution 1:1000; abcam rabbit polyclonal anti glt 1 dilution 1:1000; calbiochem la jolla ca monoclonal anti beta actin dilution 1:4000 sigma or rabbit polyclonal anti ubiquitin antibodies dilution 1:1000; dakocytomation denmark a/s glostrup denmark and horseradish peroxidase labeled anti mouse igg dilution 1:4000; ge | | |
| 18436268 | beta actin | beta actin | 1.0 | afterwards the blots were stripped and stained with beta actin antibody 1:4000 cell signaling ma usa . | | |