SciMiner Result Report Page

Document Information

PMID	16014720 ( )
Title	Ablation of the inflammatory enzyme myeloperoxidase mitigates features of Parkinson's disease in mice.
Abstract	Parkinson's disease (PD) is characterized by a loss of ventral midbrain dopaminergic neurons, which can be modeled by the neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Inflammatory oxidants have emerged as key contributors to PD- and MPTP-related neurodegeneration. Here, we show that myeloperoxidase (MPO), a key oxidant-producing enzyme during inflammation, is upregulated in the ventral midbrain of human PD and MPTP mice. We also show that ventral midbrain dopaminergic neurons of mutant mice deficient in MPO are more resistant to MPTP-induced cytotoxicity than their wild-type littermates. Supporting the oxidative damaging role of MPO in this PD model are the demonstrations that MPO-specific biomarkers 3-chlorotyrosine and hypochlorous acid-modified proteins increase in the brains of MPTP-injected mice. This study demonstrates that MPO participates in the MPTP neurotoxic process and suggests that inhibitors of MPO may provide a protective benefit in PD. USA. Neuroscience

NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.

Targets by SciMiner Summary

HUGO ID	Symbol	Target Name	#Occur	ActualStr
7218	MPO	myeloperoxidase	123	MPO-positive \| myeloperoxidase \| MPO-derived \| MPO-deficient \| MPO-damaged \| MPO-specific \|
132	ACTB	actin, beta	12	beta actin \| beta-actin \|
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	8	mac 1 \| CD11b \| MAC-1 \|
4235	GFAP	glial fibrillary acidic protein	8	glial fibrillary acidic protein \| GFAP \|
7873	NOS2A	nitric oxide synthase 2A (inducible, hepatocytes)	5	iNOS-dependent \| nitric oxide synthase \|
6155	ITGB2	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	4	CD18 \|
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	3	nadph oxidase \|
24961	HOPX	HOP homeobox	2	HOP-1-positive \|
11782	TH	tyrosine hydroxylase	2	tyrosine hydroxylase \|
2435	CSF2RA	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	1	CD116 \|

Targets by SciMiner Full list

HUGO ID	Symbol	Name	ActualStr	Score	FlankingText
7218	MPO	myeloperoxidase	MPO	7.1	Here we show that myeloperoxidase (MPO), MPO a key oxidant-producing enzyme during inflammation is upregulated in the
7218	MPO	myeloperoxidase	MPO	7.1	that ventral midbrain dopaminergic neurons of mutant mice deficient in MPO are more resistant to MPTP-induced cytotoxicity than their wild-type littermates
7218	MPO	myeloperoxidase	MPO	7.1	Supporting the oxidative damaging role of MPO in this PD model are the demonstrations that MPO-specific biomarkers
7218	MPO	myeloperoxidase	MPO-specific	1.0	of MPO in this PD model are the demonstrations that MPO-specific biomarkers 3-chlorotyrosine and hypochlorous acid-modified proteins increase in the brains
7218	MPO	myeloperoxidase	MPO	7.1	This study demonstrates that MPO participates in the MPTP neurotoxic process and suggests that inhibitors
7218	MPO	myeloperoxidase	MPO	7.1	in the MPTP neurotoxic process and suggests that inhibitors of MPO may provide a protective benefit in PD
7873	NOS2A	nitric oxide synthase 2A (inducible, hepatocytes)	iNOS	2.2	For instance NADPH oxidase and inducible nitric oxide synthase (iNOS), iNOS which are major sources of inflammatory oxidants are upregulated in
7873	NOS2A	nitric oxide synthase 2A (inducible, hepatocytes)	iNOS	2.2	Studies of mice deficient in NADPH oxidase or iNOS indicate that superoxide radical (O O 2 and NO contribute
7873	NOS2A	nitric oxide synthase 2A (inducible, hepatocytes)	iNOS-dependent	2.2	Pennathur et al. 1999 for the most part in an iNOS-dependent manner (Liberatore Liberatore et al. 1999
7218	MPO	myeloperoxidase	MPO	7.1	Conversely myeloperoxidase (MPO), MPO and not ONOO seems to promote O O '-dityrosine formation
7218	MPO	myeloperoxidase	MPO	7.1	Moreover MPO can use the NO degradation product NO 2 to generate
7218	MPO	myeloperoxidase	MPO	7.1	Vliet et al. 1997 and studies of mice deficient in MPO demonstrate that this enzyme is one of the major sources
7218	MPO	myeloperoxidase	MPO	7.1	Thus these results raise the unanticipated possibility that MPO a heme enzyme expressed in abundance in a variety of
7218	MPO	myeloperoxidase	MPO	7.1	Consistent with this hypothesis we show here not only that MPO is detected in affected brain areas of MPTP-injected mice and
7218	MPO	myeloperoxidase	MPO	7.1	in glial cells but also that mutant mice deficient in MPO are more resistant to MPTP-induced dopaminergic neurotoxicity
7218	MPO	myeloperoxidase	MPO	7.1	These findings indicate that MPO does participate in the MPTP neurotoxic process and suggest that
7218	MPO	myeloperoxidase	MPO	7.1	in the MPTP neurotoxic process and suggest that inhibitors of MPO may provide protective benefit in PD
7218	MPO	myeloperoxidase	MPO-deficient	1.0	C57BL 6J mice ( Charles River Laboratories Wilmington MA and MPO-deficient mice that had been backcrossed >10 times into the C57BL/6J
132	ACTB	actin, beta	beta-actin	0.3	transcription-PCR analysis as described previously (Wu Wu et al. 2003 beta-actin were as follows MPO 5'-AGGATAGGACTGGATTGCCTG-3' (forward) forward and 5'-GTGGTGATGCCAGTGTTGTCA-3' (reverse);
7218	MPO	myeloperoxidase	MPO	7.1	previously (Wu Wu et al. 2003 beta-actin were as follows MPO 5'-AGGATAGGACTGGATTGCCTG-3' (forward) forward and 5'-GTGGTGATGCCAGTGTTGTCA-3' (reverse); reverse beta-actin 5'-CTTTGATGTCACGCACGATTTC-3' (forward)
132	ACTB	actin, beta	beta-actin	0.3	as follows MPO 5'-AGGATAGGACTGGATTGCCTG-3' (forward) forward and 5'-GTGGTGATGCCAGTGTTGTCA-3' (reverse); reverse beta-actin 5'-CTTTGATGTCACGCACGATTTC-3' (forward) forward and 5'-GGGCCGCTCTAGGCACCAA-3' (reverse) reverse
132	ACTB	actin, beta	beta-actin	0.3	blot analysis as described previously (Wu Wu et al. 2003 beta-actin antibody (1:10,000; 1 10 000 Sigma St Louis MO
7218	MPO	myeloperoxidase	MPO	7.1	MPO isolation and activity
7218	MPO	myeloperoxidase	MPO	7.1	The methods used to prepare brain samples and to measure MPO activity are slight modifications of those described previously by Daugherty
7218	MPO	myeloperoxidase	MPO	7.1	centrifugation final supernatants were collected and used immediately to assess MPO activity by monitoring the oxidation of tetramethylbenzidine as described previously
7218	MPO	myeloperoxidase	MPO	7.1	Mouse MPO glial fibrillary acidic protein beta 2 integrin MAC-1 (CD116/CD18), CD116
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	MAC-1	2.8	Mouse MPO glial fibrillary acidic protein beta 2 integrin MAC-1 (CD116/CD18), CD116 CD18 neutrophil and tyrosine hydroxylase immunohistochemistry
2435	CSF2RA	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	CD116	1.3	MPO glial fibrillary acidic protein beta 2 integrin MAC-1 (CD116/CD18), CD116 CD18 neutrophil and tyrosine hydroxylase immunohistochemistry
6155	ITGB2	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	CD18	2.8	glial fibrillary acidic protein beta 2 integrin MAC-1 (CD116/CD18), CD116 CD18 neutrophil and tyrosine hydroxylase immunohistochemistry
4235	GFAP	glial fibrillary acidic protein	GFAP	2.5	Vision Fremont CA rabbit polyclonal anti-glial fibrillary acidic protein (GFAP; GFAP 1 500 Chemicon Temecula CA mouse monoclonal anti-MAC-1 (1:1000; 1
7218	MPO	myeloperoxidase	MPO	7.1	mouse tissues the primary anti-MPO antibody was a rabbit anti-human MPO antibody (DakoCytomation, DakoCytomation Carpinteria CA used at 1 1000 for
7218	MPO	myeloperoxidase	MPO-deficient	1.0	with UV detection ( = 295 nm in WT and MPO-deficient mice at 90 min after the last injection of 20
7218	MPO	myeloperoxidase	MPO	7.1	MPO is induced in the mouse ventral midbrain during MPTP-induced dopaminergic
7218	MPO	myeloperoxidase	MPO	7.1	To examine the possibility that MPO is a component of the inflammatory response seen in the
7218	MPO	myeloperoxidase	MPO	7.1	et al. 1999 Wu et al. 2002 we first assessed MPO mRNA and protein content in the ventral midbrain (i.e., i.e.
7218	MPO	myeloperoxidase	MPO	7.1	saline-injected control mice the ventral midbrain contained low levels of MPO mRNA and protein ( Fig 1 A-C
7218	MPO	myeloperoxidase	MPO	7.1	In contrast in MPTP-injected mice ventral midbrain levels of both MPO mRNA and protein increased in a time-dependent manner ( Fig
7218	MPO	myeloperoxidase	MPO	7.1	Ventral midbrain MPO mRNA and protein expression levels peaked at 1 and 2
7218	MPO	myeloperoxidase	MPO	7.1	We next asked whether the observed changes in MPO ventral midbrain content in MPTP-injected animals paralleled an alteration of
7218	MPO	myeloperoxidase	MPO	7.1	ventral midbrain content in MPTP-injected animals paralleled an alteration of MPO enzymatic activity by monitoring oxidation of tetramethylbenzidine
7218	MPO	myeloperoxidase	MPO	7.1	Consistent with the protein data we found that ventral midbrain MPO activity also rose during MPTP neurotoxicity in a time-dependent manner
7218	MPO	myeloperoxidase	MPO	7.1	In contrast in mutant mice deficient in MPO (MPO MPO n = 2 the ventral midbrain did not
7218	MPO	myeloperoxidase	MPO	7.1	In contrast in mutant mice deficient in MPO (MPO MPO n = 2 the ventral midbrain did not show higher
7218	MPO	myeloperoxidase	MPO	7.1	Unlike in the ventral midbrain levels of MPO mRNA proteins and catalytic activity in the cerebellum (brain brain
7218	MPO	myeloperoxidase	MPO	7.1	However more unexpected was the finding that no MPO alteration could be detected in the striatum (where where dopaminergic
7218	MPO	myeloperoxidase	MPO	7.1	administration as illustrated by the lack of change in striatal MPO activity saline 14.0 _amp_#177 4.1 ( n = 7 versus
7218	MPO	myeloperoxidase	MPO	7.1	Thus both protein levels and activity of MPO increase in the MPTP mouse model of PD specifically in
7218	MPO	myeloperoxidase	MPO	7.1	The present study shows that the level of MPO expression increases markedly in diseased SNpc from both mice exposed
7218	MPO	myeloperoxidase	MPO	7.1	This work also demonstrates that changes of MPO protein content and enzymatic activity in MPTP-intoxicated mice parallel (
7218	MPO	myeloperoxidase	MPO	7.1	Moreover MPO is found primarily in SNpc-reactive astrocytes (Figs Figs 2 3
7218	MPO	myeloperoxidase	MPO	7.1	to detect any of the well established cellular sources of MPO (neutrophils, neutrophils monocytes or macrophages (Hampton Hampton et al. 1998
7218	MPO	myeloperoxidase	MPO	7.1	The presence of MPO in damaged SNpc thus appears to derive essentially from a
7218	MPO	myeloperoxidase	MPO	7.1	other neurodegenerative diseases namely HD and ALS it appears that MPO upregulation in the brain is not pathognomonic of PD
7218	MPO	myeloperoxidase	MPO	7.1	Instead we believe that the occurrence of MPO in diseased brains is likely indicative of a disease process
7218	MPO	myeloperoxidase	MPO	7.1	are generally believed to be the only cellular sources of MPO
7218	MPO	myeloperoxidase	MPO	7.1	However neuronal expression of MPO is also increased in Alzheimer's disease (Green Green et al.
7218	MPO	myeloperoxidase	MPO	7.1	injections are associated with a time-dependent increase in ventral midbrain MPO mRNA ( A C protein expression ( B C and
7218	MPO	myeloperoxidase	MPO	7.1	A C Immunochemical studies revealed no specific MPO immunoreactivity in the ventral midbrain of saline-injected control mice
7218	MPO	myeloperoxidase	MPO	7.1	dense network of fibers and scattered cell bodies positive for MPO are seen at the level of the SNpc after MPTP
7218	MPO	myeloperoxidase	MPO-positive	1.0	Black arrows in D show the MPO-positive cellular elements
7218	MPO	myeloperoxidase	MPO-positive	1.0	E-H Confocal microscopy demonstrates that ventral midbrain MPO-positive structures ( E red are also GFAP positive ( F
4235	GFAP	glial fibrillary acidic protein	GFAP	2.5	that ventral midbrain MPO-positive structures ( E red are also GFAP positive ( F green as evidenced by the overlay of
7218	MPO	myeloperoxidase	MPO-positive	1.0	J-L In contrast ventral midbrain MPO-positive structures ( I red are not MAC-1 positive ( J
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	MAC-1	2.8	contrast ventral midbrain MPO-positive structures ( I red are not MAC-1 positive ( J green as evidenced by the overlay (
7218	MPO	myeloperoxidase	MPO	7.1	A B Ventral midbrain MPO tissue content is increased in postmortem tissue from PD patients
4235	GFAP	glial fibrillary acidic protein	GFAP	2.5	tissue from PD patients compared with controls as well as GFAP tissue content
7218	MPO	myeloperoxidase	MPO	7.1	C Positive control (purified purified MPO
7218	MPO	myeloperoxidase	MPO	7.1	C Inventral midbrain sections MPO (blue) blue is not detected in control tissues neither in
7218	MPO	myeloperoxidase	MPO	7.1	D Conversely MPO immunoreactivity (blue, blue small black arrow is found in GFAP-positive
7218	MPO	myeloperoxidase	MPO	7.1	A-D Ablation of MPO in mutant mice attenuates MPTP-induced striatal TH fibers and SNpc
7218	MPO	myeloperoxidase	MPO	7.1	saline-injected animals p _lt_ 0.05 compared with saline- and MPTP-injected MPO mice
24961	HOPX	HOP homeobox	HOP-1-positive	0.3	Twenty-four hours after MPTP injections HOP-1-positive immunoreactive material is seen mainly at the level of the
7218	MPO	myeloperoxidase	MPO-deficient	1.0	Striatal MPTP metabolism in MPO-deficient mice
7218	MPO	myeloperoxidase	MPO	7.1	MPO is expressed in reactive astrocytes after MPTP injection
7218	MPO	myeloperoxidase	MPO	7.1	To elucidate the cellular origin of MPO in the ventral midbrain of MPTP-treated mice immunohistochemical studies were
7218	MPO	myeloperoxidase	MPO	7.1	In saline controls diffuse MPO immunoreactivity was seen in the neuropil ( Fig 2 A
7218	MPO	myeloperoxidase	MPO	7.1	MPTP-treated mice 2 d after the last injection ventral midbrain MPO immunostaining was stronger especially at the level of the substantia
7218	MPO	myeloperoxidase	MPO	7.1	This analysis confirmed that MPO colocalized with the astrocytic marker GFAP as shown by the
4235	GFAP	glial fibrillary acidic protein	GFAP	2.5	This analysis confirmed that MPO colocalized with the astrocytic marker GFAP as shown by the merged image from the two fluorochromes
7218	MPO	myeloperoxidase	MPO	7.1	Conversely no evidence of MPO expression in microglial cells could be documented by using the
7218	MPO	myeloperoxidase	MPO	7.1	No noticeable cellular MPO immunoreactivity was observed in the striatum or cerebellum of either
7218	MPO	myeloperoxidase	MPO	7.1	These results demonstrate that MPO is primarily expressed in ventral midbrain astrocytes during the demise
7218	MPO	myeloperoxidase	MPO	7.1	Expression of MPO is increased in PD midbrain
7218	MPO	myeloperoxidase	MPO	7.1	To determine whether the changes in MPO observed in the MPTP mouse model of PD were present
7218	MPO	myeloperoxidase	MPO	7.1	of PD were present in the human condition we assessed MPO protein levels in postmortem ventral midbrain samples from sporadic PD
7218	MPO	myeloperoxidase	MPO	7.1	Consistent with the mouse data PD samples had significantly higher MPO protein contents compared with controls ( Fig 3 A B
7218	MPO	myeloperoxidase	MPO	7.1	Like in mice there was no significant difference in MPO to beta-actin ratios in the striatum (PD, PD 1.1 _amp_#177
132	ACTB	actin, beta	beta-actin	0.3	in mice there was no significant difference in MPO to beta-actin ratios in the striatum (PD, PD 1.1 _amp_#177 0.8 vs
7218	MPO	myeloperoxidase	MPO	7.1	Histologically cellular MPO immunoreactivity was not detected in the control ventral midbrain parenchyma
7218	MPO	myeloperoxidase	MPO	7.1	However MPO immunoreactivity was seen in ventral midbrain sections from PD patients
7218	MPO	myeloperoxidase	MPO	7.1	The similarity of the MPO alterations between the MPTP mice and the PD postmortem specimens
7218	MPO	myeloperoxidase	MPO	7.1	of using this experimental model to study the role of MPO in the PD neurodegenerative process
7218	MPO	myeloperoxidase	MPO	7.1	neurodegenerative diseases we wondered whether increases in the expression of MPO within areas of neurodegeneration can be found in neurodegenerative disorders
4235	GFAP	glial fibrillary acidic protein	GFAP	2.5	the motor cortex from ALS patients did not exhibit higher GFAP or MPO values (data data not shown
7218	MPO	myeloperoxidase	MPO	7.1	cortex from ALS patients did not exhibit higher GFAP or MPO values (data data not shown
4235	GFAP	glial fibrillary acidic protein	GFAP	2.5	caudate nucleus tissues from stage 4 HD patients had higher GFAP to beta-actin ratios (HD, HD 0.7 _amp_#177 0.1 vs controls
132	ACTB	actin, beta	beta-actin	0.3	tissues from stage 4 HD patients had higher GFAP to beta-actin ratios (HD, HD 0.7 _amp_#177 0.1 vs controls 0.1 _amp_#177
7218	MPO	myeloperoxidase	MPO	7.1	0.1 p _lt_ 0.01 n = 3-4 as well as MPO to beta-actin ratios (HD, HD 0.8 _amp_#177 0.2 vs controls
132	ACTB	actin, beta	beta-actin	0.3	_lt_ 0.01 n = 3-4 as well as MPO to beta-actin ratios (HD, HD 0.8 _amp_#177 0.2 vs controls 0.2 _amp_#177
7218	MPO	myeloperoxidase	MPO	7.1	This suggests that brain MPO expression is not specific to PD but rather generic to
7218	MPO	myeloperoxidase	MPO	7.1	MPO deficiency protects against MPTP-induced neurodegeneration
7218	MPO	myeloperoxidase	MPO	7.1	MPTP on the nigrostriatal pathway of mutant mice deficient in MPO (MPO MPO and their WT littermates (MPO MPO
7218	MPO	myeloperoxidase	MPO	7.1	the nigrostriatal pathway of mutant mice deficient in MPO (MPO MPO and their WT littermates (MPO MPO
7218	MPO	myeloperoxidase	MPO	7.1	deficient in MPO (MPO MPO and their WT littermates (MPO MPO
7218	MPO	myeloperoxidase	MPO	7.1	In saline-injected MPO and MPO mice stereological counts of SNpc dopaminergic neurons and
7218	MPO	myeloperoxidase	MPO	7.1	In saline-injected MPO and MPO mice stereological counts of SNpc dopaminergic neurons and striatal TH-positive
7218	MPO	myeloperoxidase	MPO	7.1	In MPTP-injected MPO mice there was a ~70% loss of SNpc TH-positive neurons
7218	MPO	myeloperoxidase	MPO	7.1	In contrast in MPTP-injected MPO mice there was only ~50% loss of SNpc TH-positive neurons
7218	MPO	myeloperoxidase	MPO	7.1	To examine whether MPO ablation protects not only against structural damage but also against
7218	MPO	myeloperoxidase	MPO	7.1	acid in the striatum as well as locomotor activity between MPO and MPO mice after MPTP injections
7218	MPO	myeloperoxidase	MPO	7.1	the striatum as well as locomotor activity between MPO and MPO mice after MPTP injections
7218	MPO	myeloperoxidase	MPO	7.1	Contrasting with the protection afforded by the lack of MPO on the nigrostriatal dopaminergic neurons the loss of striatal dopamine
7218	MPO	myeloperoxidase	MPO	7.1	in motor performance caused by MPTP were as severe in MPO as in MPO mice ( supplemental material available at www.jneurosci.org
7218	MPO	myeloperoxidase	MPO	7.1	caused by MPTP were as severe in MPO as in MPO mice ( supplemental material available at www.jneurosci.org
7218	MPO	myeloperoxidase	MPO	7.1	To ascertain that the resistance of MPO mice was not attributable to alterations in MPTP toxicokinetics we
7218	MPO	myeloperoxidase	MPO	7.1	(a a measure of mitochondrial function did not differ between MPO mice and their WT littermates ( Table 1
7218	MPO	myeloperoxidase	MPO	7.1	MPO damages ventral midbrain proteins
7218	MPO	myeloperoxidase	MPO	7.1	MPO is the only known mammalian source of HOCl at plasma
7218	MPO	myeloperoxidase	MPO	7.1	3-chlorotyrosine a specific and stable biomarker of protein damage by MPO (Heinecke Heinecke et al. 1999
7218	MPO	myeloperoxidase	MPO	7.1	In contrast in MPTP-treated MPO mice ( n = 3 ventral midbrain 3-chlorotyrosine was undetectable
7218	MPO	myeloperoxidase	MPO	7.1	tissues therefore supports the hypothesis that reactive intermediates produced by MPO damage brain proteins in MPTP-intoxicated mice
7218	MPO	myeloperoxidase	MPO-damaged	1.5	To localize MPO-damaged proteins tissue sections were immunostained with HOP-1 a mouse antibody
24961	HOPX	HOP homeobox	HOP-1-positive	0.3	HOP-1-positive material was seen in the neuropil within beaded-appearing fibers and
7218	MPO	myeloperoxidase	MPO	7.1	was detected in the SNpc of saline-injected mice or MPTP-injected MPO mice (data data not shown
7218	MPO	myeloperoxidase	MPO	7.1	and sometimes in PD did not show any alteration in MPO expression or enzymatic activity as illustrated in Figure 3
7873	NOS2A	nitric oxide synthase 2A (inducible, hepatocytes)	iNOS	2.2	Remarkably detectable changes in iNOS expression and enzymatic activity are also confined to ventral midbrains
7218	MPO	myeloperoxidase	MPO	7.1	After MPTP injections mutant mice deficient in MPO showed more spared SNpc dopaminergic neurons and striatal dopaminergic fibers
7218	MPO	myeloperoxidase	MPO	7.1	We also found that the lack of MPO did not alter key aspects of MPTP toxicokinetics ( Table
7218	MPO	myeloperoxidase	MPO	7.1	Together these findings indicate that MPO contributes to the pathogenic cascade of deleterious events responsible for
7218	MPO	myeloperoxidase	MPO	7.1	Surprisingly although alterations in MPO protein and enzymatic activity were only detected in the ventral
7218	MPO	myeloperoxidase	MPO	7.1	and fibers of nigrostriatal dopaminergic neurons were preserved in MPTP-injected MPO mice ( Fig 4
7218	MPO	myeloperoxidase	MPO	7.1	The relative resistance of dopaminergic neurons to MPTP-induced neurotoxicity in MPO mice was however not accompanied by a preservation of striatal
7218	MPO	myeloperoxidase	MPO	7.1	It is thus conceivable that although ablation of MPO attenuates the loss of TH protein (as as evidenced by
7218	MPO	myeloperoxidase	MPO	7.1	Targeting MPO alone may thus suffice to provide observable structural but not
7218	MPO	myeloperoxidase	MPO	7.1	combination of strategies capable of providing structural protection such as MPO inhibition with other strategies capable of protecting/stimulating protecting stimulating dopaminergic
7218	MPO	myeloperoxidase	MPO	7.1	Therefore whether MPO inhibition in PD can succeed not only in slowing neuronal
7218	MPO	myeloperoxidase	MPO	7.1	As to how MPO neurotoxic actions on dopaminergic neurons are mediated two distinct and
7218	MPO	myeloperoxidase	MPO	7.1	First and foremost MPO is known for its production of cytotoxic reactive oxygen species
7218	MPO	myeloperoxidase	MPO-derived	1.0	membrane proteins and lipids subjected to the deleterious effects of MPO-derived oxidants such as HOCl
7218	MPO	myeloperoxidase	MPO	7.1	Also supporting the oxidative role of MPO in the MPTP model is our immunohistochemical demonstration of HOCl-modified
7218	MPO	myeloperoxidase	MPO	7.1	Aside from this oxidative effect MPO can be secreted and bind CD11b/CD18 CD11b CD18 integrins to
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	CD11b	2.8	this oxidative effect MPO can be secreted and bind CD11b/CD18 CD11b CD18 integrins to the cell surface (Lau Lau et al.
6155	ITGB2	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	CD18	2.8	oxidative effect MPO can be secreted and bind CD11b/CD18 CD11b CD18 integrins to the cell surface (Lau Lau et al. 2005
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	CD11b	2.8	In the case of neutrophils ligation of CD11b/CD18 CD11b CD18 by MPO stimulates signaling pathways implicated in the activation
6155	ITGB2	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	CD18	2.8	In the case of neutrophils ligation of CD11b/CD18 CD11b CD18 by MPO stimulates signaling pathways implicated in the activation of
7218	MPO	myeloperoxidase	MPO	7.1	the case of neutrophils ligation of CD11b/CD18 CD11b CD18 by MPO stimulates signaling pathways implicated in the activation of these cells
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	CD11b	2.8	Because brain microglia do express CD11b/CD18 CD11b CD18 integrins and seem to participate in the neurodegenerative process
6155	ITGB2	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	CD18	2.8	Because brain microglia do express CD11b/CD18 CD11b CD18 integrins and seem to participate in the neurodegenerative process in
7218	MPO	myeloperoxidase	MPO	7.1	the MPTP model and in PD this cytokine-like effect of MPO may represent an additional mechanism by which dopaminergic neurons are
7218	MPO	myeloperoxidase	myeloperoxidase	1.0	here we show that myeloperoxidase mpo a key oxidant producing enzyme during inflammation is upregulated in the ventral midbrain of human pd and mptp mice.
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	nadph oxidase	1.0	for instance nadph oxidase and inducible nitric oxide synthase inos which are major sources of inflammatory oxidants are upregulated in damaged areas in both pd and the 1 methyl 4 phenyl 1 2 3 6 tetrahydropyridine mptp model o
7873	NOS2A	nitric oxide synthase 2A (inducible, hepatocytes)	nitric oxide synthase	1.0	for instance nadph oxidase and inducible nitric oxide synthase inos which are major sources of inflammatory oxidants are upregulated in damaged areas in both pd and the 1 methyl 4 phenyl 1 2 3 6 tetrahydropyridine mptp model of pd hunot et al. 1996 ; liberatore
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	nadph oxidase	1.0	studies of mice deficient in nadph oxidase or inos indicate that superoxide radical o 2 and no contribute to the mptp induced neurodegenerative process liberatore et al. 1999 ; wu et al. 2003 .
7218	MPO	myeloperoxidase	myeloperoxidase	1.0	conversely myeloperoxidase mpo and not onoo seems to promote o o ' dityrosine formation in this model of pd pennathur et al. 1999 .
132	ACTB	actin, beta	beta actin	1.0	total rna was extracted from selected brain regions and at selected time points after mptp and used for reverse transcription pcr analysis as described previously wu et al. 2003 beta actin were as follows: mpo 5' aggataggactggattgcctg 3' forward and 5' gtggtgatgccagtgttgtca 3' reverse ; beta actin 5' ctttgatgtcacgcacgatttc 3' forward and 5' gggccgctctaggcaccaa 3' reverse .
132	ACTB	actin, beta	beta actin	1.0	were as follows: mpo 5' aggataggactggattgcctg 3' forward and 5' gtggtgatgccagtgttgtca 3' reverse ; beta actin 5' ctttgatgtcacgcacgatttc 3' forward and 5' gggccgctctaggcaccaa 3' reverse .
132	ACTB	actin, beta	beta actin	1.0	mouse brain protein extracts from selected regions were prepared and used for western blot analysis as described previously wu et al. 2003 beta actin antibody 1:10 000; sigma st louis mo .
11782	TH	tyrosine hydroxylase	tyrosine hydroxylase	1.0	mouse mpo glial fibrillary acidic protein beta 2 integrin mac 1 cd116/cd18 neutrophil and tyrosine hydroxylase immunohistochemistry .
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	mac 1	1.0	mouse mpo glial fibrillary acidic protein beta 2 integrin mac 1 cd116/cd18 neutrophil and tyrosine hydroxylase immunohistochemistry .
4235	GFAP	glial fibrillary acidic protein	glial fibrillary acidic protein	1.0	mouse mpo glial fibrillary acidic protein beta 2 integrin mac 1 cd116/cd18 neutrophil and tyrosine hydroxylase immunohistochemistry .
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	mac 1	1.0	the primary antibodies used were rabbit polyclonal anti mpo 1:500; lab vision fremont ca rabbit polyclonal anti glial fibrillary acidic protein gfap; 1:500; chemicon temecula ca mouse monoclonal anti mac 1 1:1000; serotec raleigh nc and the monoclonal rat anti mouse neutrophil antibody mca771ga 1:100; serotec .
4235	GFAP	glial fibrillary acidic protein	glial fibrillary acidic protein	1.0	the primary antibodies used were rabbit polyclonal anti mpo 1:500; lab vision fremont ca rabbit polyclonal anti glial fibrillary acidic protein gfap; 1:500; chemicon temecula ca mouse monoclonal anti mac 1 1:1000; serotec raleigh nc and the monoclonal rat anti mouse neutrophil antibody mca771ga 1:100; serotec .
11782	TH	tyrosine hydroxylase	tyrosine hydroxylase	1.0	for quantitative tyrosine hydroxylase th immunostaining mice were killed 7 d after mptp.
6149	ITGAM	integrin, alpha M (complement component 3 receptor 3 subunit)	mac 1	1.0	j l in contrast ventral midbrain mpo positive structures i red are not mac 1 positive j green as evidenced by the overlay k and the mask of colocalized pixels l .
132	ACTB	actin, beta	beta actin	1.0	like in mice there was no significant difference in mpo to beta actin ratios in the striatum pd 1.1 _amp_#177; 0.8 vs controls 1.4 _amp_#177; 0.8; p > 0.05; n = 7 or cerebellum pd 0.8 _amp_#177; 0.2 vs controls 1.0 _amp_#177; 0.3; p > 0.05; n = 7 between the pd and con
132	ACTB	actin, beta	beta actin	1.0	conversely we found that caudate nucleus tissues from stage 4 hd patients had higher gfap to beta actin ratios hd 0.7 _amp_#177; 0.1 vs controls 0.1 _amp_#177; 0.1; p _lt_ 0.01; n = 3 4 as well as mpo to beta actin ratios hd 0.8 _amp_#177; 0.2 vs controls 0.2 _amp_#177; 0.1; p _lt_ 0.05; n = 5 6 .
132	ACTB	actin, beta	beta actin	1.0	ratios hd 0.7 _amp_#177; 0.1 vs controls 0.1 _amp_#177; 0.1; p _lt_ 0.01; n = 3 4 as well as mpo to beta actin ratios hd 0.8 _amp_#177; 0.2 vs controls 0.2 _amp_#177; 0.1; p _lt_ 0.05; n = 5 6 .
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	nadph oxidase	1.0	remarkably detectable changes in inos expression and enzymatic activity are also confined to ventral midbrains of mptp injected mice liberatore et al. 1999 whereas activation of nadph oxidase is observed in both ventral midbrains and striata of these animals wu et al. 2003 .