#sen2geneID pmid senID geneID hgncID approvedSymbol matchString actualString startPos score flankingText matchCodeID tag SciMinerVersion SciMinerMethod inExClude inExCludeCond phenotypeOnly conflictCode hgncIDbyNR NRText editTag editUser oldGeneID oldHgncID oldApprovedSymbol oldInExClude oldInExCludeCond 305252 3772394 443573 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 significant increase in immunosuppressive acidic protein iap in serum of patients with multiple sclerosis and other inflammatory neurological disorders. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 305253 3772394 443574 15848 8499 ORM2 alpha-1-acid glycoprotein alpha 1 acid glycoprotein 0 1.0 iap a type of alpha 1 acid glycoprotein is mainly produced by macrophages when stimulated in the presence of circulating immune complexes or some inflammatory substances. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 305254 3772394 443577 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 in multiple sclerosis patients however iap increased during exacerbation 630 +/ 191 and decreased during the inactive stage 433 +/ 170 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 299703 7836946 429575 10480 5962 IL10 il 10 il 10 0 1.0 intrathecal synthesis of interleukin 10 il 10 in viral and inflammatory diseases of the central nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299704 7836946 429575 10480 5962 IL10 interleukin 10 interleukin 10 0 1.0 intrathecal synthesis of interleukin 10 il 10 in viral and inflammatory diseases of the central nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299705 7836946 429576 10480 5962 IL10 il 10 il 10 0 1.0 the intrathecal synthesis of interleukin 10 il 10 was investigated in 120 paired cerebrospinal fluid csf and serum specimens from patients with various inflammatory and non inflammatory diseases of the central nervous system cns . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299706 7836946 429576 10480 5962 IL10 interleukin 10 interleukin 10 0 1.0 the intrathecal synthesis of interleukin 10 il 10 was investigated in 120 paired cerebrospinal fluid csf and serum specimens from patients with various inflammatory and non inflammatory diseases of the central nervous system cns . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299707 7836946 429577 10480 5962 IL10 il 10 il 10 0 1.0 il 10 was not demonstrated in the sera but detectable levels were found in the csf from: patients with acute viral "aseptic" meningitis but only within 48 72 h of symptom onset; human immunodeficiency viru 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299708 7836946 429577 10480 5962 IL10 il 10 il 10 0 1.0 cted patients with hiv related encephalitis/leukoencephalopathy or cryptococcal meningitis; a patient with primary b cell lymphoma of the cns and a patient with encephalomeningeal sarcoidosis in whom il 10 was demonstrated in all csf collected over a period of 6 months . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299709 7836946 429578 10480 5962 IL10 il 10 il 10 0 1.0 in chronic meningeal infections/inflammations il 10 seems to be continuously produced within the csf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299710 7836946 429579 10480 5962 IL10 il 10 il 10 0 1.0 our findings suggest that il 10 a cytokine which exerts many immunosuppressive actions may play different immunomodulatory roles in cns diseases; in particular its intrathecal synthesis may explain why some infectious and inflammat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297406 8605177 424637 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 human mitochondrial manganese superoxide dismutase polymorphic variant ile58thr reduces activity by destabilizing the tetrameric interface. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297407 8605177 424637 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 human mitochondrial manganese superoxide dismutase polymorphic variant ile58thr reduces activity by destabilizing the tetrameric interface. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297408 8605177 424638 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 human manganese superoxide dismutase mnsod is a homotetrameric enzyme which protects mitochondria against oxygen mediated free radical damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297409 8605177 424638 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 human manganese superoxide dismutase mnsod is a homotetrameric enzyme which protects mitochondria against oxygen mediated free radical damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297410 8605177 424648 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296756 9086508 423597 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 neurotrophic factors ntfs such as nerve growth factor ngf brain derived neurotrophic factor bdnf and ciliary neurotrophic factor cntf are currently being explored as novel therapeutics in a range of neurodegenerative disorders such as amyotrophic lateral sclerosis als and alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296757 9086508 423597 4649 2169 CNTF ciliary neurotrophic factor ciliary neurotrophic factor 0 1.0 neurotrophic factors ntfs such as nerve growth factor ngf brain derived neurotrophic factor bdnf and ciliary neurotrophic factor cntf are currently being explored as novel therapeutics in a range of neurodegenerative disorders such as amyotrophic lateral sclerosis als and alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296758 9086508 423597 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 neurotrophic factors ntfs such as nerve growth factor ngf brain derived neurotrophic factor bdnf and ciliary neurotrophic factor cntf are currently being explored as novel therapeutics in a range of neurodegenerative disorders such as amyotrophic latera 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296759 9086508 423597 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 neurotrophic factors ntfs such as nerve growth factor ngf brain derived neurotrophic factor bdnf and ciliary neurotrophic factor cntf are currently being explored as novel therapeutics in a range of neurodegenerative disorders such as amyotrophic lateral sclerosis als and alzheimer's diseas 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296760 9086508 423606 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 brain derived neurotrophic factor|ciliary neurotrophic factor|nerve growth factors|nerve tissue proteins| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296761 9086508 423606 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 brain derived neurotrophic factor|ciliary neurotrophic factor|nerve growth factors|nerve tissue proteins| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296076 9125377 422219 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 ad vectors may not be easily used either in diseases displaying major immune dysfunction e.g multiple sclerosis . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 293254 9339959 416950 10456 6011 IL3 interleukin 3 interleukin 3 0 1.0 haemopoietic growth factors like granulocyte macrophage colony stimulating factor gm csf or interleukin 3 prevent apoptosis in target cells and modulation of levels of these factors has been tried in the prevention of chemotherapy induced myelosuppression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293255 9339959 416950 5010 2434 CSF2 granulocyte-macrophage colony stimulating factor granulocyte macrophage colony stimulating factor 0 1.0 haemopoietic growth factors like granulocyte macrophage colony stimulating factor gm csf or interleukin 3 prevent apoptosis in target cells and modulation of levels of these factors has been tried in the prevention of chemotherapy induced myelosuppression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293256 9339959 416950 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 haemopoietic growth factors like granulocyte macrophage colony stimulating factor gm csf or interleukin 3 prevent apoptosis in target cells and modulation of levels of these factors has been tried in the prevention of chemotherapy induced myelosuppression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293257 9339959 416950 5010 2434 CSF2 gm csf gm csf 0 1.0 haemopoietic growth factors like granulocyte macrophage colony stimulating factor gm csf or interleukin 3 prevent apoptosis in target cells and modulation of levels of these factors has been tried in the prevention of chemotherapy induced myelosuppression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293258 9339959 416962 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 hematopoietic cell growth factors|interleukin 3|granulocyte macrophage colony stimulating factor| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288496 9562310 408233 10463 6018 IL6 il 6 il 6 0 1.0 we assayed il 6 in 105 cerebrospinal fluid csf samples from patients with als ms htlv 1 associated myelopathy ham and controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288497 9562310 408234 10463 6018 IL6 il 6 il 6 0 1.0 there was considerable overlap in il 6 levels in all patient groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288498 9562310 408235 10463 6018 IL6 il 6 il 6 0 1.0 the mean il 6 in 27 patients with als was significantly higher than in 21 patients in the other neurological disease ond group p=0.0075 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288499 9562310 408237 551 399 ALB albumin albumin 0 1.0 overall csf il 6 correlated with protein concentration but not with percentage igg or igg albumin index. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288500 9562310 408237 10463 6018 IL6 il 6 il 6 0 1.0 overall csf il 6 correlated with protein concentration but not with percentage igg or igg albumin index. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288501 9562310 408238 10463 6018 IL6 il 6 il 6 0 1.0 patients with csf oligoclonal bands were no more likely to have detectable il 6 than patients without oligoclonal bands. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288502 9562310 408239 10463 6018 IL6 il 6 il 6 0 1.0 similarly il 6 did not correlate with clinical disease activity in ms when subgroups of patients were compared or when an individual patient was followed over time. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288503 9562310 408240 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 the elevated il 6 in als may reflect an ongoing humoral immune response or il 6 may be non specifically expressed in these patients as a putative neurotrophic factor in response to nerve cell degeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288504 9562310 408240 10463 6018 IL6 il 6 il 6 0 1.0 the elevated il 6 in als may reflect an ongoing humoral immune response or il 6 may be non specifically expressed in these patients as a putative neurotrophic factor in response to nerve cell degeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288505 9562310 408243 10463 6018 IL6 il 6 il 6 0 1.0 il 6 is a b cell differentiation factor that was first described by hirano et al. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288506 9562310 408246 10463 6018 IL6 il 6 il 6 0 1.0 cerebrospinal fluid csf levels of il 6 are consistently elevated in herpes simplex virus encephalitis and other bacterial and viral cns infections houssiau et al. 1988 and frei et al. 1988 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288507 9562310 408248 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 ted in experimental allergic encephalomyelitis csf gijbels et al. 1990 and systemic lupus erythematosus with central nervous system involvement hirohata and miyamoto 1990 but il 6 was not detected in multiple sclerosis ms houssiau et al. 1988 ; frei et al. 1988 and araga et al. 1991 or detected no more frequently than in neurological disease controls hauser et al. 1990 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 288508 9562310 408248 20402 18176 SLEV1 systemic lupus erythematosus systemic lupus erythematosus 0 1.0 il 6 was detected in experimental allergic encephalomyelitis csf gijbels et al. 1990 and systemic lupus erythematosus with central nervous system involvement hirohata and miyamoto 1990 but il 6 was not detected in multiple sclerosis ms houssiau et al. 1988 ; frei et al. 1988 and araga et al. 1991 or detected no more 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 288509 9562310 408248 10463 6018 IL6 il 6 il 6 0 1.0 il 6 was detected in experimental allergic encephalomyelitis csf gijbels et al. 1990 and systemic lupus erythematosus with central nervous system involvement hirohata and miyamoto 1990 but il 6 was not detected in multiple sclerosis ms houssiau et al. 1988 ; frei et al. 1988 and araga et al. 1991 or detected no more frequently than in neurological disease controls hauser et al. 1990 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288510 9562310 408249 10463 6018 IL6 il 6 il 6 0 1.0 reports of il 6 in non inflammatory cns disease prompted the present study of csf in patients with amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288511 9562310 408250 10463 6018 IL6 il 6 il 6 0 1.0 we found a higher frequency of detection and higher levels of il 6 in als than in the other neurological disease control group. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288512 9562310 408251 10463 6018 IL6 il 6 il 6 0 1.0 in contrast there was no significant difference in csf il 6 in either ms or ham patients compared to other neurological disease controls and there was no correlation of csf immune parameters and il 6 levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288513 9562310 408252 10463 6018 IL6 il 6 il 6 0 1.0 these results are consistent with the hypothesis that csf il 6 in als has an non immune origin occurring as a neurotrophic response to nerve cell damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288514 9562310 408265 10463 6018 IL6 il 6 il 6 0 1.0 the il 6 dependent hybridoma cell line mh6obsf2 matsuda et al. 1988 was cloned four times. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288515 9562310 408268 10463 6018 IL6 il 6 il 6 0 1.0 without il 6 in the media no viable cells remained in this subclone by 72 h of culture. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288516 9562310 408272 10463 6018 IL6 il 6 il 6 0 1.0 il 6 was quantitated by reference to a dose calibration curve of recombinant human il 6 kindly supplied by drs hirano and kishimoto assayed with mh6obsf2 cells under the same conditions as the csf samples. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288517 9562310 408274 10463 6018 IL6 il 6 il 6 0 1.0 csf il 6 values were expressed as log 1 0 pg/ml. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288518 9562310 408275 10463 6018 IL6 il 6 il 6 0 1.0 the sensitivity of il 6 detection was determined to be 1.6 pg/ml. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288519 9562310 408276 10437 5992 IL1B il 1 il 1 0 1.0 specificity of the assay was confirmed by showing no mitogenic response with other recombinant human cytokines il 1 il 1_amp_#x3b2; il 2 tnf and abrogating the il 6 effect by anti il 6 polyclonal antibody genzyme boston ma . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288520 9562310 408276 10452 6001 IL2 il 2 il 2 0 1.0 specificity of the assay was confirmed by showing no mitogenic response with other recombinant human cytokines il 1 il 1_amp_#x3b2; il 2 tnf and abrogating the il 6 effect by anti il 6 polyclonal antibody genzyme boston ma . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288521 9562310 408276 10463 6018 IL6 il 6 il 6 0 1.0 specificity of the assay was confirmed by showing no mitogenic response with other recombinant human cytokines il 1 il 1_amp_#x3b2; il 2 tnf and abrogating the il 6 effect by anti il 6 polyclonal antibody genzyme boston ma . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288522 9562310 408277 551 399 ALB albumin albumin 0 1.0 igg and albumin in sera and csf were measured by electro immunoassay tibbling et al. 1977 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288523 9562310 408278 551 399 ALB albumin albumin 0 0.0 igg index was determined by the quotient csf igg/serum igg divided by the quotient csf albumin/serum albumin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288524 9562310 408278 551 399 ALB serum albumin serum albumin 0 1.0 igg index was determined by the quotient csf igg/serum igg divided by the quotient csf albumin/serum albumin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288525 9562310 408284 10463 6018 IL6 il 6 il 6 0 1.0 because of the lower boundary of detectability of 1.6 pg/ml for the il 6 assay or log 1 0 il 6 of 0.2 non parametric techniques were used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288526 9562310 408292 10463 6018 IL6 il 6 il 6 0 1.0 as shown in fig. 1 there was considerable overlap in il 6 levels in all patient groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288527 9562310 408294 10463 6018 IL6 il 6 il 6 0 1.0 table 2 shows il 6 detection in 78% of 27 patients with als median log 1 0 il 6 of 1.01 55% of 20 patients with ms median 0.94 59% of 17 patients with ham median 0.905 48% of 21 patients with other neurological diseases median 0.825 and 25% of the non neurological disease contro 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288528 9562310 408295 10463 6018 IL6 il 6 il 6 0 1.0 analysis by the non parametric wilcoxon rank sum test showed a significant difference in csf il 6 between the als and ond group p =0.0075 but no significant difference between ms and ond p =0.55 or ham and the ond group p =0.47 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288529 9562310 408296 10463 6018 IL6 il 6 il 6 0 1.0 the als ms and ham groups all had statistically significant higher mean il 6 levels than the non neurological disease control: p _amp_#x3c;0.0001 for the als group p =0.03 for the ms group and p =0.03 for the ham group. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288530 9562310 408297 10463 6018 IL6 il 6 il 6 0 1.0 the greatest csf il 6 level in the als group log 1 0 il 6 of 2.55 was a sample from the national neurological research bank. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288531 9562310 408299 10463 6018 IL6 il 6 il 6 0 1.0 although these results failed to show a higher mean il 6 level in patients with recognized immune mediated cns disease ms and ham groups this failure may be because of the relatively small number of patients in these groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288532 9562310 408300 10463 6018 IL6 il 6 il 6 0 1.0 to determine if il 6 varies with the activity of immune mediated disease data from the ms patients were analyzed depending on whether the disease was in clinical relapse or was stable or in remission. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288533 9562310 408301 10463 6018 IL6 il 6 il 6 0 1.0 the results in fig. 2 show no significant difference in csf il 6 levels with 7 of 12 patients in relapse having detectable il 6 compared to 4 of 8 patients with ms in remission or with stable disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288534 9562310 408305 10463 6018 IL6 il 6 il 6 0 1.0 despite these csf changes consistent with fluctuating immune mediated activity in the cns the csf il 6 levels remained at undetectable levels in all four spinal taps. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288535 9562310 408306 10463 6018 IL6 il 6 il 6 0 1.0 to evaluate further any correlation of csf il 6 with the extent of immune mediated activity in the cns csf parameters were compared in patients with and without detectable il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288536 9562310 408307 10463 6018 IL6 il 6 il 6 0 1.0 there was a significantly higher total igg in ms patients with detectable il 6 levels not shown but this correlation was not seen in any of the other patient groups and did not hold when data were combined for all four groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288537 9562310 408308 10463 6018 IL6 il 6 il 6 0 1.0 similarly the percent igg was higher in the als group with detectable il 6 but not in the combined patient group not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288538 9562310 408310 10463 6018 IL6 il 6 il 6 0 1.0 only total csf protein was significantly higher in patients with detectable il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288539 9562310 408311 10463 6018 IL6 il 6 il 6 0 1.0 as shown in table 3 ; mean csf protein in patients with detectable il 6 was 49.0_amp_#xb1;3.8 compared to 33.2_amp_#xb1;3.0 in patients with undetectable il 6 p _amp_#x3c;0.01 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288540 9562310 408312 10463 6018 IL6 il 6 il 6 0 1.0 fig. 4 shows csf il 6 levels in 35 patients with ms or ham who had either oligoclonal bands in the csf 14 patients or did not have oligoclonal bands 21 patients . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288541 9562310 408313 10463 6018 IL6 il 6 il 6 0 1.0 although the il 6 level was slightly higher in patients without oligoclonal bands and the percentage of detectable il 6 was higher 67% versus 43% these differences were not statistically significant. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288542 9562310 408316 10463 6018 IL6 il 6 il 6 0 1.0 we found a modest but statistically significant elevation of csf il 6 in als patients fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288543 9562310 408318 10463 6018 IL6 il 6 il 6 0 1.0 in comparing these studies a similar percentage of als patients had undetectable csf il 6 6/27 versus 2/15 ; but 37% of our patients had il 6 levels greater than 10 pg/ml compared to only 7% in the published study. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288544 9562310 408319 10463 6018 IL6 il 6 il 6 0 1.0 the il 6 levels in als csf less than 0.96 log 10 pg/ml were considerably lower than levels we detected in 8 patients with herpes simplex encephalitis 1.76 log 1 0 pg/ml sekizawa unpublished . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288545 9562310 408323 10463 6018 IL6 il 6 il 6 0 1.0 nevertheless the modest il 6 elevation noted here may be related to an ongoing humoral immune response in some patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288546 9562310 408324 20402 18176 SLEV1 systemic lupus erythematosus systemic lupus erythematosus 0 1.0 serum il 6 was not measured in als but prior studies have shown that il 6 can concentrate in the csf compartment e.g during active cns systemic lupus erythematosus hirohata and miyamoto 1990 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 288547 9562310 408324 10463 6018 IL6 il 6 il 6 0 1.0 serum il 6 was not measured in als but prior studies have shown that il 6 can concentrate in the csf compartment e.g during active cns systemic lupus erythematosus hirohata and miyamoto 1990 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288548 9562310 408325 10463 6018 IL6 il 6 il 6 0 1.0 il 6 along with tnf has been reported to be highly expressed in perivascular inflammatory cells around ms demyelinating plaques woodroofe and cuzner 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288549 9562310 408326 10463 6018 IL6 il 6 il 6 0 1.0 in spite of this expression we did not find a statistically significant elevation of il 6 in ms csf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288550 9562310 408327 10463 6018 IL6 il 6 il 6 0 1.0 moreover we were unable to document an increase in il 6 during active disease both within a group of ms patients fig 2 and in a single patient followed over time fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288551 9562310 408330 551 399 ALB albumin albumin 0 1.0 and the inability of others araga et al. 1991 ; laurenzi et al. 1990 and maimone et al. 1991 to correlate il 6 and csf parameters of immune mediated disease including percentage igg and elevated igg albumin index table 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288552 9562310 408330 10463 6018 IL6 il 6 il 6 0 1.0 however inaccuracies in detecting active disease do not explain our inability and the inability of others araga et al. 1991 ; laurenzi et al. 1990 and maimone et al. 1991 to correlate il 6 and csf parameters of immune mediated disease including percentage igg and elevated igg albumin index table 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288553 9562310 408331 10463 6018 IL6 il 6 il 6 0 1.0 the overall results in the ms and ham patients suggests either: i il 6 does not play a major role in these disease; or ii detection of il 6 is unreliable in the csf of immune mediated cns parenchymal disease because of instability or because il 6 from brain in these disease does not enter the csf compartment . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288554 9562310 408331 10463 6018 IL6 il 6 il 6 0 1.0 is unreliable in the csf of immune mediated cns parenchymal disease because of instability or because il 6 from brain in these disease does not enter the csf compartment . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288555 9562310 408332 10463 6018 IL6 il 6 il 6 0 1.0 it is possible that the il 6 elevation in als is of non immune origin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288556 9562310 408333 10463 6018 IL6 il 6 il 6 0 1.0 il 6 has been shown to induce neuronal differentiation satoh et al. 1988 and play a neurotrophic role hama et al. 1989 in tissue culture systems. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288557 9562310 408334 10463 6018 IL6 il 6 il 6 0 1.0 moreover il 6 has been shown to increase in brain in response to injury woodroofe et al. 1991 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288558 9562310 408335 10463 6018 IL6 il 6 il 6 0 1.0 we speculate that il 6 may be produced by astrocytes or microglial cells in als as a non specific response to degeneration of motor neurons or other cns cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288559 9562310 408336 10463 6018 IL6 il 6 il 6 0 1.0 this non specific effect may explain the slightly higher levels of il 6 in ond controls compared to non neurological disease controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288560 9562310 408337 10463 6018 IL6 il 6 il 6 0 1.0 future studies of multiple cytokine expression in als and other neurological disease would be helpful to distinguish an immune versus a non immune origin of il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288561 9562310 408339 10463 6018 IL6 il 6 il 6 0 1.0 csf il 6 levels in als ms including relapsing remitting and stable disease ham ond and non neurological disease control control groups with bars indicating the mean_amp_#xb1;standard error of the mean in each 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288562 9562310 408343 10463 6018 IL6 il 6 il 6 0 1.0 csf il 6 levels in ms patients with either relapsing or remitting/stable disease with bars indicating the mean_amp_#xb1;standard error of the mean in the two patient groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288563 9562310 408348 10463 6018 IL6 il 6 il 6 0 1.0 csf il 6 levels in ms or ham patients that either have ocb+ or do not have ocb_amp_#x2212; oligoclonal bands in the csf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 288564 9562310 408350 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 interleukin 6| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 282633 9762518 398369 4313 1929 CHGA chromogranin a chromogranin a 0 1.0 activated microglia have been shown to be toxic to neurons in culture and some materials found in ad lesions namely chromogranin a taupenot et al . 1996 and _amp_#x3b2; amyloid protein klegeris et al . 1994 as well as complement proteins have been found to activate microglia in vitro. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 282634 9762518 398379 6895 3530 F12 hageman factor hageman factor 0 1.0 others are amyloid p c reactive protein and the hageman factor mcgeer and mcgeer 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 282635 9762518 398379 4959 2367 CRP c-reactive protein c reactive protein 0 1.0 others are amyloid p c reactive protein and the hageman factor mcgeer and mcgeer 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 282636 9762518 398414 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 1.0 they used twins and individuals genotyped for apolipoprotein e4 an established risk factor for ad roses 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273831 10417811 383073 16700 9030 PLA2G1B phospholipase a2 phospholipase a2 0 0.0 cytosolic phospholipase a2 is induced in reactive glia following different forms of neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273832 10417811 383073 16707 9035 PLA2G4A cytosolic phospholipase a2 cytosolic phospholipase a2 0 1.0 cytosolic phospholipase a2 is induced in reactive glia following different forms of neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273833 10417811 383077 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 alization of cytosolic phospholipase a 2 in the cns following: 1 focal and global cerebral ischemia 2 facial nerve axotomy 3 human cases of alzheimer's disease 4 transgenic mice overexpressing mutant superoxide dismutase a mouse model of amyotrophic lateral sclerosis and 5 transgenic mice overexpressing mutant amyloid precursor protein which exhibits age related amyloid deposition characteristic of alzheimer's diseas 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273834 10417811 383085 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein precursor|isoenzymes|nerve tissue proteins|superoxide dismutase|phospholipases a|phospholipases a2| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275737 10525172 386981 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 inflammatory reaction is thought to be an important contributor to neuronal damage in neurodegenerative disorders such as alzheimer's disease ad parkinson's disease pd multiple sclerosis ms amyotrophic lateral sclerosis als and the parkinsonism dementia complex of guam. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 275738 10525172 386988 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 many proteins known to be involved in inflammatory processes with senile plaques and microfibrillary tangles in chronic neurodegenerative disorders like alzheimer's disease ad parkinson's disease pd multiple sclerosis ms amyotrophic lateral sclerosis als and the parkinsonism dementia complex of guam is consistent with the autotoxic loop hypothesis developed by mcgeer and mcgeer [ 56 57 ] fig 1 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 275739 10525172 387001 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 because nitric oxide reacts with o 2 _amp_#x2212; three fold faster than superoxide dismutase sod k =2.3_amp_#xd7;10 9 m _amp_#x2212;1 s _amp_#x2212;1 no is the only known biomolecule capable of out competing sod for available o 2 _amp_#x2212; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275740 10525172 387015 1184 746 ASL argininosuccinate lyase argininosuccinate lyase 0 1.0 the citrulline formed can leave the cell or be converted back to arginine via the enzymes argininosuccinate lyase located in bergmann glia and argininosuccinate synthetase located in basket cells stellate cells golgi cells and mossy fibers. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275741 10525172 387015 1203 758 ASS1 argininosuccinate synthetase argininosuccinate synthetase 0 1.0 the citrulline formed can leave the cell or be converted back to arginine via the enzymes argininosuccinate lyase located in bergmann glia and argininosuccinate synthetase located in basket cells stellate cells golgi cells and mossy fibers. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275742 10525172 387019 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 be formed as a by product of the mitochondrial respiratory chain generated primarily by autoxidation of flavoproteins [ 78 ] fig 4 or during the respiratory burst of phagocytes via the activation of nadph oxidase [ 48 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275743 10525172 387026 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 moreover excess no may also promote an increase of o 2 _amp_#x2212; production by binding to the heme moiety of the cytochrome c oxidase the complex iv of the electron transport chain in the mitochondrial membrane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275744 10525172 387026 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 moreover excess no may also promote an increase of o 2 _amp_#x2212; production by binding to the heme moiety of the cytochrome c oxidase the complex iv of the electron transport chain in the mitochondrial membrane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275745 10525172 387036 10437 5992 IL1B il 1 il 1 0 1.0 microglial cells can be activated by pro inflammatory cytokines il 1 il 6 and tnf_amp_#x3b1; as well as by _amp_#x3b2; amyloid peptide _amp_#x3b2; a [ 82 90 ] the first 42 amino acids of amyloid precursor protein app fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275746 10525172 387036 10463 6018 IL6 il 6 il 6 0 1.0 microglial cells can be activated by pro inflammatory cytokines il 1 il 6 and tnf_amp_#x3b1; as well as by _amp_#x3b2; amyloid peptide _amp_#x3b2; a [ 82 90 ] the first 42 amino acids of amyloid precursor protein app fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275747 10525172 387079 14282 7739 NEFL nf l nf l 0 1.0 these investigators also showed that the motor neuron protein neurofilament nf l could bind zinc atoms with sufficient affinity to potentially remove zinc from sod and that the loss of zinc from wild type sod almost doubled the efficiency of this enzyme for catalyzing for peroxyn 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275748 10525172 387082 14282 7739 NEFL nf l nf l 0 1.0 however strong et al. [ 81 ] recently reported that there were no significant qualitative or quantitative modifications in the nitrotyrosine immunoreactivity of nf l isolated from sporadic als cervical spinal cord tissue as compared with age matched non als controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275749 10525172 387085 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 275750 10525172 387114 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 ara et al. [ 3 ] observed the inactivation of tyrosine hydroxylase by nitration following exposure of pc 12 cells to either peroxynitrite or mptp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275751 10525172 387117 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 barker et al. [ 5 ] demonstrated the susceptibility of glutathione reductase the enzyme which regenerates glutathione from its oxidized form to peroxynitrite. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275752 10525172 387131 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 s primary neuronal insult can activate microglial cells and initiate the second step of the neurodegenerative process by induction of type ii nos which produces large amounts of no and stimulation of nadph oxidase which produces o 2 _amp_#x2212; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275753 10525172 387136 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 these authors observed an expression of type iii nos but not of type i nos by motor neurons cultured with brain derived neurotrophic factor bdnf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275754 10525172 387136 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 these authors observed an expression of type iii nos but not of type i nos by motor neurons cultured with brain derived neurotrophic factor bdnf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 275755 10525172 387157 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 schematic representation of the nitric oxide synthase monomer. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253034 11173059 346405 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 the presence of the glur2 subunit makes the ampa receptor impermeable to ca 2+ preventing a cascade of potentially toxic events triggered by the intracellular influx of ca 2+ ions through glutamate receptor ion channels day et al. 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253035 11173059 346408 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 the second feature is the lack of the ca 2+ binding proteins calbindin d28k and parvalbumin in those motor neurons that are mostly affected by amyotrophic lateral sclerosis alexianu et al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253036 11173059 346412 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 ten percent of amyotrophic lateral sclerosis cases are of familial origin and 15_amp_#x2013;20% of such families show mutations of the cu 2+ /zn 2+ superoxide dismutase gene brown 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253037 11173059 346414 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations of the superoxide dismutase gene are also found in rare cases of sporadic amyotrophic lateral sclerosis accounting for 2% of cases brown 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253038 11173059 346416 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 however the use of transgenic mouse models expressing different human superoxide dismutase mutated proteins and superoxide dismutase gene knockout mice shows that a loss of function is not the case borchelt and reaume . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253039 11173059 346417 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 on the contrary several lines of evidence support the hypothesis of a toxic gain of function acquired by the mutant superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253040 11173059 346418 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations may induce structural changes of the superoxide dismutase causing polypeptide unfolding around the active site with abnormal entry of reactive species i.e. c oono and subsequent nitration of tyrosine residues crow et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253041 11173059 346419 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 alternatively increased accessibility to the cu 2+ active site of the mutant superoxide dismutase may lead to the use of additional substrates such as hydrogen peroxide and peroxynitrite with the production of highly toxic hydroxyl radicals wiedau pazos et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253042 11173059 346421 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the oxidative stress hypothesis may warrant the search for superoxide dismutase gene mutations in patients with amyotrophic lateral sclerosis regardless of whether it is the sporadic or familial form before treatment is started. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253043 11173059 346422 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 if abnormal superoxide dismutase activity is demonstrated potential therapeutic approaches may include administration of free radical scavenging drugs or cu 2+ chelators table 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253044 11173059 346423 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 inhibition of the cu 2+ chaperone for superoxide dismutase a specific protein involved in cu 2+ acquisition by superoxide dismutase could also prevent cu 2+ mediated toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253045 11173059 346425 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 gene therapy represents a potential future perspective for superoxide dismutase related amyotrophic lateral sclerosis forms although the simple transfection of the wild type superoxide dismutase gene may not be sufficient to cure the disease as inactivation of mutated superoxide dismutase might be needed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253046 11173059 346425 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 gene may not be sufficient to cure the disease as inactivation of mutated superoxide dismutase might be needed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253047 11173059 346429 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 such neurofilaments are often phosphorylated and may also be found within intracellular inclusions in motor neurons of patients with superoxide dismutase related familial amyotrophic lateral sclerosis manetto and murayama . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253048 11173059 346430 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 neurofilaments may also represent a favorite target for the mutated superoxide dismutase as their light subunits are more susceptible to superoxide dismutase catalyzed nitration than are other proteins of the central nervous system crow et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253049 11173059 346434 14282 7739 NEFL neurofilament light neurofilament light 0 1.0 moreover transgenic mice expressing increased quantities of neurofilament light or heavy subunits develop motor neuron pathology cote and xu . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253050 11173059 346465 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 in the next few years research will probably discover new and more efficacious glutamate receptor antagonists or release inhibitors and we might witness the deployment of gene therapy approaches to reduce motor neuron vulnerability to glutamatergic excitoxicity in amyotrophic lateral sclerosis pa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253051 11173059 346466 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 the glur2 subunit of the ampa glutamate receptor and/or the calcium binding proteins calbindin d28k and parvalbumin seem to be reasonable targets: increasing the expression of such genes may improve the survival of residual motor neurons in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253052 11173059 346466 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 the glur2 subunit of the ampa glutamate receptor and/or the calcium binding proteins calbindin d28k and parvalbumin seem to be reasonable targets: increasing the expression of such genes may improve the survival of residual motor neurons in amyotro 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253053 11173059 346473 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 in addition abnormal ca 2+ entry into motor neurons may be aggravated by their constitutive lack of ca 2+ binding proteins i.e. calbinding d28k and parvalbumin . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253054 11173059 346482 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 neurotrophic factors such as brain derived neurotrophic factor bdnf ciliary neurotrophic factor cntf and insulin like growth factor 1 igf 1 enhance motor neuron survival in vitro and can also exert beneficial effects in mouse models of amyotrophic lateral sclerosis reviewed in yuen and mobley 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253055 11173059 346482 4649 2169 CNTF ciliary neurotrophic factor ciliary neurotrophic factor 0 1.0 neurotrophic factors such as brain derived neurotrophic factor bdnf ciliary neurotrophic factor cntf and insulin like growth factor 1 igf 1 enhance motor neuron survival in vitro and can also exert beneficial effects in mouse models of amyotrophic lateral sclerosis reviewed in yuen and mobley 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253056 11173059 346482 10601 6081 INS insulin insulin 0 0.0 neurotrophic factors such as brain derived neurotrophic factor bdnf ciliary neurotrophic factor cntf and insulin like growth factor 1 igf 1 enhance motor neuron survival in vitro and can also exert beneficial effects in mouse models of amyotrophic lateral sclerosis reviewed in yuen and mobley 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253057 11173059 346482 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 neurotrophic factors such as brain derived neurotrophic factor bdnf ciliary neurotrophic factor cntf and insulin like growth factor 1 igf 1 enhance motor neuron survival in vitro and can also exert beneficial effects in mouse models of amyotrophic lateral sclerosis reviewed in yuen and mobley 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253058 11173059 346482 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 neurotrophic factors such as brain derived neurotrophic factor bdnf ciliary neurotrophic factor cntf and insulin like growth factor 1 igf 1 enhance motor neuron survival in vitro and can also exert beneficial effects in mouse models of amyotrophic lateral sclerosis reviewed in yuen and mobley 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253059 11173059 346482 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 neurotrophic factors such as brain derived neurotrophic factor bdnf ciliary neurotrophic factor cntf and insulin like growth factor 1 igf 1 enhance motor neuron survival in vitro and can also exert beneficial effects in mouse models of amyotrophic lateral sclero 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253060 11173059 346490 11824 6596 LIF leukemia inhibitory factor leukemia inhibitory factor 0 1.0 however the mutation of the cntf gene may be deleterious when associated with mutations of other relevant genes such as leukemia inhibitory factor lif sendtner et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253061 11173059 346491 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 lif is another neurotrophic factor for motor neurons and a mutation of the lif gene has been detected in a small minority of amyotrophic lateral sclerosis patients giess et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253062 11173059 346496 1576 990 BCL2 bcl 2 bcl 2 0 1.0 these findings include evidence of dna fragmentation a biochemical marker of apoptosis the altered expression of mrna for bcl 2 and bax an anti apoptotic and a proapoptotic gene respectively and the demonstration of caspase 1 and caspase 3 activation which are specific intracellular proteases responsible for the execution of 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253063 11173059 346496 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 nclude evidence of dna fragmentation a biochemical marker of apoptosis the altered expression of mrna for bcl 2 and bax an anti apoptotic and a proapoptotic gene respectively and the demonstration of caspase 1 and caspase 3 activation which are specific intracellular proteases responsible for the execution of the cell death program yoshiyama ; martin and li . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253064 11173059 346496 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 e of dna fragmentation a biochemical marker of apoptosis the altered expression of mrna for bcl 2 and bax an anti apoptotic and a proapoptotic gene respectively and the demonstration of caspase 1 and caspase 3 activation which are specific intracellular proteases responsible for the execution of the cell death program yoshiyama ; martin and li . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253065 11173059 346498 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in spinal cord of human mutant superoxide dismutase transgenic mice the expression of bax and bad proapoptotic genes is increased whereas that of bcl 2 and bcl xl anti apoptotic is decreased vukosavic et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253066 11173059 346498 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 in spinal cord of human mutant superoxide dismutase transgenic mice the expression of bax and bad proapoptotic genes is increased whereas that of bcl 2 and bcl xl anti apoptotic is decreased vukosavic et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253067 11173059 346498 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in spinal cord of human mutant superoxide dismutase transgenic mice the expression of bax and bad proapoptotic genes is increased whereas that of bcl 2 and bcl xl anti apoptotic is decreased vukosavic et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253068 11173059 346499 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in double transgenic mice expressing human mutant superoxide dismutase and human bcl 2 the overexpression of bcl 2 is associated with a significant delay in disease onset kostic et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253069 11173059 346499 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in double transgenic mice expressing human mutant superoxide dismutase and human bcl 2 the overexpression of bcl 2 is associated with a significant delay in disease onset kostic et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253070 11173059 346500 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 furthermore the administration of the caspase inhibitor z val ala asp fluoromethylketone zvad fmk to mutant superoxide dismutase transgenic mice reduces disease progression and increases survival li et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253071 11173059 346503 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 interestingly caspase 1 formerly called interleukin 1_amp_#x3b2; converting enzyme is responsible for the cleavage of mature interleukin 1_amp_#x3b2; from its precursor and interleukin 1_amp_#x3b2; levels are increased in a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253072 11173059 346509 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 these inclusions appear concentric with a dense core surrounded by a filamentous halo and contain neurofilament proteins such as tubulin and ubiquitin forno 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253073 11173059 346524 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 recent studies though established a primary role for synuclein in the formation of lewy bodies and its aggregation in insoluble amyloid fibrils seems to precede the accumulation of ubiquitin and neurofilaments goedert et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253074 11173059 346527 4325 1940 CHM rep 1 rep1 0 1.0 studies focused on the synuclein gene in sporadic parkinson's disease have revealed that allele polymorphism of the promoter sequence nac rep1 is significantly associated with an increased risk of disease development especially in combination with the apolipoprotein apo allele 4 kruger et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253075 11173059 346527 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 1.0 rkinson's disease have revealed that allele polymorphism of the promoter sequence nac rep1 is significantly associated with an increased risk of disease development especially in combination with the apolipoprotein apo allele 4 kruger et al. 1999 . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 253076 11173059 346536 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 in a small german pedigree a point mutation in exon 4 of the ubiquitin carboxy terminal hydrolase l1 uch l1 gene has been detected on chromosome 4 indicating that abnormal proteolytic mechanisms may favor aggregation and ubiquitination of proteins like synuclein leroy e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253077 11173059 346536 1522 950 BAP1 ubiquitin carboxy-terminal hydrolase ubiquitin carboxy terminal hydrolase 0 1.0 in a small german pedigree a point mutation in exon 4 of the ubiquitin carboxy terminal hydrolase l1 uch l1 gene has been detected on chromosome 4 indicating that abnormal proteolytic mechanisms may favor aggregation and ubiquitination of proteins like synuclein leroy et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253078 11173059 346536 23620 12513 UCHL1 uch l1 uch l1 0 1.0 in a small german pedigree a point mutation in exon 4 of the ubiquitin carboxy terminal hydrolase l1 uch l1 gene has been detected on chromosome 4 indicating that abnormal proteolytic mechanisms may favor aggregation and ubiquitination of proteins like synuclein leroy et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253079 11173059 346544 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 free radical mediated cellular damage is commonly prevented by the scavenging activity of superoxide dismutase which converts superoxide ions to hydrogen peroxide and glutathione peroxidase which converts hydrogen peroxide to water and oxidated glutathione disulfide . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253080 11173059 346574 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ion pump activity and therefore atp expenditure in dopaminergic cells with a mitochondrial dysfunction due to a defective complex i. the concomitant rise in intracellular ca 2+ levels would activate nitric oxide synthase with the subsequent generation of toxic free radicals such as peroxynitrites. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253081 11173059 346575 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 this potential mechanism of damage to nigral neurons has already prompted a trial with remacemide a glutamate receptor antagonist in parkinson's disease parkinson study group 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253082 11173059 346581 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 the genes under scrutiny included those for tyrosine hydroxylase dopamine transporter dat dopamine receptor d2 d3 d4 and d5 monoamino oxidases a and b and catechol o methyltransferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253083 11173059 346581 6144 3023 DRD2 dopamine receptor d2 dopamine receptor d2 0 1.0 the genes under scrutiny included those for tyrosine hydroxylase dopamine transporter dat dopamine receptor d2 d3 d4 and d5 monoamino oxidases a and b and catechol o methyltransferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253084 11173059 346581 20070 11049 SLC6A3 dopamine transporter dopamine transporter 0 1.0 the genes under scrutiny included those for tyrosine hydroxylase dopamine transporter dat dopamine receptor d2 d3 d4 and d5 monoamino oxidases a and b and catechol o methyltransferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253085 11173059 346581 4744 2228 COMT catechol-o-methyltransferase catechol o methyltransferase 0 1.0 the genes under scrutiny included those for tyrosine hydroxylase dopamine transporter dat dopamine receptor d2 d3 d4 and d5 monoamino oxidases a and b and catechol o methyltransferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253086 11173059 346582 6144 3023 DRD2 dopamine receptor d2 dopamine receptor d2 0 1.0 a significant association between parkinson's disease and specific polymorphisms of dat dopamine receptor d2 and d4 monoamino oxidase a monoamino oxidase b and catechol o methyltransferase genes was demonstrated in some studies but not in others see tan et al. 2000 for review . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253087 11173059 346582 4744 2228 COMT catechol-o-methyltransferase catechol o methyltransferase 0 1.0 a significant association between parkinson's disease and specific polymorphisms of dat dopamine receptor d2 and d4 monoamino oxidase a monoamino oxidase b and catechol o methyltransferase genes was demonstrated in some studies but not in others see tan et al. 2000 for review . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253088 11173059 346585 6144 3023 DRD2 dopamine receptor d2 dopamine receptor d2 0 1.0 stingly a study has recently reported a reduced risk of developing levodopa induced dyskinesias in patients with parkinson's disease carrying the 13 or the 14 short tandem repeat polymorphisms of the dopamine receptor d2 gene oliveri et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253089 11173059 346594 5378 2638 CYP3A5 cytochrome p-450 cytochrome p 450 0 1.0 the genes of cytochrome p 450 cyp enzymes and particularly its cyp2d6 polymorphism are the most extensively investigated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253090 11173059 346596 957 18704 ARD1A n-acetyltransferase n acetyltransferase 0 1.0 in a series of investigations polymorphisms of the n acetyltransferase gene resulting in a slow acetylator phenotype were found to be significantly associated with parkinson's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253091 11173059 346598 8877 4638 GSTP1 glutathione transferase glutathione transferase 0 1.0 glutathione transferase is involved in the detoxification of exogenous toxins and the frequency of deletions of its gstt1 locus is higher in parkinson's disease patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253092 11173059 346600 8877 4638 GSTP1 glutathione transferase glutathione transferase 0 1.0 in one study the genotype distribution of gstp1 another locus of glutathione transferase significantly differed between patients and controls that had been exposed to pesticides menegon et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253093 11173059 346605 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 a number of neurotrophic factors show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253094 11173059 346605 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253095 11173059 346605 1624 1033 BDNF neurotrophin neurotrophin 0 0.0 rophic factors show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253096 11173059 346605 1624 1033 BDNF neurotrophin neurotrophin 0 0.0 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253097 11173059 346605 14727 8023 NTF3 neurotrophin 3 neurotrophin 3 0 1.0 rophic factors show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253098 11173059 346605 14728 8024 NTF4 neurotrophin 4 neurotrophin 4 0 1.0 show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253099 11173059 346605 4649 2169 CNTF ciliary neurotrophic factor ciliary neurotrophic factor 0 1.0 ffects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253100 11173059 346605 7522 3676 FGF2 basic fibroblast growth factor basic fibroblast growth factor 0 0.0 a number of neurotrophic factors show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253101 11173059 346605 7522 3676 FGF2 basic fibroblast growth factor bfgf basic fibroblast growth factor bfgf 0 1.0 a number of neurotrophic factors show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253102 11173059 346605 22058 11765 TGFA transforming growth factor transforming growth factor 0 1.0 n vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253103 11173059 346605 8240 4232 GDNF glial cell line derived neurotrophic factor glial cell line derived neurotrophic factor 0 1.0 a number of neurotrophic factors show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_am 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253104 11173059 346605 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 a number of neurotrophic factors show protective effects on dopaminergic neurons in vivo including glial cell line derived neurotrophic factor gdnf basic fibroblast growth factor bfgf brain derived neurotrophic factor neurotrophin 3 neurotrophin 4/5 ciliary neurotrophic factor and transforming growth factor tgf _amp_#x3b2; dunnett and bj_amp_#xf6;rklund 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253105 11173059 346612 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 activated microglia and astrocytosis as well as increased amounts of inflammatory cytokines such as interleukin 1_amp_#x3b2; interferon _amp_#x3b3; and tumor necrosis factor are detected in the parkinsonian substantia nigra marsden and hirsch . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253106 11173059 346613 10452 6001 IL2 interleukin 2 interleukin 2 0 1.0 furthermore interleukin 2 interleukin 4 and interleukin 6 levels are elevated in the ventricular cerebrospinal fluid and in the caudate nucleus and putamen of patients with parkinson's disease hirsch 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253107 11173059 346613 10458 6014 IL4 interleukin 4 interleukin 4 0 1.0 furthermore interleukin 2 interleukin 4 and interleukin 6 levels are elevated in the ventricular cerebrospinal fluid and in the caudate nucleus and putamen of patients with parkinson's disease hirsch 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253108 11173059 346613 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 furthermore interleukin 2 interleukin 4 and interleukin 6 levels are elevated in the ventricular cerebrospinal fluid and in the caudate nucleus and putamen of patients with parkinson's disease hirsch 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253109 11173059 346622 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the apoptosis effector molecule caspase 3 and the anti apoptotic molecule bcl 2 are overexpressed in the basal ganglia of patients with parkinson's disease confirming that apoptosis is a relevant mechanism of neural death in this paradigm marshall and hartmann . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253110 11173059 346622 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the apoptosis effector molecule caspase 3 and the anti apoptotic molecule bcl 2 are overexpressed in the basal ganglia of patients with parkinson's disease confirming that apoptosis is a relevant mechanism of neural death in this paradigm ma 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253111 11173059 346625 1576 990 BCL2 bcl 2 bcl 2 0 1.0 gene polymorphisms of apoptosis related factors e.g. bax and bcl 2 or apoptosis effector molecules e.g. caspase enzymes have still to be investigated in parkinson's disease although they may play a role in modulating the susceptibility of nigral neurons to set off a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253112 11173059 346635 24393 12854 YWHAQ protein tau protein tau 0 1.0 they are composed of hyperphosphorylated insoluble forms of microtubule associated protein tau often conjugated with ubiquitin selkoe 1999 . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 253113 11173059 346635 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 they are composed of hyperphosphorylated insoluble forms of microtubule associated protein tau often conjugated with ubiquitin selkoe 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253114 11173059 346635 12369 6893 MAPT microtubule-associated protein tau microtubule associated protein tau 0 1.0 they are composed of hyperphosphorylated insoluble forms of microtubule associated protein tau often conjugated with ubiquitin selkoe 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253115 11173059 346651 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 about half of the autosomal dominant inherited forms of alzheimer disease feature an early onset of disease and are accounted for by mutations of the amyloid precursor protein presenilin 1 ps 1 or presenilin 2 gene ps 2 rosenberg 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253116 11173059 346651 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 about half of the autosomal dominant inherited forms of alzheimer disease feature an early onset of disease and are accounted for by mutations of the amyloid precursor protein presenilin 1 ps 1 or presenilin 2 gene ps 2 rosenberg 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253117 11173059 346674 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 at present the most important genetic information in patients with late onset alzheimer disease comes from the analysis of allele polymorphism of the apolipoprotein e apoe gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253118 11173059 346674 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 at present the most important genetic information in patients with late onset alzheimer disease comes from the analysis of allele polymorphism of the apolipoprotein e apoe gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253119 11173059 346683 19699 16 SERPINA3 antichymotrypsin antichymotrypsin 0 1.0 some of them code for proteins which may participate in _amp_#x3b2; amyloid protein processing or aggregation in neuritic plaques. 1 antichymotrypsin is a protease inhibitor and an acute phase protein also found in amyloid deposits in alzheimer disease brains abraham et al. 1988 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253120 11173059 346684 19699 16 SERPINA3 antichymotrypsin antichymotrypsin 0 1.0 a polymorphism in the region coding for the signal peptide of the 1 antichymotrypsin gene was originally reported to confer a higher risk of alzheimer disease kamboh et al. 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253121 11173059 346686 19699 16 SERPINA3 antichymotrypsin antichymotrypsin 0 1.0 recent data suggest that specific polymorphism of the 1 antichymotrypsin gene may rather increase the risk for early onset alzheimer disease and that this effect is enhanced by a concomitant polymorphism of the interleukin1_amp_#x3b2; gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253122 11173059 346687 19699 16 SERPINA3 antichymotrypsin antichymotrypsin 0 1.0 licastro and licastro . 1 antichymotrypsin release in the brains of alzheimer disease patients may be secondary to local inflammatory reactions licastro et al. 2000a and contribute to enhance _amp_#x3b2; amyloid protein aggregation ma et al. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253123 11173059 346688 10436 5991 IL1A interleukin 1 interleukin 1 0 0.0 therefore polymorphism analysis of the 1 antichymotrypsin gene especially in conjunction with that of the interleukin 1 gene may provide further indications for the use of anti inflammatory drugs or interleukin 1 receptor antagonist in alzheimer disease table 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253124 11173059 346688 10444 5993 IL1R1 interleukin 1 receptor interleukin 1 receptor 0 0.0 therefore polymorphism analysis of the 1 antichymotrypsin gene especially in conjunction with that of the interleukin 1 gene may provide further indications for the use of anti inflammatory drugs or interleukin 1 receptor antagonist in alzheimer disease table 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253125 11173059 346688 10451 6000 IL1RN interleukin 1 receptor antagonist interleukin 1 receptor antagonist 0 1.0 therefore polymorphism analysis of the 1 antichymotrypsin gene especially in conjunction with that of the interleukin 1 gene may provide further indications for the use of anti inflammatory drugs or interleukin 1 receptor antagonist in alzheimer disease table 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253126 11173059 346688 19699 16 SERPINA3 antichymotrypsin antichymotrypsin 0 1.0 therefore polymorphism analysis of the 1 antichymotrypsin gene especially in conjunction with that of the interleukin 1 gene may provide further indications for the use of anti inflammatory drugs or interleukin 1 receptor antagonist in alzheimer disease tab 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253127 11173059 346691 11736 6547 LDLR low density lipoprotein receptor low density lipoprotein receptor 0 1.0 lrp is a member of the low density lipoprotein receptor superfamily and is believed to contribute to the clearance of apoe/_amp_#x3b2; amyloid protein and 2 macroglobulin/_amp_#x3b2; amyloid protein complexes hyman et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253128 11173059 346696 11736 6547 LDLR low density lipoprotein receptor low density lipoprotein receptor 0 1.0 another member of the low density lipoprotein receptor superfamily the very low density lipoprotein vldl receptor functions as a receptor for apoe containing lipoproteins and for this reason it has been hypothesized to be a potential risk factor for alzh 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253129 11173059 346699 5136 2529 CTSD cathepsin d cathepsin d 0 1.0 other gene polymorphisms have been reported to add to the risk of developing alzheimer disease including cathepsin d papassotiropoulos et al. 1999a angiotensin converting enzyme kehoe et al. 1999 tau protein lilius et al. 1999 and bleomycin hydrolase montoya et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253130 11173059 346699 1676 1059 BLMH bleomycin hydrolase bleomycin hydrolase 0 1.0 een reported to add to the risk of developing alzheimer disease including cathepsin d papassotiropoulos et al. 1999a angiotensin converting enzyme kehoe et al. 1999 tau protein lilius et al. 1999 and bleomycin hydrolase montoya et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253131 11173059 346699 12369 6893 MAPT tau protein tau protein 0 1.0 other gene polymorphisms have been reported to add to the risk of developing alzheimer disease including cathepsin d papassotiropoulos et al. 1999a angiotensin converting enzyme kehoe et al. 1999 tau protein lilius et al. 1999 and bleomycin hydrolase montoya et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253132 11173059 346699 156 2707 ACE angiotensin converting enzyme angiotensin converting enzyme 0 1.0 other gene polymorphisms have been reported to add to the risk of developing alzheimer disease including cathepsin d papassotiropoulos et al. 1999a angiotensin converting enzyme kehoe et al. 1999 tau protein lilius et al. 1999 and bleomycin hydrolase montoya et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253133 11173059 346704 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 the trophic activity of nerve growth factor ngf on cholinergic basal forebrain neurons scott and crutcher 1994 the main population of nerve cells that degenerate in alzheimer disease indicated that neurotrophic factors could play a primary rol 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253134 11173059 346710 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 brain derived neurotrophic factor levels are decreased in alzheimer disease hippocampi ferrer et al. 1999 and insulin like growth factor 1 shows protective effects against _amp_#x3b2; amyloid protein neurotoxicity dore et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253135 11173059 346710 10601 6081 INS insulin insulin 0 0.0 brain derived neurotrophic factor levels are decreased in alzheimer disease hippocampi ferrer et al. 1999 and insulin like growth factor 1 shows protective effects against _amp_#x3b2; amyloid protein neurotoxicity dore et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253136 11173059 346710 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 brain derived neurotrophic factor levels are decreased in alzheimer disease hippocampi ferrer et al. 1999 and insulin like growth factor 1 shows protective effects against _amp_#x3b2; amyloid protein neurotoxicity dore et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253137 11173059 346710 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 brain derived neurotrophic factor levels are decreased in alzheimer disease hippocampi ferrer et al. 1999 and insulin like growth factor 1 shows protective effects against _amp_#x3b2; amyloid protein neurotoxicity dore et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253138 11173059 346710 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 brain derived neurotrophic factor levels are decreased in alzheimer disease hippocampi ferrer et al. 1999 and insulin like growth factor 1 shows protective effects against _amp_#x3b2; amyloid protein neurotoxicity dore et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253139 11173059 346711 22058 11765 TGFA transforming growth factor transforming growth factor 0 1.0 transforming growth factor _amp_#x3b2;1 exhibits opposing activities because it protects neurons against _amp_#x3b2; amyloid protein toxicity prehn et al. 1996 but enhances _amp_#x3b2; amyloid protein deposition in amyloid pre 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253140 11173059 346712 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 so far dna variations of neurotrophic factor or neurotrophic factor receptor genes have been only marginally investigated in patients with alzheimer disease but more knowledge of such variations may have a tremendous impact on future therapeutic strategies table 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253141 11173059 346715 6791 3467 ESR1 estrogen receptor alpha estrogen receptor alpha 0 1.0 moreover a polymorphism of the estrogen receptor alpha gene is associated with a higher risk of developing late onset sporadic alzheimer disease brandi et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253142 11173059 346720 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 alzheimer disease since it induces microglia activation and the production of several inflammatory cytokines and chemokines including interleukin 1_amp_#x3b2; with subsequent stimulation of inducible nitric oxide synthase and further oxidative damage to neurons berger ; yates and akama . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253143 11173059 346721 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 interestingly interleukin 1 may contribute to the formation of alzheimer disease plaques by upregulating the secretion of amyloid precursor protein rogers et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253144 11173059 346725 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 in contrast the c allele of a variable number of tandem repeat polymorphism in the 3' flanking region of the interleukin 6 gene is associated with a delayed onset and a lower risk of alzheimer disease papassotiropoulos et al. 1999b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253145 11173059 346727 10436 5991 IL1A interleukin 1 interleukin 1 0 0.0 therapeutic trials involving the use of anti inflammatory drugs or interleukin 1 antagonists e.g. interleukin 1 receptor antagonist inhibitors of interleukin 1 converting enzyme are now being planned: results are eagerly awaited as they may lead to substantial changes in treatment protocols for alzheimer disease table 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253146 11173059 346727 10444 5993 IL1R1 interleukin 1 receptor interleukin 1 receptor 0 0.0 therapeutic trials involving the use of anti inflammatory drugs or interleukin 1 antagonists e.g. interleukin 1 receptor antagonist inhibitors of interleukin 1 converting enzyme are now being planned: results are eagerly awaited as they may lead to substantial changes in treatment protocols for alzheimer disease table 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253147 11173059 346727 10451 6000 IL1RN interleukin 1 receptor antagonist interleukin 1 receptor antagonist 0 1.0 therapeutic trials involving the use of anti inflammatory drugs or interleukin 1 antagonists e.g. interleukin 1 receptor antagonist inhibitors of interleukin 1 converting enzyme are now being planned: results are eagerly awaited as they may lead to substantial changes in treatment protocols for alzheimer disease table 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253148 11173059 346734 158 108 ACHE acetylcholinesterase acetylcholinesterase 0 1.0 the beneficial effects of acetylcholinesterase inhibitors also provide further clues about the role of defective cholinergic transmission in the development of cognitive and behavioral symptoms in alzheimer disease emilien et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253149 11173059 346736 21317 11329 SST somatostatin somatostatin 0 1.0 neuropeptides such as corticotrophin releasing factor and somatostatin are also lost in alzheimer disease probably reflecting damage to cortical interneurons nemeroff et al. 1991 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253150 11173059 346738 20071 11050 SLC6A4 serotonin transporter serotonin transporter 0 1.0 to date only a low transcriptional activity allele of the serotonin transporter gene has been found to confer a higher risk of alzheimer disease li and li whereas the apoe genotype seems to affect the response to acetylcholinesterase inhibitors richard et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253151 11173059 346738 158 108 ACHE acetylcholinesterase acetylcholinesterase 0 1.0 a low transcriptional activity allele of the serotonin transporter gene has been found to confer a higher risk of alzheimer disease li and li whereas the apoe genotype seems to affect the response to acetylcholinesterase inhibitors richard et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253152 11173059 346739 158 108 ACHE acetylcholinesterase acetylcholinesterase 0 1.0 genotypes of acetylcholine related enzymes receptors and transporters are currently been analyzed to clarify whether acetylcholinesterase inhibitors have a better therapeutic effect in selected cohorts of patients than in the whole alzheimer disease population table 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253153 11173059 346743 1576 990 BCL2 bcl 2 bcl 2 0 1.0 est that chronic deposition of _amp_#x3b2; amyloid protein may be crucial. _amp_#x3b2; amyloid protein up regulates pro apoptotic molecules such as bax down regulates anti apoptotic molecules such as bcl 2 and induces caspase enzymes paradis ; harada and troy . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253432 11220737 347228 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the copper/zinc superoxide dismutase msod1 gene are associated with a familial form of amyotrophic lateral sclerosis als and their expression in transgenic mice produces an als like syndrome. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253433 11220737 347230 17610 9605 PTGS2 cox 2 cox 2 0 1.0 consistent with this view the present study demonstrates that during the course of the disease the expression of cyclooxygenase type 2 cox 2 a key enzyme in the synthesis of prostanoids which are potent mediators of inflammation is dramatically increased. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253434 11220737 347231 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in both early symptomatic and end stage transgenic msod1 mice neurons and to a lesser extent glial cells in the anterior horn of the spinal cord exhibit robust cox 2 immunoreactivity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253435 11220737 347232 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 mrna and protein levels and catalytic activity are also significantly increased in the spinal cord of the transgenic msod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253436 11220737 347233 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the time course of the spinal cord cox 2 upregulation parallels that of motor neuronal loss in transgenic msod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253437 11220737 347234 17610 9605 PTGS2 cox 2 cox 2 0 1.0 we also show that cox 2 activity is dramatically increased in postmortem spinal cord samples from sporadic als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253438 11220737 347235 17610 9605 PTGS2 cox 2 cox 2 0 1.0 we speculate that cox 2 upregulation through its pivotal role in inflammation is instrumental in the als neurodegenerative process and that cox 2 inhibition may be a valuable therapeutic avenue for the treatment of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 247364 11458198 336764 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 this paper reviews the possible mechanisms which may play a role in metal induced autoimmunity with the emphasis on multiple sclerosis ms rheumatoid arthritis ra and amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 234257 11796754 317530 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 familial amyotrophic lateral sclerosis fals linked mutations in copper zinc superoxide dismutase sod1 cause motor neuron death through one or more acquired toxic properties. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 234258 11796754 317532 22551 11892 TNF tnf alpha tnf alpha 0 1.0 n decreased. cdna microarray analysis to monitor gene expression during neurodegeneration revealed an up regulation of genes related to an inflammatory process such as the tumor necrosis factor alpha tnf alpha gene resulting from glial cell activation together with the change in apoptosis related gene expression such as caspase 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 234259 11796754 317532 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 e 30 being elevated and seven decreased. cdna microarray analysis to monitor gene expression during neurodegeneration revealed an up regulation of genes related to an inflammatory process such as the tumor necrosis factor alpha tnf alpha gene resulting from glial cell activation together with the change in apoptosis related gene expression such as caspase 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 234260 11796754 317532 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 e 30 being elevated and seven decreased. cdna microarray analysis to monitor gene expression during neurodegeneration revealed an up regulation of genes related to an inflammatory process such as the tumor necrosis factor alpha tnf alpha gene resulting from glial cell activation together with the change in apoptosis related gene expression such as caspase 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 234261 11796754 317532 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 es related to an inflammatory process such as the tumor necrosis factor alpha tnf alpha gene resulting from glial cell activation together with the change in apoptosis related gene expression such as caspase 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 235280 11847479 319126 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 tumor necrosis factor and motoneuronal degeneration: an open problem. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 235281 11847479 319127 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 tumor necrosis factor tnf has been implicated in the pathogenesis of various central nervous system diseases with an inflammatory component. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 235282 11847479 319132 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 sufficient to show whether tnf has a pathogenic or a protective role in mnd though anti tnf antibodies have shown protective effects in experimental allergic encephalomyelitis eae an animal model of multiple sclerosis ms . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 235283 11847479 319134 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 antibodies monoclonal|nf kappa b|nerve growth factors|neuroprotective agents|receptors tumor necrosis factor|tumor necrosis factor alpha|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 235284 11847479 319134 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 antibodies monoclonal|nf kappa b|nerve growth factors|neuroprotective agents|receptors tumor necrosis factor|tumor necrosis factor alpha|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227545 12060810 305729 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 first minocycline inhibits microglial activation caspase 1 and inducible nitric oxide synthetase inos up regulation and decreases infarct size after experimental ischemia in rats _amp_#91; 3 4 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227546 12060810 305730 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 second minocycline inhibits caspase 1 and caspase 3 expression decreases inos activity and delays mortality in a transgenic mouse model of huntington_amp_#39;s disease _amp_#91; 5 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227547 12060810 305730 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 second minocycline inhibits caspase 1 and caspase 3 expression decreases inos activity and delays mortality in a transgenic mouse model of huntington_amp_#39;s disease _amp_#91; 5 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227548 12060810 305734 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 familial als accounts for 10_amp_#37; of all cases and mutations of the superoxide dismutase 1 sod1 gene have been identified in about 20_amp_#37; of the familial cases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227549 12060810 305734 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 familial als accounts for 10_amp_#37; of all cases and mutations of the superoxide dismutase 1 sod1 gene have been identified in about 20_amp_#37; of the familial cases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227550 12060810 305777 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 in these in vivo models minocycline prevented completely the ischemia induced activation of microglia as well as the concomitant induction of caspase 1 and inos. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227551 12060810 305780 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 however in vitro evidence obtained from a mixed spinal culture model showed that minocycline inhibited the activation and proliferation of microglia induced by excitotoxicity by inhibiting the p38 mitogen activated protein kinase p38 mapk _amp_#91; 6 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 227552 12060810 305789 10783 6193 JAK3 janus kinase 3 janus kinase 3 0 1.0 a specific inhibitor of janus kinase 3 had the largest effect and increased survival by _amp_#62; 2 months _amp_#91; 18 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 228120 12076984 307182 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 asing evidence has suggested that inflammation in the brain is closely associated with the pathogenesis of several degenerative neurologic disorders including parkinson's disease alzheimer's diseases multiple sclerosis amyotrophic lateral sclerosis and aids dementia. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 228121 12076984 307184 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 excessive production of no as a consequence of nitric oxide synthase induction in activated glia has been attributed to participate in neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 228122 12076984 307188 14968 8153 OPRD1 opioid receptor opioid receptor 0 1.0 among these agents the opioid receptor antagonist naloxone especially its non opioid enantiomer + naloxone promises to be of potential therapeutic value for the treatment of inflammation related diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229359 12124437 309219 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 familial amyotrophic lateral sclerosis fals is often caused by gain of function mutations in cu zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229360 12124437 309224 22551 11892 TNF tnf alpha tnf alpha 0 1.0 osis related genes were generally unaffected at 80 days but multiple caspases and death receptor components were up regulated at 120 days; the only exceptions being fadd and the tumor necrosis factor tnf alpha receptor p55 which was up regulated at 80 days and increased further at 120 days. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229361 12124437 309224 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 apoptosis related genes were generally unaffected at 80 days but multiple caspases and death receptor components were up regulated at 120 days; the only exceptions being fadd and the tumor necrosis factor tnf alpha receptor p55 which was up regulated at 80 days and increased further at 120 days. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229362 12124437 309228 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 tor proteins signal transducing|antigens cd|carrier proteins|cytokines|fadd protein human|fadd protein mouse|fas associated death domain protein|lymphokines|monokines|proteins|rna messenger|receptors tumor necrosis factor|receptors tumor necrosis factor type i|sod1 g93a protein|superoxide dismutase|caspases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229363 12124437 309228 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 |receptors tumor necrosis factor type i|sod1 g93a protein|superoxide dismutase|caspases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229974 12137643 310068 10601 6081 INS insulin insulin 0 0.0 recombinant human insulin like growth factor i rhigf i for amyotrophic lateral sclerosis/motor neuron disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229975 12137643 310068 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 recombinant human insulin like growth factor i rhigf i for amyotrophic lateral sclerosis/motor neuron disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229976 12137643 310069 10601 6081 INS insulin insulin 0 0.0 background: trophic factors including recombinant human insulin like growth factor i have been postulated as possible disease modifying therapies for amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229977 12137643 310069 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 background: trophic factors including recombinant human insulin like growth factor i have been postulated as possible disease modifying therapies for amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229978 12137643 310070 10601 6081 INS insulin insulin 0 0.0 randomised clinical trials of recombinant human insulin like growth factor i in amyotrophic lateral sclerosis to date have yielded conflicting results. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229979 12137643 310070 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 randomised clinical trials of recombinant human insulin like growth factor i in amyotrophic lateral sclerosis to date have yielded conflicting results. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229980 12137643 310071 10601 6081 INS insulin insulin 0 0.0 objectives: the main objective of this review was to examine the efficacy of recombinant human insulin like growth factor i in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229981 12137643 310071 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 objectives: the main objective of this review was to examine the efficacy of recombinant human insulin like growth factor i in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229982 12137643 310073 10601 6081 INS insulin insulin 0 0.0 search strategy: a search was carried out using the cochrane neuromuscular disease group register for randomised clinical trials of recombinant human insulin like growth factor i in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229983 12137643 310073 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 search strategy: a search was carried out using the cochrane neuromuscular disease group register for randomised clinical trials of recombinant human insulin like growth factor i in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229984 12137643 310074 10601 6081 INS insulin insulin 0 0.0 enquiries were also made of authors of randomised clinical trials as well as the manufacturers of recombinant human insulin like growth factor i regarding any other randomised clinical trials which had not yet been published. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229985 12137643 310074 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 enquiries were also made of authors of randomised clinical trials as well as the manufacturers of recombinant human insulin like growth factor i regarding any other randomised clinical trials which had not yet been published. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229986 12137643 310075 10601 6081 INS insulin insulin 0 0.0 selection criteria: types of studies: all randomised controlled clinical trials involving recombinant human insulin like growth factor i treatment of amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229987 12137643 310075 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 selection criteria: types of studies: all randomised controlled clinical trials involving recombinant human insulin like growth factor i treatment of amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229988 12137643 310077 10601 6081 INS insulin insulin 0 0.0 types of interventions: treatment with recombinant human insulin like growth factor i or placebo. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229989 12137643 310077 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 types of interventions: treatment with recombinant human insulin like growth factor i or placebo. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229990 12137643 310078 10601 6081 INS insulin insulin 0 0.0 types of outcome measures: primary: change in appel amyotrophic lateral sclerosis rating scale aalsrs total score with 0.1mg/kg/day of recombinant human insulin like growth factor i after nine months treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229991 12137643 310078 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 types of outcome measures: primary: change in appel amyotrophic lateral sclerosis rating scale aalsrs total score with 0.1mg/kg/day of recombinant human insulin like growth factor i after nine months treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229992 12137643 310079 10601 6081 INS insulin insulin 0 0.0 secondary: change in aalsrs with recombinant human insulin like growth factor i 0.1mg/kg/day and 0.05mg/kg/day at 1 2 3 4 5 6 7 8 9 months change in quality of life sickness impact profile scale survival and adverse events. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229993 12137643 310079 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 secondary: change in aalsrs with recombinant human insulin like growth factor i 0.1mg/kg/day and 0.05mg/kg/day at 1 2 3 4 5 6 7 8 9 months change in quality of life sickness impact profile scale survival and adverse events. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229994 12137643 310084 10601 6081 INS insulin insulin 0 0.0 main results: the primary outcome measure was change in disease progression as determined by the appel als rating scale total score with 0.1 mg/kg/day of recombinant human insulin like growth factor i subcutaneously after nine months treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229995 12137643 310084 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 main results: the primary outcome measure was change in disease progression as determined by the appel als rating scale total score with 0.1 mg/kg/day of recombinant human insulin like growth factor i subcutaneously after nine months treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229996 12137643 310085 10601 6081 INS insulin insulin 0 0.0 the level of significance was lower in the european trial which compared 59 patients on placebo with 124 on insulin like growth factor i 0.1 mg/kg/day weighted mean difference 3.30 95%ci 8.68 to 2.08 than in the north american trial which compared 90 patients on placebo with 89 on recombinant human insulin like gr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229997 12137643 310085 10601 6081 INS insulin insulin 0 0.0 like growth factor i 0.1 mg/kg/day weighted mean difference 3.30 95%ci 8.68 to 2.08 than in the north american trial which compared 90 patients on placebo with 89 on recombinant human insulin like growth factor i 0.05 mg/kg/day 89 patients and 87 patients on 0.1mg/kg/day weighted mean difference 6.00 95%ci 10.99 to 1.01 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229998 12137643 310085 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 the level of significance was lower in the european trial which compared 59 patients on placebo with 124 on insulin like growth factor i 0.1 mg/kg/day weighted mean difference 3.30 95%ci 8.68 to 2.08 than in the north american trial which compared 90 patients on placebo with 89 on recombinant human insulin like growth factor i 0.05 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229999 12137643 310085 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 i 0.1 mg/kg/day weighted mean difference 3.30 95%ci 8.68 to 2.08 than in the north american trial which compared 90 patients on placebo with 89 on recombinant human insulin like growth factor i 0.05 mg/kg/day 89 patients and 87 patients on 0.1mg/kg/day weighted mean difference 6.00 95%ci 10.99 to 1.01 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230000 12137643 310087 10601 6081 INS insulin insulin 0 0.0 the secondary outcome measures showed similar trends favouring recombinant human insulin like growth factor i but these did not reach significance at the five per cent level. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230001 12137643 310087 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 the secondary outcome measures showed similar trends favouring recombinant human insulin like growth factor i but these did not reach significance at the five per cent level. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230002 12137643 310088 10601 6081 INS insulin insulin 0 0.0 similarly the data with the 0.05mg/kg/day dose showed trends favouring recombinant human insulin like growth factor i at all time points but did not reach significance at the five per cent level at any point. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230003 12137643 310088 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 similarly the data with the 0.05mg/kg/day dose showed trends favouring recombinant human insulin like growth factor i at all time points but did not reach significance at the five per cent level at any point. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230004 12137643 310089 10601 6081 INS insulin insulin 0 0.0 evaluation of adverse events showed an increased risk of injection site reactions/inflammation with recombinant human insulin like growth factor i relative risk 2.53 95% ci 1.40 to 4.59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230005 12137643 310089 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 evaluation of adverse events showed an increased risk of injection site reactions/inflammation with recombinant human insulin like growth factor i relative risk 2.53 95% ci 1.40 to 4.59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230006 12137643 310091 10601 6081 INS insulin insulin 0 0.0 reviewer's conclusions: recombinant human insulin like growth factor i may be modestly effective but the evidence currently available is insufficient for a definitive assessment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230007 12137643 310091 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 reviewer's conclusions: recombinant human insulin like growth factor i may be modestly effective but the evidence currently available is insufficient for a definitive assessment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 223779 12194501 299401 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 among the various biochemical events associated with these conditions emerging evidence suggests the formation of superoxide anion and expression/activity of its endogenous scavenger superoxide dismutase sod as a common denominator. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 224948 12270689 301345 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 n and caspase activation may contribute to neurodegeneration in als we tested the effects of minocycline a second generation tetracycline with anti inflammatory properties in mice expressing a mutant superoxide dismutase sod1 g37r linked to human als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226018 12362410 302431 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nce of numerous molecules characteristic of free radical attack the occurrence of proteins associated with activation of the complement cascade and a sharp upregulation of the enzyme cyclooxygenase 2 cox 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226019 12362410 302433 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 is a particularly attractive target because of its marked increase in als spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218045 12387699 291553 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ible for the selective loss of motor neurones are still unknown however several hypotheses have been put forward including oxidative damage and/or toxicity from intracellular aggregates due to mutant superoxide dismutase 1 activity axonal strangulation from cytoskeletal abnormalities loss of trophic factor support and glutamate mediated excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218046 12387699 291553 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 ible for the selective loss of motor neurones are still unknown however several hypotheses have been put forward including oxidative damage and/or toxicity from intracellular aggregates due to mutant superoxide dismutase 1 activity axonal strangulation from cytoskeletal abnormalities loss of trophic factor support and glutamate mediated excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220507 12417341 294830 13784 7408 MT3 metallothionein 3 metallothionein 3 0 1.0 real time rt pcr verified that the expression level of the following six genes was altered in sals: dorfin metallothionein 3 30 kda tata binding protein associated factor neugrin ubiquitin like protein 5 and macrophage inhibiting factor related protein 8. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220508 12417341 294830 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 real time rt pcr verified that the expression level of the following six genes was altered in sals: dorfin metallothionein 3 30 kda tata binding protein associated factor neugrin ubiquitin like protein 5 and macrophage inhibiting factor related protein 8. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220509 12417341 294835 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 approximately 10% of als is familial and 10_amp_#x2013;20% of these familial als fals cases are caused by missense mutations in the cu/zn superoxide dismutase sod1 gene [ 1 ] while others are considered to be sporadic als sals . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220510 12417341 294837 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 these include oxidative toxicity glutamate receptor abnormality ubiquitin_amp_#x2013;proteasome dysfunction inflammatory and cytokine activation dysfunction in neurotrophic factors damage to mitochondria cytoskeletal abnormalities and activation of th 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220511 12417341 294891 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 for internal standard control the expression of glyceraldehyde 3 phosphate dehydrogenase gapdh was quantified simultaneously. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220512 12417341 294922 13784 7408 MT3 metallothionein 3 metallothionein 3 0 1.0 a similarity search revealed that clones 2 7 8 and 11 were identical to four known cdnas 30 kda tata binding protein associated factor tafii30 macrophage inhibiting factor related protein 8 mrp8 metallothionein 3 mt 3 and ubiquitin like protein 5 ubl5 respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220513 12417341 294922 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 vealed that clones 2 7 8 and 11 were identical to four known cdnas 30 kda tata binding protein associated factor tafii30 macrophage inhibiting factor related protein 8 mrp8 metallothionein 3 mt 3 and ubiquitin like protein 5 ubl5 respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220514 12417341 294930 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 dorfin is a new ring finger type ubiquitin ligase containing two ring finger motifs and an ibr motif at its n terminus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220515 12417341 294930 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 1.0 dorfin is a new ring finger type ubiquitin ligase containing two ring finger motifs and an ibr motif at its n terminus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220516 12417341 294951 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ubl5 is one of the ubiquitin like proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 220517 12417341 294952 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 it may possibly organize another ubiquitin like system but its function remains unknown [ 26 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 215954 12528305 289116 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 215955 12528305 289116 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199266 12843244 266716 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspase 11 is a key regulator of caspase 1 and caspase 3 activation under pathological conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199267 12843244 266716 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 11 is a key regulator of caspase 1 and caspase 3 activation under pathological conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199268 12843244 266717 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 we show here that the expression of caspase 11 is upregulated in the spinal cord of superoxide dismutase 1 sod1 g93a transgenic mice a mouse model of amyotrophic lateral sclerosis als before the onset of motor dysfunction and remains at the high levels throughout the course of disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199269 12843244 266717 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 we show here that the expression of caspase 11 is upregulated in the spinal cord of superoxide dismutase 1 sod1 g93a transgenic mice a mouse model of amyotrophic lateral sclerosis als before the onset of motor dysfunction and remains at the high levels throughout the course of disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199270 12843244 266718 10436 5991 IL1A interleukin 1 interleukin 1 0 0.0 the caspase 1 and caspase 3 like activities as well as the level of interleukin 1 beta were significantly reduced in the spinal cord of symptomatic caspase 11 / ;sod1 g93a mice compared with that of caspase 11 +/ ; sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199271 12843244 266718 10437 5992 IL1B interleukin 1, beta interleukin 1 beta 0 1.0 the caspase 1 and caspase 3 like activities as well as the level of interleukin 1 beta were significantly reduced in the spinal cord of symptomatic caspase 11 / ;sod1 g93a mice compared with that of caspase 11 +/ ; sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199272 12843244 266718 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the caspase 1 and caspase 3 like activities as well as the level of interleukin 1 beta were significantly reduced in the spinal cord of symptomatic caspase 11 / ;sod1 g93a mice compared with that of caspase 11 +/ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199273 12843244 266718 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the caspase 1 and caspase 3 like activities as well as the level of interleukin 1 beta were significantly reduced in the spinal cord of symptomatic caspase 11 / ;sod1 g93a mice compared with that of caspase 11 +/ ; sod1 g93a mi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199274 12843244 266723 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 nd lower motor neurons leading to paralysis and death at ~1 5 years after the onset cleveland and rothstein 2001 ~5% of the cases in 1993 rosen et al demonstrated that several mutations in the cu /zn superoxide dismutase sod1 are causally responsible for a subset of familial als fals . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199275 12843244 266727 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 activation of caspase 1 and caspase 3 in the spinal cords of mutant sod1 mice and als patients has been reported previously martin 1999 ; li et al. 2000 ; pasinelli et al. 2000 ; vukosavic et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199276 12843244 266727 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 activation of caspase 1 and caspase 3 in the spinal cords of mutant sod1 mice and als patients has been reported previously martin 1999 ; li et al. 2000 ; pasinelli et al. 2000 ; vukosavic et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199277 12843244 266728 3531 1508 CASP7 caspase 7 caspase 7 0 1.0 more recently activation of caspase 7 8 and 9 in a mouse model at end stage of the disease has been also reported gu_amp_eacute;gan et al. 2001 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199278 12843244 266729 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 moreover inhibition of caspase s with peptide inhibitors or by introducing a dominant negative mutant of caspase 1 delayed the onset and progression of the disease symptoms in g93a sod1 g93a transgenic mice friedlander et al. 1997 ; li et al. 2000 suggesting the importance of caspase mediated apoptosis in the als 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199279 12843244 266730 10437 5992 IL1B il 1 il 1 0 1.0 esis of als strongly suggested the involvement of caspase 11 in this process because caspase 11 is a key upstream regulator of both caspase 1 and 3 under pathological conditions wang et al. 1998 beta il 1 beta maturation and resistant to lipopolysaccharide lps induced septic shock wang et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199280 12843244 266730 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the possible involvement of both caspase 1 and caspase 3 in the pathogenesis of als strongly suggested the involvement of caspase 11 in this process because caspase 11 is a key upstream regulator of both caspase 1 and 3 under pathological con 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199281 12843244 266730 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 and caspase 3 in the pathogenesis of als strongly suggested the involvement of caspase 11 in this process because caspase 11 is a key upstream regulator of both caspase 1 and 3 under pathological conditions wang et al. 1998 beta il 1 beta maturation and resistant to lipopolysaccharide lps induced septic shock wang et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199282 12843244 266730 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the possible involvement of both caspase 1 and caspase 3 in the pathogenesis of als strongly suggested the involvement of caspase 11 in this process because caspase 11 is a key upstream regulator of both caspase 1 and 3 under pathological conditions wang e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199283 12843244 266731 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 apoptosis and caspase 3 activation by lps shock or ischemic brain injury are also defective in caspase 11 / mice kang et al. 2000 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199284 12843244 266736 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 in the present study we provide evidence that caspase 11 plays a critical role in caspase 1 and 3 activation during pathogenesis of g93a mice a mouse model of fals gurney et al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199285 12843244 266757 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 immunostaining of anti maci macrophage antigen i caltag burlingame ca anti gfap glial fibrillary acidic protein or anti neun neuronal specific nuclear protein chemicon temecula ca antibody and terminal deoxynucleotidyl transferase mediated biotinylated utp nick end labeling tunel assay were done using methods 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199286 12843244 266760 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspase 11 regulates caspase 1 and 3 activation in the spinal cords of g93a mice 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199287 12843244 266761 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 activation of caspase 1 and caspase 3 in the spinal cord of presymptomatic g93a mice has been reported previously li et al. 2000 ~60 d of age consistent with reports of active caspase 1 being present in the spinal cords of g93a mice li et al. 2000 ; pasinelli et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199288 12843244 266761 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 activation of caspase 1 and caspase 3 in the spinal cord of presymptomatic g93a mice has been reported previously li et al. 2000 ~60 d of age consistent with reports of active caspase 1 being present in the spinal cords of g93a mice li e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199289 12843244 266762 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 furthermore our analysis demonstrated a clear induction of full length caspase 1 expression starting from 60 d of age and continuing to increase as the disease progresses fig 1 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199290 12843244 266763 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 low levels of active caspase 3 were first detected at day 60 in g93a mice at approximately the time of caspase 11 induction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199291 12843244 266764 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 however no signs of caspase 1 and 3 activation were detected in the caspase 11 / ; g93a spinal cords data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199292 12843244 266765 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 these results imply that caspase 11 in addition to caspase 1 and 3 may be involved in regulating inflammatory reaction and/or apoptosis during the disease onset and progression of this mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199293 12843244 266767 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 because the lack of caspase 11 resulted in the significant inhibition of caspase 1 and caspase 3 activation our results suggest that caspase 1 and caspase 3 activation is not crucial for neurodegeneration in this mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199294 12843244 266767 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 because the lack of caspase 11 resulted in the significant inhibition of caspase 1 and caspase 3 activation our results suggest that caspase 1 and caspase 3 activation is not crucial for neurodegeneration in this mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199295 12843244 266768 10437 5992 IL1B il 1 il 1 0 1.0 furthermore because caspase 11 plays a key role in regulating il 1 beta maturation in lps stimulated mice wang et al. 1998 beta is not a key determinant in mediating neurodegeneration or the inflammatory response in this model. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199296 12843244 266769 10437 5992 IL1B il 1 il 1 0 1.0 this is consistent with the report demonstrating that the neural degeneration and accelerated death of g37r sod1 mice are not altered in the background of il 1 beta / mice nguyen et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199297 12843244 266771 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 aspase 11 has been found to be induced under multiple pathological conditions including lps induced septic shock wang et al. 1996 the experimental autoimmune encephalomyelitis eae as a mouse model of multiple sclerosis hisahara et al. 2001 brain ischemia induced by middle cerebral artery occlusion as a mouse model of stroke kang et al. 2000 and g93a transgenic mice this study . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 199298 12843244 266774 10437 5992 IL1B il 1 il 1 0 1.0 the spinal cord of g93a mice was not affected by the caspase 11 deficiency indicating that the overall inflammatory response proceeded in the absence of caspase 11 because the complete elimination of il 1 beta in il 1 beta / mice did not alter the disease course of sod1 g37r mice nguyen et al. 2001 the most likely interpretation is that g93a induces inflammatory responses through multiple or redundant 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199299 12843244 266774 10437 5992 IL1B il 1 il 1 0 1.0 beta in il 1 beta / mice did not alter the disease course of sod1 g37r mice nguyen et al. 2001 the most likely interpretation is that g93a induces inflammatory responses through multiple or redundant pathways. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199300 12843244 266775 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 our study cannot rule out however that the residual caspase activity in caspase 11 / background sufficient for neurodegeneration and caspases other than caspase 1 and caspase 3 may be involved in mediating neuronal degeneration in g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199301 12843244 266775 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 our study cannot rule out however that the residual caspase activity in caspase 11 / background sufficient for neurodegeneration and caspases other than caspase 1 and caspase 3 may be involved in mediating neuronal degeneration in g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199302 12843244 266777 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 in this regard it is worth noting that the activation of caspase 8 and 9 was found only at the end stage of mutant sod expressing transgenic mice gu_amp_eacute;gan et al. 2001 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199303 12843244 266782 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however the weak protection by bcl 2 overexpression in a mouse model of als kostic et al. 1997 suggests an involvement of alternative cell death mechanisms as well. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199304 12843244 266786 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 we showed previously that introduction of dominant negative caspase 1 c281g mutant in g93a mice delayed the disease onset and progression friedlander et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199305 12843244 266787 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 because caspase 1 interacts with caspase 11 wang et al. 1998 this dominant negative mutant of caspase 1 may act by inhibiting caspase 11. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199306 12843244 266788 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 however because the deletion of caspase 11 did not prevent neurodegeneration in the g93a mice it is possible that caspase 1c281g may act by inhibiting caspases other than caspase 1 11 or 3 or by another unknown gain of function process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199307 12843244 266794 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 upregulation of caspase 11 at the disease onset in g93a mice and reduction of caspase 1 and caspase 3 activation in caspase 11 / ;g93a double mutant mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199308 12843244 266794 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 upregulation of caspase 11 at the disease onset in g93a mice and reduction of caspase 1 and caspase 3 activation in caspase 11 / ;g93a double mutant mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199309 12843244 266795 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 a upregulation of caspase 11 and appearance of active caspase 1 and caspase 3 fragments in the g93a spinal cords. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199310 12843244 266795 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 a upregulation of caspase 11 and appearance of active caspase 1 and caspase 3 fragments in the g93a spinal cords. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199311 12843244 266798 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 eighty micrograms of the samples were also immunoblotted with monoclonal anti caspase 1 antibody for detection of full length caspase 1 c1fl and the active form active c1 and with anti active caspase 3 antibody active c3 . *igg h igg heavy chain; *nsp nonspecific. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199312 12843244 266798 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 eighty micrograms of the samples were also immunoblotted with monoclonal anti caspase 1 antibody for detection of full length caspase 1 c1fl and the active form active c1 and with anti active caspase 3 antibody active c3 . *igg h igg heavy chain; *nsp nonspecific. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199313 12843244 266802 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the caspase 3 caspase 1 and caspase 11 like enzyme activities were measured using fluorogenic substrates acdevd amc devd acyvad amc yvad and acvehd amc vehd respectively in the lysates n = 4; mean _amp_#177; sd . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199314 12843244 266802 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the caspase 3 caspase 1 and caspase 11 like enzyme activities were measured using fluorogenic substrates acdevd amc devd acyvad amc yvad and acvehd amc vehd respectively in the lysates n = 4; mean _amp_#177; sd . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199315 12843244 266803 10437 5992 IL1B il 1 il 1 0 1.0 c reduction of il 1 beta level in the absence of caspase 11 in the caspase 11 / ; g93a spinal cords. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199316 12843244 266804 10437 5992 IL1B il 1 il 1 0 1.0 spinal cords from caspase 11; g93a mice were taken at indicated days of age and the level of mature il 1 beta was measured by elisa n = 4; mean_amp_#177;sd . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199317 12843244 266829 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 to examine whether caspase 11 indeed regulates caspase 1 and/or 3 in the spinal cord of g93a mice we crossed caspase 11 / and g93a mice and compared the profiles of caspase activities in the symptomatic day 120 spinal cord lysates of littermate caspase 11 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199318 12843244 266830 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 consistent with the activation of caspase 1 and caspase 3 and the caspase 11 induction profile by immunoblot fig 1 a acyvad amc caspase 1 like acdevd amc caspase 3 like and acvehd amc caspase 11 like cleavage activities thornberry et al. 1997 ; kang et al. 2000 were elevated in the lumbar and thoracic spinal cords of g93a mice fig 1 b 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199319 12843244 266830 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 consistent with the activation of caspase 1 and caspase 3 and the caspase 11 induction profile by immunoblot fig 1 a acyvad amc caspase 1 like acdevd amc caspase 3 like and acvehd amc caspase 11 like cleavage activities thornberry et al. 1997 ; kang et al. 2000 were elevated in the lumbar and thoracic spinal cords of g93a mice fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199320 12843244 266831 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 in caspase 11 / ; g93a mice the absence of caspase 11 resulted in a significant reduction of caspase 3 and caspase 1 like activities as well as caspase 11 like activity fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199321 12843244 266831 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in caspase 11 / ; g93a mice the absence of caspase 11 resulted in a significant reduction of caspase 3 and caspase 1 like activities as well as caspase 11 like activity fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199322 12843244 266833 10437 5992 IL1B il 1 il 1 0 1.0 the secretion and maturation of il 1 beta is another downstream indicator of caspase 11 caspase 1 pathway kuida et al. 1995 beta in wild type control caspase 11 +/ ; g93a and caspase 11 / ; g93a mice by elisa fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199323 12843244 266833 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the secretion and maturation of il 1 beta is another downstream indicator of caspase 11 caspase 1 pathway kuida et al. 1995 beta in wild type control caspase 11 +/ ; g93a and caspase 11 / ; g93a mice by elisa fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199324 12843244 266834 10437 5992 IL1B il 1 il 1 0 1.0 the increase in il 1 beta levels was first detected at approximately day 90 and remained at higher levels at later time points. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199325 12843244 266835 10437 5992 IL1B il 1 il 1 0 1.0 the levels of il 1 beta in the spinal cords of caspase 11 / ; g93a mice were consistently lower than that of caspase 11 +/ ; g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199326 12843244 266836 10437 5992 IL1B il 1 il 1 0 1.0 this result indicates that caspase 11 also plays a key role in regulating il 1 beta levels in the g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199327 12843244 266839 10437 5992 IL1B il 1 il 1 0 1.0 together these results suggest that caspase 11 is activated and regulates the activities of its downstream caspases 1 and 3 and also il 1 beta levels during the pathogenesis of this model of fals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199328 12843244 266841 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the evidence of activation of caspase 1 and 3 by caspase 11 in g93a mice prompted us to compare the inflammatory response and cell death in g93a spinal cords in the presence or absence of caspase 11. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199329 12843244 266845 10437 5992 IL1B il 1 il 1 0 1.0 this result suggests that despite the significant reduction of caspase activation and il 1 beta levels in caspase 11 / ; g93a mice the inflammatory response induced by mutant sod1 was not significantly altered. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 199330 12843244 266867 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 interleukin 1|sod1 g93a protein|superoxide dismutase|casp3 protein human|casp11 protein mouse|casp3 protein mouse|caspase 3|caspases|caspase 1| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193536 14511332 258335 17610 9605 PTGS2 cox 2 cox 2 0 1.0 they are produced by two different isoforms of the cyclooxygenase cox enzyme namely cox 1 and cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193537 14511332 258336 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in particular cox 2 was demonstrated to be crucial for pg synthesis in inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193538 14511332 258337 17610 9605 PTGS2 cox 2 cox 2 0 1.0 recently inhibition of cox 2 was shown to prevent the loss of motor neurons in a model of amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193539 14511332 258338 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore spinal cox 2 expression was shown to be increased in transgenic mice that produce an als like syndrome. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193540 14511332 258339 17610 9605 PTGS2 cox 2 cox 2 0 1.0 therefore we investigated the expression of cox 1 and cox 2 in the spinal cord of seven human sporadic als patients by means of immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193541 14511332 258341 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 expression was dramatically increased in the spinal cord of patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193542 14511332 258343 17610 9605 PTGS2 cox 2 cox 2 0 1.0 statistical analysis showed a significantly higher expression of cox 2 in als for both neurons and glia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193543 14511332 258347 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the results of our study corroborate a potential role for cox 2 in the pathogenesis of motor neuron death in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193544 14511332 258348 17610 9605 PTGS2 cox 2 cox 2 0 1.0 selective cox 2 inhibition might therefore offer a new possibility in the treatment of human als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193545 14511332 258349 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however to determine the exact role of cox 2 in human als will require further research. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193546 14511332 258352 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 missense mutations in a gene encoding for the cu/zn superoxide dismutase sod1 account for a familial form of als linked to chromosome 21q rosen et al . 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193547 14511332 258355 10463 6018 IL6 il 6 il 6 0 1.0 levels of il 1beta il 6 and tumour necrosis factor alpha were found to be elevated in experimental and human sals ghezzi et al . 1998 ; sekizawa et al . 1998 ; li et al . 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193548 14511332 258356 17610 9605 PTGS2 cox 2 cox 2 0 1.0 very recently the proinflammatory enzyme cyclooxygenase 2 cox 2 was reported to be highly expressed in the spinal cord of msod1 mice almer et al . 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193549 14511332 258357 17610 9605 PTGS2 cox 2 cox 2 0 1.0 currently two cox isoforms are known namely cox 1 and cox 2 vane et al . 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193550 14511332 258358 17610 9605 PTGS2 cox 2 cox 2 0 1.0 whereas cox 1 mainly subserves _amp_#8216;house keeping_amp_#8217; functions cox 2 is the product of an _amp_#8216;immediate early gene_amp_#8217; that is rapidly inducible and tightly regulated vane et al . 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193551 14511332 258359 17610 9605 PTGS2 cox 2 cox 2 0 1.0 under normal conditions cox 2 expression is highly restricted to distinct organ systems including the kidney harris et al . 1994 and the eye maihofner et al . 2001 but cox 2 expression can be dramatically increased in various tissues following the initiation of transcription by activating factors including different proinflammatory cytokines arterial wall sheer forces or 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193552 14511332 258360 17610 9605 PTGS2 cox 2 cox 2 0 1.0 recently one of us demonstrated the constitutive expression of both cox isoforms in the spinal cord of rodents and a dramatic induction of spinal cox 2 protein following peripheral nociceptive stimulation maihofner et al . 2000b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193553 14511332 258364 17610 9605 PTGS2 cox 2 cox 2 0 1.0 very recently inhibition of cox 2 was protective in a glutamate mediated in vitro model of sals drachman _amp_ rothstein 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193554 14511332 258365 17610 9605 PTGS2 cox 2 cox 2 0 1.0 almer et al . 2001 described the immunohistochemical distribution of cox 2 in the spinal cord of msod1 mice over the progression of the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193555 14511332 258366 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore they showed an increased prostaglandin e2 pg e 2 level in post mortem samples of als cases as a marker for cox 2 activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193556 14511332 258368 17610 9605 PTGS2 cox 2 cox 2 0 1.0 therefore we compared the spinal expression of cox 1 and cox 2 in sals and control patients by means of immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193557 14511332 258369 17610 9605 PTGS2 cox 2 cox 2 0 1.0 we here demonstrate a high expression of cox 2 protein in spinal cord specimens of human sals cases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193558 14511332 258371 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the increased expression of cox 2 was corroborated by a significantly higher concentration of pg e 2 in the cerebrospinal fluid of patients diagnosed with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193559 14511332 258379 17610 9605 PTGS2 cox 2 cox 2 0 1.0 briefly goat polyclonal antisera raised against human cox 1 and cox 2 protein santa cruz biotechnology santa cruz ca were employed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193560 14511332 258380 10731 6149 ITGAM mac 1 mac 1 0 1.0 nal antihuman antibody to glial fibrillary acidic protein to label astrocytes gfap; dako glostrup denmark and a mouse monoclonal antihuman antibody to macrophage antigen complex 1 labelling microglia mac 1 serotec raleigh nc was used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193561 14511332 258380 17610 9605 PTGS2 cox 2 cox 2 0 1.0 to further differentiate the cellular distributions of cox 1 and cox 2 proteins a double staining procedure using a mouse monoclonal antihuman antibody to glial fibrillary acidic protein to label astrocytes gfap; dako glostrup denmark and a mouse monoclonal antihuman an 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193562 14511332 258380 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 to further differentiate the cellular distributions of cox 1 and cox 2 proteins a double staining procedure using a mouse monoclonal antihuman antibody to glial fibrillary acidic protein to label astrocytes gfap; dako glostrup denmark and a mouse monoclonal antihuman antibody to macrophage antigen complex 1 labelling microglia mac 1 serotec raleigh nc was used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193563 14511332 258382 614 437 ALPI alkaline phosphatase alkaline phosphatase 0 1.0 the bound primary antibodies were visualized according to the streptavidin biotin complex sbc and alkaline phosphatase antialkaline phosphatase apaap methods alone or in combination with double staining procedures probst cousin et al . 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193564 14511332 258387 17610 9605 PTGS2 cox 2 cox 2 0 1.0 specimens were coded and assessed observer blinded for presence of cox 1 and cox 2 immunoreactivity ir . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193565 14511332 258401 17610 9605 PTGS2 cox 2 cox 2 0 1.0 membranes were probed with polyclonal goat antihuman cox 1 or cox 2 serum diluted 1 : 1000 followed by a horseradish peroxidase hrp linked donkey antigoat igg secondary antibody diluted 1 : 1000; santa cruz biotechnology . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193566 14511332 258409 4959 2367 CRP c-reactive protein c reactive protein 0 1.0 a simultaneous infection was ruled out by routine laboratory assessment of c reactive protein leucocyte count and erythrocyte sedimentation rate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193567 14511332 258418 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the normal spinal cord and specifity of the antibodies to assess the specifity of the antibodies used for immunohistochemistry we performed western blotting experiments for the detection of cox 1 and cox 2 protein with spinal protein extracts from human donors with no known neurological diseases two males age 65 and 78 years . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193568 14511332 258421 17610 9605 PTGS2 cox 2 cox 2 0 1.0 figure 1b demonstrates the results of a similar experiment for the detection of cox 2 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193569 14511332 258422 17610 9605 PTGS2 cox 2 cox 2 0 1.0 protein extracts left lane from human spinal cords were separated alongside purified sheep cox 2 protein right lane by sds page blotted onto nitrocellulose membranes and incubated with the same cox 2 antibody as that used for immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193570 14511332 258423 17610 9605 PTGS2 cox 2 cox 2 0 1.0 unpurified cox 2 proteins derived from either cell lysates or tissues typically produce a double or triple band in western blot analysis at 68 75 kda fig 1b left lane . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193571 14511332 258424 17610 9605 PTGS2 cox 2 cox 2 0 1.0 a single band at 75 kda was detected for the purified cox 2 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193572 14511332 258425 17610 9605 PTGS2 cox 2 cox 2 0 1.0 to exclude potential crossreactions between the antibodies for the two cox isoforms we determined the specifity with purified cox 1 and cox 2 protein by western blotting. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193573 14511332 258426 17610 9605 PTGS2 cox 2 cox 2 0 1.0 figure 1c shows that the goat antihuman polyclonal cox 1 antibody exclusively detected cox 1 protein and not cox 2 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193574 14511332 258427 17610 9605 PTGS2 cox 2 cox 2 0 1.0 figure 1d shows the results from a similar experiment in which the goat antihuman polyclonal cox 2 antibody detected only cox 2 protein and not cox 1 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193575 14511332 258432 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in control specimens only a few motor neurons and interneurons were immunoreactive for cox 2 protein fig 2b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193576 14511332 258433 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in most neurons cox 2 ir was absent fig 2c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193577 14511332 258434 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the immunoreactive product could be clearly distinguished from lipofuscin like inclusions which had a different staining pattern compared to the reddish cox 2 ir fig 2c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193578 14511332 258438 17610 9605 PTGS2 cox 2 cox 2 0 1.0 when the number of neurons with cox 2 ir was counted the percentage of cox 2 positive motor neurons and interneurons was found to be significantly increased in sals patients compared to controls despite an overall reduction in the number of neurons 13.31 _amp_plusmn; 5 vs 37. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193579 14511332 258439 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore expression of cox 2 was found to be enhanced in sals cases compared to controls in cells that showed no neuronal morphology i.e. cells of presumed glial origin fig 2f and g . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193580 14511332 258441 17610 9605 PTGS2 cox 2 cox 2 0 1.0 as demonstrated by the coexpression with gfap glial cox 2 expression was predominantly found in astrocytes fig 2h . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193581 14511332 258442 10731 6149 ITGAM mac 1 mac 1 0 1.0 however cox 2 ir was occasionally detected in smaller cells with the morphological characteristics of microglia as shown by its coexpression with the microglia marker mac 1 fig 2i . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193582 14511332 258442 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however cox 2 ir was occasionally detected in smaller cells with the morphological characteristics of microglia as shown by its coexpression with the microglia marker mac 1 fig 2i . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193583 14511332 258443 17610 9605 PTGS2 cox 2 cox 2 0 1.0 overall the glial expression of cox 2 was significantly increased in sals cases 0.71 _amp_plusmn; 0.5 vs 2.3 _amp_plusmn; 0.5; wilcoxon signed ranked test p _lt_ 0.05; fig 5 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193584 14511332 258446 10731 6149 ITGAM mac 1 mac 1 0 1.0 this could also be demonstrated by the costaining of cox 1 with the microglial marker mac 1 fig 2l . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193585 14511332 258454 17610 9605 PTGS2 cox 2 cox 2 0 1.0 firstly despite a significant reduction of neurons in the spinal cord the percentage of cox 2 expressing motor neurons and interneurons was increased in sals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193586 14511332 258455 17610 9605 PTGS2 cox 2 cox 2 0 1.0 secondly glial expression of cox 2 was enhanced in sals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193587 14511332 258459 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 overexpression in sals 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193588 14511332 258460 17610 9605 PTGS2 cox 2 cox 2 0 1.0 expression of cox 2 in human diseases is a topic of considerable interest with regard to the recent development of cox 2 selective inhibitors hawkey 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193589 14511332 258461 17610 9605 PTGS2 cox 2 cox 2 0 1.0 regarding als drachman and rothstein drachman _amp_ rothstein 2000 demonstrated a beneficial effect of cox 2 inhibition in an in vitro model while almer et al . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193590 14511332 258462 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2001 demonstrated a role for cox 2 in mutant sod1 mice and yasojima et al . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193591 14511332 258463 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2001 showed up regulation of cox 2 mrna in spinal cord specimens of sals cases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193592 14511332 258464 17610 9605 PTGS2 cox 2 cox 2 0 1.0 recently two animal studies demonstrated a beneficial effect of selective cox 2 inhibition in mouse models of als drachman et al . 2002 ; pompl et al . 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193593 14511332 258465 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however the cellular origin of cox 2 up regulation in human sals has so far not been delineated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193594 14511332 258467 17610 9605 PTGS2 cox 2 cox 2 0 1.0 here we provide immunohistochemical evidence for a dramatic increase in spinal cox 2 expression in motor neurons interneurons and glial cells in sals despite an overall reduction in the number of neurons compared to controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193595 14511332 258468 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 was also observed in motor neurons of control specimens the staining was accentuated in the perinuclear region. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193596 14511332 258469 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this agrees with reports on the constitutive expression of cox 2 in the spinal cord of rodents and the localization of cox 2 protein determined electron microscopically maihofner et al . 2000b ; maihofner et al . 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193597 14511332 258470 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in normal conditions cox 2 derived pgs are assumed to play homeostatic functions beiche et al . 1996 ; vane et al . 1998 ; maihofner et al . 2000b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193598 14511332 258471 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nevertheless the reason for the dramatic cox 2 overexpression in sals is unknown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193599 14511332 258472 17610 9605 PTGS2 cox 2 cox 2 0 1.0 one potential explanation could be cox 2's interplay with glutamate levels of which are elevated in the csf of sals patients plaitakis et al . 1988 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193600 14511332 258473 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in pain models cox 2 protein was induced following glutamatergic stimulation maihofner et al . 2000b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193601 14511332 258475 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nf kappa b. nf kappa b in particular is crucial for cox 2 induction in several cell types vane et al . 1998 and its activation has also been linked to neurodegeneration grilli _amp_ memo 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193602 14511332 258475 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nf kappa b. nf kappa b in particular is crucial for cox 2 induction in several cell types vane et al . 1998 and its activation has also been linked to neurodegeneration grilli _amp_ memo 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193603 14511332 258476 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cytokines could also contribute to high expression of cox 2 in sals particularly il 1beta and il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193604 14511332 258476 10463 6018 IL6 il 6 il 6 0 1.0 cytokines could also contribute to high expression of cox 2 in sals particularly il 1beta and il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193605 14511332 258477 17610 9605 PTGS2 cox 2 cox 2 0 1.0 both are known inducers of cox 2 expression and their concentrations are elevated in the csf of als cases sekizawa et al . 1998 ; vane et al . 1998 ; li et al . 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193606 14511332 258479 10463 6018 IL6 il 6 il 6 0 1.0 il 1beta and il 6 are assumed to derive from glia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193607 14511332 258481 17610 9605 PTGS2 cox 2 cox 2 0 1.0 consistently we demonstrated a significantly higher expression of cox 2 in glial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193608 14511332 258482 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in agreement with a study in transgenic msod1 mice almer et al . 2001 cox 2 was found to be predominantly expressed in astrocytes and not microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193609 14511332 258483 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this might be explained by the capability of il 1beta to induce cox 2 in astrocytes but not in microglia cells vane et al . 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193610 14511332 258484 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 expression in the astroglia of rodents has been shown previously beiche et al . 1996 ; maihofner et al . 2000b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193611 14511332 258486 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore despite a significant reduction in the number of interneurons in our sals cases cox 2 expression was also found to be increased in this cell type. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193612 14511332 258487 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 this is consistent with other studies showing an altered protein expression e.g. ubiquitin stephens et al . 2001 and an active involvement of interneurons in the pathology of als rowland _amp_ shneider 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193613 14511332 258490 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2001 also found that cox 2 was present in motor neurons and predominantly in astroglia although no apparent differences in cox 1 expression were seen between msod1 mice and controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193614 14511332 258498 17610 9605 PTGS2 cox 2 cox 2 0 1.0 therefore we do not think that misclassification of neurons led to the high expression of cox 2 protein in sals presented here. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193615 14511332 258500 17610 9605 PTGS2 cox 2 cox 2 0 1.0 been used in previous studies maihofner et al . 2000b ; damm et al . 2001 ; maihofner et al . 2001 ; charalambous et al . 2003 ; maihofner et al . 2003 and were shown to be specific for the cox 1 and cox 2 protein respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193616 14511332 258503 17610 9605 PTGS2 cox 2 cox 2 0 1.0 we have intentionally focused on the in situ expression of both cox 1 and cox 2 proteins in human als spinal cords. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193617 14511332 258511 17610 9605 PTGS2 cox 2 cox 2 0 1.0 increased pg e 2 levels are also in agreement with the results of two recent animal studies where selective cox 2 inhibition was found to be protective against motor neuron death drachman et al . 2002 ; pompl et al . 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193618 14511332 258512 17610 9605 PTGS2 cox 2 cox 2 0 1.0 a role for cox 2 in the pathogenesis of sals? 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193619 14511332 258513 17610 9605 PTGS2 cox 2 cox 2 0 1.0 what is the significance of cox 2 overexpression in als? 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193620 14511332 258514 17610 9605 PTGS2 cox 2 cox 2 0 1.0 there are several lines of evidence that cox 2 might play a role in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193621 14511332 258515 17610 9605 PTGS2 cox 2 cox 2 0 1.0 firstly application of a selective cox 2 inhibitor in an in vitro organotypic model of als protected against the loss of motor neurons in this system drachman _amp_ rothstein 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193622 14511332 258516 17610 9605 PTGS2 cox 2 cox 2 0 1.0 secondly this finding was corroborated in two in vivo studies where application of a selective cox 2 inhibitor protected against motor neuron degeneration and prolonged survival in transgenic mouse models of als drachman et al . 2002 ; pompl et al . 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193623 14511332 258517 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thirdly based on the action of pgs cox 2 could promote inflammatory processes in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193624 14511332 258520 17610 9605 PTGS2 cox 2 cox 2 0 1.0 therefore cox 2 derived pgs could play a role in glutamate excitotoxicity which is postulated to occur in als rowland _amp_ shneider 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193625 14511332 258521 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this is also in line with the study of kelley and colleagues kelley et al . 1999 demonstrating a potentiation of kainic acid induced excitotoxicity in transgenic mice overexpressing cox 2 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193626 14511332 258522 17610 9605 PTGS2 cox 2 cox 2 0 1.0 fourthly cox 2 may also be involved in the production of reactive oxygen species and oxidative stress vane et al . 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193627 14511332 258527 17610 9605 PTGS2 cox 2 cox 2 0 1.0 finally cox 2 appears to be involved in neuronal cell cycle regulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193628 14511332 258529 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2002 showed that the expression of the endogenous cell cycle dependent kinase cdk inhibitor inhibitor kinase ink p18ink4 is a downstream target of neuronal cox 2 expression. p18ink4 inhibits cdk 4 6 which is in turn a key player in the regulation of g1 progression zindy et al . 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193629 14511332 258530 17610 9605 PTGS2 cox 2 cox 2 0 1.0 therefore cox 2 inhibition might attenuate apoptotic damage in neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193630 14511332 258531 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however the specifity of cox 2 expression for als has to be questioned. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193631 14511332 258532 17610 9605 PTGS2 cox 2 cox 2 0 1.0 increased cox 2 levels were also shown for alzheimer's disease parkinson's disease epilepsy and even cerebral infarction pasinetti _amp_ aisen 1998 ; vane et al . 1998 ; scali et al . 2000 ; kunz _amp_ oliw 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193632 14511332 258533 17610 9605 PTGS2 cox 2 cox 2 0 1.0 therefore we would explicitly like to state that cox 2 expression seems to be a common endpoint in neurodegeneration rather than the actual cause of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193633 14511332 258534 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore there is the possibility that cox 2 expression might be protective and antiapoptotic. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193634 14511332 258536 10437 5992 IL1B il 1 il 1 0 1.0 recently one of us was able to show that the expression of cox 2 in crc parallels the expression of il 1 beta and il 6 in crc maihofner et al . 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193635 14511332 258536 17610 9605 PTGS2 cox 2 cox 2 0 1.0 recently one of us was able to show that the expression of cox 2 in crc parallels the expression of il 1 beta and il 6 in crc maihofner et al . 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193636 14511332 258536 10463 6018 IL6 il 6 il 6 0 1.0 recently one of us was able to show that the expression of cox 2 in crc parallels the expression of il 1 beta and il 6 in crc maihofner et al . 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193637 14511332 258537 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in this context cox 2 is thought to be actively involved in carcinogenesis and antiapoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193638 14511332 258538 17610 9605 PTGS2 cox 2 cox 2 0 1.0 therefore although the animal findings are corroborated by the immunohistochemical results presented here the exact role of cox 2 in the pathogenesis of human als still remains to be elucidated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193639 14511332 258539 17610 9605 PTGS2 cox 2 cox 2 0 1.0 clinical trials are underway in the united states north east als consortium to test a potential benefit of selective cox 2 inhibition in human als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193640 14511332 258541 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in contrast to the cox 2 protein cox 1 expression was predominantly found in microglia cells and showed no significant difference between sals and controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193641 14511332 258548 17610 9605 PTGS2 cox 2 cox 2 0 1.0 alzheimer disease pasinetti _amp_ aisen 1998 where cox 2 was found to be the pivotal isoform involved in the pathology. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193642 14511332 258550 17610 9605 PTGS2 cox 2 cox 2 0 1.0 expression of cox 2 protein was markedly increased in the motoneurons interneurons and glial cells of sals cases compared to controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193643 14511332 258552 17610 9605 PTGS2 cox 2 cox 2 0 1.0 based on the beneficial effects of selective cox 2 inhibition in models of als the results of this and other studies might give a rationale for clinical investigations on potential positive effects of selective cox 2 inhibitors in human sals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193644 14511332 258552 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inhibition in models of als the results of this and other studies might give a rationale for clinical investigations on potential positive effects of selective cox 2 inhibitors in human sals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193645 14511332 258556 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 als amyotrophic lateral sclerosis; cox cyclooxygenase; csf cerebrospinal fluid; gfap glial fibrillary acidic protein; ir immunoreactivity; pg prostaglandins; sod superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 193646 14511332 258556 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 als amyotrophic lateral sclerosis; cox cyclooxygenase; csf cerebrospinal fluid; gfap glial fibrillary acidic protein; ir immunoreactivity; pg prostaglandins; sod superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195619 14556941 260916 13374 7197 MOG myelin oligodendrocyte glycoprotein myelin oligodendrocyte glycoprotein 0 1.0 encephalomyelitis eae the conventional model of ms. therefore we examined whether riluzole an inhibitor of glutamate transmission affects the pathogenesis and clinical features of ms like disease in myelin oligodendrocyte glycoprotein mog induced eae in mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195620 14556941 260916 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 recent studies suggest that glutamate neurotoxicity is involved in the pathogenesis of multiple sclerosis ms and that treatment with glutamate receptor ampa/kainate antagonists inhibits experimental autoimmune encephalomyelitis eae the conventional model of ms. therefore we examined whether riluzole an i 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 195621 14556941 260916 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 recent studies suggest that glutamate neurotoxicity is involved in the pathogenesis of multiple sclerosis ms and that treatment with glutamate receptor ampa/kainate antagonists inhibits experimental autoimmune encephalomyelitis eae the conventional model of ms. therefore we examined whether riluzole an inhibitor of glutamate transmission affects the 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195622 14556941 260925 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis ms is a chronic disabling autoimmune neurological disorder targeting the white matter of the central nervous system cns . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 195623 14556941 260942 13374 7197 MOG myelin oligodendrocyte glycoprotein myelin oligodendrocyte glycoprotein 0 1.0 we therefore investigated the clinical effects of riluzole in reducing the insult to neurons and axons in myelin oligodendrocyte glycoprotein mog induced eae in c3h.sw mice a chronic model which appears to resemble the clinical course of progressive ms better than the other disorders induced by auto antigens [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195624 14556941 261040 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 glutamate receptor mediated toxicity has been observed in an oligodendroglial cell line [ 28 ] and in cultures of differentiated oligodendrocytes [ 26 and 42 ] and in an animal model for ms [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195625 14556941 261042 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 hardin et al. [ 21 ] showed that expression of glutamine synthetase and glutamate dehydrogenase the enzymes that are responsible for glutamate degradation was dramatically reduced in astrocytes during the course of eae affecting the reuptake of glutamate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195626 14556941 261055 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 however based on several previous studies showing that the csf glutamate levels are increased in ms patients [ 2 ] and that glutamate receptor antagonists ameliorate neurological symptoms in several forms of eae [ 38 and 43 ] it is tempting to suggest that it works by the suppression of glutamatergic neurotransmission in the cns achieved by 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195627 14556941 261059 12436 6925 MBP myelin basic protein myelin basic protein 0 1.0 a recent study found high expression of the glutamate ion channel receptor glur3 on normal human t cells human t leukemia cells and mouse anti myelin basic protein t cells [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 195628 14556941 261072 12212 6783 MAG myelin associated glycoprotein myelin associated glycoprotein 0 1.0 myelin associated glycoprotein|neuroprotective agents|oligodendrocyte myelin glycoprotein|riluzole| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196856 14597108 262717 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 monocyte chemoattractant protein mcp 1 might play an important role in microglial recruitment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196857 14597108 262718 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 we studied mcp 1 levels in sera and cerebrospinal fluid of 29 als patients and compared the results with 11 control patients with tension headache. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196858 14597108 262719 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 the mcp 1 level was determined using enzyme linked immunosorbent assays elisa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196859 14597108 262720 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 a significant increase in cerebrospinal fluid mcp 1 level but not serum level was seen in the patients with als compared to the control subjects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196860 14597108 262721 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 these results suggest that cerebrospinal fluid mcp 1 activity may be a sensitive marker for neuroinflammation in als useful for monitoring treatment trials in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196861 14597108 262727 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 glial cells the resident macrophages of the cns are present before the onset of clinical symptoms and prior to significant motor neuron loss in transgenic mice with mutations of the cu/zn form of the superoxide dismutase gene sod1 an animal model of als [ alexianu et al. 2001 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196862 14597108 262729 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 ediators released from activated microglia which have harmful effects on neuron survival including peroxynitrite [ beal et al. 1997 and tohgi et al. 1999 ] prostaglandin e 2 [ almer et al. 2002 ] and interleukin 6 [ sekizawa et al. 1998 ] has been demonstrated in the cerebrospinal fluid and spinal cord of als patients for review see [ mcgeer and mcgeer 2002 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196863 14597108 262730 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 interestingly minocycline a broad spectrum antibiotic inhibiting microglial activation and proliferation [ tikka et al. 2001 and yrjanheikki et al. 1999 ] is neuroprotective in mutant superoxide dismutase transgenic mouse models of als [ kriz et al. 2002 van den bosch et al. 2002 and zhu et al. 2002 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196864 14597108 262733 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 especially monocyte chemoattractant protein 1 mcp 1 [ maghazachi et al. 1994 ] may be a key trigger for mediating chemotaxis of monocytes to the injured cns since it is a potent activator of macrophage function [ sozzani et al. 1995 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196865 14597108 262733 3758 10618 CCL2 monocyte chemoattractant protein-1 monocyte chemoattractant protein 1 0 1.0 especially monocyte chemoattractant protein 1 mcp 1 [ maghazachi et al. 1994 ] may be a key trigger for mediating chemotaxis of monocytes to the injured cns since it is a potent activator of macrophage function [ sozzani et al. 1995 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196866 14597108 262734 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 d immunohistochemically in mature senile plaques and reactive microglia in brain tissues of patients suffering from alzheimer's disease [ ishizuka et al. 1997 ] as well as in demyelinating plaques in multiple sclerosis patients [ mcmanus et al. 1998 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 196867 14597108 262734 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 mcp 1 was found immunohistochemically in mature senile plaques and reactive microglia in brain tissues of patients suffering from alzheimer's disease [ ishizuka et al. 1997 ] as well as in demyelinating pl 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196868 14597108 262735 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 changes in mcp 1 in living patients with als have not been studied however its evaluation might aid in understanding the pathogenesis of the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196869 14597108 262737 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 therefore the present study compares the mcp 1 level in csf and serum of patients with als with that in controls. 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196870 14597108 262751 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 mcp 1 levels in serum and csf samples were quantified by elisa quantikine r_amp_#x26;d systems according to the manufacturer's instructions and read at a wavelength of 450 nm reference wavelength 550 nm wi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196871 14597108 262756 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 the mann_amp_#x2013;whitney u test was used to compare mcp 1 levels in csf and serum in als patients with controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196872 14597108 262759 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 regression analysis was used to test for a possible relationship between age at time of lumbar puncture and intrathecal mcp 1 levels. 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196873 14597108 262761 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 the csf concentration of mcp 1 was significantly p _amp_#x3c;0.001 higher in als patients 570.5_amp_#xb1;199.9 pg/ml as compared to controls 285.5_amp_#xb1;81.8 pg/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196874 14597108 262762 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 although an overlap of values was seen among the als group mcp 1 values of only 8 patients of 29 were lower than or equal to the highest value in the control group i.e 396.8 pg/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196875 14597108 262763 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 furthermore mcp 1 levels in als patients 570.5_amp_#xb1;199.9 pg/ml were substantially higher in the csf p _amp_#x3c;0.001 than in the serum 191.6_amp_#xb1;104.9 pg/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196876 14597108 262765 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 by analysis of variance there was no significant influence of age at onset of symptoms nor of duration of the disease on mcp 1 levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196877 14597108 262766 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 regression analysis did not reveal a strong relationship between age at time of lumbar puncture and intrathecal mcp 1 level in als patients r =0.045; fig 1a or control patients r =0 12; fig 1b . 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196878 14597108 262771 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 this is the first study demonstrating that mcp 1 inflammatory signalling might mediate recruitment of myelomonocytic cells to areas of neurodegeneration in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196879 14597108 262772 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 the present findings provide in vivo evidence for elevated cerebrospinal fluid levels of mcp 1 in als patients providing further evidence for the hypothesis that inflammatory processes contribute to neurodegeneration in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196880 14597108 262773 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 the higher levels of mcp 1 in the csf than in paired serum samples in patients with als provide evidence for intrathecal synthesis of this chemokine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196881 14597108 262774 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 we hypothesize that degeneration of motor neurons in the lumbar spinal cord with subsequent activation of astrocytes and microglial cells induces a release of mcp 1 a chemokine produced by both glial cell types [ hayashi et al. 1995 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196882 14597108 262775 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 since mcp 1 is a potent activator of macrophage function and specifically attracts myelomonocytic cells [ calvo et al. 1996 and glabinski et al. 1997 ] it most likely triggers further immigration/activation of m 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196883 14597108 262777 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 therefore one might speculate that mcp 1 might further increase during the course of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196884 14597108 262778 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 repetitive measurement of mcp 1 may be a useful laboratory marker to follow up patients participating in neuroprotective drug trials. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196885 14597108 262779 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 due to the lack of correlation between clinical impairment/progression of the disease and csf mcp 1 levels a larger sample size may be needed to address this specific question. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196886 14597108 262780 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 from a clinical perspective it would be interesting to explore the potential of immunotherapies specifically targeting mcp 1 dependant mechanisms in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196887 14597108 262781 3758 10618 CCL2 monocyte chemoattractant protein-1 monocyte chemoattractant protein 1 0 1.0 monocyte chemoattractant protein 1 deficiency is protective in a murine stroke model [ hughes et al. 2002 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196888 14597108 262782 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 in experimental autoimmune encephalomyelitis absence of mcp 1 in mice leads to decreased local macrophage recruitment and antigen specific t helper cell type 1 immune response [ huang et al. 2001 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196889 14597108 262783 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 of note is that bindarit an indazolic derivative able to inhibit mcp 1 is able to ameliorate adjuvant arthritis in rats [ guglielmotti et al. 2002 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196890 14597108 262784 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 the present data suggest that mcp 1 levels in csf may be an appropriate surrogate marker in the diagnosis or in treatment of patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196891 14597108 262785 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 furthermore it would be worthwhile to examine the prognostic value of csf/plasma mcp 1 ratios in als patients who are followed longitudinally which should be done in further studies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196892 14597108 262787 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 correlation between age at the time of lumbar puncture and intrathecal mcp 1 levels in als patients a and control patients b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188368 14661102 251387 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 tion in certain neurodegenerative disorders parkinson s disease alzheimer s disease amyotrophic lateral sclerosis stroke and inflammatory and autoimmune disorders with particular attention devoted to multiple sclerosis . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 188369 14661102 251390 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 the participation of nitrative oxidation to the direct and indirect injury of neurons and other cells of the brain i.e. oligodendrocytes for multiple sclerosis is clear; less evident is their relevance for the development and progression of these disorders. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190257 14720207 253625 17610 9605 PTGS2 cox 2 cox 2 0 1.0 we investigated the therapeutic effects of cyclooxygenase 2 cox 2 inhibitors both alone and in combination with creatine in the g93a transgenic mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190258 14720207 253627 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the administration of cox 2 inhibitors significantly reduced prostaglandin e2 levels at 110 days of age. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190259 14720207 253628 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the combination of creatine with cox 2 inhibitors produced additive neuroprotective effects and extended survival by approximately 30%. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190260 14720207 253629 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 2 inhibitors significantly protected against depletion of anterior horn motor neurons and creatine with cox 2 inhibitors showed greater protection than cox 2 inhibitors alone. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190874 14739060 254321 12355 6872 MAPK10 map kinase map kinase 0 1.0 it is now recognized that redox regulation involving ros is key to the modulation of critical cellular functions notably for neurons astrocytes and microglia such as mitogene activated protein map kinase cascade activation ion transport calcium mobilization and apoptosis program activation. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 190875 14739060 254345 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 neuronal increases in calcium can activate a series of enzymes including protein kinase c proteases phosphatases phospholipases nnos and xanthine oxidase [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190876 14739060 254345 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 neuronal increases in calcium can activate a series of enzymes including protein kinase c proteases phosphatases phospholipases nnos and xanthine oxidase [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190877 14739060 254356 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 astrocytes take up glutamate convert it to glutamine through the action of glutamine synthetase an enzyme requiring atp and then release it for uptake by neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190878 14739060 254357 8420 4331 GLS glutaminase glutaminase 0 1.0 neurons then convert glutamine back to glutamate through the action of glutaminase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190879 14739060 254358 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 this cycle can be disrupted by inhibitors of glutamine synthetase an enzyme which can be easily damaged by oxidative stress [ 31 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190880 14739060 254360 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 finally excessive response to glutamate receptor mediated stimulation occur intra cellularly [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190881 14739060 254366 1576 990 BCL2 bcl 2 bcl2 0 1.0 three main signals cause the release of apoptogenic mitochondrial mediators: _amp_#x2022; pro apoptotic members of bcl2 family _amp_#x2022; elevated levels of intra cellular calcium such as that triggered by excitotoxicity _amp_#x2022; elevated levels of ros_amp_#x2013;rns 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190882 14739060 254368 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 hen it is released from the mitochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to inhibitors of activated caspases and causes further caspase activation _amp_#x2022; apoptosis inducing factor and endonuclease g mediate caspase independent cell death pathways 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190883 14739060 254368 6634 3346 ENDOG endonuclease g endonuclease g 0 1.0 tochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to inhibitors of activated caspases and causes further caspase activation _amp_#x2022; apoptosis inducing factor and endonuclease g mediate caspase independent cell death pathways 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190884 14739060 254368 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 _amp_#x2022; cytochrome c a member of the mitochondrial electron chain required for the generation of atp when it is released from the mitochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to in 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190885 14739060 254371 5696 2773 DFFB caspase-activated dnase caspase activated dnase 0 1.0 he collapse of trans membrane electrochemical gradient the loss of matrix solutes the swelling of mitochondria causing the release of cytochrome c procapases 2 3 and 9 apoptosis initiating factor and caspase activated dnase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190886 14739060 254371 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 this results in the collapse of trans membrane electrochemical gradient the loss of matrix solutes the swelling of mitochondria causing the release of cytochrome c procapases 2 3 and 9 apoptosis initiating factor and caspase activated dnase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190887 14739060 254372 5696 2773 DFFB caspase-activated dnase caspase activated dnase 0 1.0 cytochrome c and the cytosolic factor apaf1 activate the caspases while apoptosis initiating factor and caspase activated dnase move to the nucleus initiating apoptosis or programmed cell death [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190888 14739060 254372 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c and the cytosolic factor apaf1 activate the caspases while apoptosis initiating factor and caspase activated dnase move to the nucleus initiating apoptosis or programmed cell death [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190889 14739060 254382 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 g93a transgenic mouse [ 46 50 47 48 and 49 ]. _amp_#x2022; protein misfolding and aggregates: for example of a_amp_#x3b2; 42 for ad [ 43 ]. _amp_#x2022; proteasome dysfunction on ubiquinited material ubiquitin forms covalent bonds with other protein in order to mark them for degradation by an atp dependent non lysosomial proteolytic system i.e proteasome . _amp_#x2022; oxidative stress mitochondria dysfunc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190890 14739060 254392 17381 9461 PRPH peripherin peripherin 0 1.0 another intermediate filament peripherin is found in neuronal inclusions in patients with sporadic als and in transgenic mice with sod1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190891 14739060 254396 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the involvement of mitochondria and apoptosis in neuronal death is too revealed by a prolonged period of neuronal caspase activation especially caspase 1 [ 17 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190892 14739060 254397 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 ice [ 46 and 63 ] revealed an up regulation of gene related to an inflammatory process such as tnf_amp_#x3b1; gene resulting in glial activation together with change in apoptosis related gene such as caspase 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190893 14739060 254401 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 in familial forms missense mutation have been identified for gene encoding _amp_#x3b2; amyloid precursor protein as well as presenilin 1 psen1 and presenilin 2 psen2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190894 14739060 254401 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 in familial forms missense mutation have been identified for gene encoding _amp_#x3b2; amyloid precursor protein as well as presenilin 1 psen1 and presenilin 2 psen2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190895 14739060 254402 12369 6893 MAPT tau protein tau protein 0 1.0 the sporadic forms are thought to result from a complex interaction among multiple predisposing genes such as variant apoe the gene for _amp_#x3b1; 2 macrogobulin and perhaps the gene for tau protein and other factors including environmental contributions and occurrence by chance [ 45 and 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190896 14739060 254403 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 tion of proteins: microtubular tau protein for the former accumulation of several aggregated proteins _amp_#x3b2; amyloid especially its toxic form a_amp_#x3b2; 42 apoe [ 43 ] hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0;and 2 with an inflammatory reaction around the deposit of _amp_#x3b2; amyloid for the latter [ 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190897 14739060 254403 12369 6893 MAPT tau protein tau protein 0 1.0 the neuropathological hallmarks neurofibrillary tangles and senile plaques are both aggregation of proteins: microtubular tau protein for the former accumulation of several aggregated proteins _amp_#x3b2; amyloid especially its toxic form a_amp_#x3b2; 42 apoe [ 43 ] hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0;and 2 with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190898 14739060 254413 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 parkin is one member of the family of ubiquitin ligase responsible for ubiquination a process tagging proteins for degradation through proteosomal pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190899 14739060 254413 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 1.0 parkin is one member of the family of ubiquitin ligase responsible for ubiquination a process tagging proteins for degradation through proteosomal pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190900 14739060 254425 9766 4851 HTT huntingtin huntingtin 0 1.0 the increased number in gag repeats in the mutant gene are expressed as an elongated huntingtin protein [ 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190901 14739060 254426 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 as demonstrated in transgenic mouse this abnormal protein is cleaved to fragments conjugated with ubiquitin; which aggregate forming neuronal intra nuclear inclusions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190902 14739060 254448 12580 7008 MELAS mitochondrial encephalomyopathy mitochondrial encephalomyopathy 0 0.0 the classic phenotypes of mitochondrial encephalomyopathy has been described as mitochondrial encephalomyopathy lactic acidosis and stroke like episodes syndrome melas . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190903 14739060 254448 12580 7008 MELAS mitochondrial encephalomyopathy, lactic acidosis, mitochondrial encephalomyopathy lactic acidosis an 0 1.0 the classic phenotypes of mitochondrial encephalomyopathy has been described as mitochondrial encephalomyopathy lactic acidosis and stroke like episodes syndrome melas . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190904 14739060 254456 12580 7008 MELAS mitochondrial encephalomyopathy mitochondrial encephalomyopathy 0 1.0 primary coenzyme q deficiency cause a mitochondrial encephalomyopathy that is responsive to coenzyme q administration [ 44 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190905 14739060 254456 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 primary coenzyme q deficiency cause a mitochondrial encephalomyopathy that is responsive to coenzyme q administration [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190906 14739060 254489 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 clinical trials are underway to test inhibitors of apoptosis such as minocycline [ 17 ] coenzyme q in pd [ 56 ] and many others using so called antioxidants despite disappointing results obtained [ 51 and 52 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190907 14739060 254491 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 then the antioxidant defenses: vitamins a e c selenium food rich in vegetables and fruits and perhaps by using mitochondrial cofactors such as l carnitine r _amp_#x3b1; lipoic acid [ 35 ] riboflavine coenzyme q etc. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181107 14960605 241508 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 transgenic mice expressing a mutant form of the superoxide dismutase 1 sod1 linked to familial amyotrophic lateral sclerosis were challenged intraperitoneally with a single nontoxic or repeated injections of lps 1 mg/kg . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181108 14960605 241508 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 transgenic mice expressing a mutant form of the superoxide dismutase 1 sod1 linked to familial amyotrophic lateral sclerosis were challenged intraperitoneally with a single nontoxic or repeated injections of lps 1 mg/kg . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181109 14960605 241511 22217 11848 TLR2 toll-like receptor 2 toll like receptor 2 0 1.0 closely associated with the severity of disease is the stronger and restricted upregulation of the receptor of innate immunity toll like receptor 2 and proinflammatory cytokines in degenerating regions of the ventral spinal cord and efferent fiber tracts of the brain from the lps treated sod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181110 14960605 241514 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 key words: innate immunity ; neurodegeneration ; lipopolysaccharide ; microglia ; amyotrophic lateral sclerosis ; superoxide dismutase 1 ; proinflammatory cytokines ; transgenic mice 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181111 14960605 241514 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 key words: innate immunity ; neurodegeneration ; lipopolysaccharide ; microglia ; amyotrophic lateral sclerosis ; superoxide dismutase 1 ; proinflammatory cytokines ; transgenic mice 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181112 14960605 241519 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 interestingly numerous proinflammatory genes are induced in the cns of presymptomatic mice expressing a mutant form of superoxide dismutase 1 sod1 linked to amyotrophic lateral sclerosis als the most common form of human motor neuron disease nguyen et al. 2001b ~20% cases of familial als rosen et al. 1993 ; cudkowicz et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181113 14960605 241519 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 interestingly numerous proinflammatory genes are induced in the cns of presymptomatic mice expressing a mutant form of superoxide dismutase 1 sod1 linked to amyotrophic lateral sclerosis als the most common form of human motor neuron disease nguyen et al. 2001b ~20% cases of familial als rosen et al. 1993 ; cudkowicz et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181114 14960605 241522 4039 1774 CDK5 cyclin-dependent kinase 5 cyclin dependent kinase 5 0 1.0 1997 disruption of the calcium homeostasis morrison et al. 1996 ; roy et al. 1998 cytoskeletal abnormalities wong et al. 1995 fas ligand fasl mediated death raoul et al. 2002 and deregulation of cdk5 cyclin dependent kinase 5 nguyen et al. 2001a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181115 14960605 241522 7334 11936 FASLG fas ligand fas ligand 0 1.0 posed to account for such toxicity including excitotoxicity bruijn et al. 1997 disruption of the calcium homeostasis morrison et al. 1996 ; roy et al. 1998 cytoskeletal abnormalities wong et al. 1995 fas ligand fasl mediated death raoul et al. 2002 and deregulation of cdk5 cyclin dependent kinase 5 nguyen et al. 2001a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181116 14960605 241565 22551 11892 TNF tnf alpha tnf alpha 0 1.0 rt of the spinal cord are microglial cells see fig 3 laflamme et al. 2001 kappab alpha [inhibitory protein of nuclear factor kappab nf kappab ] index of nf kappab activity tumor necrosis factor alpha tnf alpha and cd14 data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181117 14960605 241565 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 n l5 segment and cervical part of the spinal cord are microglial cells see fig 3 laflamme et al. 2001 kappab alpha [inhibitory protein of nuclear factor kappab nf kappab ] index of nf kappab activity tumor necrosis factor alpha tnf alpha and cd14 data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181118 14960605 241565 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 n l5 segment and cervical part of the spinal cord are microglial cells see fig 3 laflamme et al. 2001 kappab alpha [inhibitory protein of nuclear factor kappab nf kappab ] index of nf kappab activity tumor necrosis factor alpha tnf alpha and cd14 data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181119 14960605 241585 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the proapoptotic cytokine tnf alpha is likely to play a determinant role in this model. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181120 14960605 241586 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the endotoxin lps is able to trigger transcriptional activation of the gene encoding tnf alpha in microglial cells across the cns and tnf alpha gene expression progressively increased in the spinal cord of sod1 mice nadeau and rivest 2000 alpha levels are also found in the csf of als patients poloni et al. 2000 kappab pathway which is critic 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181121 14960605 241620 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the bright field b.f. and dark field photomicrographs depict representative examples of the hybridization signal for tnf alpha b il 12 c and tlr2 d mrna in the reticular formation just above the olivary complex. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181122 14960605 241642 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the bright field b.f. and dark field photomicrographs depict representative examples of the hybridization signal for tnf alpha il 12 and tlr2 mrna in the l5 segment of the spinal cord a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181123 14960605 241671 23395 18809 TUBA1B alpha tubulin alpha tubulin 0 1.0 actin and alpha tubulin were used as controls for loadings. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181124 14960605 241692 23395 18809 TUBA1B alpha tubulin alpha tubulin 0 1.0 membranes were incubated with antibodies against sod1 biodesign; santa cruz biotechnology santa cruz ca alpha tubulin b512; sigma and actin mab 1501; chemicon temecula ca . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181125 14960605 241714 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we next assessed the transcriptional activation of the receptor of innate immunity tlr2 and the proapoptotic cytokine tnf alpha in the sod1 mice challenged chronically with lps. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181126 14960605 241720 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the robust expression of tlr2 mrna fig 3 d g is associated with strong hybridization signals for the genes encoding the proapoptotic cytokines tnf alpha andinterleukin 12 il 12 in degenerating efferent fiber tracts of the brain fig 3 b c and in degenerating ventral spinal horns fig 4 a rows 2 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181127 14960605 241727 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 to determine whether upregulated innate immunity transfers to the adaptive form we performed in situ hybridization on spinal cord and brain tissues using highly sensitive probes for interferon gamma ifn gamma and il 12 two cytokines essential for the transfer from the innate to the acquired immunity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 181128 14960605 241748 22551 11892 TNF tnf alpha tnf alpha 0 1.0 isera dr. a. israel institut pasteur paris france for the mouse i kappab alpha cdna dr. d. radzioch mcgill university montr_amp_eacute;al qu_amp_eacute;bec canada for the plasmid containing the mouse tnf alpha cdna dr. i. campbell the scripps research institute la jolla ca for the mouse ifn gamma cdna dr. k. pahan university of nebraska lincoln ne for the mouse il 12p40 cdna and dr. li huei tsai for hostin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176595 15081582 235185 17610 9605 PTGS2 cox 2 cox 2 0 1.0 there are two distinct cox isoenzymes known as cox 1 and cox 2 that are 65% homologous. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176596 15081582 235187 17610 9605 PTGS2 cox 2 cox 2 0 1.0 conversely cox 2 was initially characterized as an inducible enzyme that is expressed in response to inflammatory stimuli cytokines and mitogens o'banion 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176597 15081582 235188 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 is now known to be constitutively expressed in the kidney stomach and central nervous system hoffmann 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176598 15081582 235189 17610 9605 PTGS2 cox 2 cox 2 0 1.0 many cellular factors induce cox 2 expression including multiple growth factors cytokines interleukin il 1_amp_#x3b2; tumor necrosis factor tnf lipopolysaccharide lps phorbol ester and elevated intracellular calcium concentration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176599 15081582 235189 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 many cellular factors induce cox 2 expression including multiple growth factors cytokines interleukin il 1_amp_#x3b2; tumor necrosis factor tnf lipopolysaccharide lps phorbol ester and elevated intracellular calcium concentration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176600 15081582 235190 17610 9605 PTGS2 cox 2 cox 2 0 1.0 one transcription factor that influences cox 2 expression following exposure to these cellular factors is nf _amp_#x3ba;b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176601 15081582 235191 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 has an nf _amp_#x3ba;b binding site in its promoter region that is shared with other inflammatory mediators including icam 1 il 2 il 8 and complement baldwin 1996 and schmedtje et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176602 15081582 235191 10452 6001 IL2 il 2 il 2 0 1.0 cox 2 has an nf _amp_#x3ba;b binding site in its promoter region that is shared with other inflammatory mediators including icam 1 il 2 il 8 and complement baldwin 1996 and schmedtje et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176603 15081582 235191 10470 6025 IL8 il 8 il 8 0 1.0 cox 2 has an nf _amp_#x3ba;b binding site in its promoter region that is shared with other inflammatory mediators including icam 1 il 2 il 8 and complement baldwin 1996 and schmedtje et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176604 15081582 235192 10480 5962 IL10 il 10 il 10 0 1.0 specific inhibition of cox 2 upregulation can be achieved by factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 and glucocorticoids o'banion 1999 see table 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176605 15081582 235192 10490 5973 IL13 il 13 il 13 0 1.0 specific inhibition of cox 2 upregulation can be achieved by factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 and glucocorticoids o'banion 1999 see table 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176606 15081582 235192 17610 9605 PTGS2 cox 2 cox 2 0 1.0 specific inhibition of cox 2 upregulation can be achieved by factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 and glucocorticoids o'banion 1999 see table 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176607 15081582 235192 10458 6014 IL4 il 4 il 4 0 1.0 specific inhibition of cox 2 upregulation can be achieved by factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 and glucocorticoids o'banion 1999 see table 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176608 15081582 235193 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox enzymes cox 1 and cox 2 are more completely termed prostaglandin g/h synthases 1 and 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176609 15081582 235200 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the second peroxidase step of the cox 2 reaction produces the free radical superoxide which may cause damage to cells in als and other neurodegenerative diseases kaufmann et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176610 15081582 235202 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although it is unlikely that upregulation of cox 2 activity alone produces enough free radicals to account for the degree of oxidative damage associated with neurodegenerative diseases it may be one of several sources that together cause significant 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176611 15081582 235209 17610 9605 PTGS2 cox 2 cox 2 0 1.0 immunoreactivity for cox 2 is present in the dendritic spines of cortical neurons and thus may be involved in synaptic signaling kaufmann et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176612 15081582 235211 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these rats display a distinct alteration in the laminar pattern of cortical cox 2 immunoreactivity kaufmann et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176613 15081582 235212 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 immunoreactivity also is observed in the soma and throughout the dendritic extent of many neurons kaufmann et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176614 15081582 235213 17610 9605 PTGS2 cox 2 cox 2 0 1.0 constitutive cox 2 is in the spinal dorsal and ventral horns as well as in dorsal root ganglia yaksh et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176615 15081582 235214 17610 9605 PTGS2 cox 2 cox 2 0 1.0 indeed the antihyperalgesic activity of cox inhibitors is associated with regulation of constitutive cox 2 in the spinal cord svensson and yaksh 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176616 15081582 235215 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although a role for cox 2 in healthy cells is not clear under pathological conditions the induction of cox 2 in neurons has been well demonstrated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176617 15081582 235216 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 was originally localized in neurons using in situ hybridization. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176618 15081582 235217 17610 9605 PTGS2 cox 2 cox 2 0 1.0 following a single maximal electroconvulsive seizure cox 2 is rapidly induced in hippocampal and cortical neurons peaking between 1 and 2 h and falling to baseline by 24 h. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176619 15081582 235218 17610 9605 PTGS2 cox 2 cox 2 0 1.0 administration of mk 801 an antagonist of the n methyl aspartic acid nmda receptor completely inhibits the cox 2 induction implying that nmda receptor activation is involved in the upregulation of cox 2 in these neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176620 15081582 235219 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition administration of the glucocorticoid dexamethasone markedly decreases cox 2 induction but only in the neocortex yamagata et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176621 15081582 235220 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this study suggests that cox 2 upregulation in neurons is dependent upon glutamatergic activity at the synapse. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176622 15081582 235222 17610 9605 PTGS2 cox 2 cox 2 0 1.0 intraperitoneal administration of kainic acid and also its local injection into the nuclear basalis can induce seizures in a rat and subsequently upregulate cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176623 15081582 235225 17610 9605 PTGS2 cox 2 cox 2 0 1.0 1997 showed that cox 2 induction overlaps with the development of neuronal apoptosis 8 h following seizure induction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176624 15081582 235226 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore exposure of mixed cortical cells in vitro to nmda elicits a time dependent accumulation of prostaglandins that precede neuronal death and correlates with the induction of cox 2 mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176625 15081582 235227 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this nmda stimulated prostaglandin production and subsequent cell death is attenuated by a cox 2 inhibitor but not with a cox 1 selective inhibitor hewett et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176626 15081582 235228 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition genetic studies show that transgenic mice overexpressing cox 2 specifically in neurons are more susceptible to excitotoxicity kelley et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176627 15081582 235229 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in contrast cox 2 knockout mice experience reduced neuronal death compared to wild type mice when exposed to nmda or ischemia iadecola et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176628 15081582 235230 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 is induced in models of cerebral ischemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176629 15081582 235232 17610 9605 PTGS2 cox 2 cox 2 0 1.0 both regions but especially the penumbra region show a significant increase in cox 2 mrna in the ischemic area ipsilateral to the occlusion 4 and 24 h following the occlusion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176630 15081582 235233 17610 9605 PTGS2 cox 2 cox 2 0 1.0 there is a direct correlation between the extent of cox 2 mrna induction at 4 h and the severity of subsequent tissue damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176631 15081582 235234 17610 9605 PTGS2 cox 2 cox 2 0 1.0 also the glutamate antagonist agent mk 801 significantly prevents the induction of cox 2 in the penumbra region collaco moraes et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176632 15081582 235235 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these studies provide evidence of a linkage between glutamate activity subsequent cox 2 induction and finally apoptotic death in neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176633 15081582 235236 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although increased extracellular glutamate regardless of its source can induce cox 2 in neurons the full consequences of this induction in neurons are still unclear. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176634 15081582 235237 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 activity correlates with apoptosis in certain models; however from studies conducted thus far it is not clear which products of cox 2 induction are contributing to neuronal death which are helping neurons to escape death or which are unrelated to cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176635 15081582 235239 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in the nervous system cox 2 induction following cell activation or injury is not restricted to neurons since astrocytes also upregulate cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176636 15081582 235241 17610 9605 PTGS2 cox 2 cox 2 0 1.0 il 1_amp_#x3b2; causes a rapid induction of cox 2 peaking at 2 h and returning to baseline by 24 h. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176637 15081582 235243 17610 9605 PTGS2 cox 2 cox 2 0 1.0 dexamethasone can attenuate il 1_amp_#x3b2; mediated pge 2 secretion and cox 2 expression o'banion et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176638 15081582 235244 17610 9605 PTGS2 cox 2 cox 2 0 1.0 astrocytic cox 2 is also induced by lps tnf basic fibroblast growth factor bfgf and phorbol ester o'banion 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176639 15081582 235244 7522 3676 FGF2 basic fibroblast growth factor basic fibroblast growth factor 0 0.0 astrocytic cox 2 is also induced by lps tnf basic fibroblast growth factor bfgf and phorbol ester o'banion 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176640 15081582 235244 7522 3676 FGF2 basic fibroblast growth factor bfgf basic fibroblast growth factor bfgf 0 1.0 astrocytic cox 2 is also induced by lps tnf basic fibroblast growth factor bfgf and phorbol ester o'banion 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176641 15081582 235246 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although there is strong evidence for the induction of cox 2 in astrocytes in vitro there are few studies that confirm this finding in vivo. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176642 15081582 235247 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 immunoreactive astrocytes have been observed in the hippocampus at 1_amp_#x2013;11 weeks but not 3 days following kainic acid seizure induction in rats sandhya et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176643 15081582 235248 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in the cortex in alzheimer's disease in situ hybridization with a cox 2 riboprobe revealed signal in a small proportion of gfap positive astrocytes chang et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176644 15081582 235249 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition cox 2 colocalizes with gfap in infarcted human brains sairanen et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176645 15081582 235251 17610 9605 PTGS2 cox 2 cox 2 0 1.0 most in vitro studies are short term and demonstrate cox 2 induction in the order of hours after the insult. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176646 15081582 235252 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus the in vitro models may skew attempts to ascertain the significance of cox 2 activity in neurodegenerative disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176647 15081582 235253 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in the context of neurodegenerative diseases the chronic induction of cox 2 will be more pathophysiologically relevant. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176648 15081582 235264 17610 9605 PTGS2 cox 2 cox 2 0 1.0 microglia have different regulatory mechanisms than macrophages fibroblasts and synovial cells that can induce cox 2 via the cytokines tnf il 1_amp_#x3b2; and il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176649 15081582 235264 10463 6018 IL6 il 6 il 6 0 1.0 microglia have different regulatory mechanisms than macrophages fibroblasts and synovial cells that can induce cox 2 via the cytokines tnf il 1_amp_#x3b2; and il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176650 15081582 235265 17610 9605 PTGS2 cox 2 cox 2 0 1.0 none of these agents induce cox 2 or nf _amp_#x3ba;b expression in na_amp_#xef;ve microglial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176651 15081582 235266 19701 8723 SERPINA5 protein c inhibitor protein c inhibitor 0 1.0 in cultured rat brain microglia lps induces cox 2 expression that is prevented in the presence of inhibitors of nf kappab dexamethasone the antioxidant pyrrolidine dithiocarbamate and the protein c inhibitor go6976 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176652 15081582 235266 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in cultured rat brain microglia lps induces cox 2 expression that is prevented in the presence of inhibitors of nf kappab dexamethasone the antioxidant pyrrolidine dithiocarbamate and the protein c inhibitor go6976 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176653 15081582 235267 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus nf _amp_#x3ba;b is involved in lps stimulated microglial cox 2 expression bauer et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176654 15081582 235268 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although increased cox 1 in microglia is observed injury paradigms there are little data indicating the expression of cox 2 in microglia in vivo. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176655 15081582 235270 17610 9605 PTGS2 cox 2 cox 2 0 1.0 1998 showed cox 2 immunostaining of cells with a microglial like morphology in infarcted human brain but did not show colocalization with microglial markers. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176656 15081582 235279 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in a carrageenin induced pleurisy model in rats cox 2 induction peaks at 2 h with maximal pge 2 production and an increasing inflammatory response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176657 15081582 235280 17610 9605 PTGS2 cox 2 cox 2 0 1.0 at a later time cox 2 increases again but this time with increased levels of pgd 2 and pgj 2 and decreased inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176658 15081582 235281 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these temporally different inflammatory responses are modulated by the addition of a cox 2 inhibitor that causes inhibition of the early inflammatory response but increased inflammation later gilroy et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176659 15081582 235282 17610 9605 PTGS2 cox 2 cox 2 0 1.0 there also appears to be a dual role for the products of the cox 2 enzyme in the nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176660 15081582 235289 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 in addition pge 1 also derived from pge 2 reduces the incidence of apoptotic death in nerve growth factor deprived pheochromocytoma pc12 cells by preventing the activation of apoptotic signals through blocking the activation of stress activated protein kinase sapk /c jun n terminal kinase jnk kawamura et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176661 15081582 235289 10824 6204 JUN c jun c jun 0 1.0 apoptotic death in nerve growth factor deprived pheochromocytoma pc12 cells by preventing the activation of apoptotic signals through blocking the activation of stress activated protein kinase sapk /c jun n terminal kinase jnk kawamura et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176662 15081582 235295 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in these models inhibition of cox 2 can delay disease onset and progression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176663 15081582 235296 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus prostaglandin products of cox 2 appear to play a critical role in the development of motor neuron degeneration almer et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176664 15081582 235297 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in rat cortical cells high concentrations of pge 2 induce apoptosis in a dose dependent manner likely via the ep2 receptor and subsequent activation of caspase 3 takadera et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176665 15081582 235299 17610 9605 PTGS2 cox 2 cox 2 0 1.0 addition of cox 2 inhibitors prevents both pge 2 production and kainic acid induced neuronal death in these cells kim et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176666 15081582 235301 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the pge 2 stimulated glutamate release produces a feed forward cycle whereby pge 2 induced glutamate may lead to further excitatory cell activation and cox 2 induction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176667 15081582 235302 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this mechanism is highlighted in a model of cox 2 overexpression that displays acceleration of glutamate mediated neuronal apoptosis mirjany et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176668 15081582 235303 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 another prostaglandin 15 deoxy_amp_#x394; 12 14 pgj 2 a natural peroxisome proliferator activated receptor gamma ligand formed from pgd 2 induces apoptosis in both human astrocytes chattopadhyay et al. 2000 and cortical neurons rohn et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176669 15081582 235304 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 exposure to pgd 2 synthase induces apoptosis in pc12 neuronal cells via caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176670 15081582 235317 17610 9605 PTGS2 cox 2 cox 2 0 1.0 independently these cells are protected from death by the cox 2 inhibitor aphs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176671 15081582 235319 17610 9605 PTGS2 cox 2 cox 2 0 1.0 one possible reason why there are differential effects on cell survival in the presence or absence of a cox 2 inhibitor may be because cox 2 activity results in the generation of multiple prostaglandins with potentially different effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176672 15081582 235320 17610 9605 PTGS2 cox 2 cox 2 0 1.0 when cox 2 is inhibited both the pro and anti apoptotic products are lost so cellular responses are directly produced by any single prostaglandin added to culture media. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176673 15081582 235321 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however when cox 2 is not inhibited multiple prostaglandins are present that can act in a synergistic or antagonistic manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176674 15081582 235324 17610 9605 PTGS2 cox 2 cox 2 0 1.0 prostaglandins pga 1 pga 2 and pgj 2 all can suppress nf _amp_#x3ba;b activation and thus suppress cox 2 induction as well as other inflammatory mediators including inducible nitric oxide synthase and certain cytokines. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176675 15081582 235324 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 prostaglandins pga 1 pga 2 and pgj 2 all can suppress nf _amp_#x3ba;b activation and thus suppress cox 2 induction as well as other inflammatory mediators including inducible nitric oxide synthase and certain cytokines. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176676 15081582 235335 17610 9605 PTGS2 cox 2 cox 2 0 1.0 interestingly this is one area in which the significance of the differential expression of the cox 1 and cox 2 isoforms may arise. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176677 15081582 235336 17610 9605 PTGS2 cox 2 cox 2 0 1.0 since cox 1 increases in activated microglia and is not regulated by nf _amp_#x3ba;b then prostaglandins of microglial origin can regulate the activity of nf _amp_#x3ba;b and cox 2 in adjacent neurons without the same feedback regulation affecting the microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176678 15081582 235348 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in 1993 mutations in the cytosolic protein copper_amp_#x2013;zinc superoxide dismutase sod1 were reported in several fals families. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176679 15081582 235350 3544 1516 CAT catalase catalase 0 1.0 sod1 is a metalloenzyme that detoxifies the superoxide anion to form hydrogen peroxide which is then converted to water through the activity of another enzyme such as catalase mithal et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176680 15081582 235361 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 activity appears to play an important role in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176681 15081582 235362 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in many different models cox 2 upregulation occurs concurrently with als disease events. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176682 15081582 235363 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 and pge 2 are significantly elevated upwards of sevenfold in postmortem spinal cords of patients with sporadic als almer et al. 2001 and yasojima et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176683 15081582 235364 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in the spinal cords of transgenic mutant human sod1 expressing msod1 mice there is increased expression of cox 2 but not cox 1 mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176684 15081582 235365 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 mrna and protein levels cox catalytic activity and pge 2 levels are all increased in the spinal cord but not the cerebellum of msod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176685 15081582 235367 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 levels in msod1 mice are increased in both early symptomatic and end stage disease in neurons and to a lesser extent in astrocytes in the anterior horn of the spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176686 15081582 235369 17610 9605 PTGS2 cox 2 cox 2 0 1.0 selective inhibition of cox 2 with sc236 protects motor neurons in an organotypic cell culture model of als drachman and rothstein 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176687 15081582 235373 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this delayed onset is recapitulated when the selective cox 2 inhibitor nimesulide is administered prophylactically in these mice pompl et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176688 15081582 235375 17610 9605 PTGS2 cox 2 cox 2 0 1.0 treatment with celecoxib a different selective cox 2 inhibitor also prolongs survival in the msod1 mouse model of als drachman et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176689 15081582 235377 17610 9605 PTGS2 cox 2 cox 2 0 1.0 it seems that neuroinflammation proceeds albeit more slowly in cox 2 inhibitor treated animals possibly through the slower microglial cox 1 upregulation and likely through multiple additional regulatory mechanisms. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176690 15081582 235378 17610 9605 PTGS2 cox 2 cox 2 0 1.0 experiments that demonstrate protective abilities of cox 2 inhibition imply that cox 2 activation contributes to neuronal vulnerability and apoptosis by an undefined mechanism or mechanisms. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176691 15081582 235382 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition some of the prostaglandin products of the cox 2 enzyme cause direct damage to neurons as well as act in both an autocrine and paracrine manner to propagate inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176692 15081582 235384 17610 9605 PTGS2 cox 2 cox 2 0 1.0 it is clear that neuroinflammation particularly cox 2 upregulation and prostaglandin production plays a significant role in neurodegenerative disorders such as als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176693 15081582 235386 17610 9605 PTGS2 cox 2 cox 2 0 1.0 it seems likely that cox 2 inhibitors can delay the progression of symptoms and clinical studies addressing this issue are both warranted and currently underway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176694 15081582 235387 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although treatment of neurodegenerative diseases such as als with cox 2 inhibitors is likely to produce some symptomatic benefit it is very unlikely that these drugs will revolutionize the treatment of neurodegenerative disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176695 15081582 235388 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in fact it is reported that high doses of certain nsaids can activate nf _amp_#x3ba;b leading to a paradoxical activation of the cox 2 enzyme that is clearly a problem for this therapeutic approach niederberger et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176696 15081582 235389 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this finding is not surprising given that it is the level of prostaglandins that feedback on nf _amp_#x3ba;b to regulate transcription of cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176697 15081582 235390 17610 9605 PTGS2 cox 2 cox 2 0 1.0 certain downstream products of the cox 2 enzyme are pro apoptotic while others are neuroprotective. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176698 15081582 235391 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inhibiting cox 2 will block both the neurodegenerative and neuroprotective products of this enzyme. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176699 15081582 235392 17610 9605 PTGS2 cox 2 cox 2 0 1.0 it may be more appropriate in the development of future therapies rather than broadly targeting cox 2 or even further upstream at the level of nf _amp_#x3ba;b to target specific prostaglandin synthases downstream of cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 176700 15081582 235392 17610 9605 PTGS2 cox 2 cox 2 0 1.0 or even further upstream at the level of nf _amp_#x3ba;b to target specific prostaglandin synthases downstream of cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170005 15210305 227146 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the first als locus als1 to be identified on chromosome 21 contains the cytosolic copper_amp_#x2013;zinc superoxide dismutase sod1 gene which has been found to harbour at least 100 different genetic mutations which account for up to 20% of fals cases [ 18 90 and 98 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170006 15210305 227155 14064 7634 NAIP neuronal apoptosis inhibitory protein neuronal apoptosis inhibitory protein 0 1.0 clusive data have emerged from the analysis of potential risk factors in als such as the neurofilament heavy subunit [ 25 ] the apolipoprotein e allele 4 [ 71 ] the gene survival motor neuron smn and neuronal apoptosis inhibitory protein naip [ 79 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170007 15210305 227155 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 no conclusive data have emerged from the analysis of potential risk factors in als such as the neurofilament heavy subunit [ 25 ] the apolipoprotein e allele 4 [ 71 ] the gene survival motor neuron smn and neuronal apoptosis inhibitory protein naip [ 79 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170008 15210305 227155 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 no conclusive data have emerged from the analysis of potential risk factors in als such as the neurofilament heavy subunit [ 25 ] the apolipoprotein e allele 4 [ 71 ] the gene survival motor neuron smn and neuronal apoptosis inhibitory protein naip [ 79 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170009 15210305 227156 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 recently ciliary neurotrophic factor cntf has been proposed as a modifier gene since the rare null mutations cause an earlier age of onset of disease in fals cases carrying a sod1 mutation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170010 15210305 227156 4649 2169 CNTF ciliary neurotrophic factor ciliary neurotrophic factor 0 1.0 recently ciliary neurotrophic factor cntf has been proposed as a modifier gene since the rare null mutations cause an earlier age of onset of disease in fals cases carrying a sod1 mutation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170011 15210305 227223 20017 10940 SLC1A2 excitatory amino acid transporter 2 excitatory amino acid transporter 2 0 1.0 for this reason the expression of glutamate receptors and of the excitatory amino acid transporter 2 eaat2 which is involved in the removal of glutamate from the synapse in spinal cord have been extensively investigated [ 92 and 107 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170012 15210305 227223 20339 13448 SLC38A2 amino acid transporter 2 amino acid transporter 2 0 0.0 for this reason the expression of glutamate receptors and of the excitatory amino acid transporter 2 eaat2 which is involved in the removal of glutamate from the synapse in spinal cord have been extensively investigated [ 92 and 107 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170013 15210305 227225 11934 6664 LOX lysyl oxidase lysyl oxidase 0 1.0 these _amp_#x201c;inducible_amp_#x201d; elements by virtue of their responsiveness to a wide range of cell _amp_#x201c;injury_amp_#x201d; events include thioredoxin lysyl oxidase lo flavin containing monooxygenase fmo1 interleukin i receptor accessory protein il 1racp and a transcript representing a possible 14 3 3 spinal cord isoform [ 59 and 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170014 15210305 227225 10446 5995 IL1RAP il 1racp il 1racp 0 1.0 f their responsiveness to a wide range of cell _amp_#x201c;injury_amp_#x201d; events include thioredoxin lysyl oxidase lo flavin containing monooxygenase fmo1 interleukin i receptor accessory protein il 1racp and a transcript representing a possible 14 3 3 spinal cord isoform [ 59 and 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170015 15210305 227225 23454 12435 TXN thioredoxin thioredoxin 0 1.0 these _amp_#x201c;inducible_amp_#x201d; elements by virtue of their responsiveness to a wide range of cell _amp_#x201c;injury_amp_#x201d; events include thioredoxin lysyl oxidase lo flavin containing monooxygenase fmo1 interleukin i receptor accessory protein il 1racp and a transcript representing a possible 14 3 3 spinal cord isoform [ 59 and 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170016 15210305 227226 23454 12435 TXN thioredoxin thioredoxin 0 1.0 thioredoxin lo and fmo exert a powerful antioxidant function counteracting the copper catalysed oxidation of proteins in als tissue. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170017 15210305 227227 23454 12435 TXN thioredoxin thioredoxin 0 1.0 thioredoxin has been previously reported to be remarkably over expressed in adult rat motor neurones following hypoglossal nerve axotomy [ 61 ] and to be strongly induced in erythrocytes from patients with famil 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170018 15210305 227258 6450 3238 EGR1 zif 268 zif 268 0 1.0 c jun and zif 268 two immediate early genes factors widely considered as markers of neuronal response to injury and apoptotic cell death have been found to be markedly increased in dorsal and ventral horns of autopsie 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170019 15210305 227258 10824 6204 JUN c jun c jun 0 1.0 c jun and zif 268 two immediate early genes factors widely considered as markers of neuronal response to injury and apoptotic cell death have been found to be markedly increased in dorsal and ventral horns 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170020 15210305 227259 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 immunohistochemical expression of a number of gene candidates including c jun jnk/sapk a kinase that exerts a stress related activation of c jun and nf kappa b a transcription factor induced by oxidative injury with a prominent neuroprotective function have been assayed in different disease targeted tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170021 15210305 227259 10824 6204 JUN c jun c jun 0 1.0 immunohistochemical expression of a number of gene candidates including c jun jnk/sapk a kinase that exerts a stress related activation of c jun and nf kappa b a transcription factor induced by oxidative injury with a prominent neuroprotective function have been assayed in different disease targeted tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170022 15210305 227260 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 the jnk/sapk c jun pathway was found to be markedly up regulated [ 67 ] in als spinal cord astrocytes together with nf kappa b whereas motor neurones show a lower expression of these molecules. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170023 15210305 227260 10824 6204 JUN c jun c jun 0 1.0 the jnk/sapk c jun pathway was found to be markedly up regulated [ 67 ] in als spinal cord astrocytes together with nf kappa b whereas motor neurones show a lower expression of these molecules. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170024 15210305 227266 5063 2482 CSTB cystatin b cystatin b 0 1.0 another up regulated gene candidate was found to have a high homology with stefin b [stfb also called cystatin b cstb ] which is a member of the superfamily of non caspase cysteine protease inhibitors known to have an anti apoptotic function [ 45 and 85 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170025 15210305 227266 3532 1509 CASP8 cysteine protease cysteine protease 0 1.0 another up regulated gene candidate was found to have a high homology with stefin b [stfb also called cystatin b cstb ] which is a member of the superfamily of non caspase cysteine protease inhibitors known to have an anti apoptotic function [ 45 and 85 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170026 15210305 227266 5063 2482 CSTB stefin b stefin b 0 1.0 another up regulated gene candidate was found to have a high homology with stefin b [stfb also called cystatin b cstb ] which is a member of the superfamily of non caspase cysteine protease inhibitors known to have an anti apoptotic function [ 45 and 85 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170027 15210305 227267 5063 2482 CSTB cystatin b cystatin b 0 1.0 the majority of cases of progressive myoclonus epilepsy of the unverricht_amp_#x2013;lundborg type epm1 are caused by mutations mostly an expansion of a 12 bp polymorphic tandem repeat of the cystatin b gene [ 86 and 87 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170028 15210305 227268 4437 2004 CLA3 cerebellar ataxia cerebellar ataxia 0 1.0 epm1 is an autosomal recessive disorder characterized by seizures myoclonus and progression to cerebellar ataxia. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 170029 15210305 227269 5063 2482 CSTB cystatin b cystatin b 0 1.0 these mutations are responsible for the cystatin b mrna down regulation in various tissues from patients with epm1 [ 49 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170030 15210305 227270 5063 2482 CSTB cystatin b cystatin b 0 1.0 mice lacking cystatin b develop symptoms seen in the human disease with loss of cerebellar granule cells and other cellular changes characteristic of apoptosis [ 87 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170031 15210305 227279 4650 2170 CNTFR cntfr alpha cntfr alpha 0 1.0 however genotyping of the cntf receptor alpha cntfr alpha has failed to show any significant association between allelic variants of this gene and familial als fals [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170032 15210305 227280 4650 2170 CNTFR cntfr alpha cntfr alpha 0 1.0 a marked increase in cntfr alpha mrna expression was found in als spinal cord whereas the same transcript showed little or no expression in als motor cortex with no differences seen between als and control tissues [ 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170033 15210305 227283 8117 4140 GAP43 growth associated protein 43 growth associated protein 43 0 1.0 the same pattern of up regulation in motor neurones from als spinal cord applies to growth associated protein 43 gap43 a phosphoprotein which is expressed during neurite elongation [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170034 15210305 227286 951 644 AR androgen receptor androgen receptor 0 1.0 the presence of a known mutation in the androgen receptor creates a state of partial androgen insensitivity which is an important hallmark of the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170035 15210305 227287 8830 4601 GRN granulin granulin 0 1.0 granulin was found to be over expressed in spinal cord tissues from als individuals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170036 15210305 227288 8830 4601 GRN granulin granulin 0 1.0 previous studies on epithelin/granulin expression have identified a significant androgen related over expression in specific brain regions e.g hypothalamus of neonatal male rats as well as an oestradiol responsiveness in human breast canc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170037 15210305 227290 9601 14922 HRASLS h rev107 h rev107 0 1.0 another hormone sensitive transcript with high homology to rat h rev107 like protein was found to be significantly up regulated in als spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170038 15210305 227292 18105 9919 RBP1 retinol-binding protein 1 retinol binding protein1 0 1.0 cellular retinol binding protein1 crbp1 showed a marked up regulation in als spinal cord [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170039 15210305 227302 4918 2348 CREBBP creb binding protein creb binding protein 0 1.0 the hypothesis of an involvement of these molecular pathways in the pathogenesis of als may find some support in the study by yoshihara et al. [ 115 ] which shows a significant up regulation of a creb binding protein in the g93a transgenic tg animal model. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170040 15210305 227304 8830 4601 GRN granulin granulin 0 1.0 in addition the over expression of hormone sensitive transcripts in als spinal cord such as granulin may be related to the presence of an abnormal sensitivity of particular regions of the spinal cord to the action of circulating hormones. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170041 15210305 227314 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 in alzheimer's disease ad for example amyloid beta a beta deposition activates astrocytes and oligodendrocytes to produce chemokines mcp 1 and rantes which act as potent in vitro microglial and macrophage chemoattractants [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170042 15210305 227318 4039 1774 CDK5 cyclin-dependent kinase 5 cyclin dependent kinase 5 0 1.0 c1qb clusterin apoj and the t cell receptor tcr transcript have been found to be markedly up regulated in areas of als spinal cord undergoing degeneration [ 30 and 80 ] whereas a study of cyclin dependent kinase 5 cdk 5 regional expression identified a significant up regulation in als affected motor neurones [ 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170043 15210305 227318 4560 2095 CLU clusterin clusterin 0 1.0 c1qb clusterin apoj and the t cell receptor tcr transcript have been found to be markedly up regulated in areas of als spinal cord undergoing degeneration [ 30 and 80 ] whereas a study of cyclin dependent kinase 5 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170044 15210305 227319 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 and cd11b a specific marker of microglia activation have been reported to be up regulated in als spinal cord tissue [ 113 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170045 15210305 227320 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the significant up regulation of cox 2 in als spinal cord compared to control tissues including patients affected by parkinson's disease pd ad cerebrovascular accidents and other non neurological disorders adds further evidence to the obs 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170046 15210305 227321 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 mrna up regulation was restricted to pathologically affected tissue and this was accompanied by increased cox 2 protein levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170047 15210305 227323 10437 5992 IL1B il 1 il 1 0 1.0 ceptor accessory protein il 1racp mrna markedly over expressed in als spinal cord is a trans membrane protein belonging to a receptor complex which binds to the pro inflammatory protein interleukin 1 il 1 [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170048 15210305 227323 10446 5995 IL1RAP il 1racp il 1racp 0 1.0 interleukin i receptor accessory protein il 1racp mrna markedly over expressed in als spinal cord is a trans membrane protein belonging to a receptor complex which binds to the pro inflammatory protein interleukin 1 il 1 [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170049 15210305 227323 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 terleukin i receptor accessory protein il 1racp mrna markedly over expressed in als spinal cord is a trans membrane protein belonging to a receptor complex which binds to the pro inflammatory protein interleukin 1 il 1 [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170050 15210305 227324 10446 5995 IL1RAP il 1racp il 1racp 0 1.0 il 1racp has also been found to be up regulated in spinal cord from sod1 g93a transgenic mice [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170051 15210305 227326 10456 6011 IL3 interleukin 3 interleukin 3 0 1.0 chavany et al. [ 11 ] reported that transgenic mice over expressing interleukin 3 develop a selective motor neurone degeneration with an auto immune reaction causing dendritic/axonal and somatic degeneration closely resembling als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170052 15210305 227333 4278 1907 CH25H cholesterol 25-hydroxylase cholesterol 25 hydroxylase 0 1.0 a consistent up regulation of cholesterol 25 hydroxylase has been identified in post mortem als spinal cord [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170053 15210305 227339 5417 2641 CYP46A1 cholesterol 24-hydroxylase cholesterol 24 hydroxylase 0 1.0 a pivotal role for altered sphingolipid metabolism in neurodegeneration is also suggested by a recent study on cholesterol 24 hydroxylase encoded by the cyp46 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170054 15210305 227341 12369 6893 MAPT tau protein tau protein 0 1.0 a cyp46 polymorphism is associated with an increased beta amyloid load in brain tissues increased cerebrospinal fluid levels of beta amyloid peptides/phosphorylated tau protein and to a higher risk of late onset sporadic ad [ 81 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170055 15210305 227344 78 61 ABCD1 adrenoleukodystrophy adrenoleukodystrophy 0 1.0 a form of x linked adrenoleukodystrophy x ald which involves the spinal cord adrenomyeloneuropathy amn is another neurodegenerative disease characterized by elevated levels of saturated long chain fatty acids lcfa [ 64 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 170056 15210305 227373 1576 990 BCL2 bcl 2 bcl 2 0 1.0 towards the end stage of the disease bcl 2 and bcl xl proteins acting as apoptosis inhibitors show reduced expression whereas bad and bax which promote apoptosis appear to be up regulated in spinal cord of the animal model of als [ 109 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170057 15210305 227373 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 towards the end stage of the disease bcl 2 and bcl xl proteins acting as apoptosis inhibitors show reduced expression whereas bad and bax which promote apoptosis appear to be up regulated in spinal cord of the animal model of als [ 109 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170058 15210305 227379 23454 12435 TXN thioredoxin thioredoxin 0 1.0 thioredoxin known to promote cell survival by suppressing caspase dependent apoptosis was found to be differentially regulated in a post mortem expression study of spinal cord from als cases in adult rat motor n 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170059 15210305 227381 9601 14922 HRASLS h rev107 h rev107 0 1.0 other differentially expressed candidates in the post mortem study such as the human homologue of h rev107 like protein are known to have an intrinsic anti proliferative activity [ 41 ] or as in the case of the tal 1 proto oncogene to increase cell proliferation via an anti apoptotic effect. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170060 15210305 227381 21719 11556 TAL1 tal 1 tal 1 0 1.0 rentially expressed candidates in the post mortem study such as the human homologue of h rev107 like protein are known to have an intrinsic anti proliferative activity [ 41 ] or as in the case of the tal 1 proto oncogene to increase cell proliferation via an anti apoptotic effect. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170061 15210305 227382 5063 2482 CSTB cystatin b cystatin b 0 1.0 up regulation of cystatin b and 14 3 3 proteins in als spinal cord may also be seen as an anti apoptotic mechanism promoting cell survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170062 15210305 227386 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e apoe and to a lesser extent apo d gene expression are induced up to fivefold at 120 days of age. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170063 15210305 227386 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e apoe and to a lesser extent apo d gene expression are induced up to fivefold at 120 days of age. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170064 15210305 227388 9196 4879 HEXB hexosaminidase b hexosaminidase b 0 1.0 these include hexosaminidase b and brain fatty acid binding protein b fabp the latter acting as a molecular scavenger binding to oxidized fatty acids produced by lipid peroxidation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170065 15210305 227388 6918 3562 FABP7 b fabp b fabp 0 1.0 these include hexosaminidase b and brain fatty acid binding protein b fabp the latter acting as a molecular scavenger binding to oxidized fatty acids produced by lipid peroxidation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170066 15210305 227390 4278 1907 CH25H cholesterol 25-hydroxylase cholesterol 25 hydroxylase 0 1.0 this seems to be in line with the end stage finding of increased expression of cholesterol 25 hydroxylase detected in the post mortem studies [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170067 15210305 227409 22533 11881 TMSB4X thymosin beta-4 thymosin beta 4 0 1.0 among inflammatory candidates fig 4a transcripts for thymosin beta 4 a microglial marker are up regulated at 30 days whereas their expression declines at a later stage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170068 15210305 227410 22533 11881 TMSB4X prothymosin beta-4 prothymosin beta 4 0 1.0 prothymosin beta 4 mrna undergoes a significant up regulation after 80 days of life. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170069 15210305 227438 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 the amyloid precursor protein/presenilin 1 app+ps1 transgenic mouse is a model for amyloid deposition and as in ad the mice develop memory deficits and amyloid deposits accumulate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170070 15210305 227442 17345 9449 PRNP prion protein prion protein 0 0.0 inflammatory rna profile of microglia has been recently described which contrasts with that of uninfected microglia exposed to inflammatory stimuli such as lipopolysaccharide and ifn gamma as well as prion protein prp amyloid [ 5 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170071 15210305 227442 17345 9449 PRNP prion protein prp prion protein prp 0 1.0 inflammatory rna profile of microglia has been recently described which contrasts with that of uninfected microglia exposed to inflammatory stimuli such as lipopolysaccharide and ifn gamma as well as prion protein prp amyloid [ 5 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170072 15210305 227444 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 up regulation of a subset of mrnas involved in inflammatory/immune functions have been described in monocyte depleted peripheral blood mononuclear cells from patients affected by relapsing remitting multiple sclerosis compared to age and sex matched controls [ 88 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 170073 15210305 227459 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 in these studies apoptotic or necrotic cell death was assessed through morphological criteria and gene expression analysis of specific apoptosis related gene candidates such as bcl xl and the calcineurin mediated bad dephosphorylation which is known to activate the caspase 3 apoptotic cascade [ 103 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170074 15210305 227459 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 ough morphological criteria and gene expression analysis of specific apoptosis related gene candidates such as bcl xl and the calcineurin mediated bad dephosphorylation which is known to activate the caspase 3 apoptotic cascade [ 103 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170075 15210305 227466 5063 2482 CSTB cystatin b cystatin b 0 1.0 cystatin b was also found to be close to the sod1 gene on chromosome 21. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 170076 15210305 227470 5063 2482 CSTB cystatin b cystatin b 0 1.0 an tissue show the activation of unique neuroprotective mechanisms which are not identified in the studies of animal models exemplified by the up regulation of transcripts like 14 3 3 protein fmo and cystatin b. further insight in these changes which may be particularly relevant for the human form of the disease may open the way to a full understanding of the intrinsic molecular dysfunction leading to motor 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175691 15341181 234528 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 evidence is now available to support this scenario for neurological disorders such as alzheimer's disease amyotrophic lateral sclerosis parkinson's disease multiple sclerosis and huntington's disease but also in the brain damage following ischemia and reperfusion down's syndrome and mitochondrial encephalopathies. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 175692 15341181 234529 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 uries brain cells have evolved integrated responses the so called longevity assurance processes composed of several genes termed vitagenes and including among others members of the hsp system such as hsp70 and hsp32 to detect and control diverse forms of stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175693 15341181 234530 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in particular hsp32 also known as heme oxygenase 1 ho 1 has received considerable attention as it has been recently demonstrated that ho 1 induction by generating the vasoactive molecule carbon monoxide and the potent antioxidant bilirubin could represent a protective system potentially active against brain oxidative injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175694 15341181 234530 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 in particular hsp32 also known as heme oxygenase 1 ho 1 has received considerable attention as it has been recently demonstrated that ho 1 induction by generating the vasoactive molecule carbon monoxide and the potent antioxidant bilirubin could repr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175695 15341181 234531 9462 5013 HMOX1 ho 1 ho 1 0 1.0 increasing evidence suggests that the ho 1 gene is redox regulated and its expression appears closely related to conditions of oxidative and nitrosative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164715 15453089 221233 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 is the inducible isoform rapidly expressed in several cell types in response to growth factors cytokines and pro inflammatory molecules. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164716 15453089 221234 17610 9605 PTGS2 cox 2 cox 2 0 1.0 since its discovery in the early 1990s cox 2 has emerged as a major player in inflammatory reactions in peripheral tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164717 15453089 221235 17610 9605 PTGS2 cox 2 cox 2 0 1.0 by extension cox 2 expression in brain has been associated with pro inflammatory activities thought to be instrumental in neurodegenerative processes of several acute and chronic diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164718 15453089 221237 17610 9605 PTGS2 cox 2 cox 2 0 1.0 first in the central nervous system cox 2 is expressed under normal conditions and contributes to fundamental brain functions such as synaptic activity memory consolidation and functional hyperemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164719 15453089 221239 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in spite of the intense research of the last decade the evidence of a direct role of cox 2 in neurodegenerative events is still controversial. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164720 15453089 221240 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 this article will review new data in this area focusing on some major human neurological diseases such as multiple sclerosis amyotrophic lateral sclerosis parkinson disease creutzfeldt jakob disease and alzheimer disease. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 164721 15453089 221241 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore the emerging role of cox 2 in behavioral and cognitive functions will be discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164722 15453089 221252 17610 9605 PTGS2 cox 2 cox 2 0 1.0 besides a constitutive isoform cox 1 which is widely distributed in virtually all cell types and is thought to mediate physiological responses a second and inducible isoform termed cox 2 was identified in the early 1990s 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164723 15453089 221253 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 is rapidly expressed in several cell types in response to growth factors cytokines and pro inflammatory molecules and has emerged as the isoform primarily responsible for prostanoid production in acu 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164724 15453089 221254 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 and cox 2 are coded by 2 distinct genes located on human chromosome 9 and 1 respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164725 15453089 221255 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 2 gene is characterized by the presence of a tata box and a multitude of binding sites for transcription factors in its promoter region which account for the complex regulation of cox 2 expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164726 15453089 221256 17610 9605 PTGS2 cox 2 cox 2 0 1.0 n a long 3' untranslated region which has been found in many immediate early genes acts as mrna instability determinant or as translation inhibitory element suggesting post transcriptional control of cox 2 expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164727 15453089 221259 17610 9605 PTGS2 cox 2 cox 2 0 1.0 ites are conserved a few crucial substitutions cause important conformational variations in the active site pocket of the 2 isoenzymes which could account for the different sensitivities of cox 1 and cox 2 to specific inhibitors 5 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164728 15453089 221260 17610 9605 PTGS2 cox 2 cox 2 0 1.0 one important difference between the 2 isoforms is the 18 amino acid insert near the cox 2 c terminus which is not present in cox 1 and has allowed the production of specific antibodies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164729 15453089 221263 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however in brain testes and kidney macula densa cells both cox 1 and cox 2 are expressed under physiological conditions 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164730 15453089 221264 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in rat brain cox 1 and cox 2 immunoreactivities are present in discrete neuronal populations distributed in distinct areas of cerebral cortex and hippocampus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164731 15453089 221266 17610 9605 PTGS2 cox 2 cox 2 0 1.0 similarly mrnas for both cox 1 and cox 2 are present in several regions of human brain although cox 2 is the prominent isoform particularly in the hippocampus 8 9 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164732 15453089 221267 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the relative contribution of cox 1 and cox 2 activity to brain pathology and physiology has been recently questioned 10 11 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164733 15453089 221268 17610 9605 PTGS2 cox 2 cox 2 0 1.0 on one side it has been argued that cox 1 activity in brain diseases has been overlooked; on the other side mandatory evidence suggests that cox 2 plays a special role in normal neuronal function and in neurotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164734 15453089 221269 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although this debate will be solved only by further clinical and experimental studies it is clear that the popular paradigm by which cox 1 serves physiological functions and cox 2 is responsible for _amp_#147;pathological_amp_#148; pgs cannot explain an increasing number of findings. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164735 15453089 221279 17610 9605 PTGS2 cox 2 cox 2 0 1.0 over expression of cox 2 has been associated with neurotoxicity in acute conditions such as hypoxia/ ischemia and seizures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164736 15453089 221280 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however the beneficial or detrimental role played by cox 2 in inflammatory and neurodegenerative brain pathologies is still controversial. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164737 15453089 221281 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 the present article will review new data in this area focusing on some major human neurological diseases such as multiple sclerosis ms amyotrophic lateral sclerosis als parkinson disease pd creutzfeldt jakob disease cjd and alzheimer disease ad . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 164738 15453089 221282 17610 9605 PTGS2 cox 2 cox 2 0 1.0 first the emerging role of cox 2 in cognitive functions will be discussed since understanding the role of cox 2 in brain function is an important prerequisite to fully understanding how to exploit the potential benefits of cox 2 inhibition in disabling neurological diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164739 15453089 221282 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in brain function is an important prerequisite to fully understanding how to exploit the potential benefits of cox 2 inhibition in disabling neurological diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164740 15453089 221283 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in mammalian brain cox 2 is constitutively expressed in specific neuronal populations under normal physiological conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164741 15453089 221284 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in rat brain cox 2 mrna and immunoreactivity were detected in dentate gyrus granule cells pyramidal cell neurons in the hippocampus the piriform cortex superficial cell layers of neocortex the amygdala and at low level 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164742 15453089 221285 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this _amp_#147;constitutive_amp_#148; neuronal cox 2 expression should be more correctly regarded as _amp_#147;dynamically_amp_#148; regulated since it is dependent on normal synaptic activity is rapidly increased during seizures or ischemia and is dow 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164743 15453089 221286 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the dependence of cox 2 expression on natural excitatory synaptic activity is supported by the presence of cox 2 immunoreactivity in distal dendrites and dendritic spines which are involved in synaptic signaling and by its exclusive localization to excitatory glutamatergic neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164744 15453089 221287 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore the heterogeneous distribution within a neuronal population is compatible with induction of cox 2 in subsets of neurons in response to natural excitatory synaptic stimulation as shown for other immediate early genes activated by excitatory stimulation 14 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164745 15453089 221288 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the involvement of cox 2 in synaptic activity is further supported by the developmental profile of cox 2 expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164746 15453089 221289 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in rat brain cox 2 expression follows developmental gradients and coincides with the critical period of activity dependent cortical development 17 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164747 15453089 221290 17610 9605 PTGS2 cox 2 cox 2 0 1.0 yndrome_amp_#151;a neurological disorder associated with mental retardation defective development of cortical neurons and abnormalities of dendritic branching_amp_#151;the laminar pattern of cortical cox 2 immunoreactivity is disrupted in that cox 2 positive neurons are decreased in number and randomly distributed 18 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164748 15453089 221290 17610 9605 PTGS2 cox 2 cox 2 0 1.0 immunoreactivity is disrupted in that cox 2 positive neurons are decreased in number and randomly distributed 18 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164749 15453089 221291 17610 9605 PTGS2 cox 2 cox 2 0 1.0 rats subjected to selective destruction of basal forebrain cholinergic neurons during the first post natal week showed decreased levels of cox 2 but not cox 1 in the hippocampus at adulthood. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164750 15453089 221292 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this effect was accompanied by impairment in social memory suggesting that the early loss of hippocampal cholinergic input may impact on the expression of cox 2 in hippocampal neurons and on the functional role of pgs in synaptic activity 19 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164751 15453089 221293 17610 9605 PTGS2 cox 2 cox 2 0 1.0 indirect evidence of cox 2 involvement in synaptic plasticity has been obtained in the recent years by using cox inhibitors in in vivo and in vitro models of synaptic plasticity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164752 15453089 221294 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 inhibitors but not cox 1 selective inhibitors administered systemically shortly after training in the morris water maze a hippocampal dependent learning task have been shown to impair spatial memory 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164753 15453089 221296 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition pre training infusion of a cox 2 specific inhibitor celecoxib in the hippocampus of adult rats impaired acquisition of the morris water maze suggesting that in rats cox 2 activity in the hippocampus is necessary for both memory and learning of a spatial task 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164754 15453089 221301 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in agreement with this hypothesis pge 2 but not pgd 2 reversed the suppression of ltp induced by cox 2 inhibitor in hippocampal dentate granule neurons in vitro 24 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164755 15453089 221302 17610 9605 PTGS2 cox 2 cox 2 0 1.0 pge 2 which is preferentially formed during the enzymatic activity of cox 2 rather than of cox 1 could participate to synaptic plasticity through several mechanisms including modulation of adrenergic noradrenergic and glutamatergic neurotransmission remodeling of actin in th 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164756 15453089 221303 17610 9605 PTGS2 cox 2 cox 2 0 1.0 moreover cox 2 derived pgs are involved in the coupling of synaptic plasticity with cerebral blood flow as suggested by the attenuation of the increase in neocortical blood flow in response to vibrissal stimulation 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164757 15453089 221303 17610 9605 PTGS2 cox 2 cox 2 0 1.0 pgs are involved in the coupling of synaptic plasticity with cerebral blood flow as suggested by the attenuation of the increase in neocortical blood flow in response to vibrissal stimulation by the cox 2 inhibitor ns398. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164758 15453089 221304 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the hyperemic response was also impaired in mutant mice lacking of cox 2 26 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164759 15453089 221305 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in spite of the emerging evidence of a physiological role for cox 2 in brain development and function cox 2 knockout mice show no gross abnormalities of brain anatomy. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164760 15453089 221308 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis ms is an inflammatory demyelinating disease of the cns with a typical onset in the early adult life and characterized by perivascular infiltration of lymphocytes and macrophages into the brain parenc 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 164761 15453089 221313 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in this light the expression of cox 2 and its contribution to the pathogenic events in ms have been explored in several animal models and in ms patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164762 15453089 221314 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 immunoreactivity has been found in experimental autoimmune encephalomyelitis eae an extensively used animal model. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164763 15453089 221315 17610 9605 PTGS2 cox 2 cox 2 0 1.0 analysis of spinal cord of sjl mice immunized with a peptide of the myelin constituent proteolipid protein revealed that during the acute phase of eae cox 2 expression is confined within infiltrating macrophages and ramified microglia close to the inflammatory infiltrates. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164764 15453089 221316 17610 9605 PTGS2 cox 2 cox 2 0 1.0 very rare reactive astrocytes expressed cox 2 in this phase but their number significantly increased during relapse phase suggesting that cox 2 induction in astrocytes could be due to soluble factors i.e. cytokines produced during the protracted inflammatory insults 30 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164765 15453089 221317 12436 6925 MBP myelin basic protein myelin basic protein 0 1.0 in a different eae model in which lewis rats were immunized with a peptide of another myelin protein the myelin basic protein cox 2 immunoreactivity was exclusively found associated with neurons and endothelial cells 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164766 15453089 221317 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in a different eae model in which lewis rats were immunized with a peptide of another myelin protein the myelin basic protein cox 2 immunoreactivity was exclusively found associated with neurons and endothelial cells 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164767 15453089 221318 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the number of cox 2 positive endothelial cells increased with the progression of the disease most prominently in areas of cellular infiltration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164768 15453089 221320 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in eae the number of cox 1 positive macrophages increased along with that of cox 2 positive cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164769 15453089 221321 17610 9605 PTGS2 cox 2 cox 2 0 1.0 sensitivity response to heat killed bacillus calmette gu_amp_#233;rin which results in t cell and macrophage recruitment to the brain parenchyma breakdown of bbb primary demyelination and axon damage cox 2 expression was restricted to major infiltrating hematogenous cell populations such as neutrophils and mononuclear phagocytes and to perivascular cells of the blood vessels in the vicinity of the lesi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164770 15453089 221322 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these perivascular cells were identified as macrophages but the possibility that some endothelial cells also expressed cox 2 could not be ruled out. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164771 15453089 221323 17610 9605 PTGS2 cox 2 cox 2 0 1.0 neuronal cox 2 was not affected by the ongoing inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164772 15453089 221324 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in spite of the extensive astrocyte and microglial reaction occurring over a broad area surrounding the inflammatory lesions there was no obvious cox 2 staining in these cells indicating that the upregulation of cox 2 expression in this model of chronic immune mediated lesions is remarkably restricted to the lesion sites 32 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164773 15453089 221324 17610 9605 PTGS2 cox 2 cox 2 0 1.0 staining in these cells indicating that the upregulation of cox 2 expression in this model of chronic immune mediated lesions is remarkably restricted to the lesion sites 32 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164774 15453089 221325 17610 9605 PTGS2 cox 2 cox 2 0 1.0 a similar restricted cox 2 expression has been described in brain tissues from 7 ms patients 33 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164775 15453089 221326 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in these specimens characterized by the presence of chronic active lesions cox 2 expression was studied by sophisticated confocal microscopy analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164776 15453089 221327 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 positive cells were present in all chronic active lesions examined and generally located on the border of myelinated regions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164777 15453089 221328 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 immunoreactivity was largely but not exclusively associated with cells expressing the macrophage/microglial marker cd64 the fc receptor typically associated with activated macrophages. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164778 15453089 221328 7431 24692 FCAMR fc receptor fc receptor 0 1.0 cox 2 immunoreactivity was largely but not exclusively associated with cells expressing the macrophage/microglial marker cd64 the fc receptor typically associated with activated macrophages. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164779 15453089 221329 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however not all cd64 positive cells expressed cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164780 15453089 221330 17610 9605 PTGS2 cox 2 cox 2 0 1.0 expression of cox 2 was frequently associated with that of inducible no synthase inos suggesting that both enzymes could contribute to the progression of ms through their ability to produce free radicals such as superox 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164781 15453089 221331 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the authors also propose that the colocalization of cox 2 and inos may be functionally linked to oligodendroglial excitotoxic death in ms. indeed both pge 2 and peroxinitrite could increase the local concentration of glutamate to toxic levels by inducing ca 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164782 15453089 221332 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nonetheless a protective role of cox 2 in ms cannot be excluded. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164783 15453089 221345 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 missense mutations in the gene encoding for the cu/zn superoxide dismutase sod1 account for a familial form of als linked to chromosome 21q. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164784 15453089 221350 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the well established role of cox 2 in inflammation and in glutamate dependent neurotoxicity has set the basis for the hypothesis of cox 2 involvement in als pathogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164785 15453089 221351 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 mrna and protein were increased in postmortem spinal cords of als patients 42 and transgenic mutated sod1 mice 43 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164786 15453089 221352 17610 9605 PTGS2 cox 2 cox 2 0 1.0 elevation of pge 2 tissue levels paralleled the increased expression of cox 2 43 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164787 15453089 221354 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cell types expressing cox 2 have been identified in both animal and human specimens. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164788 15453089 221355 17610 9605 PTGS2 cox 2 cox 2 0 1.0 under normal conditions cox 2 is expressed in neurons in the spinal cord dorsal and ventral horns as well as in dorsal root ganglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164789 15453089 221356 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in postmortem spinal cord of als patients cox 2 expression was markedly increased and localized to both neurons and glial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164790 15453089 221357 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the number of cox 2 positive motor neurons and interneurons was significantly increased in spite of the expected overall reduction in the total number of neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164791 15453089 221358 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition cox 2 was associated with astrocytes and and to a much lesser extent with microglial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164792 15453089 221360 17610 9605 PTGS2 cox 2 cox 2 0 1.0 a similar pattern of cox 2 expression was reported for the mutated sod1 transgenic mice 43 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164793 15453089 221361 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the role of cox 2 activity in als was examined by using selective cox 2 inhibitors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164794 15453089 221362 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in the first study the cox 2 inhibitor sc236 significantly protected motor neurons in an organotypic spinal cord culture model in which neuronal death is induced by treo hydroaspartate an inhibitor of astrocytic glutamate re upt 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164795 15453089 221363 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these findings suggested that cox 2 could take part in the excitotoxic damage caused by elevated glutamate levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164796 15453089 221364 17610 9605 PTGS2 cox 2 cox 2 0 1.0 subsequently the same group showed that treatment of sod1 transgenic mice with cox 2 inhibitor celecoxib significantly delayed the onset of disease prolonged the survival and reduced the spinal neurodegeneration and glial activation 47 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164797 15453089 221365 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these studies suggest that inhibition of cox 2 could have therapeutic benefits by altering the cascade of events leading to the progressive neuronal death in als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164798 15453089 221366 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however in these studies mice received the cox 2 inhibitor treatment beginning several weeks before the onset of disease defined as a 30_amp_#37; decrease in motor performance. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164799 15453089 221367 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus the efficacy of cox 2 inhibition in the presence of overt clinical signs of disease remains to be investigated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164800 15453089 221368 17610 9605 PTGS2 cox 2 cox 2 0 1.0 several mechanisms could be triggered by cox 2 overexpression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164801 15453089 221369 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition to the enhancing effect of pge 2 on glutamate release cox 2 could contribute to oxidative stress mediated damage by producing oxidizing reactive species during the peroxidase activity fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164802 15453089 221370 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in transgenic mutated sod1 mice cox 2 and inos are induced with a similar temporal pattern and co expression of the 2 enzymes as discussed in the previous section could lead to the formation of more reactive free radical species such as 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164803 15453089 221371 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 could also contribute to als by promoting inflammatory processes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164804 15453089 221386 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the first study reported an increased expression of cox 2 in ameboid or activated microglial cells in the substantia nigra from 11 idiopathic pd patients whereas neuronal and astroglial cox 2 expression was not different in the control and pd groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164805 15453089 221387 17610 9605 PTGS2 cox 2 cox 2 0 1.0 moderate cox 1 immunoreactivity was observed in some neuronal somata and processes and in few glial cells in both groups suggesting that the greater potential for pg synthesis is associated to cox 2 and microglial cells 53 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164806 15453089 221388 17610 9605 PTGS2 cox 2 cox 2 0 1.0 by contrast the second and more recent study 52 showed that cox 2 is specifically induced in substantia nigra dopaminergic neurons in postmortem pd specimens and in the 1 methyl 4 phenyl 1 2 3 6 tetrahydropyridine mptp mouse model. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164807 15453089 221391 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the involvement of cox 2 in pd neurodegeneration was further suggested by the observation that mptp neurodegeneration was mitigated in cox 2 but not in cox 1 knock out mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164808 15453089 221395 17345 9449 PRNP prion protein prion protein 0 0.0 the characteristic neuropathological signs of the disease are amyloid deposition of the proteinase resistant prion protein prp res or prp sc astrocytosis and spongiform degeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164809 15453089 221395 17345 9449 PRNP prion protein prp prion protein prp 0 1.0 the characteristic neuropathological signs of the disease are amyloid deposition of the proteinase resistant prion protein prp res or prp sc astrocytosis and spongiform degeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164810 15453089 221397 10437 5992 IL1B il 1 il 1 0 1.0 in spite of the prominent microglial activation classical pro inflammatory mediators such as il 1 il 6 tnf [alpha] and ifn [gamma] were not detected in significant amount in a murine model of prion disease in which c57bl/6j mice are infected with scrapie the prion form affecting sheep. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164811 15453089 221397 10463 6018 IL6 il 6 il 6 0 1.0 in spite of the prominent microglial activation classical pro inflammatory mediators such as il 1 il 6 tnf [alpha] and ifn [gamma] were not detected in significant amount in a murine model of prion disease in which c57bl/6j mice are infected with scrapie the prion form affecting sheep. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164812 15453089 221398 22058 11765 TGFA transforming growth factor transforming growth factor 0 1.0 by contrast the immunoregulatory cytokine transforming growth factor [beta] and pge 2 were increased 54 55 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164813 15453089 221399 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the increase in hippocampal pge 2 levels was associated with a strong induction of cox 2 expression which increased with the progression of disease and was specifically localized to microglial cells 56 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164814 15453089 221401 17610 9605 PTGS2 cox 2 cox 2 0 1.0 were then confirmed in a second murine model in which ch3 mice were infected with homogenates from 2 cases of genetic cjd and 3 cases of sporadic cjd 57 suggesting that the selective upregulation of cox 2 in microglial cells is not characteristic of a specific prion agent or mouse strain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164815 15453089 221402 17610 9605 PTGS2 cox 2 cox 2 0 1.0 different results were reported in a recent study in which both cox 1 and cox 2 were increased in sporadic cjd cortex 58 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164816 15453089 221403 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 immunoreactivity was present in macrophages/microglial cells whereas cox 2 was predominantly in neurons. mrnas and proteins of both isoforms were higher in tissue from temporal lobe of 1 cjd patient when compared to 1 neuropathologically unaltered control case. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164817 15453089 221407 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the increased levels of pge 2 in the csf of cjd patients and the high expression of cox 2 in microglial cells in experimental prion diseases suggest that pge 2 synthesis may be associated with the clearance of apoptotic neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164818 15453089 221408 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in cjd abundance of apoptotic neurons correlated well with microglial activation 60 and recently interaction of microglial cells with apoptotic neurons has been reported to selectively promote cox 2 expression and pge 2 synthesis 61 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164819 15453089 221416 17610 9605 PTGS2 cox 2 cox 2 0 1.0 over the last 10 years several analyses of cox 1 and cox 2 expressions have been carried out in animal models and postmortem ad brain tissues providing a substantial but still controversial body of evidence pointing to the involvement of cox 2 in the cascade 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164820 15453089 221416 17610 9605 PTGS2 cox 2 cox 2 0 1.0 expressions have been carried out in animal models and postmortem ad brain tissues providing a substantial but still controversial body of evidence pointing to the involvement of cox 2 in the cascade of events leading to neurodegeneration in ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164821 15453089 221417 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 mrna levels in ad brains were reported as either decreased or increased 9 65 66 possibly because of the short half life of cox 2 transcripts or individual variability of inflammatory related processes 67 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164822 15453089 221419 17610 9605 PTGS2 cox 2 cox 2 0 1.0 several studies reported increased neuronal cox 2 immunoreactivity compared to control brain tissues 9 68 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164823 15453089 221420 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however in other studies in which cox 2 expression was related to specific hallmarks of the disease such as clinical dementia rating and braak stage of disease the number of cox 2 positive neurons decreased with the severity of dementia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164824 15453089 221421 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in end stage ad cox 2 positive neurons were significantly fewer than in non demented controls 68 69 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164825 15453089 221422 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in a more recent study 70 the number of neurons expressing cox 2 negatively correlated with the braak score for amyloid deposits although a moderate albeit non significant cox 2 increase was found at braak stage a corresponding to the mildest stage of disease when compared to non demented control cases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164826 15453089 221423 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 immunoreactivity did not correlate with braak staging for neurofibrillary changes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164827 15453089 221424 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these recent studies suggest that cox 2 expression varies with the disease stage and this may explain the controversial findings reported in the literature. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164828 15453089 221425 17610 9605 PTGS2 cox 2 cox 2 0 1.0 hoozemans et al also reported a colocalization and a significant correlation of neuronal cox 2 expression with cell cycle regulators involved in controlling the g 0 / g 1 phase such as cyclin d1 and e and the retinoblastoma protein 69 70 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164829 15453089 221425 3794 1582 CCND1 cyclin d1 cyclin d1 0 1.0 hoozemans et al also reported a colocalization and a significant correlation of neuronal cox 2 expression with cell cycle regulators involved in controlling the g 0 / g 1 phase such as cyclin d1 and e and the retinoblastoma protein 69 70 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164830 15453089 221427 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although there are some indications that cox 2 might regulate cell cycle progression 70 the functional link between cox 2 and cell cycle alteration remains elusive. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164831 15453089 221428 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nonetheless it can be suggested that cox 2 and cell cycle proteins are involved in early steps leading to neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164832 15453089 221429 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in contrast to cox 2 the levels of cox 1 mrna and protein were not significantly altered in ad brains 9 72 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164833 15453089 221435 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this pattern is consistent with the slight increase in the number of cox 2 positive neurons at braak stage a as well as with the reduction in cox 2 positive neurons reported in patients with severe dementia and braak end stage disease as previously reported 68 70 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164834 15453089 221436 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the moderate increase in cox 2 expression and activity at very early stages of ad could explain the primary protective of nsaids by preventing early steps leading to neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164835 15453089 221437 17610 9605 PTGS2 cox 2 cox 2 0 1.0 upregulation of neuronal cox 2 is associated with ischemia and excitotoxicity suggesting that cox 2 is involved in neurotoxic mechanisms. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164836 15453089 221438 17610 9605 PTGS2 cox 2 cox 2 0 1.0 increased susceptibility to excitotoxicity in cox 2 over expressing neurons and neuroprotection by cox 2 inhibition has been shown in several experimental models 64 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164837 15453089 221439 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nonetheless increased cox 2 expression could be an adaptive reaction to pathological events such as cerebrovascular dysfunction early inflammatory processes or oxidative stress in the attempt to restore lost physiological funct 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164838 15453089 221440 17610 9605 PTGS2 cox 2 cox 2 0 1.0 taking into account the positive and negative effects of increased cox 2 activity and the emerging role of cox 2 derived pgs in brain function it is difficult to predict the final outcome of long term therapeutic cox 2 inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164839 15453089 221440 17610 9605 PTGS2 cox 2 cox 2 0 1.0 derived pgs in brain function it is difficult to predict the final outcome of long term therapeutic cox 2 inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164840 15453089 221441 17610 9605 PTGS2 cox 2 cox 2 0 1.0 at present clinical trials of selective cox 2 inhibitors have not been as convincing as expected but these failures may be related to drug selection and dose duration of treatment and state of disease of selected patients 64 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164841 15453089 221442 17610 9605 PTGS2 cox 2 cox 2 0 1.0 echanisms such as lowering of a[beta] peptide levels reduction in the plaque pathology and activation of the peroxisome proliferator activated receptor [gamma] suggesting that selective inhibition of cox 2 may not be the optimal therapeutic strategy 64 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164842 15453089 221443 17610 9605 PTGS2 cox 2 cox 2 0 1.0 since its discovery in early 1990s cox 2 has emerged as a major player in inflammatory reactions in peripheral tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164843 15453089 221444 17610 9605 PTGS2 cox 2 cox 2 0 1.0 evidence from several laboratories indicates that cox 2 is induced in various inflammatory settings is the main source of pgs responsible for clinical signs of inflammation and its inhibition leads to anti inflammatory effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164844 15453089 221445 17610 9605 PTGS2 cox 2 cox 2 0 1.0 by extension cox 2 expression in brain has been associated with pro inflammatory activities thought to be instrumental in neurodegenerative processes of several acute and chronic diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164845 15453089 221446 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however 2 major aspects should be borne in mind when considering the significance of cox 2 activity in brain diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164846 15453089 221447 17610 9605 PTGS2 cox 2 cox 2 0 1.0 first cox 2 is expressed under normal conditions and contributes to fundamental brain functions such as synaptic activity memory consolidation and functional hyperemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164847 15453089 221451 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in spite of the intense research of the last decade the evidence of a direct role of cox 2 in neurodegenerative events is still controversial and further experimental and clinical studies are required to improve our knowledge of how and when cox 2 inhibition may have beneficial effects for 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164848 15453089 221451 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in neurodegenerative events is still controversial and further experimental and clinical studies are required to improve our knowledge of how and when cox 2 inhibition may have beneficial effects for patients suffering from inflammatory and degenerative neuropathologies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164849 15453089 221453 17610 9605 PTGS2 cox 2 cox 2 0 1.0 several cell types including resident cells i.e neurons glia endothelial cells and infiltrating blood cells can express cox 2 in brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164850 15453089 221454 17610 9605 PTGS2 cox 2 cox 2 0 1.0 over expression of cox 2 in each of these cells may have different functional consequences and its final outcome is likely to depend on the prevailing product of cox 2 activity including pgs with different functions and free radicals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164851 15453089 221455 17610 9605 PTGS2 cox 2 cox 2 0 1.0 neurons are particularly susceptible to damage caused by free radicals generated through cox 2 peroxidase activity whereas glial cells are more resistant. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164852 15453089 221456 17610 9605 PTGS2 cox 2 cox 2 0 1.0 specific signals seem responsible for cox 2 induction and/or over expression in particular cell types such as glutamate in neurons cytokines in astrocytes and apoptotic neurons in microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 164853 15453089 221458 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the beneficial effects of specific and non specific cox 2 inhibitors in several experimental models and epidemiological studies are an indirect proof of the causative role of cox 2 in neurodegeneration as cox independent mechanisms cannot be excluded. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 168307 15507874 225814 22079 11778 TGM2 transglutaminase 2 transglutaminase 2 0 1.0 new target against inflammatory diseases: transglutaminase 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 168694 15512862 226139 1576 990 BCL2 bcl 2 bcl 2 0 1.0 neuroprotective agents|proto oncogene proteins c bcl 2|superoxide dismutase 1|superoxide dismutase|peptide hydrolases|caspases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161127 15571972 216599 9766 4851 HTT huntingtin huntingtin 0 1.0 recent studies have reported that a daily treatment with minocycline 5_amp_#x2013;10 mg/kg i.p. slows progression and delays mortality of mice carrying the exon 1 of mutated huntingtin with 144 cag repeats when administrated from 8.5 weeks of age carreras et al. 2003 chen et al. 2000 wang et al. 2003b and wang et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161128 15571972 216600 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 ompanied by a decrease in the level of interleukin 1_amp_#x3b2; and in the cytosolic release of apoptogenic mitochondrial factors for a review see blum et al. 2001 such as cytochrome c smac/diablo or apoptosis inducing factor aif; wang et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161129 15571972 216600 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ts beneficial effect was accompanied by a decrease in the level of interleukin 1_amp_#x3b2; and in the cytosolic release of apoptogenic mitochondrial factors for a review see blum et al. 2001 such as cytochrome c smac/diablo or apoptosis inducing factor aif; wang et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161130 15571972 216601 9766 4851 HTT huntingtin huntingtin 0 1.0 in vitro minocycline 5_amp_#x2013;100 _amp_#x3bc;m inhibits cell death and apoptosis induced by either mutated huntingtin or other neurotoxic stimulations promoting caspase activation blum et al. unpublished observations; wang et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161131 15571972 216624 9766 4851 HTT huntingtin huntingtin 0 1.0 2003 using a slice culture model of hd clearly demonstrated that 30 _amp_#x3bc;m minocycline inhibit huntingtin aggregation up to tenfold. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161132 15571972 216626 9766 4851 HTT huntingtin huntingtin 0 1.0 however this is inconsistent with other recent in vitro data showing that 50 _amp_#x3bc;m minocycline fails to inhibit aggregation in cells overexpressing mutated huntingtin apostol et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161133 15571972 216653 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 minocycline could also facilitate recovery after spinal cord injury lee et al. 2003 and wells et al. 2003 attenuate neuropathic pain raghavendra et al. 2003 and display beneficial effect in models of multiple sclerosis brundula et al. 2002 and nelissen et al. 2003 and autoimmune encephalomyelitis popovic et al. 2002 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 161134 15571972 216658 11780 6563 LGALS3 mac 2 mac 2 0 1.0 morphologically minocycline reduces the proliferation/activation of resting microglial cells as revealed by cd11b/ox 42 mac 2 or isolectine b4 staining dommergues et al. 2003 _amp_#x2014;45 mg/kg i.p.; he et al. 2001 _amp_#x2014;45 mg/kg i.p.; kriz et al. 2002 _amp_#x2014;1 g/kg p.o.; tikka and koistinaho 2001 and tikka et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161135 15571972 216660 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 accordingly several studies showed that minocycline reduces the expression of inducible nitric oxide synthase and subsequent nitric oxide production as well as caspase 1 activity/expression and thereby prevents the formation of interleukin 1_amp_#x3b2; amin et al. 1996 ; chen et al. 2000 _amp_#x2014;5 mg/kg/d i.p.; du et al. 2001 _amp_#x2014;60 to 120 mg/kg p.o.; yrj 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161136 15571972 216660 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 accordingly several studies showed that minocycline reduces the expression of inducible nitric oxide synthase and subsequent nitric oxide production as well as caspase 1 activity/expression and thereby prevents the formation of interleukin 1_amp_#x3b2; amin et al. 1996 ; chen et al. 2000 _amp_#x2014;5 mg/kg/ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161137 15571972 216665 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the mitochondrial level to rescue the collapse of transmembrane potential and the alterations of permeability transition which are responsible for the cytosolic release of apoptogenic factors such as cytochrome c aif or smac/diablo mediating caspase dependent and independent cell death matsuki et al. 2003 and wang et al. 2003b _amp_#x2014;5 mg/kg i.p.; zhu et al. 2002 _amp_#x2014;22.5 to 45 mg/kg i.p. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161138 15571972 216666 1576 990 BCL2 bcl 2 bcl 2 0 1.0 additionally minocycline has been recently shown to up regulate expression of the anti apoptotic protein bcl 2 wang et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161139 15571972 216667 1576 990 BCL2 bcl 2 bcl 2 0 1.0 minocycline can also reduce the cleavage_amp_#x2014;and thus the activation_amp_#x2014;of bid a pro apoptotic protein of the bcl 2 family wang et al. 2003a _amp_#x2014;10 mg/kg i.p. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161140 15571972 216691 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 this was accompanied by a substantial reduction of caspase 3 activity inflammation and gliosis kriz et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161369 15572176 216717 17610 9605 PTGS2 cox 2 cox 2 0 1.0 reactive astrocytes in als contain protein inclusions express inflammatory makers such as the inducible forms of nitric oxide synthase inos and cyclooxygenase cox 2 display nitrotyrosine immunoreactivity and downregulate the glutamate transporter eaat2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161370 15572176 216717 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 reactive astrocytes in als contain protein inclusions express inflammatory makers such as the inducible forms of nitric oxide synthase inos and cyclooxygenase cox 2 display nitrotyrosine immunoreactivity and downregulate the glutamate transporter eaat2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161371 15572176 216722 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 in addition reactive astrocytes secrete pro apoptotic mediators such as nerve growth factor ngf or fas ligand a mechanism that may serve to eliminate vulnerable motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161372 15572176 216722 7334 11936 FASLG fas ligand fas ligand 0 1.0 in addition reactive astrocytes secrete pro apoptotic mediators such as nerve growth factor ngf or fas ligand a mechanism that may serve to eliminate vulnerable motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161373 15572176 216731 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 about 10% of als cases show familial inheritance 20% of which are caused by mutations in the gene encoding copper zinc superoxide dismutase sod 1 [ 106 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161374 15572176 216742 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 by proliferating and adopting a reactive phenotype characterized morphologically by hypertrophic nuclei and cell bodies and elaboration of distinct long and thick processes with increased content of glial fibrillary acidic protein gfap . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161375 15572176 216756 17610 9605 PTGS2 cox 2 cox 2 0 1.0 reactive astrocytes in als show increased immunoreactivity for gfap and the calcium binding protein s100_amp_#x3b2; [ 85 ] and express inflammatory makers such as cox 2 [ 81 ] inos and neuronal nos [ 5 and 115 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161376 15572176 216759 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 g85r sod 1 mutation astrocytes display major morphological and functional changes characterized by the appearance of sod1 containing aggregates and decreased expression of glial glutamate transporter glt 1 [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161377 15572176 216766 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 in addition hypertrophic spinal cord astrocytes occurring in the late stages of the disease express the activated form of p38 mitogen activated protein kinase [ 130 ] which is stimulated by nitric oxide and inflammatory mediators. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161378 15572176 216769 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 howland et al. [ 62 ] found that gliosis coincided with early vacuolization of the neuropil and with a striking focal loss of the glt 1 glutamate transporter in the ventral horn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161379 15572176 216807 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 some inflammatory molecules such as fibroblast growth factor [ 64 ] major histocompatibility complex encoded antigens [ 89 ] interferon gamma [ 70 and 89 ] and nos [ 70 ] have been found elevated in motor neurons after nerve lesions or spinal cord injury and proposed to signal between motor neurons and glia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161380 15572176 216813 10601 6081 INS insulin insulin 0 1.0 further evidence for a role for motor neurons modulating astrocytes reactivity was provided in g93a sod 1 mice expressing increased levels of insulin growth factor 1 igf 1 in spinal motor neurons and skeletal muscle [ 67 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161381 15572176 216826 20017 10940 SLC1A2 glt 1 glt1 0 1.0 many als patients have elevated glutamate levels in cerebrospinal fluid and a selective reduction of the astrocytic glutamate transporter eaat2 glt1 giving support to the excitotoxic hypothesis of motor neuron degeneration [ 107 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161382 15572176 216841 17610 9605 PTGS2 cox 2 cox 2 0 1.0 for example reactive astrocytes in als express cox 2 an enzyme that catalyzes the synthesis of the inflammatory prostaglandin e2 which in turn stimulates glutamate release from astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161383 15572176 216842 17610 9605 PTGS2 cox 2 cox 2 0 1.0 treatment of als mice with the cox 2 inhibitor celecoxib delayed the onset of the disease and increased the survival rates [ 30 ] further suggesting a link between inflammation and excitotoxicity. 4.2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161384 15572176 216847 10463 6018 IL6 il 6 il 6 0 1.0 for example in the cns interleukin 1_amp_#x3b2; il 1_amp_#x3b2; and il 6 exert a powerful regulation of glial cells [ 109 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161385 15572176 216849 10463 6018 IL6 il 6 il 6 0 1.0 proinflammatory il 1_amp_#x3b2; and il 6 are synthesized by neuroglia during epileptic activity [ 105 ] the response being greater when seizures are associated with neuronal damage suggesting the release of neuronal mediators. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161386 15572176 216851 17610 9605 PTGS2 cox 2 cox 2 0 1.0 interestingly cytokine signaling can induce inos cox 2 and nmda receptor subunit phosphorylation with different consequences in glial and neuronal cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161387 15572176 216853 17610 9605 PTGS2 cox 2 cox 2 0 1.0 activation of murine astrocytes with tumour necrosis factor alpha tnf _amp_#x3b1; il 1_amp_#x3b2; and ifn_amp_#x3b3; induces il 6 cox 2 and inos and makes the cells vulnerable to undergo apoptosis in response to fas ligand fasl [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161388 15572176 216853 7334 11936 FASLG fas ligand fas ligand 0 1.0 f murine astrocytes with tumour necrosis factor alpha tnf _amp_#x3b1; il 1_amp_#x3b2; and ifn_amp_#x3b3; induces il 6 cox 2 and inos and makes the cells vulnerable to undergo apoptosis in response to fas ligand fasl [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161389 15572176 216853 10463 6018 IL6 il 6 il 6 0 1.0 activation of murine astrocytes with tumour necrosis factor alpha tnf _amp_#x3b1; il 1_amp_#x3b2; and ifn_amp_#x3b3; induces il 6 cox 2 and inos and makes the cells vulnerable to undergo apoptosis in response to fas ligand fasl [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161390 15572176 216855 10463 6018 IL6 il 6 il 6 0 1.0 activated astrocytes are potent producers of il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161391 15572176 216856 10463 6018 IL6 il 6 il 6 0 1.0 while il 6 can promote survival and protect neurons from degeneration it can also promote astrocyte proliferation and activation [ 31 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161392 15572176 216867 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 some motor neurons plated on these reactive astrocytes were smaller and displayed immunoreactivity for cleaved caspase 3 suggesting the activation of apoptotic mechanisms. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161393 15572176 216885 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 the apoptotic pathway activated by fas seems to be specific for motor neurons requiring co activation of caspase 8 and p38 as well as the production of nitric oxide by neuronal nos [ 101 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161394 15572176 216886 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 another potential apoptotic candidate released by astrocytes is nerve growth factor ngf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161395 15572176 216888 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 while ngf can signal through activation of the high affinity trka receptor it also can activate the non selective neurotrophin receptor p75 ntr a member of the tumor necrosis factor receptor superfamily. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161396 15572176 216888 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 while ngf can signal through activation of the high affinity trka receptor it also can activate the non selective neurotrophin receptor p75 ntr a member of the tumor necrosis factor receptor superfamily. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161397 15572176 216888 3889 11919 CD40 tumor necrosis factor receptor tumor necrosis factor receptor 0 0.0 while ngf can signal through activation of the high affinity trka receptor it also can activate the non selective neurotrophin receptor p75 ntr a member of the tumor necrosis factor receptor superfamily. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161398 15572176 216888 3889 11919 CD40 tumor necrosis factor receptor superfamily tumor necrosis factor receptor superfamily 0 1.0 while ngf can signal through activation of the high affinity trka receptor it also can activate the non selective neurotrophin receptor p75 ntr a member of the tumor necrosis factor receptor superfamily. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161399 15572176 216890 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 however they do respond to other members of the neurotrophin family including bdnf nt 3 and nt 4/5 [ 123 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161400 15572176 216890 14728 8024 NTF4 nt 4/5 nt 4/5 0 1.0 however they do respond to other members of the neurotrophin family including bdnf nt 3 and nt 4/5 [ 123 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161401 15572176 216890 14728 8024 NTF4 nt 4/5 nt 4/5 0 1.0 however they do respond to other members of the neurotrophin family including bdnf nt 3 and nt 4/5 [ 123 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 161402 15572176 216897 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 expression of ngf receptors in active multiple sclerosis lesions suggests a role for ngf in regulating the autoimmune response at both immune and glial cell levels [ 17 and 135 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 161403 15572176 216902 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 it has been recently shown that the pro neurotrophin is enriched in the cns [ 38 ] and could be secreted by different cell types [ 56 and 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155437 15649489 206198 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 we investigated the therapeutic effect of pioglitazone a peroxisome proliferator activated receptor gamma ppar _amp_#x3b3; agonist in the g93a sod1 transgenic mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155438 15649489 206205 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 a major advance in understanding its pathogenesis came from the genetics that identified mutations in the gene coding for copper_amp_#x2013;zinc superoxide dismutase 1 sod1 in a subset of patients with autosomal dominant inherited als rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155439 15649489 206205 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 a major advance in understanding its pathogenesis came from the genetics that identified mutations in the gene coding for copper_amp_#x2013;zinc superoxide dismutase 1 sod1 in a subset of patients with autosomal dominant inherited als rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155440 15649489 206211 10601 6081 INS insulin insulin 0 1.0 ppars have been implicated in insulin sensitivity adipocyte differentiation and inflammatory processes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155441 15649489 206216 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 others reported that pioglitazone protected tyrosine hydroxylase th positive substantia nigra neurons from death induced by mptp breidert et al. 2002 and dehmer et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155442 15649489 206217 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 pioglitazone treatment reduced activation of microglia reduced induction of inos positive cells and less glial fibrillary acidic protein positive cells in both striatum and substantia nigra pars compacta of mptp treated mice dehmer et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155443 15649489 206286 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 il 1_amp_#x3b2; tumor necrosis factor and inos levels are increased in transgenic mouse models of als almer et al. 1999 elliott 2001 ghezzi et al. 1998 and li et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155444 15649489 206289 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 transcription profiling of the spinal cords of mice with g93a sod1 mutations showed up regulation of tumor necrosis factor cd68 and caspase 1 mrna at 11 weeks of age prior to motor neuron death yoshihara et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155445 15649489 206289 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 transcription profiling of the spinal cords of mice with g93a sod1 mutations showed up regulation of tumor necrosis factor cd68 and caspase 1 mrna at 11 weeks of age prior to motor neuron death yoshihara et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155446 15649489 206290 10731 6149 ITGAM mac 1 mac 1 0 1.0 furthermore markers of microgial activation including cd63 mac 1 cathepsin 5 _amp_#x3b2;2_amp_#xa0;microglobulin c10c and agc1q _amp_#x3b2; are increased at 90 and 120 days of age olsen et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155447 15649489 206292 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 in the present studies we tested the neuroprotective effects of the peroxisome proliferator activated receptor gamma agonist pioglitazone. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155448 15649489 206294 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 recently daily treatment with 45 mg po pioglitazone for 3 years induced apparent clinical improvement without adverse events treatment in a patient with secondary multiple sclerosis pershadsingh et al. 2004 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 155449 15649489 206299 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 it reduced induction of inos positive cells and there was less glial fibrillary acidic protein positive cells in both the striatum and substantia nigra pars compacta. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155450 15649489 206338 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nf kappa b|neuroprotective agents|ppar gamma|thiazolidinediones|pioglitazone|3 nitrotyrosine|tyrosine|nitric oxide synthase|nitric oxide synthase type ii|nos2 protein mouse|sod1 g93a protein|superoxide dismutas 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 155451 15649489 206338 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 nf kappa b|neuroprotective agents|ppar gamma|thiazolidinediones|pioglitazone|3 nitrotyrosine|tyrosine|nitric oxide synthase|nitric oxide synthase type ii|nos2 protein mouse|sod1 g93a protein|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156677 15657392 207607 10601 6081 INS insulin insulin 0 0.0 here we show that muscle restricted expression of a localized insulin like growth factor igf 1 isoform maintained muscle integrity and enhanced satellite cell activity in sod1 transgenic mice inducing calcineurin mediated regenerative pathways. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156678 15657392 207607 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 here we show that muscle restricted expression of a localized insulin like growth factor igf 1 isoform maintained muscle integrity and enhanced satellite cell activity in sod1 transgenic mice inducing calcineurin mediated regenerative pathways. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156679 15657392 207610 10601 6081 INS insulin insulin 0 0.0 abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156680 15657392 207610 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 1.0 abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156681 15657392 207610 4362 14079 CHRNA9 acetylcholine receptor acetylcholine receptor 0 1.0 abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dism 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156682 15657392 207610 13949 7577 MYH7 myosin heavy chain myosin heavy chain 0 1.0 this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156683 15657392 207610 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 abbreviations used in this paper: achr acetylcholine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156684 15657392 207610 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase1 0 1.0 holine receptor; als amyotrophic lateral sclerosis; cna calcineurin; gfap glial fibrillary acidic protein; igf insulin like growth factor; migf 1 local isoform of igf 1; myhc myosin heavy chain; sod1 superoxide dismutase1; wt wild type. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156685 15657392 207618 10601 6081 INS insulin insulin 0 0.0 among these insulin like growth factor 1 igf 1 has been implicated in anabolism of muscle and nerve tissues inducing muscle hypertrophy and promoting neuronal survival musar_amp_ograve; and rosenthal 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156686 15657392 207618 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 among these insulin like growth factor 1 igf 1 has been implicated in anabolism of muscle and nerve tissues inducing muscle hypertrophy and promoting neuronal survival musar_amp_ograve; and rosenthal 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156687 15657392 207618 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 among these insulin like growth factor 1 igf 1 has been implicated in anabolism of muscle and nerve tissues inducing muscle hypertrophy and promoting neuronal survival musar_amp_ograve; and rosenthal 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156688 15657392 207652 23395 18809 TUBA1B alpha tubulin alpha tubulin 0 1.0 immunoblotting for alpha tubulin served as a control for protein loading. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156689 15657392 207681 22551 11892 TNF tnf alpha tnf alpha 0 1.0 c rt pcr analysis of tnf alpha and _amp_#223; actin of wt lane 1 mlc/migf 1 lane 2 sod1 lane 3 and sod1 /migf 1 lane 4 transgenic mice at 123 d old. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156690 15657392 207683 22551 11892 TNF tnf alpha tnf alpha 0 1.0 lane 6 identifies the rna positive control pc for tnf alpha obtained from spleen. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156691 15657392 207697 5693 2770 DES desmin desmin 0 1.0 in addition markers of satellite cell activity such as pax 7 and desmin were increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desm 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156692 15657392 207697 5693 2770 DES desmin desmin 0 1.0 were increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satel 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156693 15657392 207697 14010 7612 MYOG myogenin myogenin 0 1.0 re increased to varying extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satellite cell 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156694 15657392 207697 13949 7577 MYH7 myosin heavy chain myosin heavy chain 0 1.0 g extents in affected sod mice fig 2 c whereas hallmarks of satellite cell activity and fiber maturation including centralized nuclei fig 2 a yellow arrows pax 7 isoforms desmin myogenin and neonatal myosin heavy chain myhc expression were present exclusively in the sod1 /migf 1 muscles at all stages of disease including at paralysis stage fig 2 c and not depicted thus satellite cell activation is likely to contrib 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156695 15657392 207715 4362 14079 CHRNA9 acetylcholine receptor acetylcholine receptor 0 1.0 alterations in motor neuronal activity typical of denervated muscle and motor neuron diseases also affect the configuration of neuromuscular junctions in sod1 mice characterized by the diffusion of acetylcholine receptor achr postsynaptic clusters fig 4 a yellow arrow . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156696 15657392 207728 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 comparable patterns of glial fibrillary acidic protein gfap immunoreactivity were found in spinal cords of sod1 n = 6 and sod /migf 1 n = 6 transgenic mice before the symptom onset 28 d; fig 5 b a b and d insert lanes 1 and 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156697 15657392 207731 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the activation of astroglia can be correlated with the expression of certain cytokines such as tnf alpha which enhance the response to inflammatory states and contribute to the progression of neurological dysfunction in sod1 mice elliott 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156698 15657392 207732 22551 11892 TNF tnf alpha tnf alpha 0 1.0 although tnf alpha expression was normally undetectable in the cns of healthy mice fig 5 c lanes 1 and 2 it accumulated in the spinal cord of sod1 mice at paralysis stage 123 d; fig 5 c lane 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156699 15657392 207733 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in contrast tnf alpha expression was not apparent in the spinal cord of sod1 /migf 1 transgenic mice fig 5 c lane 4 . migf 1 hypertrophic muscle therefore functions as a protective tissue for the cns modulating reactive a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156700 15657392 207764 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the following oligonucleotides were used: tnf alpha sense 5' cccagaccctcacacactcagat 3' and anti sense 5' ttgtcccttgaagagaacctg 3'; _amp_#223; actin sense 5' gtgggccgctctaggcacaa 3' and anti sense 5' ctctttgatgtcacgcacgatttc 3'. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156701 15657392 207768 5693 2770 DES desmin desmin 0 1.0 filters were blotted with antibodies against hsod pax7 myogenin desmin neo myhc from s schiaffino university of padova padova italy agrin gfap. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156702 15657392 207768 14010 7612 MYOG myogenin myogenin 0 1.0 filters were blotted with antibodies against hsod pax7 myogenin desmin neo myhc from s schiaffino university of padova padova italy agrin gfap. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156703 15657392 207770 10601 6081 INS insulin insulin 0 1.0 as its name implies igf 1 is similar to insulin in structure. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 156704 15657392 207771 10601 6081 INS insulin insulin 0 1.0 the mature igf 1 is a single chain protein of 70 aa and differs from insulin by retention of the c domain by a short extension of the a domain to include a novel domain d and by the presence of variable cooh terminal extension peptides e peptides; fig s1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157142 15668976 208357 6452 3240 EGR3 early growth response 3 early growth response 3 0 1.0 downregulated genes included those associated with cytoskeleton/axonal transport transcription and cell surface antigens/receptors such as dynactin microtubule associated proteins and early growth response 3 egr3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157143 15668976 208359 22568 11905 TNFRSF10B death receptor 5 death receptor 5 0 1.0 promoters for cell death pathway death receptor 5 cyclins a1 and c and caspases 1 3 and 9 were upregulated whereas cell death inhibitors acetyl coa transporter and nf kappab were also upregulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157144 15668976 208360 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 moreover neuroprotective neurotrophic factors such as ciliary neurotrophic factor cntf hepatocyte growth factor hgf and glial cell line derived neurotrophic factor were upregulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157145 15668976 208360 4649 2169 CNTF ciliary neurotrophic factor ciliary neurotrophic factor 0 1.0 moreover neuroprotective neurotrophic factors such as ciliary neurotrophic factor cntf hepatocyte growth factor hgf and glial cell line derived neurotrophic factor were upregulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157146 15668976 208360 9207 4893 HGF hepatocyte growth factor hepatocyte growth factor 0 1.0 moreover neuroprotective neurotrophic factors such as ciliary neurotrophic factor cntf hepatocyte growth factor hgf and glial cell line derived neurotrophic factor were upregulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157147 15668976 208360 8240 4232 GDNF glial cell line derived neurotrophic factor glial cell line derived neurotrophic factor 0 1.0 moreover neuroprotective neurotrophic factors such as ciliary neurotrophic factor cntf hepatocyte growth factor hgf and glial cell line derived neurotrophic factor were upregulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157378 15681814 208634 22551 11892 TNF tnf alpha tnf alpha 0 1.0 new therapeutic strategies and drug candidates for neurodegenerative diseases: p53 and tnf alpha inhibitors and glp 1 receptor agonists. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157379 15681814 208640 22551 11892 TNF tnf alpha tnf alpha 0 1.0 such targets include tnf alpha p53 and glp 1 receptor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157380 15681814 208641 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the cytokine tnf alpha is elevated in alzheimer's disease parkinson's disease stroke and amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157381 15681814 208645 8198 4191 GCG glucagon-like peptide 1 glucagon like peptide 1 0 0.0 stimulation of the glucagon like peptide 1 receptor glp 1r in brain is associated with neurotrophic functions that additionally can protect cells against excess glutamate and other toxic insults. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157382 15681814 208645 8406 4324 GLP1R glucagon-like peptide 1 receptor glucagon like peptide 1 receptor 0 1.0 stimulation of the glucagon like peptide 1 receptor glp 1r in brain is associated with neurotrophic functions that additionally can protect cells against excess glutamate and other toxic insults. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157383 15681814 208647 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 neoplasm proteins|receptors glucagon|receptors tumor necrosis factor type ii|tumor necrosis factor decoy receptors|tumor suppressor protein p53|glucagon like peptide receptor| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157384 15681814 208647 7568 3701 FHIT tumor suppressor protein tumor suppressor protein 0 1.0 neoplasm proteins|receptors glucagon|receptors tumor necrosis factor type ii|tumor necrosis factor decoy receptors|tumor suppressor protein p53|glucagon like peptide receptor| 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 157737 15691215 209296 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the discovery that a small percentage of als cases are familial and involve mutation in a superoxide dismutase gene sod1 led to the development of transgenic mouse models presently widely used for testing possible drugs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157738 15691215 209297 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 mutations in the vascular endothelial growth factor gene vegf also appear to be involved. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157739 15691215 209300 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 gene transfer of vegf or glial cell line derived neurotrophic factor anti inflammatory cox 2 inhibitors and minocycline have had particularly promising results in mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157740 15691215 209300 17610 9605 PTGS2 cox 2 cox 2 0 1.0 gene transfer of vegf or glial cell line derived neurotrophic factor anti inflammatory cox 2 inhibitors and minocycline have had particularly promising results in mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 157741 15691215 209300 8240 4232 GDNF glial cell line derived neurotrophic factor glial cell line derived neurotrophic factor 0 1.0 gene transfer of vegf or glial cell line derived neurotrophic factor anti inflammatory cox 2 inhibitors and minocycline have had particularly promising results in mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 150951 15777251 199027 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 these include head injury multiple sclerosis ms stroke and neurodegenerative diseases parkinson's disease pd alzheimer's disease ad or amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 150952 15777251 199034 10463 6018 IL6 il 6 il 6 0 1.0 indeed while ms patients and mice subjected to experimental autoimmune encephalomyelitis eae display gender specific alterations of ifn gamma and il 12 variations of tnf and il 6 were associated with pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 150953 15777251 199035 10463 6018 IL6 il 6 il 6 0 1.0 also in case of more acute neurodegenerative conditions such as stroke the effect of il 6 gene g 174c polymorphism was different in males and females. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 150968 15782606 199052 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 [primary progressive multiple sclerosis as a differential diagnosis of als: a case report] 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 150969 15782606 199057 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 er multiple plaques on the head and spinal mri a prolonged central conduction time of mep and sep a delayed p100 latency of vep and a increased igg index in the csf indicated primary progressive type multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 151012 15799549 199166 17610 9605 PTGS2 cox 2 cox 2 0 1.0 macrophages in als spinal cord showed strong expression of cyclooxygenase 2 cox 2 one log greater than control tissues and inducible nitric oxide synthase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151013 15799549 199166 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 macrophages in als spinal cord showed strong expression of cyclooxygenase 2 cox 2 one log greater than control tissues and inducible nitric oxide synthase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151014 15799549 199168 3890 11935 CD40LG cd40 ligand cd40 ligand 0 1.0 vessels showed damage to the tight junction protein zo 1 in relation to perivascular cd40 receptor positive macrophages and cd40 ligand positive t lymphocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151015 15799549 199168 22190 11827 TJP1 zo 1 zo 1 0 1.0 vessels showed damage to the tight junction protein zo 1 in relation to perivascular cd40 receptor positive macrophages and cd40 ligand positive t lymphocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151016 15799549 199168 22190 11827 TJP1 tight junction protein zo-1 tight junction protein zo 1 0 1.0 vessels showed damage to the tight junction protein zo 1 in relation to perivascular cd40 receptor positive macrophages and cd40 ligand positive t lymphocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151017 15799549 199170 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in control cases with corticospinal tract degeneration following hemispheric cerebral infarction macrophage infiltration of the white matter was cox 2 negative and restricted to lateral and anterior corticospinal tracts. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151256 15804265 199553 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inhibition of a key mediator of inflammation cyclooxygenase 2 cox 2 represents a promising therapeutic approach in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151257 15804265 199554 17610 9605 PTGS2 cox 2 cox 2 0 1.0 here we tested the in vivo effects of a specific cox 2 inhibitor rofecoxib administered by intraperitoneal injection in the sod1 g93a g1h mouse model of the familial form of als fals . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147169 15962273 193994 3758 10618 CCL2 monocyte chemoattractant protein-1 monocyte chemoattractant protein 1 0 1.0 production of monocyte chemoattractant protein 1 in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147170 15962273 193996 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 monocyte chemoattractant protein 1 mcp 1 is critical for recruitment of inflammatory cells of monocytic lineage after inflammation or injury to the central nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147171 15962273 193996 3758 10618 CCL2 monocyte chemoattractant protein-1 monocyte chemoattractant protein 1 0 1.0 monocyte chemoattractant protein 1 mcp 1 is critical for recruitment of inflammatory cells of monocytic lineage after inflammation or injury to the central nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147172 15962273 193997 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 mcp 1 concentrations were measured by an enzyme linked immunosorbent assay in the cerebrospinal fluid csf and the serum of 27 patients with als and 30 patients with noninflammatory neurological diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147173 15962273 193998 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 in als circulating mcp 1 levels were significantly increased in the serum and particularly in the csf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147174 15962273 193999 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 immunoreactivity for mcp 1 in als spinal cord was detected mostly in astrocytes but also in microglia neurons and within the vasculature of the cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147175 15962273 194000 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 our findings suggest a role for mcp 1 as an important molecular mediator of the injury response in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147250 15974901 194272 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 these include alzheimer's ad parkinson's pd and huntington's diseases amyotrophic lateral sclerosis all of the tauopathies multiple sclerosis and many other less common conditions. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 135367 16014720 179141 13419 7218 MPO myeloperoxidase myeloperoxidase 0 1.0 here we show that myeloperoxidase mpo a key oxidant producing enzyme during inflammation is upregulated in the ventral midbrain of human pd and mptp mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135368 16014720 179150 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 for instance nadph oxidase and inducible nitric oxide synthase inos which are major sources of inflammatory oxidants are upregulated in damaged areas in both pd and the 1 methyl 4 phenyl 1 2 3 6 tetrahydropyridine mptp model o 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135369 16014720 179150 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 for instance nadph oxidase and inducible nitric oxide synthase inos which are major sources of inflammatory oxidants are upregulated in damaged areas in both pd and the 1 methyl 4 phenyl 1 2 3 6 tetrahydropyridine mptp model of pd hunot et al. 1996 ; liberatore 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135370 16014720 179151 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 studies of mice deficient in nadph oxidase or inos indicate that superoxide radical o 2 and no contribute to the mptp induced neurodegenerative process liberatore et al. 1999 ; wu et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135371 16014720 179156 13419 7218 MPO myeloperoxidase myeloperoxidase 0 1.0 conversely myeloperoxidase mpo and not onoo seems to promote o o ' dityrosine formation in this model of pd pennathur et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135372 16014720 179169 211 132 ACTB beta actin beta actin 0 1.0 total rna was extracted from selected brain regions and at selected time points after mptp and used for reverse transcription pcr analysis as described previously wu et al. 2003 beta actin were as follows: mpo 5' aggataggactggattgcctg 3' forward and 5' gtggtgatgccagtgttgtca 3' reverse ; beta actin 5' ctttgatgtcacgcacgatttc 3' forward and 5' gggccgctctaggcaccaa 3' reverse . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135373 16014720 179169 211 132 ACTB beta actin beta actin 0 1.0 were as follows: mpo 5' aggataggactggattgcctg 3' forward and 5' gtggtgatgccagtgttgtca 3' reverse ; beta actin 5' ctttgatgtcacgcacgatttc 3' forward and 5' gggccgctctaggcaccaa 3' reverse . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135374 16014720 179174 211 132 ACTB beta actin beta actin 0 1.0 mouse brain protein extracts from selected regions were prepared and used for western blot analysis as described previously wu et al. 2003 beta actin antibody 1:10 000; sigma st louis mo . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135375 16014720 179182 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 mouse mpo glial fibrillary acidic protein beta 2 integrin mac 1 cd116/cd18 neutrophil and tyrosine hydroxylase immunohistochemistry . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135376 16014720 179182 10731 6149 ITGAM mac 1 mac 1 0 1.0 mouse mpo glial fibrillary acidic protein beta 2 integrin mac 1 cd116/cd18 neutrophil and tyrosine hydroxylase immunohistochemistry . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135377 16014720 179182 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 mouse mpo glial fibrillary acidic protein beta 2 integrin mac 1 cd116/cd18 neutrophil and tyrosine hydroxylase immunohistochemistry . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135378 16014720 179184 10731 6149 ITGAM mac 1 mac 1 0 1.0 the primary antibodies used were rabbit polyclonal anti mpo 1:500; lab vision fremont ca rabbit polyclonal anti glial fibrillary acidic protein gfap; 1:500; chemicon temecula ca mouse monoclonal anti mac 1 1:1000; serotec raleigh nc and the monoclonal rat anti mouse neutrophil antibody mca771ga 1:100; serotec . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135379 16014720 179184 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 the primary antibodies used were rabbit polyclonal anti mpo 1:500; lab vision fremont ca rabbit polyclonal anti glial fibrillary acidic protein gfap; 1:500; chemicon temecula ca mouse monoclonal anti mac 1 1:1000; serotec raleigh nc and the monoclonal rat anti mouse neutrophil antibody mca771ga 1:100; serotec . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135380 16014720 179187 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 for quantitative tyrosine hydroxylase th immunostaining mice were killed 7 d after mptp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135381 16014720 179248 10731 6149 ITGAM mac 1 mac 1 0 1.0 j l in contrast ventral midbrain mpo positive structures i red are not mac 1 positive j green as evidenced by the overlay k and the mask of colocalized pixels l . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135382 16014720 179282 211 132 ACTB beta actin beta actin 0 1.0 like in mice there was no significant difference in mpo to beta actin ratios in the striatum pd 1.1 _amp_#177; 0.8 vs controls 1.4 _amp_#177; 0.8; p > 0.05; n = 7 or cerebellum pd 0.8 _amp_#177; 0.2 vs controls 1.0 _amp_#177; 0.3; p > 0.05; n = 7 between the pd and con 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135383 16014720 179288 211 132 ACTB beta actin beta actin 0 1.0 conversely we found that caudate nucleus tissues from stage 4 hd patients had higher gfap to beta actin ratios hd 0.7 _amp_#177; 0.1 vs controls 0.1 _amp_#177; 0.1; p _lt_ 0.01; n = 3 4 as well as mpo to beta actin ratios hd 0.8 _amp_#177; 0.2 vs controls 0.2 _amp_#177; 0.1; p _lt_ 0.05; n = 5 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135384 16014720 179288 211 132 ACTB beta actin beta actin 0 1.0 ratios hd 0.7 _amp_#177; 0.1 vs controls 0.1 _amp_#177; 0.1; p _lt_ 0.01; n = 3 4 as well as mpo to beta actin ratios hd 0.8 _amp_#177; 0.2 vs controls 0.2 _amp_#177; 0.1; p _lt_ 0.05; n = 5 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 135385 16014720 179316 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 remarkably detectable changes in inos expression and enzymatic activity are also confined to ventral midbrains of mptp injected mice liberatore et al. 1999 whereas activation of nadph oxidase is observed in both ventral midbrains and striata of these animals wu et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140257 16101543 184883 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these compounds are converted from arachnoidic acid aa by two isoforms of the cyclooxygenase cox enzyme namely cox 1 and cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140258 16101543 184884 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in particular the action of cox 2 and pgs in cns inflammation has gained much attention recently. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140827 16104843 184910 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 foremost among these is the vegf vascular endothelial growth factor family and vegfrs vegf receptors . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140828 16104843 184911 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a also referred to as vpf vascular permeability factor an important regulator of endothelial cell physiology was identified approx. 15 years ago [ 1 2 ] and has been recognized as the major growth fact 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140829 16104843 184911 23910 12680 VEGFA vascular permeability factor vascular permeability factor 0 1.0 vegf a also referred to as vpf vascular permeability factor an important regulator of endothelial cell physiology was identified approx. 15 years ago [ 1 2 ] and has been recognized as the major growth factor that is relatively specific for endothelial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140830 16104843 184912 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a is a dimeric glycoprotein essential for many angiogenic processes in normal and abnormal states such as tumour vascularization mainly by interacting with two tyrosine kinase receptors vegfr 1 [also k 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140831 16104843 184913 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a exhibits two major biological activities: one is the capacity to stimulate vascular endothelial cell proliferation [ 1 6 7 ] and the other is the ability to increase vascular permeability [ 2 8 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140832 16104843 184914 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a also promotes the survival and migration of endothelial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140833 16104843 184918 23910 12680 VEGFA vegf a vegf a 0 1.0 currently the vegf family includes vegf a plgf placenta growth factor vegf b vegf c vegf d vegf e and svvegf snake venom vegf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140834 16104843 184918 7579 3708 FIGF vegf d vegf d 0 1.0 currently the vegf family includes vegf a plgf placenta growth factor vegf b vegf c vegf d vegf e and svvegf snake venom vegf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140835 16104843 184918 16459 8893 PGF placenta growth factor placenta growth factor 0 1.0 currently the vegf family includes vegf a plgf placenta growth factor vegf b vegf c vegf d vegf e and svvegf snake venom vegf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140836 16104843 184920 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140837 16104843 184921 16317 8800 PDGFB platelet-derived growth factor platelet derived growth factor 0 1.0 structurally vegf belongs to the vegf/pdgf platelet derived growth factor supergene family. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140838 16104843 184924 23910 12680 VEGFA vegf a vegf a 0 1.0 the human vegf a gene is organized into eight exons separated by seven introns [ 10 11 ] and is located at 6p21.3 [ 12 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140839 16104843 184925 23910 12680 VEGFA vegf a vegf a 0 1.0 human vegf a has at least nine subtypes due to the alternative splicing of a single gene: vegf 121 vegf 145 vegf 148 vegf 162 vegf 165 vegf 165 b vegf 183 vegf 189 and vegf 206 [ 13 14 ] figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140840 16104843 184933 14682 8004 NRP1 neuropilin 1 neuropilin 1 0 1.0 vegf 165 binds the coreceptors nrp 1 neuropilin 1 [ 20 ] and nrp 2 neuropilin 2 whereas vegf 145 binds only nrp 2 [ 21 ] figure 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140841 16104843 184933 14683 8005 NRP2 neuropilin 2 neuropilin 2 0 1.0 vegf 165 binds the coreceptors nrp 1 neuropilin 1 [ 20 ] and nrp 2 neuropilin 2 whereas vegf 145 binds only nrp 2 [ 21 ] figure 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140842 16104843 184938 23227 12372 TSHB thyroid stimulating hormone thyroid stimulating hormone 0 1.0 gene expression of vegf is regulated by a variety of stimuli such as hypoxia growth factors transformation p53 mutation oestrogen tsh thyroid stimulating hormone tumour promoters and no nitric oxide . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140843 16104843 184940 9230 4910 HIF1A hypoxia-inducible factor 1 hypoxia inducible factor 1 0 1.0 it is now well established that hif 1 hypoxia inducible factor 1 is a key mediator of hypoxic responses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140844 16104843 184940 19746 18420 SETD2 hif 1 hif 1 0 1.0 it is now well established that hif 1 hypoxia inducible factor 1 is a key mediator of hypoxic responses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140845 16104843 184941 19746 18420 SETD2 hif 1 hif 1 0 1.0 hif 1 is a transcriptional activator composed of hif 1 a and hif 1 b subunits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140846 16104843 184942 19746 18420 SETD2 hif 1 hif 1 0 1.0 both hif 1 a and hif 1 b are constitutively expressed in various types of tumour. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140847 16104843 184943 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 under normal oxygenation conditions hif 1 a is scarcely detectable because it is targeted for rapid destruction by an e3 ubiquitin ligase containing pvhl von hippel lindau tumour suppressor protein . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140848 16104843 184943 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 0.0 under normal oxygenation conditions hif 1 a is scarcely detectable because it is targeted for rapid destruction by an e3 ubiquitin ligase containing pvhl von hippel lindau tumour suppressor protein . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140849 16104843 184943 19746 18420 SETD2 hif 1 hif 1 0 1.0 under normal oxygenation conditions hif 1 a is scarcely detectable because it is targeted for rapid destruction by an e3 ubiquitin ligase containing pvhl von hippel lindau tumour suppressor protein . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140850 16104843 184943 16060 8607 PARK2 e3 ubiquitin ligase e3 ubiquitin ligase 0 1.0 under normal oxygenation conditions hif 1 a is scarcely detectable because it is targeted for rapid destruction by an e3 ubiquitin ligase containing pvhl von hippel lindau tumour suppressor protein . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140851 16104843 184944 19746 18420 SETD2 hif 1 hif 1 0 1.0 the interaction between pvhl and a specific domain of the hif 1 a subunit is regulated through hydroxylation of a proline residue pro in hif 1 a by prolyl 4 hydroxylase which requires molecular oxygen and iron for its activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140852 16104843 184944 15948 8546 P4HA1 prolyl 4-hydroxylase prolyl 4 hydroxylase 0 1.0 the interaction between pvhl and a specific domain of the hif 1 a subunit is regulated through hydroxylation of a proline residue pro in hif 1 a by prolyl 4 hydroxylase which requires molecular oxygen and iron for its activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140853 16104843 184945 19746 18420 SETD2 hif 1 hif 1 0 1.0 under hypoxic conditions hif 1 a expression increases as a result of suppressed prolyl hydroxylation of hif 1 a and decreased ubiquitination and degradation [ 26 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140854 16104843 184946 19746 18420 SETD2 hif 1 hif 1 0 1.0 furthermore hypoxia inhibits the oxygen dependent hydroxylation of an asparagine residue asn in hif 1 a in the c terminal transactivation domain of hif 1 a to promote interaction with the p300/cbp [creb camp response element binding protein binding protein] co activator and induce a hre hypoxia response element driven transcription of the vegf gene [ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140855 16104843 184947 7683 3796 FOS ap 1 ap 1 0 1.0 very recently gerald et al. [ 29 ] have demonstrated that jund a member of the ap 1 family of transcription factors is involved in the regulation of prolyl hydroxylase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140856 16104843 184949 23910 12680 VEGFA vegf a vegf a 0 1.0 consequently hif 1 a protein accumulates under normoxic conditions and the transcription of vegf a is increased [ 29 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140857 16104843 184949 19746 18420 SETD2 hif 1 hif 1 0 1.0 consequently hif 1 a protein accumulates under normoxic conditions and the transcription of vegf a is increased [ 29 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140858 16104843 184960 16459 8893 PGF plgf 2 plgf 2 0 1.0 alternative splicing of the human plgf gene generates four isoforms which differ in size and binding properties: plgf 1 plgf 131 plgf 2 plgf 152 plgf 3 plgf 203 and plgf 4 plgf 224 [ 37 39 ] figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140859 16104843 184961 1452 913 AZU1 heparin-binding protein heparin binding protein 0 1.0 plgf 1 is the shortest isoform and a non heparin binding protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140860 16104843 184962 16459 8893 PGF plgf 2 plgf 2 0 1.0 plgf 2 is able to bind heparin and the co receptors nrp 1 and nrp 2 due to the insertion of a highly basic 21 amino acid sequence encoded by exon vi near the c terminus [ 37 ] figure 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140861 16104843 184964 16459 8893 PGF plgf 2 plgf 2 0 1.0 plgf 4 consists of the same sequence of plgf 3 plus a heparin binding domain previously thought to be present only in plgf 2 [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140862 16104843 184965 23910 12680 VEGFA vegf a vegf a 0 1.0 the crystal structure of human plgf 1 has shown that this protein is structurally similar to vegf a [ 40 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140863 16104843 184966 23910 12680 VEGFA vegf a vegf a 0 1.0 furthermore despite this moderate sequence conservation plgf and vegf a bind to the same binding interface of vegfr 1 in a very similar fashion [ 41 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140864 16104843 184967 23910 12680 VEGFA vegf a vegf a 0 1.0 however recent studies have reported that unlike in vegf a n glycosylation in plgf plays an important role in vegfr 1 binding [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140865 16104843 184977 7579 3708 FIGF vegf d vegf d 0 1.0 vegf c and vegf d 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140866 16104843 184978 7579 3708 FIGF vegf d vegf d 0 1.0 vegf c contains a region sharing approx. 30% amino acid identity with vegf 165 ; however it is more closely related to vegf d by virtue of the presence of n and c terminal extensions that are not found in other vegf family members [ 49 ] figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140867 16104843 184979 23910 12680 VEGFA vegf a vegf a 0 1.0 both vegf c and vegf d bind and activate vegfr 3 flt 4; a member of the vegfr family that does not bind vegf a as well as vegfr 2 and are mitogenic for cultured endothelial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140868 16104843 184979 7579 3708 FIGF vegf d vegf d 0 1.0 both vegf c and vegf d bind and activate vegfr 3 flt 4; a member of the vegfr family that does not bind vegf a as well as vegfr 2 and are mitogenic for cultured endothelial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140869 16104843 184981 7579 3708 FIGF vegf d vegf d 0 1.0 both vegf c and vegf d are produced as a preproprotein with long n and c terminal propeptides flanking the vegf homology domain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140870 16104843 184983 7579 3708 FIGF vegf d vegf d 0 1.0 this activation of vegf c and vegf d by proteolytic cleavage is at least partly regulated by the serine protease plasmin [ 50 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140871 16104843 184985 7579 3708 FIGF vegf d vegf d 0 1.0 in vitro vegf c and vegf d stimulate the migration and mitogenesis of cultured endothelial cells [ 49 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140872 16104843 184988 7579 3708 FIGF vegf d vegf d 0 1.0 less is known of the function of vegf d but stacker et al. [ 53 ] have revealed that vegf d induces the formation of lymphatics within tumours and promotes the metastasis of tumour cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140873 16104843 184990 23910 12680 VEGFA vegf a vegf a 0 1.0 homologues of vegf have also been identified in the genome of the parapoxvirus orf virus [ 54 ] and have been shown to have vegf a like activities. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140874 16104843 184999 23910 12680 VEGFA vegf a vegf a 0 1.0 takahashi et al. [ 61 ] have shown that snakes utilize these venom specific vegfs in addition to vegf a. svvegfs function as dimers and each chain comprises approx. 110 122 amino acid residues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140875 16104843 185006 23910 12680 VEGFA vegf a vegf a 0 1.0 vegfr 1 is a 180 kda high affinity receptor for vegf a vegf b plgf and tf svvegf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140876 16104843 185008 23910 12680 VEGFA vegf a vegf a 0 1.0 the second ig domain of vegfr 1 is the major binding site for vegf a and plgf [ 16 41 67 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140877 16104843 185009 23910 12680 VEGFA vegf a vegf a 0 1.0 vegfr 1 binds vegf a with at least 10 fold higher affinity than vegfr 2 k d =10 30 pm [ 16 ]; however ligand binding results in a maximal 2 fold increase in kinase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140878 16104843 185012 23910 12680 VEGFA vegf a vegf a 0 1.0 vegfr 1 blocking antibodies prevent the migration but not proliferation of huvecs human umbilical vein endothelial cells in response to vegf a indicating the involvement of vegfr 1 in endothelial cell migration [ 68 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140879 16104843 185013 17734 9718 PXN paxillin paxillin 0 1.0 ulate the reorganization of actin via p38 mapk mitogen activated protein kinase whereas vegfr 2 contributes to the re organization of the cytoskeleton by phosphorylating fak focal adhesion kinase and paxillin figure 2 suggesting a different contribution of the two receptors to the chemotactic response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140880 16104843 185015 23910 12680 VEGFA vegf a vegf a 0 1.0 iced form of vegfr 1 that encodes a soluble truncated form of the receptor containing only the first six ig domains has been cloned from a huvec cdna library [ 16 ]. svegfr 1 soluble vegfr 1 inhibits vegf a activity by sequestering vegf a from signalling receptors and by forming non signalling heterodimers with vegfr 2 [ 69 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140881 16104843 185015 23910 12680 VEGFA vegf a vegf a 0 1.0 activity by sequestering vegf a from signalling receptors and by forming non signalling heterodimers with vegfr 2 [ 69 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140882 16104843 185020 23910 12680 VEGFA vegf a vegf a 0 1.0 vegfr 2 is a 200 230 kda high affinity receptor for vegf a k d =75 760 pm vegf e and svvegfs as well as the processed form of vegf c and vegf d. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140883 16104843 185020 7579 3708 FIGF vegf d vegf d 0 1.0 vegfr 2 is a 200 230 kda high affinity receptor for vegf a k d =75 760 pm vegf e and svvegfs as well as the processed form of vegf c and vegf d. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140884 16104843 185021 23910 12680 VEGFA vegf a vegf a 0 1.0 the binding site for vegf a has been mapped to the second and third ig domains [ 74 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140885 16104843 185023 23910 12680 VEGFA vegf a vegf a 0 1.0 tyrosine phosphorylation sites in human vegfr 2 bound to vegf a are tyr and tyr in the kinase insert domain tyr and tyr in the kinase domain and tyr and tyr in the c terminal tail. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140886 16104843 185024 23910 12680 VEGFA vegf a vegf a 0 1.0 among them tyr and tyr are the two major vegf a dependent autophosphorylation sites [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140887 16104843 185025 16737 15917 PLCB1 phospholipase c phospholipase c 0 1.0 tyr creates a binding site for the vegfr associated protein [ 77 ] and tyr creates a binding site for sck [ 78 ] shb [ 79 ] and plc phospholipase c g [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140888 16104843 185026 23910 12680 VEGFA vegf a vegf a 0 1.0 vegfr 2 is the major mediator of the mitogenic angiogenic and permeability enhancing effects of vegf a. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140889 16104843 185030 23910 12680 VEGFA vegf a vegf a 0 1.0 byzova et al. [ 84 ] have reported that the activation of vegfr 2 by vegf a results in the pi3k/akt dependent activation of several integrins leading to enhanced cell adhesion and migration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140890 16104843 185035 7579 3708 FIGF vegf d vegf d 0 1.0 vegfr 3 is a 195 kda high affinity receptor for vegf c and vegf d. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140891 16104843 185040 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 the phosphorylation of vegfr 3 has been shown to lead to a pi3k dependent activation of akt and pkc protein kinase c dependent activation of p42/p44 mapk [ 88 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140892 16104843 185043 23910 12680 VEGFA vegf a vegf a 0 1.0 nrp 1 is a 130 140 kda cell surface glycoprotein first identified as a semaphorin receptor involved in neuronal guidance [ 90 ] and subsequently found as an isoform specific receptor for vegf a [ 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140893 16104843 185043 16830 9103 PLXNB1 semaphorin receptor semaphorin receptor 0 1.0 nrp 1 is a 130 140 kda cell surface glycoprotein first identified as a semaphorin receptor involved in neuronal guidance [ 90 ] and subsequently found as an isoform specific receptor for vegf a [ 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140894 16104843 185043 8338 4281 GJA8 cell surface glycoprotein cell surface glycoprotein 0 1.0 nrp 1 is a 130 140 kda cell surface glycoprotein first identified as a semaphorin receptor involved in neuronal guidance [ 90 ] and subsequently found as an isoform specific receptor for vegf a [ 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140895 16104843 185045 16459 8893 PGF plgf 2 plgf 2 0 1.0 nrp 1 is able to bind vegf 165 vegf b plgf 2 and some vegf e variants whereas nrp 2 can bind vegf 145 vegf 165 plgf 2 and vegf c. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140896 16104843 185047 16833 9106 PLXNC1 plexin plexin 0 1.0 it has been shown that both nrps can join with receptors belonging to the plexin family and such plexin/nrp complexes are able to transduce signals as the physiological receptor of class 3 semaphorins [ 91 92 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140897 16104843 185060 23910 12680 VEGFA vegf a vegf a 0 1.0 in addition a 2 to 3 fold overexpression of vegf a from its endogenous locus results in severe abnormalities in heart development and lethality at embryonic days 12.5 and 14 [ 100 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140898 16104843 185061 23910 12680 VEGFA vegf a vegf a 0 1.0 these results demonstrate the importance of tightly regulating vegf a expression during embryonic development. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140899 16104843 185066 23910 12680 VEGFA vegf a vegf a 0 1.0 takahashi et al. [ 76 ] have shown that tyr and tyr are two major vegf a dependent autophosphorylation sites in vegfr 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140900 16104843 185067 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 however only autophosphorylation of tyr is crucial for vegf dependent endothelial cell proliferation via the plc g /pkc/raf/mek [mapk/erk extracellular signal regulated kinase kinase]/erk pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140901 16104843 185070 23910 12680 VEGFA vegf a vegf a 0 1.0 sphorylation of tyr appears to be required to trigger the sequential activation of cdc42 and p38 mapk and to drive p38 mapk mediated actin remodelling in stress fibres in endothelial cells exposed to vegf a [ 106 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140902 16104843 185071 19050 10436 RPS6KB1 p70 s6k p70 s6k 0 1.0 the activation of the pi3k/p70 s6k s6 kinase pathway by vegfr 2 is also involved in vegf a induced endothelial cell proliferation [ 107 ] figure 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140903 16104843 185071 23910 12680 VEGFA vegf a vegf a 0 1.0 the activation of the pi3k/p70 s6k s6 kinase pathway by vegfr 2 is also involved in vegf a induced endothelial cell proliferation [ 107 ] figure 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140904 16104843 185073 4602 13164 CNBP sterol regulatory element-binding protein sterol regulatory element binding protein 0 1.0 in addition recent studies have revealed various downstream mediators of vegf induced angiogenic signalling such as diacylglycerol kinase a [ 109 ] srf serum response factor [ 110 ] srebp sterol regulatory element binding protein [ 111 ] and iqgap1 [ 112 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140905 16104843 185073 21251 11291 SRF serum response factor serum response factor 0 1.0 in addition recent studies have revealed various downstream mediators of vegf induced angiogenic signalling such as diacylglycerol kinase a [ 109 ] srf serum response factor [ 110 ] srebp sterol regulatory element binding protein [ 111 ] and iqgap1 [ 112 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140906 16104843 185073 5807 2856 DGKQ diacylglycerol kinase diacylglycerol kinase 0 1.0 in addition recent studies have revealed various downstream mediators of vegf induced angiogenic signalling such as diacylglycerol kinase a [ 109 ] srf serum response factor [ 110 ] srebp sterol regulatory element binding protein [ 111 ] and iqgap1 [ 112 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140907 16104843 185075 23871 19964 VASH1 vasohibin vasohibin 0 1.0 vasohibin and dscr1 down syndrome critical region protein 1 are significantly induced by vegf in endothelial cells [ 113 114 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140908 16104843 185078 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a is known to increase the vascular permeability of microvessels to circulating macromolecules [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140909 16104843 185080 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a significantly accumulates in malignant ascites [ 116 ] and pleural effusion [ 117 ] suggesting that it plays a fundamental role in the accumulation of malignant fluid through the enhancement of vascu 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140910 16104843 185081 23910 12680 VEGFA vegf a vegf a 0 1.0 consistent with a role in the regulation of vascular permeability vegf a induces endothelial fenestration in some vascular beds and in cultured adrenal endothelial cells the extravasation of ferritin by way of the vvo vesiculo vacuolar organelle [ 14 ] and disorganization 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140911 16104843 185081 4012 1764 CDH5 ve-cadherin ve cadherin 0 1.0 scular beds and in cultured adrenal endothelial cells the extravasation of ferritin by way of the vvo vesiculo vacuolar organelle [ 14 ] and disorganization of endothelial junctional proteins such as ve cadherin and occludin [ 118 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140912 16104843 185081 14874 8104 OCLN occludin occludin 0 1.0 in cultured adrenal endothelial cells the extravasation of ferritin by way of the vvo vesiculo vacuolar organelle [ 14 ] and disorganization of endothelial junctional proteins such as ve cadherin and occludin [ 118 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140913 16104843 185082 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a increases vascular permeability in mesenteric microvessels by activation of vegfr 2 on endothelial cells and subsequent activation of plc. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140914 16104843 185087 4012 1764 CDH5 ve-cadherin ve cadherin 0 1.0 in addition blockade of src prevents the disassociation of a complex comprising vegfr 2 ve cadherin and b catenin with the same kinetics with which it prevents vegf mediated vascular permeability and oedema [ 120 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140915 16104843 185087 10827 6207 JUP catenin catenin 0 1.0 in addition blockade of src prevents the disassociation of a complex comprising vegfr 2 ve cadherin and b catenin with the same kinetics with which it prevents vegf mediated vascular permeability and oedema [ 120 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140916 16104843 185089 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a can induce production of no and endogenous no can increase vascular permeability [ 121 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140917 16104843 185095 23910 12680 VEGFA vegf a vegf a 0 1.0 numerous studies have established vegf a as a key angiogenic player in cancer. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140918 16104843 185096 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a is expressed in most tumours and its expression correlates with tumour progression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140919 16104843 185097 23910 12680 VEGFA vegf a vegf a 0 1.0 in addition to tumour cells tumour associated stroma is also an important source of vegf a [ 127 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140920 16104843 185099 23910 12680 VEGFA vegf a vegf a 0 1.0 the expression of vegf a mrna is highest in hypoxic tumour cells adjacent to necrotic areas [ 16 ] indicating that the induction of vegf a by hypoxia in growing tumours can change the balance of inhibitors and activators of angiogenesis leading to the growth of new blood vessels into tumour. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140921 16104843 185104 11333 5176 KRR1 rip 1 rip1 0 1.0 rip1 tag2 t antigen 2 mice develop islet tumours of the pancreas by 12 14 weeks of age as a result of expression of the sv40 tag oncogene in insulin producing b cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140922 16104843 185104 10601 6081 INS insulin insulin 0 1.0 rip1 tag2 t antigen 2 mice develop islet tumours of the pancreas by 12 14 weeks of age as a result of expression of the sv40 tag oncogene in insulin producing b cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140923 16104843 185106 11333 5176 KRR1 rip 1 rip1 0 1.0 vegf a and vegfrs are constitutively expressed in the islet vasculature before and after the initiation of angiogenesis angiogenic switch [ 133 ]; however when vegf a is absent from islet b cells of rip1 tag2 mice both angiogenic switching and carcinogenesis as well as tumour growth are severely disrupted [ 134 ] indicating that vegf a plays a critical role in angiogenic switching and carcinogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140924 16104843 185106 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a and vegfrs are constitutively expressed in the islet vasculature before and after the initiation of angiogenesis angiogenic switch [ 133 ]; however when vegf a is absent from islet b cells of rip1 tag2 mice both angiogenic switching and carcinogenesis as well as tumour growth are severely disrupted [ 134 ] indicating that vegf a plays a critical role in ang 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140925 16104843 185106 23910 12680 VEGFA vegf a vegf a 0 1.0 is absent from islet b cells of rip1 tag2 mice both angiogenic switching and carcinogenesis as well as tumour growth are severely disrupted [ 134 ] indicating that vegf a plays a critical role in angiogenic switching and carcinogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140926 16104843 185107 23910 12680 VEGFA vegf a vegf a 0 1.0 bergers et al. [ 135 ] have revealed that mmp matrix metalloproteinase 9 is also a component of the angiogenic switch as this proteinase makes vegf a available for the interaction with its receptors by releasing sequestered vegf a. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140927 16104843 185107 23910 12680 VEGFA vegf a vegf a 0 1.0 available for the interaction with its receptors by releasing sequestered vegf a. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140928 16104843 185107 13327 7176 MMP9 matrix metalloproteinase 9 matrix metalloproteinase 9 0 1.0 bergers et al. [ 135 ] have revealed that mmp matrix metalloproteinase 9 is also a component of the angiogenic switch as this proteinase makes vegf a available for the interaction with its receptors by releasing sequestered vegf a. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140929 16104843 185108 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a impairs the endothelial barrier by disrupting a ve cadherin/ b catenin complex via the activation of src and facilitates tumour cell extravasation and metastasis [ 136 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140930 16104843 185108 4012 1764 CDH5 ve-cadherin ve cadherin 0 1.0 vegf a impairs the endothelial barrier by disrupting a ve cadherin/ b catenin complex via the activation of src and facilitates tumour cell extravasation and metastasis [ 136 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140931 16104843 185108 10827 6207 JUP catenin catenin 0 1.0 vegf a impairs the endothelial barrier by disrupting a ve cadherin/ b catenin complex via the activation of src and facilitates tumour cell extravasation and metastasis [ 136 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140932 16104843 185109 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a also induces the disruption of hepatocellular tight junctions which may promote tumour invasion [ 137 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140933 16104843 185111 13327 7176 MMP9 mmp 9 mmp 9 0 1.0 hiratsuka et al. [ 138 ] have shown that vegfr 1 signalling is also involved in tumour metastasis being linked to the induction of mmp 9 in lung endothelial cells and to the facilitation of lung specific metastasis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140934 16104843 185119 23910 12680 VEGFA vegf a vegf a 0 1.0 transgenic mice that overexpress vegf a specifically in the epidermis exhibit an increased density of tortuous cutaneous blood capillaries as well as highly increased leucocyte rolling and adhesion in postcapillary skin venules suggesting 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140935 16104843 185119 23910 12680 VEGFA vegf a vegf a 0 1.0 is exhibit an increased density of tortuous cutaneous blood capillaries as well as highly increased leucocyte rolling and adhesion in postcapillary skin venules suggesting that enhanced expression of vegf a in epidermal keratinocytes is sufficient to develop psoriasis like inflammatory skin lesions [ 143 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140936 16104843 185120 23910 12680 VEGFA vegf a vegf a 0 1.0 moreover heterozygous vegf a transgenic mice which do not spontaneously develop inflammatory skin lesions are unable to down regulate experimentally induced inflammation and exhibit a psoriasis like phenotype characterized by ep 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140937 16104843 185121 16459 8893 PGF plgf 2 plgf 2 0 1.0 transgenic overexpression of plgf 2 in epidermal keratinocytes also results in a significantly increased inflammatory response whereas a deficiency of plgf results in a diminished and abbreviated inflammatory response [ 145 ] suggestin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140938 16104843 185122 23910 12680 VEGFA vegf a vegf a 0 1.0 local production of vegf a in arthritic synovial tissue has been documented [ 16 ] and appears to correlate with disease activity in humans. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140939 16104843 185123 23910 12680 VEGFA vegf a vegf a 0 1.0 subsequently vegf a has been shown to be important in the pathogenesis of ra rheumatoid arthritis in animal models [ 146 148 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140940 16104843 185127 23910 12680 VEGFA vegf a vegf a 0 1.0 exaggerated levels of vegf a have been detected in tissues and biological samples from people with asthma where these levels correlate directly with disease [ 149 ] and inversely with airway function [ 150 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140941 16104843 185129 23910 12680 VEGFA vegf a vegf a 0 1.0 a recent study using lung targeted vegf 165 transgenic mice has revealed a novel function of vegf a in allergic responses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140942 16104843 185130 23910 12680 VEGFA vegf a vegf a 0 1.0 in these mice vegf a induces asthma like inflammation airway and vascular remodelling and airway hyper responsiveness. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140943 16104843 185131 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a also enhances respiratory sensitization to antigen as well as t h 2 t helper type 2 cell mediated inflammation and increases the number of activated dendritic cells [ 151 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140944 16104843 185132 23910 12680 VEGFA vegf a vegf a 0 1.0 thus vegf a has a critical role in pulmonary t h 2 inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140945 16104843 185133 23910 12680 VEGFA vegf a vegf a 0 1.0 other studies have provided evidence for a role for vegf a as a pro inflammatory mediator in allograft rejection [ 152 ] and neointimal formation [ 153 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140946 16104843 185135 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a mrna expression not normally found in the adult mouse brain is up regulated after cerebral ischaemia and elevated vegf a levels can be detected as early as 3 h after stroke with a peak between 12 and 48 h [ 154 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140947 16104843 185136 23910 12680 VEGFA vegf a vegf a 0 1.0 previous studies have demonstrated that the antagonism of vegf a results in reduced oedema and tissue damage after ischaemia implicating vegf a in the pathophysiology of stroke [ 155 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140948 16104843 185137 23910 12680 VEGFA vegf a vegf a 0 1.0 paul et al. [ 156 ] have reported that src mice are resistant to vegf a induced vascular permeability and show decreased infarct volumes after stroke. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140949 16104843 185138 23910 12680 VEGFA vegf a vegf a 0 1.0 systemic application of a src inhibitor suppresses vascular permeability protecting wild type mice from ischaemia induced brain damage without influencing vegf a expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140950 16104843 185139 23910 12680 VEGFA vegf a vegf a 0 1.0 however sun et al. [ 157 ] have reported that intracerebroventricular administration of vegf a reduces infarct size improves neurological performance and enhances the delayed survival of newborn neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140951 16104843 185140 23910 12680 VEGFA vegf a vegf a 0 1.0 these conflicting results appear to reflect dual roles of vegf a in stroke: neuroprotective and pro inflammatory effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140952 16104843 185141 23910 12680 VEGFA vegf a vegf a 0 1.0 in this context when infused through the internal carotid artery low and intermediate doses of vegf a significantly promote neuroprotection of the ischaemic brain whereas a high dose of vegf a offers no neuroprotection to the ischaemic brain or the damaged neurons of normal brain [ 158 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140953 16104843 185142 23910 12680 VEGFA vegf a vegf a 0 1.0 further studies are required for the therapeutic application of vegf a against stroke. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140954 16104843 185149 23910 12680 VEGFA vegf a vegf a 0 1.0 a subsequent study has revealed that vegf a is a modifier associated with motor neuron degeneration in human als and in a mouse model of als [ 162 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140955 16104843 185150 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a treatment increases the life expectancy of als mice without causing toxic side effects [ 163 164 ] indicating that vegf a has neuroprotective effects on motor neurons and treatment with vegf a could be one of the most effective therapies for als reported so far. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140956 16104843 185152 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 the activation of vegfr 1 results in the paracrine release of hgf hepatocyte growth factor il 6 interleukin 6 and other hepatotrophic molecules by lsecs to the extent that hepatocytes are stimulated to proliferate when co cultured with lsecs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140957 16104843 185152 9207 4893 HGF hepatocyte growth factor hepatocyte growth factor 0 1.0 the activation of vegfr 1 results in the paracrine release of hgf hepatocyte growth factor il 6 interleukin 6 and other hepatotrophic molecules by lsecs to the extent that hepatocytes are stimulated to proliferate when co cultured with lsecs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140958 16104843 185152 10463 6018 IL6 il 6 il 6 0 1.0 the activation of vegfr 1 results in the paracrine release of hgf hepatocyte growth factor il 6 interleukin 6 and other hepatotrophic molecules by lsecs to the extent that hepatocytes are stimulated to proliferate when co cultured with lsecs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140959 16104843 185153 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a has no direct mitogenic effect on hepatocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140960 16104843 185169 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 key words: angiogenesis inflammation signal transduction tumour vascular endothelial growth factor vegf vascular permeability. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140961 16104843 185170 16737 15917 PLCB1 phospholipase c phospholipase c 0 1.0 d binding protein interacting protein 2; pdk1 phosphoinositide dependent kinase 1; pi3k phosphoinositide 3 kinase; pilsap puromycin intensive leucyl specific aminopeptidase; pkc protein kinase c; plc phospholipase c; plgf placenta growth factor; pvhl von hippel lindau tumour suppressor protein; ra rheumatoid arthritis; rtk receptor tyrosine kinase; s6k s6 kinase; tag t antigen; t h 2 t helper type 2; utr untrans 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140962 16104843 185170 9230 4910 HIF1A hypoxia-inducible factor 1 hypoxia inducible factor 1 0 1.0 abbreviations: als amyotrophic lateral sclerosis; dscr1 down syndrome critical region protein 1; ecm extracellular matrix; erk extracellular signal regulated kinase; fak focal adhesion kinase; hif 1 hypoxia inducible factor 1; hre hypoxia response element; huvec human umbilical vein endothelial cell; lsec liver sinusoidal endothelial cell; mab monoclonal antibody; mapk mitogen activated protein kinase; mmp matrix metallop 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140963 16104843 185170 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 n; paip2 polyadenylated binding protein interacting protein 2; pdk1 phosphoinositide dependent kinase 1; pi3k phosphoinositide 3 kinase; pilsap puromycin intensive leucyl specific aminopeptidase; pkc protein kinase c; plc phospholipase c; plgf placenta growth factor; pvhl von hippel lindau tumour suppressor protein; ra rheumatoid arthritis; rtk receptor tyrosine kinase; s6k s6 kinase; tag t antigen; t h 2 t helpe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140964 16104843 185170 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 abbreviations: als amyotrophic lateral sclerosis; dscr1 down syndrome critical region protein 1; ecm extracellular matrix; erk extracellular signal regulated kinase; fak focal adhesion kinase; hif 1 hypoxia inducible factor 1; hre hypoxia response element; huvec human umbilical vein endothelial cell; lsec liver sinusoidal endothelial cell; mab monoclonal antibod 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140965 16104843 185170 19746 18420 SETD2 hif 1 hif 1 0 1.0 abbreviations: als amyotrophic lateral sclerosis; dscr1 down syndrome critical region protein 1; ecm extracellular matrix; erk extracellular signal regulated kinase; fak focal adhesion kinase; hif 1 hypoxia inducible factor 1; hre hypoxia response element; huvec human umbilical vein endothelial cell; lsec liver sinusoidal endothelial cell; mab monoclonal antibody; mapk mitogen activated protein 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140966 16104843 185170 16459 8893 PGF placenta growth factor placenta growth factor 0 1.0 racting protein 2; pdk1 phosphoinositide dependent kinase 1; pi3k phosphoinositide 3 kinase; pilsap puromycin intensive leucyl specific aminopeptidase; pkc protein kinase c; plc phospholipase c; plgf placenta growth factor; pvhl von hippel lindau tumour suppressor protein; ra rheumatoid arthritis; rtk receptor tyrosine kinase; s6k s6 kinase; tag t antigen; t h 2 t helper type 2; utr untranslated region; vegf vascular e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140967 16104843 185170 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 wth factor; pvhl von hippel lindau tumour suppressor protein; ra rheumatoid arthritis; rtk receptor tyrosine kinase; s6k s6 kinase; tag t antigen; t h 2 t helper type 2; utr untranslated region; vegf vascular endothelial growth factor; vegfr vegf receptor; svegfr 1 soluble vegfr 1; svvegf snake venom vegf; tf svvegf trimeresurus flavoviridis svvegf; vpf vascular permeability factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140968 16104843 185170 23910 12680 VEGFA vascular permeability factor vascular permeability factor 0 1.0 elper type 2; utr untranslated region; vegf vascular endothelial growth factor; vegfr vegf receptor; svegfr 1 soluble vegfr 1; svvegf snake venom vegf; tf svvegf trimeresurus flavoviridis svvegf; vpf vascular permeability factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140969 16104843 185172 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 the vegf vascular endothelial growth factor family and its receptors are essential regulators of angiogenesis and vascular permeability. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140970 16104843 185173 23910 12680 VEGFA vegf a vegf a 0 1.0 currently the vegf family consists of vegf a plgf placenta growth factor vegf b vegf c vegf d vegf e and snake venom vegf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140971 16104843 185173 7579 3708 FIGF vegf d vegf d 0 1.0 currently the vegf family consists of vegf a plgf placenta growth factor vegf b vegf c vegf d vegf e and snake venom vegf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140972 16104843 185173 16459 8893 PGF placenta growth factor placenta growth factor 0 1.0 currently the vegf family consists of vegf a plgf placenta growth factor vegf b vegf c vegf d vegf e and snake venom vegf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140973 16104843 185174 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a has at least nine subtypes due to the alternative splicing of a single gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140974 16104843 185176 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a binds to and activates two tyrosine kinase receptors vegfr vegf receptor 1 and vegfr 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140975 16104843 185178 23910 12680 VEGFA vegf a vegf a 0 1.0 in solid tumours vegf a and its receptor are involved in carcinogenesis invasion and distant metastasis as well as tumour angiogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140976 16104843 185179 23910 12680 VEGFA vegf a vegf a 0 1.0 vegf a also has a neuroprotective effect on hypoxic motor neurons and is a modifier of als amyotrophic lateral sclerosis . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140977 16104843 185181 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 0.0 vascular endothelial growth factor a|receptors vascular endothelial growth factor| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 140978 16104843 185181 23910 12680 VEGFA vascular endothelial growth factor a vascular endothelial growth factor a 0 1.0 vascular endothelial growth factor a|receptors vascular endothelial growth factor| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142376 16120782 186872 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 because peroxisome proliferator activated receptor gamma ppar gamma agonists act as potent anti inflammatory drugs we tested whether superoxide dismutase sod1 g93a transgenic mice a mouse model of als benefit from oral treatment with the ppar gamma agonist pioglitazo 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142377 16120782 186872 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 agonists act as potent anti inflammatory drugs we tested whether superoxide dismutase sod1 g93a transgenic mice a mouse model of als benefit from oral treatment with the ppar gamma agonist pioglitazone pio . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142378 16120782 186872 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 because peroxisome proliferator activated receptor gamma ppar gamma agonists act as potent anti inflammatory drugs we tested whether superoxide dismutase sod1 g93a transgenic mice a mouse model of als benefit from oral treatment with the ppar gamma agonist 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142379 16120782 186872 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 because peroxisome proliferator activated receptor gamma ppar gamma agonists act as potent anti inflammatory drugs we tested whether superoxide dismutase sod1 g93a transgenic mice a mouse model of als benefit from oral treatment with the ppar gamma agonist pioglitazone pio . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142380 16120782 186876 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 activated microglia were significantly reduced at sites of neurodegeneration in pio treated sod1 g93a mice as were the protein levels of cyclooxygenase 2 and inducible nitric oxide synthase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142381 16120782 186877 4413 1984 CISH suppressor of cytokine signaling suppressor of cytokine signaling 0 0.0 interestingly mrna levels of the suppressor of cytokine signaling 1 and 3 genes were increased by pio whereas both the mrna and protein levels of endogenous mouse sod1 and of transgenic human sod1 remained unaffected. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142382 16120782 186877 20987 19383 SOCS1 suppressor of cytokine signaling 1 suppressor of cytokine signaling 1 0 1.0 interestingly mrna levels of the suppressor of cytokine signaling 1 and 3 genes were increased by pio whereas both the mrna and protein levels of endogenous mouse sod1 and of transgenic human sod1 remained unaffected. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142383 16120782 186879 10601 6081 INS insulin insulin 0 1.0 peroxisome proliferator activated receptor gamma ppar gamma ligands were developed as oral antidiabetic drugs after the discovery that ppar gamma activation increases insulin sensitivity and normalizes serum glucose levels berger and moller 2002 gamma activators of the thiazolidinedione tzd class of antidiabetic drugs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142384 16120782 186879 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 peroxisome proliferator activated receptor gamma ppar gamma ligands were developed as oral antidiabetic drugs after the discovery that ppar gamma activation increases insulin sensitivity and normalizes serum glucose levels berger and moller 2002 gamma activators of the thiazolidinedione tzd class of antidiabetic drugs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142385 16120782 186879 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 peroxisome proliferator activated receptor gamma ppar gamma ligands were developed as oral antidiabetic drugs after the discovery that ppar gamma activation increases insulin sensitivity and normalizes serum glucose levels berger and moller 2002 ga 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142386 16120782 186880 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 beyond their insulin sensitizing and other metabolic actions ppar gamma ligands exert several other ppar gamma dependent and independent antineoplastic and anti inflammatory effects daynes and jones 2002 ; blanquart et al. 2003 ; grommes et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142387 16120782 186880 10601 6081 INS insulin insulin 0 1.0 beyond their insulin sensitizing and other metabolic actions ppar gamma ligands exert several other ppar gamma dependent and independent antineoplastic and anti inflammatory effects daynes and jones 2002 ; blanquart et a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142388 16120782 186883 17610 9605 PTGS2 cox 2 cox 2 0 1.0 feature of als is the loss of motor neurons talbot 2002 which is accompanied by a robust glial response including activation of microglia and astrocytes as well as the expression of cyclooxygenase 2 cox 2 and nitric oxide synthase inos in the spinal cord phul et al. 2000 ; almer et al. 2001 ; yasojima et al. 2001 ; barbeito et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142389 16120782 186883 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 f als is the loss of motor neurons talbot 2002 which is accompanied by a robust glial response including activation of microglia and astrocytes as well as the expression of cyclooxygenase 2 cox 2 and nitric oxide synthase inos in the spinal cord phul et al. 2000 ; almer et al. 2001 ; yasojima et al. 2001 ; barbeito et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142390 16120782 186884 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 both pathologies motor neuron loss and neuroinflammation can be found in transgenic mice overexpressing mutant variants of the human gene encoding for copper/zinc superoxide dismutase sod1 which have been linked to inherited als gurney et al. 1994 ; hensley et al. 2002 ; yoshihara et al. 2002 ; kunst 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142391 16120782 186886 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 in microglia and macrophages ppar gamma activation results in inhibition of proinflammatory gene expression through various mechanisms landreth and heneka 2001 gamma agonists reduce amyloid beta peptide and cytokine mediated neuroinflammat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142392 16120782 186887 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 given the beneficial effects observed in these studies we tested whether an oral treatment of sod1 transgenic mice with the ppar gamma agonist pioglitazone would reduce neuroinflammation protect from motor neuron loss and improve clinical als symptoms. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142393 16120782 186937 17610 9605 PTGS2 cox 2 cox 2 0 1.0 for the analysis of inos and cox 2 100 microg of protein samples was separated in 10% sds gels transferred onto immobilon p polyvinylidene difluoride membranes and stained with a polyclonal inos antibody at 1:500 dilution rabbit polyc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142394 16120782 186937 17610 9605 PTGS2 cox 2 cox 2 0 1.0 difluoride membranes and stained with a polyclonal inos antibody at 1:500 dilution rabbit polyclonal antibody to c terminus of murine inos; santa cruz biotechology heidelberg germany or a polyclonal cox 2 antibody at a 1:600 dilution rabbit polyclonal antibody to synthetic peptide from murine cox 2; cayman ann arbor mi . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142395 16120782 186937 17610 9605 PTGS2 cox 2 cox 2 0 1.0 antibody at a 1:600 dilution rabbit polyclonal antibody to synthetic peptide from murine cox 2; cayman ann arbor mi . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142396 16120782 186938 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the specificities of the inos and cox 2 antibodies have been confirmed by positive controls containing inos or cox 2 protein data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142397 16120782 186943 211 132 ACTB beta actin beta actin 0 1.0 afterward the blots were stripped and stained with a monoclonal anti beta actin antibody at 1:10 000 dilution sigma aldrich taufkirchen germany . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142398 16120782 186946 20987 19383 SOCS1 socs 1 socs 1 0 1.0 the primers were the following: suppressor of cytokine signaling socs 1 forward 5' agc agc tcg aaa agg cag tc 3' and reverse 5' aca ctc act tcc gca cct tc 3'; socs 3 forward 5' acc agc gcc act tct tca cg 3' and reverse 5' gtg gag cat cat act gat cc 3'; mouse sod1 forward 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142399 16120782 186946 20991 19391 SOCS3 socs 3 socs 3 0 1.0 the primers were the following: suppressor of cytokine signaling socs 1 forward 5' agc agc tcg aaa agg cag tc 3' and reverse 5' aca ctc act tcc gca cct tc 3'; socs 3 forward 5' acc agc gcc act tct tca cg 3' and reverse 5' gtg gag cat cat act gat cc 3'; mouse sod1 forward 5' gtc cgt cgg ctt ctc gtc t 3' and reverse 5' cac aac tgg ttc acc gct tg 3'; human sod1 forw 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142400 16120782 186946 4413 1984 CISH suppressor of cytokine signaling suppressor of cytokine signaling 0 1.0 the primers were the following: suppressor of cytokine signaling socs 1 forward 5' agc agc tcg aaa agg cag tc 3' and reverse 5' aca ctc act tcc gca cct tc 3'; socs 3 forward 5' acc agc gcc act tct tca cg 3' and reverse 5' gtg gag cat cat act gat cc 3'; mouse sod1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142401 16120782 186947 20987 19383 SOCS1 socs 1 socs 1 0 1.0 glyceraldehyde 3 phosphate dehydrogenase forward 5' tca cca ggg ctg cca ttt gc 3' and reverse 5' gac tcc acg aca tac tca gc 3' were used as housekeeping control for socs 1 and 3; beta actin forward 5' cac agc ttc ttt gca gct cct t 3' and reverse 5' tca gga tac ctc tct tgc tct gg 3' were used as housekeeping control for mouse and human sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142402 16120782 186947 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 glyceraldehyde 3 phosphate dehydrogenase forward 5' tca cca ggg ctg cca ttt gc 3' and reverse 5' gac tcc acg aca tac tca gc 3' were used as housekeeping control for socs 1 and 3; beta actin forward 5' cac agc ttc ttt gca gct cct t 3' and re 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142403 16120782 186947 211 132 ACTB beta actin beta actin 0 1.0 glyceraldehyde 3 phosphate dehydrogenase forward 5' tca cca ggg ctg cca ttt gc 3' and reverse 5' gac tcc acg aca tac tca gc 3' were used as housekeeping control for socs 1 and 3; beta actin forward 5' cac agc ttc ttt gca gct cct t 3' and reverse 5' tca gga tac ctc tct tgc tct gg 3' were used as housekeeping control for mouse and human sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142404 16120782 186957 211 132 ACTB beta actin beta actin 0 1.0 for the calculation of the relative abundancies of mouse and human sod1 transcripts the differences in c t between beta actin and sod1 were determined and expressed as x fold difference from beta actin expression using the following equation: 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142405 16120782 186977 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 ppar gamma ligands suppress microglial activation thereby protecting neurons from inflammation mediated cell death heneka et al. 1999 ~50%. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142406 16120782 186978 17610 9605 PTGS2 cox 2 cox 2 0 1.0 coinduction of cox 2 and inos were described in several neurodegenerative disorders including als as well as in the sod1 g93a model used in this study almer et al. 1999 2001 ; sasaki et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142407 16120782 186979 17610 9605 PTGS2 cox 2 cox 2 0 1.0 western blot analysis of lumbar spinal cord lysates from 90 d old mice confirmed cox 2 expression in wild type mice n = 4 and revealed that sod1 g93a mice n = 4 showed elevated cox 2 levels fig 3 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142408 16120782 186981 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in both cases pio treatment significantly decreased cox 2 and inos expression in sod1 g93a mice n = 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142409 16120782 186982 20987 19383 SOCS1 socs 1 socs 1 0 1.0 notably this reduction was paralleled by a marked transcriptional upregulation of anti inflammatory socs 1 and socs 3 genes fig 3 c in both pio treated groups n = 5 for all groups . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142410 16120782 186982 20991 19391 SOCS3 socs 3 socs 3 0 1.0 notably this reduction was paralleled by a marked transcriptional upregulation of anti inflammatory socs 1 and socs 3 genes fig 3 c in both pio treated groups n = 5 for all groups . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142411 16120782 186987 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 ppar gamma and neuroinflammation 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142412 16120782 186989 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 originally developed as oral antidiabetics agonists of ppar gamma have been found to exert potent anti inflammatory effects in several models of neuroinflammation landreth and heneka 2001 gamma mediated reduction of inflammation was neuroprotective we hypothesized 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142413 16120782 186989 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 s of neuroinflammation landreth and heneka 2001 gamma mediated reduction of inflammation was neuroprotective we hypothesized that sod1 g93a transgenic mice would benefit from chronic treatment with a ppar gamma agonist within the thiazolidinedione class of ppar gamma agonists pio is the only substance that penetrates the blood brain barrier to a significant extent maeshiba et al. 1997 and has therefore been 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142414 16120782 186989 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 agonist within the thiazolidinedione class of ppar gamma agonists pio is the only substance that penetrates the blood brain barrier to a significant extent maeshiba et al. 1997 and has therefore been chosen for treatment experiments. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142415 16120782 186990 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 our results strongly suggest that pio mediated suppression of inflammation may offer a new therapeutic avenue in als treatment as supported by previous findings in animal models of multiple sclerosis niino et al. 2001 ; feinstein et al. 2002 ; natarajan et al. 2003 parkinson's disease breidert et al. 2002 and stroke sundararajan et al. 2005 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 142416 16120782 186991 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 ppar gamma and microglial activation 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142417 16120782 187007 20987 19383 SOCS1 socs 1 socs 1 0 1.0 nos western blots n = 4 for all groups from spinal cord samples derived from 90 d old mice b are shown. p _lt_ 0.01 and p _lt_ 0.001 compared with the respective nontreated group. c quantification of socs 1 and socs 3 mrna levels in the spinal cord at day 90 of life n = 5 for all groups . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142418 16120782 187007 20991 19391 SOCS3 socs 3 socs 3 0 1.0 blots n = 4 for all groups from spinal cord samples derived from 90 d old mice b are shown. p _lt_ 0.01 and p _lt_ 0.001 compared with the respective nontreated group. c quantification of socs 1 and socs 3 mrna levels in the spinal cord at day 90 of life n = 5 for all groups . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142419 16120782 187007 17610 9605 PTGS2 cox 2 cox 2 0 1.0 quantification of microglia at day 90 of life bottom right; n = 4 for wt and wt pio; n = 5 for sod1 and sod1 pio and of cox 2 and inos western blots n = 4 for all groups from spinal cord samples derived from 90 d old mice b are shown. p _lt_ 0.01 and p _lt_ 0.001 compared with the respective nontreated group. c quantificati 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142420 16120782 187018 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 ppar gamma mediated inhibition of inflammatory mediators 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142421 16120782 187019 17610 9605 PTGS2 cox 2 cox 2 0 1.0 we found a marked reduction in the expression of cox 2 and inos two major proinflammatory enzymes after pio treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142422 16120782 187020 17610 9605 PTGS2 cox 2 cox 2 0 1.0 coinduction of both enzymes by several factors including glutamate release and secretion of proinflammatory cytokines may be caused by similar or identical stimulators o'banion 1999 because the cox 2 and inos promoters share several binding sites for signal transduction factors involved in inflammatory signal cascades xie et al. 1993 ; nathan and xie 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142423 16120782 187021 17610 9605 PTGS2 cox 2 cox 2 0 1.0 apart from the detrimental action of either inos derived excess no or cox 2 generated proinflammatory prostanoids the dual inhibition of both enzymes observed in response to pio treatment may be advantageous because both pathways mutually increase their pathogenicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142424 16120782 187022 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus no may increase the catalytic activity of cox 2 thereby increasing the production of proinflammatory prostanoids nogawa et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142425 16120782 187024 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 ppar gamma mediated activation of anti inflammatory genes 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142426 16120782 187025 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 several ppar gamma dependent and independent anti inflammatory actions of the tzd class of drugs have been described and suppression of inflammation may be achieved not at a single but at multiple levels including dire 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142427 16120782 187026 20987 19383 SOCS1 socs 1 socs 1 0 1.0 interestingly socs 1 and socs 3 have been reported to increase in response to tzds in microglia and astrocytes in vitro which in turn inhibit janus kinase signal transducer and activator of transcription jak stat inflamm 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142428 16120782 187026 20991 19391 SOCS3 socs 3 socs 3 0 1.0 interestingly socs 1 and socs 3 have been reported to increase in response to tzds in microglia and astrocytes in vitro which in turn inhibit janus kinase signal transducer and activator of transcription jak stat inflammatory signa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142429 16120782 187027 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the latter signal transduction pathway is also involved in the inos and cox 2 gene regulation after inflammatory stimulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142430 16120782 187028 20987 19383 SOCS1 socs 1 socs 1 0 1.0 because the ability of socs 1 and socs 3 to suppress cytokine stimulation has also been confirmed by in vivo experiments using knock out mice shouda et al. 2001 ; suzuki et al. 2001 it seems likely that upregulation of socs 1 and 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142431 16120782 187028 20987 19383 SOCS1 socs 1 socs 1 0 1.0 and socs 3 to suppress cytokine stimulation has also been confirmed by in vivo experiments using knock out mice shouda et al. 2001 ; suzuki et al. 2001 it seems likely that upregulation of socs 1 and socs 3 levels in response to pio treatment reflects one mechanism of the anti inflammatory effect observed and antagonizing the jak stat pathway contributes to the observed suppression of inos an 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142432 16120782 187028 20991 19391 SOCS3 socs 3 socs 3 0 1.0 because the ability of socs 1 and socs 3 to suppress cytokine stimulation has also been confirmed by in vivo experiments using knock out mice shouda et al. 2001 ; suzuki et al. 2001 it seems likely that upregulation of socs 1 and socs 3 lev 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142433 16120782 187028 20991 19391 SOCS3 socs 3 socs 3 0 1.0 to suppress cytokine stimulation has also been confirmed by in vivo experiments using knock out mice shouda et al. 2001 ; suzuki et al. 2001 it seems likely that upregulation of socs 1 and socs 3 levels in response to pio treatment reflects one mechanism of the anti inflammatory effect observed and antagonizing the jak stat pathway contributes to the observed suppression of inos and cox 2 exp 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142434 16120782 187028 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nd socs 3 levels in response to pio treatment reflects one mechanism of the anti inflammatory effect observed and antagonizing the jak stat pathway contributes to the observed suppression of inos and cox 2 expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142435 16120782 187030 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 the principal clinical usage of ppar gamma agonists is for treatment of type ii diabetes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142436 16120782 187031 10601 6081 INS insulin insulin 0 1.0 the drugs act to enhance insulin sensitivity and normalize blood glucose levels patsouris et al. 2004 gamma in enhancing muscle strength and preserving neuronal integrity and function might also arise from improved glucose utilizati 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142437 16120782 187032 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 it has been shown recently that ppar gamma agonist treatment leads to an upregulation of cu/zn sod1 expression in a rat model of ischemia shimazu et al. 2005 suggesting that enhanced sod1 levels may be protective by reducing oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142438 16120782 187038 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 sing an early anti inflammatory treatment strategy initiated well before the first onset of clinical symptoms does not allow us to conclude that patients suffering from sporadic als will benefit from ppar gamma agonist treatment if initiated after clinical onset of disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142439 16120782 187039 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 however it seems possible that in the case of familiar als family members with an inherited als risk which can be diagnosed before the appearance of clinical symptoms may benefit from prophylactic ppar gamma agonist medication. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131189 16179515 172942 20017 10940 SLC1A2 excitatory amino acid transporter 2 excitatory amino acid transporter 2 0 1.0 however it did upregulate 3 genes unaffected by the presence of the g93a/sod1 mutation: glial fibrillary acidic protein gfap stroma derived factor 1 sdf 1 and excitatory amino acid transporter 2 eaat2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131190 16179515 172942 20339 13448 SLC38A2 amino acid transporter 2 amino acid transporter 2 0 0.0 however it did upregulate 3 genes unaffected by the presence of the g93a/sod1 mutation: glial fibrillary acidic protein gfap stroma derived factor 1 sdf 1 and excitatory amino acid transporter 2 eaat2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131191 16179515 172942 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 however it did upregulate 3 genes unaffected by the presence of the g93a/sod1 mutation: glial fibrillary acidic protein gfap stroma derived factor 1 sdf 1 and excitatory amino acid transporter 2 eaat2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131192 16179515 172945 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 baicalein treatment also downregulated tumor necrosis factor receptor tnfrp55 and upregulated noninducible nitric oxide synthase nnos and glutamine synthase gs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131193 16179515 172945 3889 11919 CD40 tumor necrosis factor receptor tumor necrosis factor receptor 0 1.0 baicalein treatment also downregulated tumor necrosis factor receptor tnfrp55 and upregulated noninducible nitric oxide synthase nnos and glutamine synthase gs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131194 16179515 172945 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 baicalein treatment also downregulated tumor necrosis factor receptor tnfrp55 and upregulated noninducible nitric oxide synthase nnos and glutamine synthase gs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128754 16380619 169457 10463 6018 IL6 il 6 il 6 0 1.0 abnormal levels of interleukin il 6 were described in patients with als related to an inflammatory process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128755 16380619 169458 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the authors compared il 6 and tumor necrosis factor alpha tnf alpha levels in csf and sera from 10 hypoxemics and 10 normoxemics patients with als to those of 10 hypoxemics and 10 normoxemics neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128756 16380619 169458 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 the authors compared il 6 and tumor necrosis factor alpha tnf alpha levels in csf and sera from 10 hypoxemics and 10 normoxemics patients with als to those of 10 hypoxemics and 10 normoxemics neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128757 16380619 169458 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 the authors compared il 6 and tumor necrosis factor alpha tnf alpha levels in csf and sera from 10 hypoxemics and 10 normoxemics patients with als to those of 10 hypoxemics and 10 normoxemics neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128758 16380619 169458 10463 6018 IL6 il 6 il 6 0 1.0 the authors compared il 6 and tumor necrosis factor alpha tnf alpha levels in csf and sera from 10 hypoxemics and 10 normoxemics patients with als to those of 10 hypoxemics and 10 normoxemics neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128759 16380619 169460 10463 6018 IL6 il 6 il 6 0 1.0 elevated il 6 levels in als could correspond to a normal response to hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128760 16380619 169463 22551 11892 TNF tnf alpha tnf alpha 0 1.0 an excessive production of tumor necrosis factor alpha tnf alpha with lower csf levels of interleukin il 6 was demonstrated in a sod 1 mouse model suggesting an increase cytotoxic potential of microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128761 16380619 169463 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 an excessive production of tumor necrosis factor alpha tnf alpha with lower csf levels of interleukin il 6 was demonstrated in a sod 1 mouse model suggesting an increase cytotoxic potential of microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128762 16380619 169463 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 an excessive production of tumor necrosis factor alpha tnf alpha with lower csf levels of interleukin il 6 was demonstrated in a sod 1 mouse model suggesting an increase cytotoxic potential of microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128763 16380619 169463 10463 6018 IL6 il 6 il 6 0 1.0 an excessive production of tumor necrosis factor alpha tnf alpha with lower csf levels of interleukin il 6 was demonstrated in a sod 1 mouse model suggesting an increase cytotoxic potential of microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128764 16380619 169465 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha could act as a principal driver for neuroinflammation because its receptors are elevated in the presymptomatic phases of the disease while several costimulating cytokines il 1_amp_#223; il 6 and chem 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128765 16380619 169465 10463 6018 IL6 il 6 il 6 0 1.0 tnf alpha could act as a principal driver for neuroinflammation because its receptors are elevated in the presymptomatic phases of the disease while several costimulating cytokines il 1_amp_#223; il 6 and chemokines act to potentiate its effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128766 16380619 169466 22551 11892 TNF tnf alpha tnf alpha 0 1.0 however there were conflicting results: either no difference in il 6 tnf alpha or il 12 was found in patients with als and healthy and inflammatory controls or elevated levels of il 6 and il 1_amp_#223; in the csf spinal cords and sera of patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128767 16380619 169466 10463 6018 IL6 il 6 il 6 0 1.0 however there were conflicting results: either no difference in il 6 tnf alpha or il 12 was found in patients with als and healthy and inflammatory controls or elevated levels of il 6 and il 1_amp_#223; in the csf spinal cords and sera of patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128768 16380619 169468 10463 6018 IL6 il 6 il 6 0 1.0 increased il 6 levels were shown in pulmonary conditions such as obstructive sleep apnea in which paroxystic nocturnal desaturations lead to chronic hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128769 16380619 169469 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in light of the inflammatory hypothesis we investigated the role of hypoxemia in the regulation of cytokines by studying tnf alpha and il 6 in the sera and csf of hypoxemic and normoxemic patients with als and neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128770 16380619 169469 10463 6018 IL6 il 6 il 6 0 1.0 in light of the inflammatory hypothesis we investigated the role of hypoxemia in the regulation of cytokines by studying tnf alpha and il 6 in the sera and csf of hypoxemic and normoxemic patients with als and neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128771 16380619 169476 22551 11892 TNF tnf alpha tnf alpha 0 1.0 il 6 and tnf alpha levels in csf and sera were determined using a chemiluminescent assay quantiglo r_amp_d systems and an elisa test quantikine r_amp_d systems . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128772 16380619 169476 10463 6018 IL6 il 6 il 6 0 1.0 il 6 and tnf alpha levels in csf and sera were determined using a chemiluminescent assay quantiglo r_amp_d systems and an elisa test quantikine r_amp_d systems . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128773 16380619 169477 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found higher levels of il 6 in csf z = 2.7; p = 0.02 in serum z = 2.1; p = 0.04 and tnf alpha in serum z = 2.5; p = 0.01 in hypoxemic vs normoxemic patients with als figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128774 16380619 169477 10463 6018 IL6 il 6 il 6 0 1.0 we found higher levels of il 6 in csf z = 2.7; p = 0.02 in serum z = 2.1; p = 0.04 and tnf alpha in serum z = 2.5; p = 0.01 in hypoxemic vs normoxemic patients with als figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128775 16380619 169478 22551 11892 TNF tnf alpha tnf alpha 0 1.0 a correlation exists between pao 2 and levels of csf il 6 p = 0.0001 r = 0.7 serum il 6 p = 0.007 r = 0.6 serum tnf alpha p = 0.001 r = 0.7 in patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128776 16380619 169478 10463 6018 IL6 il 6 il 6 0 1.0 a correlation exists between pao 2 and levels of csf il 6 p = 0.0001 r = 0.7 serum il 6 p = 0.007 r = 0.6 serum tnf alpha p = 0.001 r = 0.7 in patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128777 16380619 169479 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in neurologic controls we found higher levels of il 6 in csf z = 2.8; p = 0.02 in serum z = 2.3; p = 0.02 and tnf alpha in serum z = 2.0; p = 0.05 in hypoxemic controls vs normoxemic ones figure 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128778 16380619 169479 10463 6018 IL6 il 6 il 6 0 1.0 in neurologic controls we found higher levels of il 6 in csf z = 2.8; p = 0.02 in serum z = 2.3; p = 0.02 and tnf alpha in serum z = 2.0; p = 0.05 in hypoxemic controls vs normoxemic ones figure 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128779 16380619 169480 22551 11892 TNF tnf alpha tnf alpha 0 1.0 there were correlations between pao 2 and csf il 6 p = 0.01 r = 0.5 serum il 6 p = 0.01 r = 0.5 and serum tnf alpha levels p = 0.01 r = 0.5 in neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128780 16380619 169480 10463 6018 IL6 il 6 il 6 0 1.0 there were correlations between pao 2 and csf il 6 p = 0.01 r = 0.5 serum il 6 p = 0.01 r = 0.5 and serum tnf alpha levels p = 0.01 r = 0.5 in neurologic controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128781 16380619 169481 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha was undetectable in csf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128782 16380619 169482 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found no correlation between il 6 or tnf alpha levels in plasma and those in csf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128783 16380619 169482 10463 6018 IL6 il 6 il 6 0 1.0 we found no correlation between il 6 or tnf alpha levels in plasma and those in csf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128784 16380619 169483 22551 11892 TNF tnf alpha tnf alpha 0 1.0 il 6 and tnf alpha levels did not correlate with age clinical presentation or disease duration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128785 16380619 169483 10463 6018 IL6 il 6 il 6 0 1.0 il 6 and tnf alpha levels did not correlate with age clinical presentation or disease duration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128786 16380619 169484 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found an increase in il 6 levels in csf and sera and tnf alpha in sera in hypoxemic patients with als and hypoxemic neurologic controls vs normoxemic ones but no difference between patients with als and controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128787 16380619 169484 10463 6018 IL6 il 6 il 6 0 1.0 we found an increase in il 6 levels in csf and sera and tnf alpha in sera in hypoxemic patients with als and hypoxemic neurologic controls vs normoxemic ones but no difference between patients with als and controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128788 16380619 169485 10463 6018 IL6 il 6 il 6 0 1.0 a correlation existed between il 6 levels and the severity of hypoxemia in both groups suggesting that cytokine levels must be interpreted according to the degree of hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128789 16380619 169487 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 hypoxia activates the endothelial cells to release inflammatory mediators and growth factors such as vascular endothelial growth factor vegf thought to play a role in the pathophysiology of sporadic als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128790 16380619 169490 22551 11892 TNF tnf alpha tnf alpha 0 1.0 on the other hand hypoxia stimulates the proinflammatory cytokines such as tnf alpha and il 6 mediated by others transcriptional factors: nuclear factor kappab ap 1 and sp 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128791 16380619 169490 7683 3796 FOS ap 1 ap 1 0 1.0 on the other hand hypoxia stimulates the proinflammatory cytokines such as tnf alpha and il 6 mediated by others transcriptional factors: nuclear factor kappab ap 1 and sp 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128792 16380619 169490 10463 6018 IL6 il 6 il 6 0 1.0 on the other hand hypoxia stimulates the proinflammatory cytokines such as tnf alpha and il 6 mediated by others transcriptional factors: nuclear factor kappab ap 1 and sp 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128793 16380619 169491 22551 11892 TNF tnf alpha tnf alpha 0 1.0 hypoxemia episodes cause early microglia activation followed by the release of a variety of neurotoxic products including excitatory amino acid nitric oxide and proinflammatory cytokines such as il 6 tnf alpha and il 1_amp_#223;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128794 16380619 169491 10463 6018 IL6 il 6 il 6 0 1.0 cute hypoxemia episodes cause early microglia activation followed by the release of a variety of neurotoxic products including excitatory amino acid nitric oxide and proinflammatory cytokines such as il 6 tnf alpha and il 1_amp_#223;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128795 16380619 169492 22551 11892 TNF tnf alpha tnf alpha 0 1.0 higher il 6 and tnf alpha levels could therefore correspond to a normal response to hypoxemia probably via nf kappab. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128796 16380619 169492 10463 6018 IL6 il 6 il 6 0 1.0 higher il 6 and tnf alpha levels could therefore correspond to a normal response to hypoxemia probably via nf kappab. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128797 16380619 169493 10463 6018 IL6 il 6 il 6 0 1.0 it was demonstrated that the upregulation of il 6 induced by hypoxemia could represent an endogenous neuroprotective mechanism against excitotoxic factor injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128798 16380619 169494 10463 6018 IL6 il 6 il 6 0 1.0 a neuroprotective effect of increased levels of il 6 was also observed in animal models of als or in the context of excitotoxicity after hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128799 16380619 169495 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the same observation was made for prostaglandin e 2 pge 2 which is an inflammatory mediator and a major downstream product of cyclooxygenase 2 cox 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128800 16380619 169496 17610 9605 PTGS2 cox 2 cox 2 0 1.0 increased levels of pge 2 and cox 2 were described in patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128801 16380619 169497 17610 9605 PTGS2 cox 2 cox 2 0 1.0 pge 2 and cox 2 presented both angiogenic properties and reciprocal interactions between cox 2/pge 2 and vegf are described. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128802 16380619 169498 17610 9605 PTGS2 cox 2 cox 2 0 1.0 our findings suggest that increased levels of il 6 tnf alpha pge 2. and cox 2 observed in patients with als parallel motor neuronal loss and could correspond to a natural response to hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128803 16380619 169498 22551 11892 TNF tnf alpha tnf alpha 0 1.0 our findings suggest that increased levels of il 6 tnf alpha pge 2. and cox 2 observed in patients with als parallel motor neuronal loss and could correspond to a natural response to hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128804 16380619 169498 10463 6018 IL6 il 6 il 6 0 1.0 our findings suggest that increased levels of il 6 tnf alpha pge 2. and cox 2 observed in patients with als parallel motor neuronal loss and could correspond to a natural response to hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128805 16380619 169499 17610 9605 PTGS2 cox 2 cox 2 0 1.0 we hypothesize that cox 2 inhibitors may even be harmful in patients with als because they can block the natural upregulation loop of vegf during hypoxemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128806 16380619 169501 10463 6018 IL6 il 6 il 6 0 1.0 this may explain the age associated increase in il 6 sera levels found after exercise in patients with neuromuscular diseases including als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128807 16380619 169505 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in patients with als according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and the 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128808 16380619 169505 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in patients with als according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and the normoxemic groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128809 16380619 169505 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in patients with als according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and the normoxemic groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128810 16380619 169507 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in neurologic controls according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128811 16380619 169507 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in neurologic controls according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and the normoxemic groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 128812 16380619 169507 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 csf and sera interleukin 6 levels and tumor necrosis factor alpha sera levels in neurologic controls according to the condition of hypoxemia or normoxemia pao 2 . *significant difference p _lt_ 0.05 between the hypoxemic and the normoxemic groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118014 16425674 153703 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 aeol 10150 a small molecule antioxidant analogous to the catalytic site of superoxide dismutase is under development by aeolus formerly incara as a potential subcutaneous treatment for amyotrophic lateral sclerosis als stroke spinal cord injury lung inflammation and mucositis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118651 16436205 154682 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mice expressing a glycine _amp_#x02192; alanine substitution in cytosolic cu zn superoxide dismutase g93a sod1 associated with familial amyotrophic lateral sclerosis als demonstrate age dependent neuroinflammation associated with broad spectrum cytokine eicosanoid and oxidant production. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118652 16436205 154685 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 a significant elevation in either the basal or the tumor necrosis alpha tnf_amp_#x003b1; stimulated levels of proinflammatory eicosanoids prostaglandin e 2 pge 2 and leukotriene b 4 ltb 4 ; inducible nitric oxide synthase inos and _amp_#x02022;no indexed by nitrite release into the culture medium ; and protein carbonyl products. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118653 16436205 154702 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 tumor necrosis factor _amp_#x003b1; tnf_amp_#x003b1; and its principle receptor tnf ri are particularly elevated at pre and post symptomatic stages of disease [ 6 9 ] suggesting a rationale for the application of this cyt 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118654 16436205 154705 604 435 ALOX5 arachidonic acid 5-lipoxygenase arachidonic acid 5 lipoxygenase 0 1.0 likewise arachidonic acid 5 lipoxygenase 5lox is elevated in g93a sod1 spinal cords and the 5lox antagonist nordihydroguaiaretic acid ndga slows disease progression in the als mouse [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118655 16436205 154735 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 cells were treated with recombinant murine tnf_amp_#x003b1; and/or interferon gamma ifn_amp_#x003b3; bd pharmingen san diego ca usa as indicated in specific experiments. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118656 16436205 154736 551 399 ALB albumin albumin 0 0.0 cytokines were predissolved in 4% fatty acid free bovine serum albumin bsa in 0.9% saline at 100 fold working concentration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118657 16436205 154736 551 399 ALB serum albumin serum albumin 0 1.0 cytokines were predissolved in 4% fatty acid free bovine serum albumin bsa in 0.9% saline at 100 fold working concentration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118658 16436205 154772 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 primary astrocyte cultures from g93a sod1 or nontransgenic mice were almost exclusively astrocytic based on immunocytochemical staining with anti glial fibrillary acidic protein gfap not illustrated . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118659 16436205 154790 10463 6018 IL6 il 6 il 6 0 1.0 il 6 which has some neuroprotective functions [ 20 ] tended to decrease in g93a sod1 cultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 118660 16436205 154854 604 435 ALOX5 5 lox 5 lox 0 1.0 insets show western blot analysis of basal cox ii and 5 lox more ... 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122440 16510725 160990 22551 11892 TNF tnf alpha tnf alpha 0 1.0 important mediators of inflammation such as the cytokine tumor necrosis factor alpha tnf alpha and its superfamily member fibroblast associated cell surface ligand fasl have been implicated in apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122441 16510725 160990 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 important mediators of inflammation such as the cytokine tumor necrosis factor alpha tnf alpha and its superfamily member fibroblast associated cell surface ligand fasl have been implicated in apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122442 16510725 160990 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 important mediators of inflammation such as the cytokine tumor necrosis factor alpha tnf alpha and its superfamily member fibroblast associated cell surface ligand fasl have been implicated in apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122443 16510725 160991 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found increased tnf alpha and fasl immunoreactivity in lumbar spinal cord sections of als patients and g93a transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122444 16510725 160992 22551 11892 TNF tnf alpha tnf alpha 0 1.0 both increased tnf alpha and fasl immunostaining in the lumbar spinal cord of the g93a sod1 transgenic mice occurred at 40 60 d well before the onset of symptoms and loss of motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122445 16510725 160993 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we tested the neuroprotective effect of thalidomide and its analog lenalidomide pharmacological agents that inhibit the expression of tnf alpha and other cytokines by destabilizing their mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122446 16510725 160995 22551 11892 TNF tnf alpha tnf alpha 0 1.0 treated g93a mice showed a reduction in tnf alpha and fasl immunoreactivity as well as their mrna in the lumbar spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122447 16510725 160996 10437 5992 IL1B il 1 il 1 0 1.0 both compounds also reduced interleukin il 12p40 il 1 alpha and il 1 beta and increased il ra and tgf beta1 mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122448 16510725 160998 22551 11892 TNF tnf alpha tnf alpha 0 1.0 key words: g93a; sod1; thalidomide; lenalidomide; tnf alpha; fasl 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122449 16510725 161001 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 a major discovery in the study of als was the finding of missense mutations in the enzyme copper zinc superoxide dismutase sod1 which is associated with 15 20% of familial als cases rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122450 16510725 161004 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tumor necrosis factor alpha tnf alpha is a major inflammatory cytokine that elicits a wide range of biological responses including neuronal apoptosis tewari and dixit 1996 alpha mediates its biological effects through activation of two d 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122451 16510725 161004 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 tumor necrosis factor alpha tnf alpha is a major inflammatory cytokine that elicits a wide range of biological responses including neuronal apoptosis tewari and dixit 1996 alpha mediates its biological effects through act 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122452 16510725 161004 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 tumor necrosis factor alpha tnf alpha is a major inflammatory cytokine that elicits a wide range of biological responses including neuronal apoptosis tewari and dixit 1996 alpha mediates its biological effects through activatio 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122453 16510725 161005 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 lpha can induce fasl pinkoski et al. 2002 alpha binds to its receptor e.g. tnf r1 similar to the events that take place when fasl binds to fas then death inducing signaling complex disc will form and caspase 8 is activated which leads to apoptotic cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122454 16510725 161006 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in the present study we examined the temporal pattern of tnf alpha and fasl immunoreactivity in the lumbar spinal cord of g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122455 16510725 161007 22551 11892 TNF tnf alpha tnf alpha 0 1.0 because previous work showed that the pro inflammatroy cytokines tnf alpha and fasl are elevated in both human and mouse models of als and play a role in the pathogenesis of als we tested the neuroprotective effects of thalidomide and lenalidomide two immunomodulatory agent 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122456 16510725 161007 22551 11892 TNF tnf alpha tnf alpha 0 1.0 levated in both human and mouse models of als and play a role in the pathogenesis of als we tested the neuroprotective effects of thalidomide and lenalidomide two immunomodulatory agents that inhibit tnf alpha production corral et al. 1999 ; bartlett et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122457 16510725 161039 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 the primers used were as follows: tnf alpha sense 5' gacccagtgtgggaag 3' and antisense 5' ggttcagtgatgt agcga 3'; glyceraldehyde 3 phosphate dehydrogenase gapdh sense 5' ccatggagaaggctggg 3' and antisense 5' caaaa gttgtcatggatgacc 3'. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122458 16510725 161039 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the primers used were as follows: tnf alpha sense 5' gacccagtgtgggaag 3' and antisense 5' ggttcagtgatgt agcga 3'; glyceraldehyde 3 phosphate dehydrogenase gapdh sense 5' ccatggagaaggctggg 3' and antisense 5' caaaa gttgtcatggatgacc 3'. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122459 16510725 161045 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the amounts of tnf alpha and gapdh cdna were calculated using linear regression analysis from standard curves for both tnf alpha and gapdh and the amount of tnf alpha cdna was expressed as a percentage of gapdh. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122460 16510725 161057 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the sections were immunostained with antibodies to tnf alpha serotec raleigh nc fasl santa cruz biotechnology santa cruz ca cd40 serotec oxford uk and glial fibrillary acid protein gfap; dako carpinteria ca using a modified avidin biotin peroxidase technique. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122461 16510725 161061 22551 11892 TNF tnf alpha tnf alpha 0 1.0 double immunofluorescence was performed to demonstrate the glial localization of tnf alpha and fasl. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122462 16510725 161062 22551 11892 TNF tnf alpha tnf alpha 0 1.0 sections were incubated for 18 h in the primary antibody mixture containing anti tnf alpha or anti fasl and the astrocyte marker anti gfap. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122463 16510725 161069 22551 11892 TNF tnf alpha tnf alpha 0 1.0 paraffin sections 7 microm thick were prepared and processed for tnf alpha or fasl immunohistochemistry as described above. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122464 16510725 161082 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and fasl immunoreactivity in g93a sod1 mouse model of als 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122465 16510725 161083 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we investigated the temporal pattern of tnf alpha and fasl immunoreactivity in g93a sod1 mice at 40 and 60 d asymptomatic 90 d early symptomatic 110 d fully symptomatic and end stage 120 135 d in the ventral horn of the lumbar spinal cords. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122466 16510725 161084 22551 11892 TNF tnf alpha tnf alpha 0 1.0 immunohistochemical analysis showed little tnf alpha immunoreactivity at 40 d which appeared similar to controls in the motor neurons of the ventral horn in the lumbar spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122467 16510725 161085 22551 11892 TNF tnf alpha tnf alpha 0 1.0 at 60 d motor neurons from g93a mice with a healthy appearance were stained with tnf alpha moderately and immunoreactivity became more intense at 90 and 110 d. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122468 16510725 161087 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha colocalized with the motor neuron marker smi 32 kiaei et al. 2006 alpha staining also occurred in actrocytes at 110 d of age as demonstrated by colocalization with the astrocyte marker gfap by double 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122469 16510725 161090 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and fasl are important mediators of inflammation and they play a role in apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122470 16510725 161091 22551 11892 TNF tnf alpha tnf alpha 0 1.0 studies performed in mouse models of als and patients with als show increases in tnf alpha. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122471 16510725 161092 10437 5992 IL1B il 1 il 1 0 1.0 ther at 120 d in high expressing g93a mice hensley et al. 2002 alpha was increased in the lumbar spinal cord of g37r sod1 mice at 7 and 10 months of age and the signal was unchanged in the absence of il 1 beta nguyen et al. 2001 alpha expression at 11 weeks of age 5.3 fold in g93a sod1 mice which increased further at 14 and 17 weeks 8 fold yoshihara et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122472 16510725 161092 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in als patients antigenic tnf alpha and its soluble receptors measured by elisa were significantly higher in als patients than in healthy controls poloni et al. 2000 alpha mrna expression in spinal cords of g93a mice at 4 months of age 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122473 16510725 161092 22551 11892 TNF tnf alpha tnf alpha 0 1.0 me weaker reaching a maximum at 7.5 8 months of age in low copy number g93a mice elliott 2001 alpha receptors was also present a study using rpas showed increased fas associated death domain fadd and tnf alpha receptor p55 at 80 d which increased further at 120 d in high expressing g93a mice hensley et al. 2002 alpha was increased in the lumbar spinal cord of g37r sod1 mice at 7 and 10 months of age and th 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122474 16510725 161093 22551 11892 TNF tnf alpha tnf alpha 0 1.0 glial cells are the major source of tnf alpha expression in the cns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122475 16510725 161094 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found that both lumbar spinal cord motor neurons and glia from g93a sod1 mice express high levels of tnf alpha and this occurs at 60 d well before the onset of symptoms. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122476 16510725 161096 22551 11892 TNF tnf alpha tnf alpha 0 1.0 an increase in tnf alpha mrna was confirmed by real time rt pcr in g93a mice at 110 d. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122477 16510725 161097 22551 11892 TNF tnf alpha tnf alpha 0 1.0 double labeling of tnf alpha with gfap confirmed expression of tnf alpha in astrocytes fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122478 16510725 161098 22551 11892 TNF tnf alpha tnf alpha 0 1.0 this is consistent with a previous study in which tnf alpha immunoreactivity was increased at 17 weeks of age in microglia and motor neurons of g93a sod1 mice yoshihara et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122479 16510725 161099 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 fas triggers cell death in embryonic motoneurons by a pathway requiring upregulation of neuronal nitric oxide synthase and involving daxx apoptosis signal regulated kinase 1 and p38 as well as the fadd/caspase 8 pathway raoul et al. 2002 alpha upregulates fasl pinkoski et al. 2002 alpha immunostaining was found in th 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122480 16510725 161099 22551 11892 TNF tnf alpha tnf alpha 0 1.0 and p38 as well as the fadd/caspase 8 pathway raoul et al. 2002 alpha upregulates fasl pinkoski et al. 2002 alpha immunostaining was found in the neurons of adjacent sections suggesting that fasl and tnf alpha are coexpressed in these neurons fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122481 16510725 161099 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 s triggers cell death in embryonic motoneurons by a pathway requiring upregulation of neuronal nitric oxide synthase and involving daxx apoptosis signal regulated kinase 1 and p38 as well as the fadd/caspase 8 pathway raoul et al. 2002 alpha upregulates fasl pinkoski et al. 2002 alpha immunostaining was found in the neurons of adjacent sections suggesting that fasl and tnf alpha are coexpressed in these ne 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122482 16510725 161099 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 fas triggers cell death in embryonic motoneurons by a pathway requiring upregulation of neuronal nitric oxide synthase and involving daxx apoptosis signal regulated kinase 1 and p38 as well as the fadd/caspase 8 pathway raoul et al. 2002 alpha upregulates fasl pinkoski et al. 2002 alpha immunostaining was found in th 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122483 16510725 161100 22551 11892 TNF tnf alpha tnf alpha 0 1.0 because both tnf alpha and fasl immunostaining were increased in g93a mice we examined the effects of thalidomide and its analog lenalidomide which inhibits the stability of tnf alpha mrna moreira et al. 1993 alpha and fasl expression in motor neurons of g93a mice there was a delay of disease onset and a significant attenuation of disease progression in g93a sod1 mice figs 4 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122484 16510725 161102 22551 11892 TNF tnf alpha tnf alpha 0 1.0 quantitative rt pcr showed that both thalidomide and lenalidomide significantly reduced tnf alpha mrna levels at 110 d of age. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122485 16510725 161103 10437 5992 IL1B il 1 il 1 0 1.0 both compounds also inhibited il 12p40 il 1 alpha and il 1 beta. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122486 16510725 161105 22551 11892 TNF tnf alpha tnf alpha 0 1.0 our findings provide additional evidence for a role of pro inflammatory cytokines in als and suggest that tnf alpha and fasl and related cytokines have important triggering roles in the pathogenesis of als in initiating a cell death pathway s . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122487 16510725 161106 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha binds to tnf receptor 1 and activates it to ligate with tnf alpha receptor associated death domain tradd forming the disc that leads to activation of caspase 8 resulting in bid cleavage and the activation of executioner caspases 3 6 and 7. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122488 16510725 161106 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 tnf alpha binds to tnf receptor 1 and activates it to ligate with tnf alpha receptor associated death domain tradd forming the disc that leads to activation of caspase 8 resulting in bid cleavage and the activation of executioner caspases 3 6 and 7. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122489 16510725 161107 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 fasl works in a similar way by binding to fas/cd95 receptor and activate it to cause fadd ligation and disc formation which also leads on to caspase 8 activation bid cleavage and ultimately activation of caspases 3 6 and 7 nagata 1997 1999 ; pinkoski et al. 2000 ; ugolini et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122490 16510725 161108 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 because these two pathways converge on caspase 8 activation they may have synergistic effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122491 16510725 161111 10437 5992 IL1B il 1 il 1 0 1.0 lenalidomide inhibited tnf alpha with less potency compared with thalidomide; in contrast lenalidomide was more potent in inhibiting other cytokines such as il 12p40 il 1 alpha and il 1 beta. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122492 16510725 161111 22551 11892 TNF tnf alpha tnf alpha 0 1.0 lenalidomide inhibited tnf alpha with less potency compared with thalidomide; in contrast lenalidomide was more potent in inhibiting other cytokines such as il 12p40 il 1 alpha and il 1 beta. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122493 16510725 161117 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in both erythema nodosum leprosum and myelodysplastic syndromes upregulation of tnf alpha production is postulated to contribute to disease pathogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122494 16510725 161119 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the suppression of spinal cord tnf alpha mrna in our study by thalidomide and lenalidomide hence extension of survival in g93a mice suggests that this class of immunomodulatory agents may have efficacy in diseases of the cns associated with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122495 16510725 161122 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha immunoreactivity in g93a sod1 and control mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122496 16510725 161123 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha immunoreactivity was examined in the spinal cords of transgenic g93a sod1 mice at 40 60 90 and 110 d of age and in 110 d old transgenic wild type hsod1 n1029 control mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122497 16510725 161124 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha immunoreactivity is seen in the anterior horn motor neurons arrows with heavy staining in the cytoplasm and nucleus of motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122498 16510725 161125 22551 11892 TNF tnf alpha tnf alpha 0 1.0 thalidomide treatment reduced tnf alpha immunoreactivity middle row left panel . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122499 16510725 161126 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha double immunofluorescence with gfap showed that tnf alpha colocalizes with gfap in astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122500 16510725 161127 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the white arrowhead points to an astrocyte labeled with tnf alpha green and gfap red and colocalization of tnf alpha and gfap yellow . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122501 16510725 161139 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and fasl immunoreactivity in human als and controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122502 16510725 161140 22551 11892 TNF tnf alpha tnf alpha 0 1.0 fasl top panels and tnf alpha bottom panels immunoreactivities in the lumbar ventral horn of the spinal cord of human als and control patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122503 16510725 161141 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found tnf alpha and fasl immunoreactive neurons in the lumbar spinal cord sections of a familial als patient with sod1 mutation i113t and sporadic als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122504 16510725 161142 22551 11892 TNF tnf alpha tnf alpha 0 1.0 intense tnf alpha and fasl immunoreactivity occurred predominantly in neurons of als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122505 16510725 161143 22551 11892 TNF tnf alpha tnf alpha 0 1.0 coexistence of tnf alpha and fasl occurred in the same neurons in adjacent sections of als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122506 16510725 161161 22551 11892 TNF tnf alpha tnf alpha 0 1.0 real time rt pcr for tnf alpha expression in the spinal cord tissue of g93a sod1 control mice and g93a mice treated with thalidomide or lenalidomide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122507 16510725 161162 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the amount of tnf alpha cdna was measured in the total cdna made from total mrna isolated from spinal cord tissue of 110 d old n1029/b6sjl controls and g93a sod1 mice treated with vehicle thalidomide or lenalidomide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122508 16510725 161163 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha cdna amount in different samples was normalized against gapdh cdna and expressed as a percentage of gapdh cdna ** p _lt_ 0.01; *** p _lt_ 0.0005; mann whitney test . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122509 16510725 161168 10437 5992 IL1B il 1 il 1 0 1.0 spinal cord total rna was used against a rpa multiprobe of cytokines. a il 1 alpha rna was elevated in vehicle treated g93a mice compared with wild type n1020 controls and significantly reduced in lenalidomide treated g93a mice while unchanged in thalidomide treated g93a mice 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122510 16510725 161168 10437 5992 IL1B il 1 il 1 0 1.0 ha rna was elevated in vehicle treated g93a mice compared with wild type n1020 controls and significantly reduced in lenalidomide treated g93a mice while unchanged in thalidomide treated g93a mice. b il 1 beta rna was elevated in vehicle treated g93a mice compared with wild type n1020 controls and significantly reduced by lenalidomide but not thalidomide treatment. c il 12p40 rna was elevated in vehic 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122511 16510725 161174 22551 11892 TNF tnf alpha tnf alpha 0 1.0 both tnf alpha and fasl immunoreactivity persisted relatively strong in the lumbar spinal cord sections of g93a mice at end stage data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122512 16510725 161176 22551 11892 TNF tnf alpha tnf alpha 0 1.0 fasl immunoreactivity colocalized with gfap indicating that fasl immunostaining was found in both neurons and astrocytes similar to tnf alpha. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122513 16510725 161177 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and fasl immunoreactivity in human als 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122514 16510725 161178 22551 11892 TNF tnf alpha tnf alpha 0 1.0 consistent with the immunohistochemical findings in als transgenic mice intense tnf alpha and fasl immunoreactivity occurred in the lumbar spinal cord sections from an als patient with a sod1 mutation i113t as well as sporadic als patients whereas control tissues showed very little or no 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122515 16510725 161178 22551 11892 TNF tnf alpha tnf alpha 0 1.0 and fasl immunoreactivity occurred in the lumbar spinal cord sections from an als patient with a sod1 mutation i113t as well as sporadic als patients whereas control tissues showed very little or no tnf alpha and fasl immunoreactivity fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122516 16510725 161179 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and fasl coexisted in the motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122517 16510725 161187 22551 11892 TNF tnf alpha tnf alpha 0 1.0 histological analysis revealed that the increase in survival was associated with a marked dose dependent decrease in tnf alpha immunoreactivity in the motor neurons and glial cells in the spinal cord lumbar regions of g93a mice compared with saline treated controls data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122518 16510725 161188 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we show that thalidomide treatment reduced tnf alpha and fasl immunoreactivity in the spinal cords of g93a mice figs 1 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122519 16510725 161198 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha mrna in g93a mice 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122520 16510725 161199 22551 11892 TNF tnf alpha tnf alpha 0 1.0 to determine whether tnf alpha mrna is upregulated and whether thalidomide and lenalidomide can block its mrna elevation in the spinal cord of g93a mice real time quantitative pcr was performed using cdna synthesized from total rn 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122521 16510725 161200 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha mrna was increased 10 fold in g93a sod1 mice compared with control littermates p _lt_ 0.005 fig 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122522 16510725 161201 22551 11892 TNF tnf alpha tnf alpha 0 1.0 thalidomide and lenalidomide treatment reduced tnf alpha mrna significantly p _lt_ 0.01 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122523 16510725 161205 10437 5992 IL1B il 1 il 1 0 1.0 lenalidomide also downregulated il 1 alpha and il 1 beta. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122524 16510725 161206 22062 11769 TGFB3 tgf beta3 tgf beta3 0 1.0 no changes were detected in il 12p35 il 10 il 18 ifn gamma or ifn beta il 6 tgf beta3 and lt alpha or lt beta data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122525 16510725 161206 10480 5962 IL10 il 10 il 10 0 1.0 no changes were detected in il 12p35 il 10 il 18 ifn gamma or ifn beta il 6 tgf beta3 and lt alpha or lt beta data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122526 16510725 161206 10508 5986 IL18 il 18 il 18 0 1.0 no changes were detected in il 12p35 il 10 il 18 ifn gamma or ifn beta il 6 tgf beta3 and lt alpha or lt beta data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 122527 16510725 161206 6392 3209 EEF1B3 beta 3 beta3 0 1.0 no changes were detected in il 12p35 il 10 il 18 ifn gamma or ifn beta il 6 tgf beta3 and lt alpha or lt beta data not shown . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 122528 16510725 161206 10463 6018 IL6 il 6 il 6 0 1.0 no changes were detected in il 12p35 il 10 il 18 ifn gamma or ifn beta il 6 tgf beta3 and lt alpha or lt beta data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 109234 16533145 142007 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 with the discovery of mutations in one gene cu/zn superoxide dismutase as a primary cause of some forms of als model systems have been developed that have helped us begin to understand mechanisms involved in motor neuron death and enabled testing of potential new therap 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 109235 16533145 142008 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 several other genes have been implicated as risk factors in motor neuron diseases including neurofilaments cytoplasmic dynein and dynactin vascular endothelial growth factor and angiogenin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113254 16624536 146828 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 while between 5 and 8% of als cases are familial fals of which 20% harbour missense mutations in the copper_amp_#x2013;zinc superoxide dismutase sod1 gene [3] the majority of als cases are sporadic sals . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113255 16624536 146830 17381 9461 PRPH peripherin peripherin 0 1.0 key components of the pathological process of als include glutamate excitotoxicity disturbances in cytoskeletal protein metabolism e.g. neurofilament peripherin oxidative injury altered mitochondrial function and neuroinflammation [5] and [6] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113256 16624536 146844 5010 2434 CSF2 granulocyte-macrophage colony stimulating factor granulocyte macrophage colony stimulating factor 0 1.0 oglia become primed in response to primary stimuli from neurons or astrocytes including interferon _amp_#x3b3; ifn_amp_#x3b3; tumour necrosis factor tnf macrophage colony stimulating factor m csf and granulocyte macrophage colony stimulating factor gm csf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113257 16624536 146844 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 microglia become primed in response to primary stimuli from neurons or astrocytes including interferon _amp_#x3b3; ifn_amp_#x3b3; tumour necrosis factor tnf macrophage colony stimulating factor m csf and granulocyte macrophage colony stimulating factor gm csf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113258 16624536 146844 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 m csf and granulocyte macrophage colony stimulating factor gm csf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113259 16624536 146844 5010 2434 CSF2 gm csf gm csf 0 1.0 i from neurons or astrocytes including interferon _amp_#x3b3; ifn_amp_#x3b3; tumour necrosis factor tnf macrophage colony stimulating factor m csf and granulocyte macrophage colony stimulating factor gm csf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113260 16624536 146844 5008 2432 CSF1 m csf m csf 0 1.0 microglia become primed in response to primary stimuli from neurons or astrocytes including interferon _amp_#x3b3; ifn_amp_#x3b3; tumour necrosis factor tnf macrophage colony stimulating factor m csf and granulocyte macrophage colony stimulating factor gm csf . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113261 16624536 146847 10437 5992 IL1B il 1 il 1 0 1.0 in response to secondary stimuli such as interleukin 1 il 1 il 6 and tnf microglia exert maximal activity through secretion of inflammatory mediators fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113262 16624536 146847 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 in response to secondary stimuli such as interleukin 1 il 1 il 6 and tnf microglia exert maximal activity through secretion of inflammatory mediators fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113263 16624536 146847 10463 6018 IL6 il 6 il 6 0 1.0 in response to secondary stimuli such as interleukin 1 il 1 il 6 and tnf microglia exert maximal activity through secretion of inflammatory mediators fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113264 16624536 146862 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 while constitutively expressed in the human brain macrophage colony stimulating factor m csf receptor expression is upregulated in als precentral gyrus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113265 16624536 146862 5008 2432 CSF1 m csf m csf 0 1.0 while constitutively expressed in the human brain macrophage colony stimulating factor m csf receptor expression is upregulated in als precentral gyrus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113266 16624536 146864 17610 9605 PTGS2 cox 2 cox 2 0 1.0 an increased expression of pro inflammatory cytokines cox 2 [29] [30] and [31] and of microglia mediated protein oxidative pathology [32] is also observed in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113267 16624536 146869 7334 11936 FASLG fas ligand fas ligand 0 1.0 in vitro experiments have shown that products released by activated microglia can lead to motor neuron death via tnf mediated apoptotic mechanisms [35] and by fas ligand or no induced apoptotic pathways [36] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113268 16624536 146882 5008 2432 CSF1 m csf m csf 0 1.0 specifically both tgf _amp_#x3b2;1 and m csf expression are upregulated in presymptomatic mice with tnf expression being increased well in advance of the appearance of motor deficits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113269 16624536 146884 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this process is associated with an increased level of cox 2 mrna and protein and an increase in pge 2 content limited to the regions associated with motor neuron pathology further confirming a role for microglial activation [31] and [51] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113270 16624536 146885 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the latter observation is consistent with in vitro observations that the motor neuron death induced by chronic glutamate excitotoxicity in organotypic spinal cord cultures can be suppressed by cox 2 inhibition [52] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113271 16624536 146886 22217 11848 TLR2 toll-like receptor 2 toll like receptor 2 0 1.0 tor neuron disease is accelerated by chronic stimulation of inflammation using lps in the sod1 g37r mouse model of als with increasing levels of pro inflammatory cytokines and increased expression of toll like receptor 2 tlr 2 [53] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113272 16624536 146895 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 oic acid nmda receptor antagonists and soluble tnf receptor protect neurons from microglial conditioned media dependent death which is thought to result from oxidative damage resulting from inducible nitric oxide synthase inos activity [59] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113273 16624536 146899 7334 11936 FASLG fas ligand fas ligand 0 1.0 this work may offer an explanation for the sensitivity of motor neurons in particular to fas ligand and no triggered cell death mediated at least in part by neighbouring microglia as trophic deprivation and excitotoxic stimulation did not have similar effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113274 16624536 146902 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 this suggests a capacity for the motor neuron itself to _amp_#x201c;summon_amp_#x201d; a microglial response a postulate supported to some degree by the observation that granulocyte/macrophage colony stimulating factor gm csf receptors are up regulated on microglial cells adjacent to axotomized facial motor neurons [63] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113275 16624536 146902 5010 2434 CSF2 gm csf gm csf 0 1.0 acity for the motor neuron itself to _amp_#x201c;summon_amp_#x201d; a microglial response a postulate supported to some degree by the observation that granulocyte/macrophage colony stimulating factor gm csf receptors are up regulated on microglial cells adjacent to axotomized facial motor neurons [63] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113276 16624536 146903 5008 2432 CSF1 colony stimulating factor 1 colony stimulating factor 1 0 1.0 colony stimulating factor 1 csf 1 promotes the proliferation and differentiation of both monocytes [64] and microglia [65] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113277 16624536 146906 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 following facial axotomy a similar loss of the early stages of microglial activation is observed in mice in which macrophage colony stimulating factor m csf is absent [67] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113278 16624536 146906 5008 2432 CSF1 m csf m csf 0 1.0 following facial axotomy a similar loss of the early stages of microglial activation is observed in mice in which macrophage colony stimulating factor m csf is absent [67] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113279 16624536 146908 10463 6018 IL6 il 6 il 6 0 1.0 il 6 knockout mice not only fail to demonstrate the early microglial response to motor neuron injury but also show a reduced astrocytic response in keeping with a dual role of il 6 in both mediating motor neuron/microglial and microglial/astrocytic interactions [68] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113280 16624536 146909 10463 6018 IL6 il 6 il 6 0 1.0 it is of interest that microglia derived from adult mutant sod1 transgenic mice show decreased il 6 production in response to lps stimulated activation compared to controls [37] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113281 16624536 146915 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 through activation of the phosphatidylinositol 3 kinase/protein kinase b pathway fractalkine will inhibit fas ligand induced microglial apoptosis through down regulation of the pro apoptotic function of bad and up regulation of the anti apoptotic activity 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113282 16624536 146915 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 tein kinase b pathway fractalkine will inhibit fas ligand induced microglial apoptosis through down regulation of the pro apoptotic function of bad and up regulation of the anti apoptotic activity of bcl xl [71] thus promoting microglial cell survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113283 16624536 146915 543 391 AKT1 protein kinase b protein kinase b 0 1.0 through activation of the phosphatidylinositol 3 kinase/protein kinase b pathway fractalkine will inhibit fas ligand induced microglial apoptosis through down regulation of the pro apoptotic function of bad and up regulation of the anti apoptotic activity of bcl xl [71] t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113284 16624536 146915 7334 11936 FASLG fas ligand fas ligand 0 1.0 through activation of the phosphatidylinositol 3 kinase/protein kinase b pathway fractalkine will inhibit fas ligand induced microglial apoptosis through down regulation of the pro apoptotic function of bad and up regulation of the anti apoptotic activity of bcl xl [71] thus promoting microglial cell survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113285 16624536 146917 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 ne cell culture experiments fractalkine suppressed the production of nitric oxide no il 6 and tnf by activated microglia and suppressed neuronal cell death induced by microglia activated with lps and interferon gamma ifn _amp_#x3b3; in a dose dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113286 16624536 146917 10463 6018 IL6 il 6 il 6 0 1.0 in murine cell culture experiments fractalkine suppressed the production of nitric oxide no il 6 and tnf by activated microglia and suppressed neuronal cell death induced by microglia activated with lps and interferon gamma ifn _amp_#x3b3; in a dose dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113287 16624536 146919 10437 5992 IL1B il 1 il 1 0 1.0 potential candidates for mediating microglia/motor neuron interactions include a number of pro inflammatory cytokines e.g. il 1 il 6 and tnf [77] [78] and [79] and neurotrophic factors e.g. plasminogen tgf _amp_#x3b2; bfgf bdnf ngf nt 3 and nt 4 [80] [81] and [82] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113288 16624536 146919 16797 9071 PLG plasminogen plasminogen 0 1.0 potential candidates for mediating microglia/motor neuron interactions include a number of pro inflammatory cytokines e.g. il 1 il 6 and tnf [77] [78] and [79] and neurotrophic factors e.g. plasminogen tgf _amp_#x3b2; bfgf bdnf ngf nt 3 and nt 4 [80] [81] and [82] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113289 16624536 146919 10463 6018 IL6 il 6 il 6 0 1.0 potential candidates for mediating microglia/motor neuron interactions include a number of pro inflammatory cytokines e.g. il 1 il 6 and tnf [77] [78] and [79] and neurotrophic factors e.g. plasminogen tgf _amp_#x3b2; bfgf bdnf ngf nt 3 and nt 4 [80] [81] and [82] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113290 16624536 146920 10437 5992 IL1B il 1 il 1 0 1.0 il 1 and tnf have similar biological properties in that at higher concentrations both mimic the cytotoxic effects of lps [83] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113291 16624536 146921 10437 5992 IL1B il 1 il 1 0 1.0 il 1 mediates a general inflammatory response that recruits the further secretion of pro inflammatory cytokines e.g. il 6 il 8 colony stimulating factors csfs ifn /_amp_#x3b2; and can also have a trophic 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113292 16624536 146921 10470 6025 IL8 il 8 il 8 0 1.0 il 1 mediates a general inflammatory response that recruits the further secretion of pro inflammatory cytokines e.g. il 6 il 8 colony stimulating factors csfs ifn /_amp_#x3b2; and can also have a trophic effect. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113293 16624536 146921 10463 6018 IL6 il 6 il 6 0 1.0 il 1 mediates a general inflammatory response that recruits the further secretion of pro inflammatory cytokines e.g. il 6 il 8 colony stimulating factors csfs ifn /_amp_#x3b2; and can also have a trophic effect. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113294 16624536 146922 10437 5992 IL1B il 1 il 1 0 1.0 the use of a recombinant il 1 receptor antagonist r hu met il 1ra significantly reduces the volume of damage following brain injury [84] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113295 16624536 146922 10448 5997 IL1RAPL2 il-1 receptor il 1 receptor 0 1.0 the use of a recombinant il 1 receptor antagonist r hu met il 1ra significantly reduces the volume of damage following brain injury [84] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113296 16624536 146924 10437 5992 IL1B il 1 il 1 0 1.0 when il 1 is added to mixed astrocytic/neuronal cultures a 5 to 7 fold increase in astrocytes is observed [86] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113297 16624536 146926 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 when signaling through the tnfr1 tnfr1 recruits a tnf receptor associated death domain tradd that can then interact with the fas associated death domain to activate caspase 8 leading to downstream activation of effector caspases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113298 16624536 146927 1666 593 BIRC5 survivin survivin 0 1.0 tnfr1 and tradd activation can also lead to nf_amp_#x3ba;b dependent reporter gene expression that in turn drives expression of anti apoptotic gene products including survivin inhibitor of apoptosis protein 1 iap1 iap2 x chromosome linked iap bcl 2 bcl xl bfl 1/a1 and flip [88] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113299 16624536 146927 1576 990 BCL2 bcl 2 bcl 2 0 1.0 nf_amp_#x3ba;b dependent reporter gene expression that in turn drives expression of anti apoptotic gene products including survivin inhibitor of apoptosis protein 1 iap1 iap2 x chromosome linked iap bcl 2 bcl xl bfl 1/a1 and flip [88] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113300 16624536 146927 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 p_#x3ba;b dependent reporter gene expression that in turn drives expression of anti apoptotic gene products including survivin inhibitor of apoptosis protein 1 iap1 iap2 x chromosome linked iap bcl 2 bcl xl bfl 1/a1 and flip [88] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113301 16624536 146927 1665 591 BIRC3 inhibitor of apoptosis protein 1 inhibitor of apoptosis protein 1 0 1.0 tnfr1 and tradd activation can also lead to nf_amp_#x3ba;b dependent reporter gene expression that in turn drives expression of anti apoptotic gene products including survivin inhibitor of apoptosis protein 1 iap1 iap2 x chromosome linked iap bcl 2 bcl xl bfl 1/a1 and flip [88] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113302 16624536 146931 10456 6011 IL3 il 3 il 3 0 1.0 microglia can also inhibit sodium nitroprusside an no donor induced neuronal apoptosis in vitro through a tnf dependant mechanism whereas il 3 il 6 bfgf and m csf are ineffective in the same experimental paradigm [92] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113303 16624536 146931 5008 2432 CSF1 m csf m csf 0 1.0 microglia can also inhibit sodium nitroprusside an no donor induced neuronal apoptosis in vitro through a tnf dependant mechanism whereas il 3 il 6 bfgf and m csf are ineffective in the same experimental paradigm [92] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113304 16624536 146931 10463 6018 IL6 il 6 il 6 0 1.0 microglia can also inhibit sodium nitroprusside an no donor induced neuronal apoptosis in vitro through a tnf dependant mechanism whereas il 3 il 6 bfgf and m csf are ineffective in the same experimental paradigm [92] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113305 16624536 146956 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 increased levels of monocyte chemoattractant protein 1 mcp 1 are seen in the cerebrospinal fluid csf from als patients [98] and [99] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113306 16624536 146956 3758 10618 CCL2 monocyte chemoattractant protein-1 monocyte chemoattractant protein 1 0 1.0 increased levels of monocyte chemoattractant protein 1 mcp 1 are seen in the cerebrospinal fluid csf from als patients [98] and [99] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113307 16624536 146958 10437 5992 IL1B il 1 il 1 0 1.0 these cells present antigen to th1 cells which can in turn produce il 1 ifn _amp_#x3b3; tnf _amp_#x3b2; and further activate macrophages. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113308 16624536 146967 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this stimulation results in increased glutamate uptake and decreased no production as well as decreased mrna expression of inflammatory products including cox 2 inos and i_amp_#x3ba;b an inhibitor of nf _amp_#x3ba;b by microglia compared to lps treated microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113309 16624536 146974 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 an in vitro experiment demonstrated in mixed primary spinal cord cultures that igg from patients with als induces apoptosis via the caspase 3 pathway selectively in motor neurons [107] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113310 16624536 146986 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 monocyte chemoattractant protein 1 mcp 1 is critical for migration of monoctyes to areas of injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113311 16624536 146986 3758 10618 CCL2 monocyte chemoattractant protein-1 monocyte chemoattractant protein 1 0 1.0 monocyte chemoattractant protein 1 mcp 1 is critical for migration of monoctyes to areas of injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113312 16624536 146987 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 as discussed in relation to adaptive and acquired immunity in als mcp 1 concentrations are significantly increased in both serum and cerebrospinal fluid csf from als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113313 16624536 146988 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 mcp 1 immunoreactivity is highest in astrocytes in als spinal cord suggesting that astrocytes have an important role in mediating the inflammatory response to injury in als [98] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113314 16624536 146990 17610 9605 PTGS2 cox 2 cox 2 0 1.0 like microglia reactive astrocytes express inflammatory markers including inos and cox 2 [114] and can produce proinflammatory mediators including prostaglandins [115] il 6 [116] and tnf [114] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113315 16624536 146990 10463 6018 IL6 il 6 il 6 0 1.0 like microglia reactive astrocytes express inflammatory markers including inos and cox 2 [114] and can produce proinflammatory mediators including prostaglandins [115] il 6 [116] and tnf [114] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113316 16624536 146992 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 fibroblast growth factor 1 fgf 1 released from motor neurons in response to injury or oxidative stress leads to accumulation of fgf receptor 1 fgfr1 in astrocytic nuclei and stimulates nerve growth factor ngf expression and secretion by astrocytes [117] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113317 16624536 146992 7521 3665 FGF1 fibroblast growth factor 1 fibroblast growth factor 1 0 1.0 fibroblast growth factor 1 fgf 1 released from motor neurons in response to injury or oxidative stress leads to accumulation of fgf receptor 1 fgfr1 in astrocytic nuclei and stimulates nerve growth factor ngf expression and se 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113318 16624536 146992 7551 3689 FGFR2 fgf receptor fgf receptor 0 1.0 fibroblast growth factor 1 fgf 1 released from motor neurons in response to injury or oxidative stress leads to accumulation of fgf receptor 1 fgfr1 in astrocytic nuclei and stimulates nerve growth factor ngf expression and secretion by astrocytes [117] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113319 16624536 146994 7334 11936 FASLG fas ligand fas ligand 0 1.0 fas ligand and tnf produced by reactive astrocytes can also activate death receptors in injured motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113320 16624536 147004 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the site of action of minocycline appears to be at both the level of the microglia in which the up regulation of inos is inhibited and at the target cell where the release of mitochondrial cytochrome c and thus the initiation of a pro apoptotic pathway is inhibited [127] [128] [129] and [130] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113321 16624536 147010 17610 9605 PTGS2 cox 2 cox 2 0 1.0 celecoxib celebrex and rofecoxib are inhibitors of cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113322 16624536 147011 17610 9605 PTGS2 cox 2 cox 2 0 1.0 treatment with these cox 2 inhibitors combined with creatine increased survival by up to 30% in sod1 mutant mice [139] [140] and [141] while treatment with a non specific cox inhibitor sulindac extended survival by roughly 10% 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113323 16624536 147036 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113324 16624536 147036 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 114313 16637591 148926 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 on the other hand elevations of s100b levels in blood or cerebrospinal fluid have been observed in patients with alzheimer's disease down's syndrome amyotrophic lateral sclerosis multiple sclerosis schizophrenia depression cerebral stroke and traumatic brain injury and the levels have reached micromol/l order at focal regions. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 114314 16637591 148927 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 it has been documented that the excessive s100b promotes the expression of inducible nitric oxide synthase or pro inflammatory cytokines and exhibits detrimental effects on neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116151 16647138 150326 17610 9605 PTGS2 cox 2 cox 2 0 1.0 three forms of cox enzymes designated as cox 1 cox 2 and cox 3 occur in mammalian tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116152 16647138 150329 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inflammatory mediators such as cytokines growth factors and bacterial endotoxin rapidly induce cox 2 which is normally undetectable in healthy tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116153 16647138 150330 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 is constitutively expressed in the kidney stomach and brain hoffmann 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116154 16647138 150331 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 and cox 2 are homodimers. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116155 16647138 150334 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 contains val at the 434 and 523 positions whereas cox 2 has ile at positions 434 and 523. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116156 16647138 150335 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these differences in amino acid sequences may result in larger and more flexible substrate and inhibitor binding sites in cox 2 than in cox 1 kurumbail et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116157 16647138 150336 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the amino acid sequences of cox 1 and cox 2 also differ from each other at the n and c termini. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116158 16647138 150337 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 lacks a 17 amino acid sequence at the n terminus but has an extra 18 amino acid sequence at the c terminus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116159 16647138 150338 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus the active site of cox 2 is larger and more accommodating than that of cox 1 and cox 1 displays negative allosterism at low concentrations of aa. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116160 16647138 150339 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this property may be responsible for greater eicosanoid production by cox 2 when the aa concentration is low smith et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116161 16647138 150340 17610 9605 PTGS2 cox 2 cox 2 0 1.0 aa is the preferred substrate for cox 1 and cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116162 16647138 150346 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 2 gene is 8.3 kb whereas the cox 1 gene is much larger 22 kb vane et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116163 16647138 150347 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 mrna is approximately 2.8 kb while cox 2 mrna is approximately 4.0 kb. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116164 16647138 150348 17610 9605 PTGS2 cox 2 cox 2 0 1.0 analysis of the 5_amp_#x2032; flanking untranslated regions of cox 1 and cox 2 indicates that the cox 1 gene is associated with housekeeping activities whereas the cox 2 gene is involved in response related activities. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116165 16647138 150349 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the 5_amp_#x2032; flanking region of the cox 2 gene has a tata box 30 base pairs upstream from the transcription start site tazawa et al. 1994 whereas the same region in the cox 1 gene has no canonic tata box wu 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116166 16647138 150350 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 2 gene also contains a number of putative regulatory sites including the cyclic amp response element il 6 response element ap 2 nuclear factor _amp_#x3ba;b nf _amp_#x3ba;b sp 1 pea 3 gata 1 and glucoco 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116167 16647138 150350 22027 11742 TFAP2A ap 2 ap 2 0 1.0 the cox 2 gene also contains a number of putative regulatory sites including the cyclic amp response element il 6 response element ap 2 nuclear factor _amp_#x3ba;b nf _amp_#x3ba;b sp 1 pea 3 gata 1 and glucocorticoid response element wu 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116168 16647138 150350 10463 6018 IL6 il 6 il 6 0 1.0 the cox 2 gene also contains a number of putative regulatory sites including the cyclic amp response element il 6 response element ap 2 nuclear factor _amp_#x3ba;b nf _amp_#x3ba;b sp 1 pea 3 gata 1 and glucocorticoid response element wu 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116169 16647138 150351 10480 5962 IL10 il 10 il 10 0 1.0 thus factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 can specifically inhibit cox 2 upregulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116170 16647138 150351 10490 5973 IL13 il 13 il 13 0 1.0 thus factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 can specifically inhibit cox 2 upregulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116171 16647138 150351 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 can specifically inhibit cox 2 upregulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116172 16647138 150351 10458 6014 IL4 il 4 il 4 0 1.0 thus factors that inhibit nf _amp_#x3ba;b activity such as il 4 il 10 and il 13 can specifically inhibit cox 2 upregulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116173 16647138 150352 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 1 gene also has some putative regulatory sites such as sp 1 ap 2 nf il 6 gata 1 and a shear stress response element but the location of these sites differs considerably from those in the cox 2 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116174 16647138 150352 22027 11742 TFAP2A ap 2 ap 2 0 1.0 the cox 1 gene also has some putative regulatory sites such as sp 1 ap 2 nf il 6 gata 1 and a shear stress response element but the location of these sites differs considerably from those in the cox 2 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116175 16647138 150352 10463 6018 IL6 il 6 il 6 0 1.0 the cox 1 gene also has some putative regulatory sites such as sp 1 ap 2 nf il 6 gata 1 and a shear stress response element but the location of these sites differs considerably from those in the cox 2 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116176 16647138 150353 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 does not respond to nf _amp_#x3ba;b as intensely as cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116177 16647138 150354 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in rat and ovine brain cox 1 and cox 2 immunoreactivities are present in discrete neuronal populations distributed in distinct areas of cerebral cortex midbrain and hippocampus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116178 16647138 150355 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 immunoreactivity is enriched in midbrain pons and medulla breder et al. 1995 whereas cox 2 immunoreactivity prevails in neurons and glial cells of hippocampus hypothalamus and amygdala andreasson et al. 2001 and yamagata et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116179 16647138 150356 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in neurons astrocytes and microglial cells cox 2 immunoreactivity is localized to the perinuclear regions tomimoto et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116180 16647138 150357 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the expression of cox 2 is markedly increased in microglial cells after intraperitoneal administration of lipopolysaccharide lps whereas neuronal cox 2 remains unchanged elmquist et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116181 16647138 150358 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in microglial cells cox 2 expression and ability to release pge 2 txa 2 and txb 2 upon stimulation by lps are several times higher than in astrocytes but lower than in peripheral macrophages giulian et al. 1996 and minghetti 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116182 16647138 150359 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 induction in microglia by proinflammatory stimuli is apparently similar to peripheral macrophages and plays important roles in inflammatory and immune responses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116183 16647138 150361 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although different pharmacological properties have been described for cox 3 compared with cox 1 or cox 2 enzymes many investigators consider it to be a splice variant of cox 1 chandrasekharan et al. 2002 and davies et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116184 16647138 150364 17610 9605 PTGS2 cox 2 cox 2 0 1.0 comparison of canine cox 3 activity with murine cox 1 and cox 2 demonstrates that analgesic/antipyretic drugs such as acetaminophen phenacetin antipyrine and dipyrone selectively inhibit cox 3 and some nonsteroidal anti inflammatory drugs potently inhibit cox 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116185 16647138 150372 17610 9605 PTGS2 cox 2 cox 2 0 1.0 ce analysis indicated that the 98 base pair intron 1 of cox 1 gene remains unprocessed in cox 3 inducing a frameshift mutation and a 127 amino acid open reading frame with no sequence similarity with cox 2 snipes et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116186 16647138 150388 604 435 ALOX5 5 lox 5 lox 0 1.0 the biosynthesis of leukotrienes including 5 hydroxyeicosatetraenoic acid 5 hete involves 5 lox. 12 lox the most common lox in the brain hambrecht et al. 1987 with its mrna present in rat cortical neurons astrocytes and oligodendrocytes bendani et al. 1995 generates predominantly 12 hydroxyeico 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116187 16647138 150388 606 429 ALOX12 12 lox 12 lox 0 1.0 the biosynthesis of leukotrienes including 5 hydroxyeicosatetraenoic acid 5 hete involves 5 lox. 12 lox the most common lox in the brain hambrecht et al. 1987 with its mrna present in rat cortical neurons astrocytes and oligodendrocytes bendani et al. 1995 generates predominantly 12 hydroxyeicosatetrae 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116188 16647138 150397 604 435 ALOX5 5 lox 5 lox 0 1.0 they include 5 lox 12 lox and 15 lox. 12 lox catalyzes the stereospecific incorporation of molecular oxygen into the c 12 position of aa to generate 12 hpete which is reduced by cellular glutathione peroxidase to 12 he 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116189 16647138 150397 606 429 ALOX12 12 lox 12 lox 0 1.0 they include 5 lox 12 lox and 15 lox. 12 lox catalyzes the stereospecific incorporation of molecular oxygen into the c 12 position of aa to generate 12 hpete which is reduced by cellular glutathione peroxidase to 12 hete li et al. 1997 . 12 lox 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116190 16647138 150397 606 429 ALOX12 12 lox 12 lox 0 1.0 catalyzes the stereospecific incorporation of molecular oxygen into the c 12 position of aa to generate 12 hpete which is reduced by cellular glutathione peroxidase to 12 hete li et al. 1997 . 12 lox has been cloned and characterized from rat brain watanabe et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116191 16647138 150397 8759 4553 GPX1 cellular glutathione peroxidase cellular glutathione peroxidase 0 1.0 they include 5 lox 12 lox and 15 lox. 12 lox catalyzes the stereospecific incorporation of molecular oxygen into the c 12 position of aa to generate 12 hpete which is reduced by cellular glutathione peroxidase to 12 hete li et al. 1997 . 12 lox has been cloned and characterized from rat brain watanabe et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116192 16647138 150398 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 rat brain 12 lipoxygenase contains six conserved histidines characteristic for all cloned lipoxygenases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116193 16647138 150399 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 it displays the highest degree of identity to porcine leukocyte 12 lipoxygenase 71% and to human 15 lipoxygenase 75% but has less resemblance to human platelet 12 lipoxygenase 59% or rat leukocyte 5 lipoxygenase 41% . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116194 16647138 150401 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 a part of the brain 12 lipoxygenase cdna is used as a probe in northern blots. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116195 16647138 150402 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 sequencing of parts of the corresponding cdnas from other rat tissues and their comparison with brain 12 lipoxygenase indicates that mrnas from the different rat tissues are identical watanabe et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116196 16647138 150403 604 435 ALOX5 5 lox 5 lox 0 1.0 5 lox and 15 lox have also been sequenced from several non neural sources dixon et al. 1988 matsumoto et al. 1988 and sigal et al. 1988 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116197 16647138 150404 604 435 ALOX5 5 lox 5 lox 0 1.0 they have a molecular mass of 78 kda and share considerable homology with 5 lox and 15 lox from soybean. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116198 16647138 150408 604 435 ALOX5 5 lox 5 lox 0 1.0 5 lox is present in brain tissue and neural cells in the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116199 16647138 150409 604 435 ALOX5 5 lox 5 lox 0 1.0 upon cell activation leading to leukotriene synthesis 5 lox translocates from the cytoplasm to the nuclear envelope. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116200 16647138 150412 8779 4566 GRB2 growth factor receptor-bound protein 2 growth factor receptor bound protein 2 0 1.0 nd other microsomal glutathione transferases but has no enzymic activity itself. 5 lox also contains an src homology 3 sh3 binding motif which may be involved in the interaction of 5 lox protein with growth factor receptor bound protein 2 grb2 lepley et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116201 16647138 150412 604 435 ALOX5 5 lox 5 lox 0 1.0 flap shows homology with ltc 4 synthase and other microsomal glutathione transferases but has no enzymic activity itself. 5 lox also contains an src homology 3 sh3 binding motif which may be involved in the interaction of 5 lox protein with growth factor receptor bound protein 2 grb2 lepley et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116202 16647138 150412 604 435 ALOX5 5 lox 5 lox 0 1.0 also contains an src homology 3 sh3 binding motif which may be involved in the interaction of 5 lox protein with growth factor receptor bound protein 2 grb2 lepley et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116203 16647138 150413 604 435 ALOX5 5 lox 5 lox 0 1.0 in cerebellar granule neurons dexamethasone a glucocorticoid increases 5 lox mrna and protein contents 3 h after treatment and this increase persists for at least 24 h. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116204 16647138 150414 604 435 ALOX5 5 lox 5 lox 0 1.0 the glucocorticoid antagonist ru486 blocks the stimulatory effect of dexamethasone on 5 lox expression indicating that dexamethasone increases 5 lox expression in a glucocorticoid receptor dependent manner uz et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116205 16647138 150414 14650 7978 NR3C1 glucocorticoid receptor glucocorticoid receptor 0 1.0 the glucocorticoid antagonist ru486 blocks the stimulatory effect of dexamethasone on 5 lox expression indicating that dexamethasone increases 5 lox expression in a glucocorticoid receptor dependent manner uz et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116206 16647138 150415 604 435 ALOX5 5 lox 5 lox 0 1.0 these studies also indicate that dexamethasone increases the stability of 5 lox mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116207 16647138 150419 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 cytochrome p450 epoxygenases epox 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116208 16647138 150420 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 in addition to the cox and lox pathways the cytochrome p450 cyp450 pathways also catalyze arachidonic acid conversion to biologically active compounds by an nadph dependent oxidative reaction coon 2005 and kroetz and xu 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116209 16647138 150423 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 although the levels of various cytochrome p450 enzymes in brain are low it has been shown that these enzymes are expressed at relatively high levels in astrocytes peng et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116210 16647138 150426 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition adenovirus mediated cyp2c9 gene transfection and epox overexpression in endothelial cells result in endothelial cell tube formation by stimulating cox 2 expression and prostacyclin production michaelis et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116211 16647138 150427 16613 8975 PIK3CA pi3-kinase pi3 kinase 0 1.0 in endothelial cell cultures the overexpression of epox upregulates both endothelial nitric oxide synthase enos and pi3 kinase/akt pathways. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 16613 8975 PIK3CA 1 UserEdit 116212 16647138 150427 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 in endothelial cell cultures the overexpression of epox upregulates both endothelial nitric oxide synthase enos and pi3 kinase/akt pathways. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116213 16647138 150427 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 in endothelial cell cultures the overexpression of epox upregulates both endothelial nitric oxide synthase enos and pi3 kinase/akt pathways. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116214 16647138 150428 16613 8975 PIK3CA pi3-kinase pi3 kinase 0 1.0 not only enos inhibitors but also pi3 kinase/akt signaling pathway inhibitors can prevent this upregulation by epox. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 16616 8978 PIK3CG 0 116215 16647138 150429 16613 8975 PIK3CA pi3-kinase pi3 kinase 0 1.0 this indicates that both enos and pi3 kinase/akt pathways may mediate the angiogenic effects of eets kawasaki et al. 2003 . 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 16616 8978 PIK3CG 0 116216 16647138 150431 16613 8975 PIK3CA pi3-kinase pi3 kinase 0 1.0 collectively these studies suggest that epox derived eets modulate angiogenesis via a nitric oxide dependent mechanism as well as via activation of pi3 kinase and mark pathways wang et al. 2003 and wang et al. 2005b . 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 16616 8978 PIK3CG 0 116217 16647138 150432 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 studies on astroglial cytochrome p450 expression suggest a putative capacity of these enzymes to metabolize in situ psychoactive or lipophilic xenobiotics that are associated with pharmacological and/or toxicological consequences. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116218 16647138 150433 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 astrocytes appear to be the most active steroidogenic cells in the brain expressing neurosteroidogenic cytochrome p450 and producing various neurosteroids. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116219 16647138 150453 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the first phase of arachidonic acid release involves the expression and stimulation of ipla 2 with the generation of pge 2 ltb 4 and paf through cox 2 lox and acetyl coa acetyltransferase reactions respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116220 16647138 150456 17610 9605 PTGS2 cox 2 cox 2 0 1.0 pla 2 cox 2 and lox inhibitors have been used to treat acute inflammation and pain de gaetano et al. 2003 farooqui et al. in press and yeo et al. 2004 in various animal models of pain mediated by inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116221 16647138 150465 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 the d class resolvins block tumor necrosis factor _amp_#x3b1; induced interleukin il 1_amp_#x3b2; transcripts and are potent regulators of pmn infiltration in brain serhan et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116222 16647138 150484 606 429 ALOX12 12 lox 12 lox 0 1.0 the action of 12 lox produces lipid hydroperoxides. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116223 16647138 150495 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 and cox 2 play a central role in the induction of nociception produced by injections of complete freund's adjuvant or carrageenan into the paw hay et al. 1997 ichitani et al. 1997 and ito et al. 2001b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116224 16647138 150496 17610 9605 PTGS2 cox 2 cox 2 0 1.0 an increase in the expression of cox 2 activity accompanies the induction of nociception svensson and yaksh 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116225 16647138 150497 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 expression and its activity in neuropathic pain are controversial. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116226 16647138 150498 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 levels in the dorsal spinal cord increase following a l5/l6 spinal nerve ligation zhao et al. 2000 and intrathecal or local injections of cox 2 inhibitors prevent the development of nociception. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116227 16647138 150499 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in contrast only a very small change in spinal cord cox 2 mrna and protein expression follows the spared nerve injury model of partial nerve injury in the rat and selective cox 2 inhibition does not alter the nociception. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116228 16647138 150500 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this indicates that cox 2 does not play a role in the development and maintenance of nociception broom et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116229 16647138 150501 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this suggests that nociception is modulated by interactions between central as well as peripheral nociceptive mechanisms and both mechanisms involve cox 2 generated metabolites. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116230 16647138 150507 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nmda receptor dependent synaptic activity dynamically regulates the expression of the cox 2 gene in brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116231 16647138 150510 17610 9605 PTGS2 cox 2 cox 2 0 1.0 during ltp induction the most abundant prostaglandins generated in the brain through cox 1/cox 2 pathways pge 2 pgf 2a and pgd 2 are modulators of synaptic activity and efficacy by exerting their paracrine effect through pre and postsynaptic receptors and their autocrine effect through intraneur 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116232 16647138 150511 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the observation that cox 2 inhibitors block the induction of ltp in hippocampal dentate granules neurons supports this suggestion chen et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116233 16647138 150512 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the addition of pge 2 but not pgd 2 or pgf 2_amp_#x3b1; reverses cox 2 mediated suppression of ltp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116234 16647138 150513 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these studies suggest that pge 2 is the effector of cox 2 induced synaptic plasticity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116235 16647138 150514 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the translocation of cox 2 to the nuclear envelope during neural cell stimulation generates eicosanoids that are involved in gene expression morita et al. 1995 and vane et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116236 16647138 150518 606 429 ALOX12 12 lox 12 lox 0 1.0 thus in mechanosensory neurons of the marine mollusk aplysia californica 12 lox metabolites act as second messengers and participate in communication with local groups of cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116237 16647138 150519 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 hpetes and leukotrienes generated by 5 lox and 12 lox inhibit neurotransmitter release by modulating calcium and protein kinase c activity and affect synaptic activity and efficacy wolfe and horrocks 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116238 16647138 150519 604 435 ALOX5 5 lox 5 lox 0 1.0 hpetes and leukotrienes generated by 5 lox and 12 lox inhibit neurotransmitter release by modulating calcium and protein kinase c activity and affect synaptic activity and efficacy wolfe and horrocks 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116239 16647138 150519 606 429 ALOX12 12 lox 12 lox 0 1.0 hpetes and leukotrienes generated by 5 lox and 12 lox inhibit neurotransmitter release by modulating calcium and protein kinase c activity and affect synaptic activity and efficacy wolfe and horrocks 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116240 16647138 150528 1279 800 ATP1A2 sodium-potassium atpase sodium potassium atpase 0 1.0 inhibition of sodium potassium atpase by 4 hne can result in the depolarization of neuronal membranes leading to the opening of nmda receptor channels and the influx of additional calcium into the cell kadoya et al. 2003 . 4 hne induces 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116241 16647138 150528 17610 9605 PTGS2 cox 2 cox 2 0 1.0 by 4 hne can result in the depolarization of neuronal membranes leading to the opening of nmda receptor channels and the influx of additional calcium into the cell kadoya et al. 2003 . 4 hne induces cox 2 expression in macrophages. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116242 16647138 150529 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the expression of cox 2 plays an important role in the intensification of inflammatory responses in brain tissue. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116243 16647138 150608 10640 14645 IPPK inositol 1 inositol 1 0 1.0 ate transcription factors and gene expression and stimulate activities of phospholipases a 2 c and d. the stimulation of these enzymes results in the generation of arachidonic acid diacylglycerol and inositol 1 4 5 trisphosphate. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 116244 16647138 150609 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 arachidonic acid is metabolized to eicosanoids diacylglycerol activates protein kinase c and inositol 1 4 5 trisphosphate mobilizes calcium from intracellular stores ishii and shimizu 2000 and izumi and shimizu 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116245 16647138 150609 10640 14645 IPPK inositol 1 inositol 1 0 1.0 arachidonic acid is metabolized to eicosanoids diacylglycerol activates protein kinase c and inositol 1 4 5 trisphosphate mobilizes calcium from intracellular stores ishii and shimizu 2000 and izumi and shimizu 1995 . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 116246 16647138 150611 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 paf stimulates phosphatidylinositol 3 kinase and mitogen activated protein map kinase and inhibits adenylate cyclase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116247 16647138 150611 12355 6872 MAPK10 map kinase map kinase 0 1.0 paf stimulates phosphatidylinositol 3 kinase and mitogen activated protein map kinase and inhibits adenylate cyclase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116248 16647138 150611 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 1.0 paf stimulates phosphatidylinositol 3 kinase and mitogen activated protein map kinase and inhibits adenylate cyclase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116249 16647138 150616 17610 9605 PTGS2 cox 2 cox 2 0 1.0 paf also stimulates the inducible isoform of cox 2 bazan et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116250 16647138 150617 17610 9605 PTGS2 cox 2 cox 2 0 1.0 an immediate early gene encodes cox 2 which is responsible for prostaglandin synthesis in neuropathological processes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116251 16647138 150618 17610 9605 PTGS2 cox 2 cox 2 0 1.0 preincubation of cells with paf antagonist bn 50730 blocks stimulation of the immediate early gene responsible for cox 2 bazan et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116252 16647138 150624 17732 9717 PXMP3 paf 1 paf 1 0 1.0 in rats the administration of paf antagonists impairs spatial learning and inhibitory avoidance tests while treatment with a synthetic non hydrolyzable analog of paf 1 o hexadecyl 2 methylcarbamoyl sn glycerol 3 phosphocholine enhances memory packard et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116253 16647138 150635 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 excessive levels of paf are associated with neuronal injury in brain tissue and are involved in ischemic injury spinal cord injury hiv multiple sclerosis and meningitis brochet et al. 1995 and gelbard et al. 1994 table 2 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 116254 16647138 150637 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 paf activates inflammatory cells and increases vasopermeability a role it may play in acute and chronic inflammatory diseases such as multiple sclerosis and viral and bacterial infections brochet et al. 1995 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 116255 16647138 150638 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 administration of paf antagonists improves the neurological score of patients with multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 116256 16647138 150639 16715 9040 PLA2G7 platelet-activating factor acetylhydrolase platelet activating factor acetylhydrolase 0 1.0 a mutation of platelet activating factor acetylhydrolase in man causes a devastating neuro developmental syndrome miller_amp_#x2013;dieker lissencephaly or miller_amp_#x2013;dieker syndrome mds . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116257 16647138 150640 16715 9040 PLA2G7 platelet-activating factor acetylhydrolase platelet activating factor acetylhydrolase 0 1.0 these patients have a thick cerebral cortex that is formed without its usual folds indicating that platelet activating factor acetylhydrolase plays a crucial role in brain development. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116258 16647138 150667 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 12 hydroxyeicosatetraenoic acid 12 hete is a product of 12 lipoxygenase's action on arachidonic acid. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116259 16647138 150670 606 429 ALOX12 arachidonate 12-lipoxygenase arachidonate 12 lipoxygenase 0 1.0 a cdna encoding for arachidonate 12 lipoxygenase was identified in rat brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116260 16647138 150670 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 a cdna encoding for arachidonate 12 lipoxygenase was identified in rat brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116261 16647138 150671 606 429 ALOX12 12 lox 12 lox 0 1.0 cloned rat brain 12 lox generates some 15 hete watanabe et al. 1993 . 15 lox also synthesizes 12 and 15 hete from arachidonic acid kuhn et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116262 16647138 150674 5369 2634 CYP2J2 arachidonic acid epoxygenase arachidonic acid epoxygenase 0 1.0 eets and 20 hete: products of p450 arachidonic acid epoxygenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116263 16647138 150675 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 brain parenchymal tissue metabolizes arachidonic acid via the cytochrome p450 epoxygenase to epoxyeicosatrienoic acids eets which can dilate cerebral arterioles and increase k + currents in cerebral arteriolar smooth muscle cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116264 16647138 150682 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 treatment of the donor vessels with a cytochrome p450 epoxygenase inhibitor ppoh eliminated dilator responses in both donor and detector vessels as well as hyperpolarization of detector vessels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116265 16647138 150699 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 in this instance they presented evidence that cytochrome p450 derived epoxyeicosatrienoic acids induced the vasodilation as well as an increase in capillary density. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116266 16647138 150701 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 brief exposures 5 min of rat brain slices to _amp_#x3b1; amino 3 hydroxy 5 methyl 4 isoxazolepropionic acid ampa a glutamate receptor agonist elicited increases in arteriolar diameter and decreased vasomotion frequency which were not inhibited by the epoxygenase inhibitor miconazole lovick et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116267 16647138 150720 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 2 inhibitor ns 398 was ineffective as were two cytochrome p450 antagonists ms ppoh and miconazole suggesting that cox 2 and p450 metabolites do not play a significant role in vasodilation as compared to cox 1 metabolites. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116268 16647138 150720 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 the cox 2 inhibitor ns 398 was ineffective as were two cytochrome p450 antagonists ms ppoh and miconazole suggesting that cox 2 and p450 metabolites do not play a significant role in vasodilation as compared to cox 1 metabolites. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116269 16647138 150725 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2006 observed dense immunohistochemical staining for cox 1 but not cox 2 in the astrocytic endfeet that ensheath cortical arterioles as well as in small cells with a morphology typical of microglial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116270 16647138 150737 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 expression and prostaglandin e2 production are enhanced in the spinal cord after peripheral tissue injury and subsequent inflammation dirig and yaksh 1999 ichitani et al. 1997 nakayama et al. 2002 an 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116271 16647138 150751 8408 4326 GLRA1 glycine receptor glycine receptor 0 1.0 the inhibitory strychnine sensitive glycine receptor was identified as a specific target of pge 2 but not of pgf 2_amp_#x3b1; pgd 2 or pgi 2 which reduced inhibitory glycinergic synaptic transmission at low nanomolar concentrations whereas gaba ampa an 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116272 16647138 150752 17300 9388 PRKAR1A camp-dependent protein kinase camp dependent protein kinase 0 1.0 inhibition of glycine receptors occurred via a postsynaptic mechanism involving activation of ep2 receptors cholera toxin sensitive g proteins and camp dependent protein kinase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116273 16647138 150754 17610 9605 PTGS2 cox 2 cox 2 0 1.0 constitutive levels of cox 2 in the spinal cord are low but peripheral inflammation upregulates this enzyme beiche et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116274 16647138 150762 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in the brain synaptic activity regulates the basal expression of cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116275 16647138 150764 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore cox 2 is localized in neuronal dendritic spines where active synapses are located kaufmann et al. 1996 implying that both constitutive and inducible cox 2 may participate in synaptic plasticity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116276 16647138 150765 17610 9605 PTGS2 cox 2 cox 2 0 1.0 selective cox 2 inhibition significantly reduced postsynaptic excitability back propagation of dendritic action potential associated ca 2+ influx and induction of long term potentiation in hippocampal dentate granul 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116277 16647138 150767 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these results are consistent with a likely role of pge 2 generated by cox 2 in the regulation of membrane excitability and long term synaptic plasticity in hippocampal perforant path_amp_#x2013;dentate gyrus synapses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116278 16647138 150769 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 synthesized pge 2 may act on pg receptors within the same neuron or in neighboring neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116279 16647138 150771 17610 9605 PTGS2 cox 2 cox 2 0 1.0 administration of a selective cox 2 inhibitor to eliminate endogenous pge 2 reduced somatic and dendritic membrane excitability in hippocampal ca1 pyramidal neurons in brain slices. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116280 16647138 150772 17610 9605 PTGS2 cox 2 cox 2 0 1.0 as reversed by applications of pge 2 which produced significant increases in frequency of firing excitatory postsynaptic potential amplitude and temporal summation in slices previously treated with a cox 2 inhibitor chen and bazan 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116281 16647138 150781 17610 9605 PTGS2 cox 2 cox 2 0 1.0 an interesting new finding is that there is a profound difference between nsaids with different selectivities for cox 1 and cox 2 with regard to their effects on the synthesis of endogenous levels of rat brain kynurenic acid kyna schwieler et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116282 16647138 150782 17610 9605 PTGS2 cox 2 cox 2 0 1.0 nsaids displaying an inhibitory action on cox 1 increased brain kyna formation whereas cox 2 selective inhibitors had the opposite effect. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116283 16647138 150784 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 an inhibitory action on cox 1 could possibly contribute to a reduction in glutamatergic transmission along pain recognition pathways thus enhancing analgesic activity because kynurenic acid acts as a glutamate receptor antagonist with some selectivity for the nmda receptor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116284 16647138 150788 606 429 ALOX12 12 lox 12 lox 0 1.0 much of the interest in the role of lipoxygenases as modulators of synaptic function in the central nervous system has been focused on 12 lox. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116285 16647138 150789 606 429 ALOX12 12 lox 12 lox 0 1.0 detection of 12 lox mrna was reported in neuronal cultures palluy et al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116286 16647138 150790 606 429 ALOX12 12 lox 12 lox 0 1.0 in 1990 several groups suggested that arachidonic acid or one of its 12 lox metabolites might function as a retrograde messenger in long term potentiation ltp and long term depression ltd in the hippocampus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116287 16647138 150792 606 429 ALOX12 12 lox 12 lox 0 1.0 two 12 lox metabolites of arachidonic acid 12 hydroxyeicosatrienoic acid hete and 12 hydroperoxyeicosatetraenoic acid 12 hpete significantly increased k + stimulated release of glutamate from hippocampal synapt 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116288 16647138 150794 606 429 ALOX12 12 lox 12 lox 0 1.0 1990 demonstrated that the 12 lox pathway of arachidonic acid metabolism in cerebral cortical slices was stimulated by glutamate and n methyl d aspartate with the formation of 12 hete. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116289 16647138 150797 606 429 ALOX12 12 lox 12 lox 0 1.0 however in this instance 12 lox products attenuated depolarization evoked accumulation of intraterminal free ca 2+ and glutamate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116290 16647138 150798 606 429 ALOX12 12 lox 12 lox 0 1.0 they proposed that while arachidonic acid acts as a positive modulator of the glutamate release involved in long term potentiation 12 lox metabolites provide signals designed to limit neurotransmitter release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116291 16647138 150799 604 435 ALOX5 5 lox 5 lox 0 1.0 further evidence for an involvement of 12 lox rather than 5 lox or a cyclooxygenase in homosynaptic long term depression of the hippocampus was obtained using selective inhibitors for each of these enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116292 16647138 150799 606 429 ALOX12 12 lox 12 lox 0 1.0 further evidence for an involvement of 12 lox rather than 5 lox or a cyclooxygenase in homosynaptic long term depression of the hippocampus was obtained using selective inhibitors for each of these enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116293 16647138 150800 606 429 ALOX12 12 lox 12 lox 0 1.0 the 12 lox inhibitor baicalein was the most effective in blocking hippocampal ltd normandin et al. 1996 indicating that 12 lox metabolites may be important factors controlling the expression of hippocampal ltd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116294 16647138 150802 606 429 ALOX12 12 lox 12 lox 0 1.0 oncentrations caused a decrease and high concentrations an increase in agonist binding which was a consequence of modifications to receptor affinity and not to changes in the number of binding sites. 12 lox inhibitors preferentially reduced the pla 2 induced decrease in ampa binding and the addition of 12 hpete decreased ampa binding. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116295 16647138 150803 606 429 ALOX12 12 lox 12 lox 0 1.0 the 12 lox inhibitor baicalein totally blocked ltd in the ca1 region of hippocampal slices. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116296 16647138 150804 606 429 ALOX12 12 lox 12 lox 0 1.0 overall these results were consistent with the concept that arachidonic acid metabolites produced by the 12 lox pathway could account for ampa receptor alterations for both ltp and ltd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116297 16647138 150806 606 429 ALOX12 12 lox 12 lox 0 1.0 2003 in a recent multidisciplinary study gave evidence for a role of 12 lox metabolites in metabotropic glutamate receptor dependent long term depression at hippocampal ca3_amp_#x2013;ca1 synapses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116298 16647138 150806 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 2003 in a recent multidisciplinary study gave evidence for a role of 12 lox metabolites in metabotropic glutamate receptor dependent long term depression at hippocampal ca3_amp_#x2013;ca1 synapses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116299 16647138 150807 606 429 ALOX12 12 lox 12 lox 0 1.0 their results strongly support the hypothesis that a 12 lox pathway is required for the induction of metabotropic glutamate receptor dependent ltd but is not required for ltp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116300 16647138 150807 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 their results strongly support the hypothesis that a 12 lox pathway is required for the induction of metabotropic glutamate receptor dependent ltd but is not required for ltp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116301 16647138 150808 606 429 ALOX12 12 lox 12 lox 0 1.0 the 12 lox metabolite of arachidonic acid 12 s hpete appeared to satisfy all the requirements of a messenger molecule that is actively recruited for the induction of metabotropic glutamate receptor dependent lt 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116302 16647138 150808 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 the 12 lox metabolite of arachidonic acid 12 s hpete appeared to satisfy all the requirements of a messenger molecule that is actively recruited for the induction of metabotropic glutamate receptor dependent ltd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116303 16647138 150811 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 in contrast to the cyclo and lipo oxygenases there is currently little evidence that the metabolites of arachidonic acid generated by cytochrome p450 epoxygenase play a significant role in the modulation of synaptic transmission in the cns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116304 16647138 150848 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the development of cox deficient mice has allowed investigators to study the individual roles of the cox 1 and cox 2 isoforms. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116305 16647138 150851 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 deficient mice have poor survival rates reduced resolution of gastrointestinal ulcers progressive renal disease reduced ovulation fertilization implantation and decidualization normal uninduced pg le 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116306 16647138 150852 17610 9605 PTGS2 cox 2 cox 2 0 1.0 it is noteworthy that central nervous system involvement does not appear in these lists and that for the maintenance of normal physiology cox 2 appears to play a more critical role. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116307 16647138 150855 17610 9605 PTGS2 cox 2 cox 2 0 1.0 at 30 to 40 min after il 1_amp_#x3b2; cox 1 ko mice showed a smaller reduction in milk intake in comparison with wild type mice whereas cox 2 mice responded more like wild type animals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116308 16647138 150856 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however at 90 to 120 min after il 1_amp_#x3b2; administration cox 2 ko mice showed only small responses while cox 1 ko mice responded normally. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116309 16647138 150857 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this result suggests that while cox 1 is primarily involved in the early phase of milk intake cox 2 is more responsible for the later phase swiergiel and dunn 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116310 16647138 150858 17610 9605 PTGS2 cox 2 cox 2 0 1.0 iadecola et al. 2001a and iadecola et al. 2001b have demonstrated reduced and increased susceptibility to ischemic brain injury in cox 2 and cox 1 deficient mice respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116311 16647138 150860 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2004 also observed a decreased level of neuronal injury produced by transient global ischemia in cox 2 deficient mice in comparison with wild type mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116312 16647138 150861 17610 9605 PTGS2 cox 2 cox 2 0 1.0 various lines of evidence implicate cox 2 in fever production. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116313 16647138 150862 17610 9605 PTGS2 cox 2 cox 2 0 1.0 its expression is enhanced in the brain after peripheral intraperitoneal lipopolysaccharide lps or intravenous and intracerebral il 1_amp_#x3b2; administration whereas cox 2 inhibitors suppress the fever induced by these pyrogens cao et al. 1996 cao et al. 1997 cao et al. 2001 ek et al. 2001 and minghetti et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116314 16647138 150864 17610 9605 PTGS2 cox 2 cox 2 0 1.0 1999 assessed the febrile response to injection of intraperitoneal lps in cox 1 and cox 2 deficient mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116315 16647138 150865 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the wild type and cox 1 _amp_#x2212;/_amp_#x2212; mice responded to lps with a 1_amp_#xb0;c rise in temperature whereas the cox 2 _amp_#x2212;/_amp_#x2212; mice displayed no increase in temperature indicating that cox 2 is necessary for lps induced fever production. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116316 16647138 150865 17610 9605 PTGS2 cox 2 cox 2 0 1.0 _amp_#x2212;/_amp_#x2212; mice displayed no increase in temperature indicating that cox 2 is necessary for lps induced fever production. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116317 16647138 150866 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 experiments on 12 lipoxygenase deficient mice indicate that this enzyme may depress responses to morphine and cocaine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116318 16647138 150868 606 429 ALOX12 12 lox 12 lox 0 1.0 in addition the 12 lox deficient mice demonstrated enhanced signs of opiate withdrawal. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116319 16647138 150869 606 429 ALOX12 12 lox 12 lox 0 1.0 cocaine mediated increases in locomotor activity were augmented acutely but not chronically in 12 lox _amp_#x2212;/_amp_#x2212; mice walters et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116320 16647138 150870 606 429 ALOX12 12 lox 12 lox 0 1.0 together these results suggest a role for 12 lox products in morphine and cocaine behavioral responses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116321 16647138 150871 604 435 ALOX5 5 lox 5 lox 0 1.0 studies with 5 lox deficient transgenic animals suggest that this enzyme may contribute to anxiety and depression like behaviors manev and manev 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116322 16647138 150873 17610 9605 PTGS2 cox 2 cox 2 0 1.0 endocannabinoids and cox 2 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116323 16647138 150876 6901 3553 FAAH fatty acid amide hydrolase fatty acid amide hydrolase 0 1.0 the principal enzyme for the metabolism of aea is fatty acid amide hydrolase faah . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116324 16647138 150878 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in addition to these hydrolytic pathways endocannabinoids can be selectively oxygenated by a cox 2 pathway kozak and marnett 2002 and yu et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116325 16647138 150879 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inhibition of cox 2 can potentiate the action of these endocannabinoids kim and alger 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116326 16647138 150880 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 furthermore metabolites of aea and 2 ag derived from cox 2 possess biological activity including the activation of protein kinase c as well as having effects on the contractility of smooth muscle preparations nirodi et al. 2004 and ross et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116327 16647138 150880 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore metabolites of aea and 2 ag derived from cox 2 possess biological activity including the activation of protein kinase c as well as having effects on the contractility of smooth muscle preparations nirodi et al. 2004 and ross et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116328 16647138 150881 17610 9605 PTGS2 cox 2 cox 2 0 1.0 prostanoids derived from both aea and 2 ag are significantly more stable metabolically than free acid pgs suggesting that cox 2 action on endocannabinoids may provide oxygenated lipids with sufficiently long half lives to act as systemic mediators or pro drugs kozak et al. 2004 and patrignani et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116329 16647138 150886 17610 9605 PTGS2 cox 2 cox 2 0 1.0 ns 398 completely inhibited the pge 2 production induced by either aea or maea a selective cox 2 inhibitor indicating induction of cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116330 16647138 150887 17610 9605 PTGS2 cox 2 cox 2 0 1.0 aea and maea increased the expression of cox 2 protein an action that am 251 a selective cannabinoid receptor 1 agonist partially inhibited. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116331 16647138 150887 4644 2159 CNR1 cannabinoid receptor 1 cannabinoid receptor 1 0 1.0 aea and maea increased the expression of cox 2 protein an action that am 251 a selective cannabinoid receptor 1 agonist partially inhibited. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116332 16647138 150888 17610 9605 PTGS2 cox 2 cox 2 0 1.0 additionally aea increased cox 2 promoter activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116333 16647138 150890 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2005 suggested that aea increases cox 2 expression at the transcriptional level through a cannabinoid receptor 1 mediated mechanism in the cerebral microvascular endothelium. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116334 16647138 150890 4644 2159 CNR1 cannabinoid receptor 1 cannabinoid receptor 1 0 1.0 2005 suggested that aea increases cox 2 expression at the transcriptional level through a cannabinoid receptor 1 mediated mechanism in the cerebral microvascular endothelium. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116335 16647138 150893 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2005 concluded that oxidation of ecb by cox 2 decreases their level in the hippocampus thus enhancing ltp. ecbs which are generated during robust stimulation of hippocampal slices stella et al. 1997 tonically decrease basal excitatory transmissi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116336 16647138 150897 17610 9605 PTGS2 cox 2 cox 2 0 1.0 conversely inhibition of cox 2 prevented ltp in hippocampal dentate neurons kim and alger 2004 leading to the conclusion that cox 2 regulates the formation of cb1 ligands that negatively regulate ltp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116337 16647138 150910 606 429 ALOX12 12 lox 12 lox 0 1.0 these increases sustained at up to 30 min post injury confirmed the previous observations and demonstrated an involvement of 12 lox in the injury process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116338 16647138 150914 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 is an important mediator of neuroinflammation feng et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116339 16647138 150916 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 pge 2 one of its products is implicated in inflammation and the apoptosis of cortical cells by acting on the ep2 receptor which in turn activates caspase 3 a pro apoptotic agent takadera et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116340 16647138 150917 17610 9605 PTGS2 cox 2 cox 2 0 1.0 concussive injury of the rat cerebral cortex caused a bilateral induction of cox 2 mrna in the cortex and dentate gyrus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116341 16647138 150918 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 activity was detectable in these areas and persisted in the ipsilateral cortex for at least 72 h kunz et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116342 16647138 150920 17610 9605 PTGS2 cox 2 cox 2 0 1.0 upregulation of cox 2 mrna has also been observed in the rat spinal cord following a traumatic injury adachi et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116343 16647138 150921 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 immunoreactivity in this instance was observed only in endothelial cells of the blood vessels and not in neurons astrocytes monocytes macrophages or microglia at 6 h after injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116344 16647138 150923 17610 9605 PTGS2 cox 2 cox 2 0 1.0 1998 observed trauma induced cox 2 mrna expression in spinal cord neurons and around blood vessels and dash et al. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116345 16647138 150924 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2000 found cox 2 protein almost exclusively in neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116346 16647138 150925 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the effects of cox 2 inhibition on recovery following traumatic brain injury tbi in rats have been contradictory. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116347 16647138 150928 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2000 using celecoxib observed a worsening of motor but not cognitive performance and suggested that cox 2 induction following tbi may play a protective role. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116348 16647138 150943 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 inhibitors of phospholipase a 2 and cytochrome p450 epoxygenase blocked this capacitative ca 2+ entry from the extracellular space indicating a role for these enzymes in capacitative ca 2+ influx with the restoration of normal intracellular ca 2+ leve 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116349 16647138 150946 561 403 ALDH3A2 fatty aldehyde dehydrogenase fatty aldehyde dehydrogenase 0 1.0 it is caused by a deficiency of the microsomal fatty aldehyde dehydrogenase de laurenzi et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116350 16647138 150946 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 0.0 it is caused by a deficiency of the microsomal fatty aldehyde dehydrogenase de laurenzi et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116351 16647138 150951 561 403 ALDH3A2 fatty aldehyde dehydrogenase fatty aldehyde dehydrogenase 0 1.0 the deficiency of fatty aldehyde dehydrogenase is also accompanied by the accumulation of aldehyde modified lipids or fatty alcohols in sls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116352 16647138 150951 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 0.0 the deficiency of fatty aldehyde dehydrogenase is also accompanied by the accumulation of aldehyde modified lipids or fatty alcohols in sls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116353 16647138 150953 604 435 ALOX5 5 lox 5 lox 0 1.0 although the treatment of sls patients with the 5 lox inhibitor zileuton blocks peripheral sls symptoms and inhibits ltb 4 synthesis it does not improve cns symptoms willemsen et al. 2001b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116354 16647138 150956 17610 9605 PTGS2 cox 2 cox 2 0 1.0 studies on cox 1 and cox 2 gene deletion provided some information on the roles of these enzymes in stroke injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116355 16647138 150960 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 deficient mice displayed a reduced susceptibility to ischemic brain injury and nmda neurotoxicity iadecola et al. 2001a and sasaki et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116356 16647138 150961 17610 9605 PTGS2 cox 2 cox 2 0 1.0 conversely mice with neuronal overexpression of cox 2 had increased levels of pge 2 with significant increases in infarct volume following middle cerebral artery occlusion dore et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116357 16647138 150962 17610 9605 PTGS2 cox 2 cox 2 0 1.0 clinical trials have recently revealed that long term therapy with cox 2 inhibitors increases the incidence of myocardial infarction and stroke which has been attributed to blockade of the vasoprotective effects of cox 2 derived pgi 2 fitzgerald 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116358 16647138 150962 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inhibitors increases the incidence of myocardial infarction and stroke which has been attributed to blockade of the vasoprotective effects of cox 2 derived pgi 2 fitzgerald 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116359 16647138 150963 17610 9605 PTGS2 cox 2 cox 2 0 1.0 recent studies have demonstrated that pge 2 may be responsible for the neurotoxic effects of cox 2 manabe et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116360 16647138 150964 17610 9605 PTGS2 cox 2 cox 2 0 1.0 prostaglandin ep1 receptors may be essential for the neurotoxic effects of cox 2 derived pge 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116361 16647138 150967 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 mrna is upregulated in the ischemic rat cerebral hemisphere beginning 6 h after ischemia and reaching a maximum after 12 h nogawa et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116362 16647138 150968 17610 9605 PTGS2 cox 2 cox 2 0 1.0 neurons at the medial edge of the ischemic area had cox 2 immunoreactivity and the injured brain had elevated pge 2 levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116363 16647138 150969 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these data would appear to implicate cox 2 in the mechanisms of delayed neuronal death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116364 16647138 150989 17610 9605 PTGS2 cox 2 cox 2 0 1.0 arachidonic acid released during stroke ischemic or hemorrhagic by pla 2 activation may be converted to prostaglandins by both cox 1 and cox 2 during the immediate response and predominantly by cox 2 during the delayed response murakami et al. 2002 . spla 2 upregulates cox 2 bidgood et al. 2000 and is functionally coupled with cox 2 but not with cox 1 balsinde et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116365 16647138 150989 17610 9605 PTGS2 cox 2 cox 2 0 1.0 during the delayed response murakami et al. 2002 . spla 2 upregulates cox 2 bidgood et al. 2000 and is functionally coupled with cox 2 but not with cox 1 balsinde et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116366 16647138 150990 17610 9605 PTGS2 cox 2 cox 2 0 1.0 substantial increases in cox 2 mrna and protein levels occur in the peri infarct and focal ischemic areas of permanent middle cerebral artery occlusion mcao at 3 to 12 h and 12 to 24 h respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116367 16647138 150991 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in the ischemic core significant increases in cox 2 mrna followed 6 h of ischemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116368 16647138 150992 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the ischemic core during ischemic periods did not show increases in cox 2 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116369 16647138 150995 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 pharmacologic blockade of ep2 signaling by blockade of protein kinase a activation reversed this protective effect mccullough et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116370 16647138 150998 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in another human study cox 1 expressed intensely in microglia but weakly in neurons in control brains whereas cox 2 was absent in control autopsied brains. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116371 16647138 150999 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however cox 2 was induced robustly in neurons during the acute phase of focal ischemia and subsided during the subacute phases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116372 16647138 151000 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 was also upregulated in microglia during focal ischemia tomimoto et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116373 16647138 151015 16737 15917 PLCB1 phospholipase c phospholipase c 0 1.0 the phospholipase c plc inhibitor u73122 also failed to depress significantly ischemia/reperfusion evoked arachidonic acid efflux. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116374 16647138 151020 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 they ascertained the abilities of inhibitors of pla 2 as well as inhibitors of cox lox and cytochrome p450 isozymes to reverse the depolarization. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116375 16647138 151021 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 pretreatment of slice preparations with the pla 2 inhibitor 4 bromophenylacyl bromide pbpb or the cytochrome p450 inhibitor 17 octadecynoic acid 17 oda significantly restored the membrane potential to pre exposure levels after the reintroduction of oxygen and glucose. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116376 16647138 151025 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 iments was that activation of the arachidonic acid cascade via pla 2 and free radical production by arachidonic acid metabolism contribute to the irreversible depolarization by in vitro ischemia with cytochrome p450 isozymes making a major contribution. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116377 16647138 151031 17610 9605 PTGS2 cox 2 cox 2 0 1.0 pretreatment with indomethacin an inhibitor of cox 1 and cox 2 reduced infarct size following focal ischemia with reperfusion in rats buccellati et al. 1998 reduced ischemia evoked ca1 hippocampal injury in a gerbil model sasaki et al. 1988 and suppressed hypere 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116378 16647138 151033 17610 9605 PTGS2 cox 2 cox 2 0 1.0 ibuprofen which also inhibits both cox 1 and cox 2 reduced neuronal injury and improved cerebral blood flow and neurological outcome in global ischemia grice et al. 1987 kuhn et al. 1986 park et al. 2005 and patel et al. 1993 with decreased infarct s 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116379 16647138 151036 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the recent development of selective cox 2 inhibitors has stimulated a number of studies of their efficacy as cerebroprotective agents. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116380 16647138 151038 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the beneficial effects of ns 389 on ischemic brain injury were not apparent in mice with deletion of the inducible nitric oxide synthase nos gene which suggests that cox 2 reaction products may be another mechanism by which inos derived nitric oxide contributes to ischemic brain injury nagayama et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116381 16647138 151038 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the beneficial effects of ns 389 on ischemic brain injury were not apparent in mice with deletion of the inducible nitric oxide synthase nos gene which suggests that cox 2 reaction products may be another mechanism by which inos derived nitric oxide contributes to ischemic brain injury nagayama et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116382 16647138 151040 17610 9605 PTGS2 cox 2 cox 2 0 1.0 another cox 2 inhibitor nimesulide effectively limited hippocampal damage following forebrain ischemia in the gerbil candelario jalil et al. 2002b and candelario jalil et al. 2003a and mouse sasaki et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116383 16647138 151041 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the degree of hippocampal neuronal injury produced by global ischemia in cox 2 deficient mice was less than that in wild type mice sasaki et al. 2004 further demonstrating involvement of this enzyme in ischemic injury to the brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116384 16647138 151044 17610 9605 PTGS2 cox 2 cox 2 0 1.0 selective inhibition of cox 1 by valerylsalicylate or of cox 2 by rofecoxib was used to assess the relative contributions of the two enzymes to ischemia induced oxidative damage in the gerbil brain candelario jalil et al. 2003b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116385 16647138 151046 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the highly selective cox 2 inhibitor dfu was neuroprotective when administered several hours after transient cerebral ischemia in gerbils candelario jalil et al. 2002a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116386 16647138 151047 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the selective cox 2 inhibitors sc58125 and sc58326 are neuroprotective in rat global and focal cerebral ischemia models respectively govoni et al. 2001 and nakayama et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116387 16647138 151049 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2004 examined whether the selective cox 2 inhibitor celecoxib reduces cerebral inflammation and edema after intracerebral hemorrhage in rats. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116388 16647138 151053 17610 9605 PTGS2 cox 2 cox 2 0 1.0 s 2474 a novel nsaid suppresses cox 2 at low nanomolar levels but does not affect cox 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116389 16647138 151062 604 435 ALOX5 5 lox 5 lox 0 1.0 neurons immunostaining for 5 lox were upregulated in sites of focal ischemic damage of human brains tomimoto et al. 2002 and immunoreactive glial cells appeared in injured areas. 5 lox immunoreactive leukocytes infiltrated small blood vessels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116390 16647138 151063 604 435 ALOX5 5 lox 5 lox 0 1.0 cerebral ischemia in the gerbil brain of 5 min duration led to an upregulation of 5 lox immunoreactivity in neurons and an increase in ltc 4 in all regions of the forebrain with the largest increase in the hippocampus ohtsuki et al. 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116391 16647138 151071 604 435 ALOX5 5 lox 5 lox 0 1.0 2001 demonstrated significant protection of ca1 pyramidal cells following the application of two non selective lox inhibitors nordihydroguaiaretic acid and esculentin a selective 5 lox inhibitor aa861 and two selective 12 lox inhibitors baicalein and cinnamyl 3 4 dihydroxy _amp_#x3b1; cyanocinnamate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116392 16647138 151071 606 429 ALOX12 12 lox 12 lox 0 1.0 ignificant protection of ca1 pyramidal cells following the application of two non selective lox inhibitors nordihydroguaiaretic acid and esculentin a selective 5 lox inhibitor aa861 and two selective 12 lox inhibitors baicalein and cinnamyl 3 4 dihydroxy _amp_#x3b1; cyanocinnamate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116393 16647138 151074 604 435 ALOX5 5 lox 5 lox 0 1.0 the importance of 5 lox is further supported by evidence indicating that the gene encoding 5 lox activating protein confers a risk of stroke in humans helgadottir et al. 2004 and lohmussaar et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116394 16647138 151078 604 435 ALOX5 5 lox 5 lox 0 1.0 no significant differences in infarct size between control and 5 lipoxygenase ko mice were evident after permanent or transient 60 min cerebral ischemia kitagawa et al. 2004 indicating that 5 lox is not essential for ischemic injury to the brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116395 16647138 151082 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 eets are the only cytochrome p450 metabolites of arachidonic acid produced by endothelial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116396 16647138 151085 5369 2634 CYP2J2 arachidonic acid epoxygenase arachidonic acid epoxygenase 0 1.0 2002 reported that tia induces the expression of p450 2c11 an arachidonic acid epoxygenase which is upregulated in the brain after a 2 h mcao with 24 h of reperfusion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116397 16647138 151097 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these enzymes include pla 2 cox 2 lox and epox. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116398 16647138 151098 17610 9605 PTGS2 cox 2 cox 2 0 1.0 marked increases in cox 2 and 5 lox mrna and protein levels occur following kainate injections in rat brain adams et al. 1996 manev et al. 1998 and sandhya et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116399 16647138 151098 604 435 ALOX5 5 lox 5 lox 0 1.0 marked increases in cox 2 and 5 lox mrna and protein levels occur following kainate injections in rat brain adams et al. 1996 manev et al. 1998 and sandhya et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116400 16647138 151099 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this increase in cox 2 and 5 lox can be prevented by not only glutamate receptor antagonists koistinaho et al. 1999 and pepicelli et al. 2002 but also by cox 2 and 5 lox inhibitors manev et al. 2000a and pepicelli et al. 2002 indicating that generation of prostaglandins thromboxanes and leukotrienes is a receptor mediated process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116401 16647138 151099 604 435 ALOX5 5 lox 5 lox 0 1.0 this increase in cox 2 and 5 lox can be prevented by not only glutamate receptor antagonists koistinaho et al. 1999 and pepicelli et al. 2002 but also by cox 2 and 5 lox inhibitors manev et al. 2000a and pepicelli et al. 2002 indicating that generation of prostaglandins thromboxanes and leukotrienes is a receptor mediated process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116402 16647138 151099 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 this increase in cox 2 and 5 lox can be prevented by not only glutamate receptor antagonists koistinaho et al. 1999 and pepicelli et al. 2002 but also by cox 2 and 5 lox inhibitors manev et al. 2000a and pepicelli et al. 2002 indicating that generation of prostaglandins thromboxa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116403 16647138 151100 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the role of cox 2 and 5 lox in excitotoxicity is also supported by microdialysis studies in vivo in hippocampus of freely moving rats pepicelli et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116404 16647138 151100 604 435 ALOX5 5 lox 5 lox 0 1.0 the role of cox 2 and 5 lox in excitotoxicity is also supported by microdialysis studies in vivo in hippocampus of freely moving rats pepicelli et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116405 16647138 151101 17610 9605 PTGS2 cox 2 cox 2 0 1.0 pge 2 and 8 epi pgf 2_amp_#x3b1; generation can be blocked by the infusion of nmda antagonists as well as cox 1 and cox 2 inhibitors indicating that both cox 1 and cox 2 contribute to the prostaglandin synthesis and oxidative damage in excitotoxicity pepicelli et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116406 16647138 151104 17610 9605 PTGS2 cox 2 cox 2 0 1.0 his cross talk refines communication among glutamate prostaglandin leukotriene and thromboxane receptors but under pathological situations it promotes neuronal injury that depends on the magnitude of cox 2 and 5 lox expression iadecola et al. 2001a nakayama et al. 1998 and pepicelli et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116407 16647138 151104 604 435 ALOX5 5 lox 5 lox 0 1.0 talk refines communication among glutamate prostaglandin leukotriene and thromboxane receptors but under pathological situations it promotes neuronal injury that depends on the magnitude of cox 2 and 5 lox expression iadecola et al. 2001a nakayama et al. 1998 and pepicelli et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116408 16647138 151105 17610 9605 PTGS2 cox 2 cox 2 0 1.0 it is likely that increased cox 2 and 5 lox activities and high levels of their reaction products are involved in extending excitotoxicity and oxidative stress during neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116409 16647138 151105 604 435 ALOX5 5 lox 5 lox 0 1.0 it is likely that increased cox 2 and 5 lox activities and high levels of their reaction products are involved in extending excitotoxicity and oxidative stress during neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116410 16647138 151107 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 however it is reported that g protein coupled metabotropic glutamate receptors are functionally linked to plc and cytochrome p450 arachidonate epoxygenase activity gebremedhin et al. 2003 indicating that excitotoxicity may also involve epox activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116411 16647138 151108 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the neurochemical consequences of increased cox 2 and 5 lox activities and high levels of their products include not only the generation of highly reactive oxygen free radical species with their potent damaging effects on neural membrane phospholipi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116412 16647138 151108 604 435 ALOX5 5 lox 5 lox 0 1.0 the neurochemical consequences of increased cox 2 and 5 lox activities and high levels of their products include not only the generation of highly reactive oxygen free radical species with their potent damaging effects on neural membrane phospholipids protein 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116413 16647138 151109 17610 9605 PTGS2 cox 2 cox 2 0 1.0 our emphasis on the interaction between glutamate receptors and cox 2 and 5 lox activities and their reaction products does not rule out the participation of other mechanisms involved in neural cell injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116414 16647138 151109 604 435 ALOX5 5 lox 5 lox 0 1.0 our emphasis on the interaction between glutamate receptors and cox 2 and 5 lox activities and their reaction products does not rule out the participation of other mechanisms involved in neural cell injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116415 16647138 151110 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however it is timely and appropriate to apply the concept of synergism between glutamate and cox 2 and 5 lox generated products and their receptors to neural cell injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116416 16647138 151110 604 435 ALOX5 5 lox 5 lox 0 1.0 however it is timely and appropriate to apply the concept of synergism between glutamate and cox 2 and 5 lox generated products and their receptors to neural cell injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116417 16647138 151113 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the synergistic actions of glutamate and cox 2 and 5 lox generated products may be rapid whereas in neurodegenerative disorders in which oxygen and nutrients are available to the nerve cell and ionic gradients are maintained to a limited extent d 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116418 16647138 151113 17610 9605 PTGS2 cox 2 cox 2 0 1.0 hereas in neurodegenerative disorders in which oxygen and nutrients are available to the nerve cell and ionic gradients are maintained to a limited extent due to the availability of atp glutamate and cox 2 and 5 lox product mediated damage may take a longer time to develop. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116419 16647138 151113 604 435 ALOX5 5 lox 5 lox 0 1.0 the synergistic actions of glutamate and cox 2 and 5 lox generated products may be rapid whereas in neurodegenerative disorders in which oxygen and nutrients are available to the nerve cell and ionic gradients are maintained to a limited extent due to the 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116420 16647138 151113 604 435 ALOX5 5 lox 5 lox 0 1.0 neurodegenerative disorders in which oxygen and nutrients are available to the nerve cell and ionic gradients are maintained to a limited extent due to the availability of atp glutamate and cox 2 and 5 lox product mediated damage may take a longer time to develop. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116421 16647138 151114 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these studies suggest that cox 2 and 5 lox generated products along with free radical formation play critical roles in brain damage mediated by the excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116422 16647138 151114 604 435 ALOX5 5 lox 5 lox 0 1.0 these studies suggest that cox 2 and 5 lox generated products along with free radical formation play critical roles in brain damage mediated by the excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116423 16647138 151123 17610 9605 PTGS2 cox 2 cox 2 0 1.0 seizures activate cytosolic pla 2 visioli et al. 1994 and induce the expression of cytosolic pla 2 kajiwara et al. 1996 and cox 2 marcheselli and bazan 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116424 16647138 151125 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in rat brain cox 2 mrna is preferentially expressed in neurons where it is developmentally regulated tocco et al. 1997 and cox 2 expression is induced by kainic acid induced seizures chen et al. 1995 and tocco et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116425 16647138 151126 17610 9605 PTGS2 cox 2 cox 2 0 1.0 glutamate excitotoxicity in primary cultures of rat cortico hippocampal neurons is also associated with increased expression of cox 2 tocco et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116426 16647138 151127 17610 9605 PTGS2 cox 2 cox 2 0 1.0 induction of cox 2 but not cox 1 gene expression has been demonstrated to precede apoptosis in the granule cell layer of the dentate gyrus ho et al. 1998 and may contribute to the mechanisms leading to apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116427 16647138 151134 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in another seizure model the genetically epilepsy susceptible e1 mouse expression of cox 2 in the hippocampus was upregulated after an epileptic seizure and indomethacin a cox 2 inhibitor shortened the duration from seizure onset to full recovery okada et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116428 16647138 151135 17610 9605 PTGS2 cox 2 cox 2 0 1.0 a rat hippocampal kindling model enabled a study of the role of cox 2 in seizure activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116429 16647138 151136 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 encoded in an early response gene increased in a synaptic activity dependent manner with induction becoming evident initially in hippocampal neurons and then spreading to cortical neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116430 16647138 151137 17610 9605 PTGS2 cox 2 cox 2 0 1.0 when rats were rekindled 34 days later this spreading of cox 2 expression persisted. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116431 16647138 151138 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 2 selective inhibitor nimesulide attenuated kindling development tu and bazan 2003 thus neuronal cox 2 gene induction and cpla 2 activation are key signaling events in epileptogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116432 16647138 151140 17610 9605 PTGS2 cox 2 cox 2 0 1.0 2003 examined the effects of cox 2 on the _amp_#x2018;rapid kindling_amp_#x2019; development in cox 2 knockout mice and mice treated with nimesulide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116433 16647138 151141 17610 9605 PTGS2 cox 2 cox 2 0 1.0 they also measured cox 2 mrna expression and pge 2 concentrations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116434 16647138 151142 17610 9605 PTGS2 cox 2 cox 2 0 1.0 kindling in hippocampal neurons of control mice markedly increased brain cox 2 mrna levels with a significant increase in pge 2 levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116435 16647138 151143 17610 9605 PTGS2 cox 2 cox 2 0 1.0 moreover conditions of cox 2 deficiency significantly decreased the incidence of after discharges total after discharge duration and seizure behavior induction suggesting that inducible cox 2 facilitates the recurrence of hippocampal seizures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116436 16647138 151145 17610 9605 PTGS2 cox 2 cox 2 0 1.0 1999 developed a transgenic mouse model with neuronal overexpression of the human cox 2 to further explore its role in excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116437 16647138 151146 17610 9605 PTGS2 cox 2 cox 2 0 1.0 overexpression of hcox 2 potentiated the intensity and lethality of kainic acid excitotoxicity thus demonstrating a cause_amp_#x2013;effect relationship between neuronal cox 2 expression and excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116438 16647138 151146 17610 9605 PTGS2 hcox 2 hcox 2 0 1.0 overexpression of hcox 2 potentiated the intensity and lethality of kainic acid excitotoxicity thus demonstrating a cause_amp_#x2013;effect relationship between neuronal cox 2 expression and excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116439 16647138 151149 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the cox 2 selective inhibitor rofecoxib significantly reduced kainate induced cell death in the rat hippocampus kunz and oliw 2001b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116440 16647138 151150 17610 9605 PTGS2 cox 2 cox 2 0 1.0 another selective cox 2 inhibitor celecoxib was effective in reducing electroshock induced convulsions in rats shafiq et al. 2003 whereas nimesulide aggravated kainic acid induced seizures in the rat kunz and oliw 2001a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116441 16647138 151151 17610 9605 PTGS2 cox 2 cox 2 0 1.0 with the exception of high temperature febrile induced seizures no reports on the effects of cox 2 inhibitors on epileptic seizures in humans have appeared. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116442 16647138 151158 17610 9605 PTGS2 cox 2 cox 2 0 1.0 a marked increase of cox 1 and cox 2 expression and immunoreactivity in cerebral cortex and hippocampal regions of ad brains correlates with the number of senile plaques neuronal atrophy and increased levels of pge 2 found in ad pasinet 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116443 16647138 151159 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the neuroprotective effects of cox 1 and cox 2 inhibitors nsaid strongly support the view that upregulation of these enzymes in ad is detrimental to neuronal survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116444 16647138 151160 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the molecular mechanism by which cox 1 and cox 2 promote amyloidogenic accumulation of _amp_#x3b2; amyloid peptide is not fully understood. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116445 16647138 151161 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 1 and cox 2 potentiate _amp_#x3b2; amyloid peptide generation through mechanisms that involve _amp_#x3b3; secretase activity qin et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116446 16647138 151163 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore cox 2 expression is also involved in regulation of cell cycle activity and cell cycle abnormalities are associated with the pathogenesis of ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116447 16647138 151164 17610 9605 PTGS2 cox 2 cox 2 0 1.0 re entry into the cell cycle may underlie cox 2 mediated neuronal damage in ad xiang et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116448 16647138 151165 604 435 ALOX5 5 lox 5 lox 0 1.0 upregulation of 5 lox expression has also been reported to occur in various regions of older rat brain compared to younger animals manev et al. 2000b and uz et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116449 16647138 151167 604 435 ALOX5 5 lox 5 lox 0 1.0 the significance of 5 lox upregulation in aged rat brain remains unknown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116450 16647138 151168 604 435 ALOX5 5 lox 5 lox 0 1.0 however increased 5 lox activity may make neurons vulnerable to various insults including excitotoxicity and oxidative stress uz et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116451 16647138 151169 604 435 ALOX5 5 lox 5 lox 0 1.0 based on these findings 5 lox gene polymorphism has been proposed for the onset of ad manev 2000 and qu et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116452 16647138 151183 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the sporadic form of this disease is characterized by a prominent neuroinflammatory component upregulation of cox 2 mrna and oxidative stress yasojima et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116453 16647138 151184 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mutations in cu/zn superoxide dismutase sod1 gene have been reported to occur in familial form of als beal 1998a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116454 16647138 151185 17610 9605 PTGS2 cox 2 cox 2 0 1.0 upregulation of cox 2 mrna also occurs in sod1 transgenic mice at the onset of als almer et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116455 16647138 151187 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in an organotypic cell culture model of als the addition of a selective cox 2 inhibitor sc236 blocked the destruction of motor neurons drachman and rothstein 2000 suggesting that cox 2 may play an important role in inflammatory processes in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116456 16647138 151188 17610 9605 PTGS2 cox 2 cox 2 0 1.0 similarly treatment with celecoxib another cox 2 inhibitor prolongs the survival of neurons in the sod1 mouse model of als drachman et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116457 16647138 151189 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although upregulation of cox 2 and pge 2 levels may not be the root cause of als alterations in these parameters may be responsible for the induction and maintenance of inflammation during the progression of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116458 16647138 151194 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the substantia nigra has increased lipid peroxidation iron levels and superoxide dismutase sod activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116459 16647138 151196 17610 9605 PTGS2 cox 2 cox 2 0 1.0 at present nothing is known about the expression of cox 2 in patients with pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116460 16647138 151197 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however involvement of cox 2 in the pathogenesis of pd has been explored in an animal model treated with n methyl 4 phenyl 1 2 3 6 tetrahydropyridine mptp as well as in cox 2 gene knockout mice feng et al. 2003 and teismann et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116461 16647138 151198 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus a lower mortality rate has been reported after mptp injection in heterozygous cox 2 deficient mice than in the wild type mice and inhibition of cox 2 protein expression decreases the lesions caused by mptp and protects dopaminergic neurons in the substantia nigra. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116462 16647138 151199 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the molecular mechanism associated with cox 2 mediated neurodegeneration in animal models of pd remains unknown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116463 16647138 151200 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however cox 2 inhibition may prevent the formation of the oxidant species of reactive quinones. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116464 16647138 151204 606 429 ALOX12 12 lox 12 lox 0 1.0 a decrease in gsh triggers the activation of neuronal 12 lox resulting in the production of 12 lox generated products and peroxides li et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116465 16647138 151205 606 429 ALOX12 12 lox 12 lox 0 1.0 treatment of cell cultures with 12 lox inhibitors blocks neuronal cell death induced by gsh depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116466 16647138 151213 17345 9449 PRNP prion protein prion protein 0 0.0 neuronal loss gliosis and accumulation of abnormal extracellular _amp_#x3b2; helix rich prion protein prp sc characterize cjd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116467 16647138 151213 17345 9449 PRNP prion protein prp prion protein prp 0 1.0 neuronal loss gliosis and accumulation of abnormal extracellular _amp_#x3b2; helix rich prion protein prp sc characterize cjd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116468 16647138 151214 17345 9449 PRNP prion protein prion protein 0 0.0 this abnormal protein is an isoform of a normally occurring _amp_#x3b1; helix rich prion protein prp c whose function has not been clearly elucidated brown 1999 and prusiner 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116469 16647138 151214 17345 9449 PRNP prion protein prp prion protein prp 0 1.0 this abnormal protein is an isoform of a normally occurring _amp_#x3b1; helix rich prion protein prp c whose function has not been clearly elucidated brown 1999 and prusiner 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116470 16647138 151217 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the observation that prp c regulates cu 2+ /zn 2+ superoxide dismutase suggests that prp c is involved in redox balance. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116471 16647138 151219 17610 9605 PTGS2 cox 2 cox 2 0 1.0 using rt pcr and western blotting both cox 1 and cox 2 are significantly increased in brains from cjd patients compared to age matched controls implicating both enzymes in the pathogenesis of cjd deininger et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116472 16647138 151220 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in csf from sporadic and familial cjd and in brain homogenates of scrapie infected mice the upregulation of cox 1 and cox 2 is accompanied by a several fold increase in concentrations of pge 2 and f 2 isoprostane 8 epi prostaglandin f 2_amp_#x3b1; 8 epi pgf 2_amp_#x3b1; compared to age matched controls minghetti et al. 20 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116473 16647138 151229 604 435 ALOX5 5 lox 5 lox 0 1.0 the 5 lox pathway may mediate the prp106_amp_#x2013;126 toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116474 16647138 151230 604 435 ALOX5 5 lox 5 lox 0 1.0 this suggestion is based on the observation that prp106_amp_#x2013;126 mediated neurodegeneration can be blocked by 5 lox inhibitors such as nordihydroguaiaretic acid and caffeic acid. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116475 16647138 151231 604 435 ALOX5 5 lox 5 lox 0 1.0 these inhibitors also prevent the prp106_amp_#x2013;126 induced caspase 3 activation and annexin v binding involved in 5 lox mediated apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116476 16647138 151231 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 these inhibitors also prevent the prp106_amp_#x2013;126 induced caspase 3 activation and annexin v binding involved in 5 lox mediated apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116477 16647138 151232 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in contrast indomethacin a cox 1 and cox 2 inhibitor and baicalein a 12 lox inhibitor do not affect prp106_amp_#x2013;126 induced neurotoxicity in cerebellar granule neuronal cultures stewart et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116478 16647138 151232 606 429 ALOX12 12 lox 12 lox 0 1.0 in contrast indomethacin a cox 1 and cox 2 inhibitor and baicalein a 12 lox inhibitor do not affect prp106_amp_#x2013;126 induced neurotoxicity in cerebellar granule neuronal cultures stewart et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116479 16647138 151233 604 435 ALOX5 5 lox 5 lox 0 1.0 these observations implicate 5 lox in the pathophysiology of cjd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116480 16647138 151240 22058 11765 TGFA transforming growth factor transforming growth factor 0 1.0 for example pge 2 synthesis in astrocytes is more sensitive to exogenous stimuli such as transforming growth factor _amp_#x3b2;1 tgf_amp_#x3b2;1 and serum than are neurons luo et al. 1998b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116481 16647138 151241 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in astrocytes tgf_amp_#x3b2;1 upregulates cox 1 expression and serum increases cox 2 expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116482 16647138 151242 17610 9605 PTGS2 cox 2 cox 2 0 1.0 neither tgf_amp_#x3b2;1 nor serum affects cox 1 and cox 2 expression in neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116483 16647138 151243 17610 9605 PTGS2 cox 2 cox 2 0 1.0 furthermore cox 1 compensates for the loss of cox 2 in the cox 2 knockout cox 2 _amp_#x2212;/_amp_#x2212; mouse brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116484 16647138 151244 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus cox 2 _amp_#x2212;/_amp_#x2212; shows a compensatory increase in brain cox 1 expression and activity with exogenous arachidonic acid in brain tissue bosetti et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116485 16647138 151245 604 435 ALOX5 5 lox 5 lox 0 1.0 similarly neuronal and astrocytic 5 lox 12 lox and 15 lox and epox isozymes differ considerably in responses to exogenous stimuli funk 1996 and kwon et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116486 16647138 151245 606 429 ALOX12 12 lox 12 lox 0 1.0 similarly neuronal and astrocytic 5 lox 12 lox and 15 lox and epox isozymes differ considerably in responses to exogenous stimuli funk 1996 and kwon et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 116487 16647138 151288 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 it is becoming increasingly evident that eicosanoid cannabinoid platelet activating factor and glutamate receptor mediated signaling mechanisms are linked through many common second messengers. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105662 16737688 136267 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 transgenic mice expressing a mutated human cu/zn superoxide dismutase sod1 gene develop a motor neuron disease similar to familial amyotrophic lateral sclerosis fals . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105663 16737688 136279 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 about 15_amp_#x2013;20% of fals has been linked to inheritance in an autosomal dominant fashion of a mutant form of cu/zn superoxide dismutase sod1; rosen 1993 that normally functions in the regulation of oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105664 16737688 136326 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 fluorojade and silver staining as well as sod1 and tyrosine hydroxylase ihc see below were used to identify degenerative changes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105665 16737688 136340 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 primary antibodies were used to further evaluate neurodegenerative alterations sod1 and tyrosine hydroxylase to identify the molecular changes associated with degeneration caspase 3 active and to characterize the immune reaction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105666 16737688 136340 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 primary antibodies were used to further evaluate neurodegenerative alterations sod1 and tyrosine hydroxylase to identify the molecular changes associated with degeneration caspase 3 active and to characterize the immune reaction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105667 16737688 136341 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 therefore we focused on the major participants in the immune response microglia/macrophages phosphotyrosine a specific and excellent marker for microglia; tillotson and wood 1989 astrocytes glial fibrillary acidic protein t cells t cell receptor cd3 and dendritic cells cd11c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105668 16737688 136451 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 fects neurons as well as glial cells and neurites before somata v spreads caudocranially from the spinal cord up to telencephalic areas and vi does not involve the activation of the apoptotic protein caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105669 16737688 136464 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in addition we performed immunohistochemical stainings of active caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105670 16737688 136465 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we did not find evidence for the expression of casp3act in any animal suggesting that either caspase 3 is not involved in cell death and consequently that apoptosis is not a major cell death mechanism in the sod1 g93a transgenics. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105671 16737688 136496 10734 6152 ITGAX integrin alpha x integrin alpha x 0 1.0 the integrin alpha x subunit cd11c is a known marker for dendritic cells dc metlay et al. 1990 and antibodies against this protein have been widely used to analyze the distribution of dendritic cells in nervous system pa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 105672 16737688 136512 22087 11782 TH tyrosine 3-monooxygenase tyrosine 3 monooxygenase 0 1.0 tyrosine 3 monooxygenase|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106051 16753239 137026 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 under such conditions glia can become chronically activated and may contribute to the neuropathology associated with a variety of neuroinflammatory disorders including multiple sclerosis ms alzheimer's disease ad parkinson's disease pd amyotrophic lateral sclerosis als and stroke. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 106052 16753239 137056 7683 3796 FOS ap 1 ap 1 0 1.0 for example these agonists inhibit transcription factors including nf _amp_#x3ba;b ap 1 and stat 1 from activating gene expression in this manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106053 16753239 137085 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 zolidinediones which are commonly used to treat type ii diabetes and the naturally occurring 15d pgj 2 inhibited no as well as the cytokines il 1_amp_#x3b2; il 6 and tnf _amp_#x3b1; and the chemokine mcp 1 by both primary mouse microglia and astrocytes storer et al. 2005a and storer et al. 2005b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106054 16753239 137085 10463 6018 IL6 il 6 il 6 0 1.0 recently we demonstrated that thiazolidinediones which are commonly used to treat type ii diabetes and the naturally occurring 15d pgj 2 inhibited no as well as the cytokines il 1_amp_#x3b2; il 6 and tnf _amp_#x3b1; and the chemokine mcp 1 by both primary mouse microglia and astrocytes storer et al. 2005a and storer et al. 2005b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106055 16753239 137094 10463 6018 IL6 il 6 il 6 0 1.0 2004 demonstrated that the ppar _amp_#x3b3; agonist 15d pgj 2 inhibited lps induction of no tnf _amp_#x3b1; il 1_amp_#x3b2; and il 6 in primary astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106056 16753239 137097 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 furthermore the studies demonstrated that 15d pgj 2 also altered astrocyte expression of these pro inflammatory molecules by inhibiting the phosphatidylinositol 3 kinase akt signaling pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106057 16753239 137099 21416 11364 STAT3 stat 3 stat3 0 1.0 2003 demonstrated that the ppar _amp_#x3b3; agonists 15d pgj 2 and rosiglitazone inhibit the phosphorylation of stat1 stat3 jak1 and jak2 in microglia and astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106058 16753239 137100 20987 19383 SOCS1 socs 1 socs 1 0 1.0 the authors further demonstrated that these agonists induce the expression of suppressor of cytokine signaling socs 1 and 3 which alters jak/stat phosphorylation and jak/stat mediated signaling. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106059 16753239 137100 4413 1984 CISH suppressor of cytokine signaling suppressor of cytokine signaling 0 1.0 the authors further demonstrated that these agonists induce the expression of suppressor of cytokine signaling socs 1 and 3 which alters jak/stat phosphorylation and jak/stat mediated signaling. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106060 16753239 137106 10463 6018 IL6 il 6 il 6 0 1.0 for example these ppar _amp_#x3b3; agonists blocked tnf _amp_#x3b1; and il 6 expression by monocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106061 16753239 137110 17610 9605 PTGS2 cox 2 cox 2 0 1.0 recent studies demonstrated that tzds block the production of inos tnf _amp_#x3b1; il 6 and cox 2 by primary rat microglia and astrocytes and protected cortical neurons in a neuron glia co culture paradigm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106062 16753239 137110 10463 6018 IL6 il 6 il 6 0 1.0 recent studies demonstrated that tzds block the production of inos tnf _amp_#x3b1; il 6 and cox 2 by primary rat microglia and astrocytes and protected cortical neurons in a neuron glia co culture paradigm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106063 16753239 137124 7683 3796 FOS ap 1 ap 1 0 1.0 furthermore these studies indicated that gemfibrozil suppressed cytokine induction of nf _amp_#x3ba;b ap 1 and c/ebp _amp_#x3b2; dependent luciferase activity following transfection into glial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106064 16753239 137125 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 cently demonstrated that a variety of ppar _amp_#x3b1; agonists inhibit the production of no as well as the pro inflammatory cytokines tnf _amp_#x3b1; il 1_amp_#x3b2; il 6 il 12 p40 and the chemokine mcp 1 by primary mouse microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106065 16753239 137125 10463 6018 IL6 il 6 il 6 0 1.0 we recently demonstrated that a variety of ppar _amp_#x3b1; agonists inhibit the production of no as well as the pro inflammatory cytokines tnf _amp_#x3b1; il 1_amp_#x3b2; il 6 il 12 p40 and the chemokine mcp 1 by primary mouse microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106066 16753239 137126 19272 10477 RXRA retinoid x receptor retinoid x receptor 0 1.0 interestingly the ppar _amp_#x3b1; agonist fenofibrate in combination with the retinoid x receptor agonist 9 cis retinoic acid suppressed microglial production of no tnf _amp_#x3b1; il 1_amp_#x3b2; and il 6 in an additive manner xu et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106067 16753239 137126 10463 6018 IL6 il 6 il 6 0 1.0 terestingly the ppar _amp_#x3b1; agonist fenofibrate in combination with the retinoid x receptor agonist 9 cis retinoic acid suppressed microglial production of no tnf _amp_#x3b1; il 1_amp_#x3b2; and il 6 in an additive manner xu et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106068 16753239 137127 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 similarly fenofibrate and 9 cis ra acted in an additive manner in inhibiting lps induction of no tnf _amp_#x3b1; il 1_amp_#x3b2; il 6 and mcp 1 expression in primary astrocytes unpublished data . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106069 16753239 137127 10463 6018 IL6 il 6 il 6 0 1.0 similarly fenofibrate and 9 cis ra acted in an additive manner in inhibiting lps induction of no tnf _amp_#x3b1; il 1_amp_#x3b2; il 6 and mcp 1 expression in primary astrocytes unpublished data . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106070 16753239 137139 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis 3.1.1. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 106071 16753239 137144 12436 6925 MBP myelin basic protein myelin basic protein 0 1.0 using neural antigen specific t cells from the spleen of myelin basic protein ac 1_amp_#x2013;11 tcr transgenic mice which when activated with antigen can induce eae diab et al. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106072 16753239 137146 10480 5962 IL10 il 10 il 10 0 1.0 additionally this agonist suppressed ifn _amp_#x3b3; il 10 and il 4 production by activated lymphocytes diab et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106073 16753239 137146 10458 6014 IL4 il 4 il 4 0 1.0 additionally this agonist suppressed ifn _amp_#x3b3; il 10 and il 4 production by activated lymphocytes diab et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106074 16753239 137198 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 this disease is characterized by death of tyrosine hydroxylase positive neurons in the striatum and substantia nigra. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106075 16753239 137200 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 pioglitazone dramatically inhibited glial activation in these studies suggesting that this ppar _amp_#x3b3; agonist may protect tyrosine hydroxylase positive neurons by controlling glial activation breidert et al. 2002 and dehmer et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106076 16753239 137206 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 recent reports demonstrate that the ppar _amp_#x3b3; agonist pioglitazone protected motor neurons improved motor performance and extended the survival of superoxide dismutase 1 g93a transgenic mice an animal model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106077 16753239 137206 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 recent reports demonstrate that the ppar _amp_#x3b3; agonist pioglitazone protected motor neurons improved motor performance and extended the survival of superoxide dismutase 1 g93a transgenic mice an animal model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106078 16753239 137208 4413 1984 CISH suppressor of cytokine signaling suppressor of cytokine signaling 0 0.0 finally these studies demonstrated reduced gliosis decreased nf _amp_#x3ba;b and increased suppressor of cytokine signaling 1 and 3 expression in pioglitazone treated animals kiaei et al. 2005 and sch_amp_#xfc;tz et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106079 16753239 137208 20987 19383 SOCS1 suppressor of cytokine signaling 1 suppressor of cytokine signaling 1 0 1.0 finally these studies demonstrated reduced gliosis decreased nf _amp_#x3ba;b and increased suppressor of cytokine signaling 1 and 3 expression in pioglitazone treated animals kiaei et al. 2005 and sch_amp_#xfc;tz et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106080 16753239 137221 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 the ppar _amp_#x3b1; agonist fenofibrate reduced the susceptibility of apolipoprotein e deficient mice to stroke. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106081 16753239 137221 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 the ppar _amp_#x3b1; agonist fenofibrate reduced the susceptibility of apolipoprotein e deficient mice to stroke. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106668 16766086 138218 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 ppar_amp_#x3b3; agonists have been shown to be efficacious in animal models of alzheimer's disease stroke multiple sclerosis parkinson's disease and amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 106669 16766086 138225 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 the type ii nuclear receptor peroxisome proliferator activated receptor gamma ppar_amp_#x3b3; has proven to be an attractive target for treatment of cns disease as agonists of this receptor have been shown to be effective in ameliorating disease related symptomology and pathol 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106670 16766086 138231 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 together these findings inspired a number of studies investigating the utility of these agents in a broad range of disease indications including alzheimer's disease ad stroke multiple sclerosis parkinson's disease and amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 106671 16766086 138240 10601 6081 INS insulin insulin 0 1.0 ppar_amp_#x3b3; agonists act principally in adipose tissue to stimulate fatty acid metabolism sensitize tissues to insulin action and modulate blood glucose levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106672 16766086 138251 14029 17016 MYST2 histone acetyltransferase histone acetyltransferase 0 1.0 coactivator proteins like cbp and p300 act to positively regulate gene expression due to their intrinsic histone acetyltransferase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106673 16766086 138256 7683 3796 FOS ap 1 ap 1 0 1.0 ppar_amp_#x3b3; suppress proinflammatory gene expression at the transcriptional level through antagonizing the actions of nf_amp_#x3ba;b ap 1 and stat1 transcription factors daynes and jones 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106674 16766086 138276 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 similarly the injection of the proinflammatory stimulus lipopolysaccharide into the rat cerebellum resulted in induction of inducible nitric oxide synthase inos expression and subsequent neuronal death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106675 16766086 138286 10827 6207 JUP catenin catenin 0 1.0 the protective effect was correlated with a ppar_amp_#x3b3; mediated inhibition of the protein kinase gsk3_amp_#x3b2; and elevation of cellular _amp_#x3b2; catenin levels although it is unclear how these effects were elicited. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106676 16766086 138287 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 interestingly nerve growth factor was shown to increase the expression and activity of ppar_amp_#x3b3; in sympathetic neuron like pc12 cells fuenzalida et al. 2005 and noradrenaline exposure increased ppar_amp_#x3b3; levels in neuron 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106677 16766086 138297 17610 9605 PTGS2 cox 2 cox 2 0 1.0 these agents suppressed cytokine as well as cox 2 expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106678 16766086 138335 10601 6081 INS insulin insulin 0 1.0 specifically they postulate that rosiglitazone improves insulin sensitivity and suppresses serum corticosteroid levels in the transgenic animals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106679 16766086 138359 17610 9605 PTGS2 cox 2 cox 2 0 1.0 expression of inflammatory genes such as inos cyclooxygenase 2 cox 2 proinflammatory cytokines and intercellular adhesion molecule are upregulated following stroke and increasing the level or the activity of these proteins exacerbates injury while antagonism of the ac 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106680 16766086 138367 17610 9605 PTGS2 cox 2 cox 2 0 1.0 there is a reduced inflammatory infiltrate in tzd treated rats that is associated with reduced expression of inflammatory mediators such as inos cox 2 and il 1_amp_#x3b2; fig 5 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106681 16766086 138374 10601 6081 INS insulin insulin 0 1.0 an nih sponsored trial is currently testing the ability of pioglitazone to decrease stroke incidence in non diabetic patients with insulin resistance. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106682 16766086 138377 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 106683 16766086 138378 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is a progressive autoimmune neurodegenerative disorder and experimental allergic encephalomyelitis eae is an animal model which recapitulates many aspects of the human disease. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 106684 16766086 138410 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 ite the common belief that ppar_amp_#x3b3; modulates eae by its anti inflammatory activity in t cells microglia and astrocytes it remains possible that it affects other cell types involved in eae and multiple sclerosis including neurons and oligodendrocytes. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 106685 16766086 138455 17610 9605 PTGS2 cox 2 cox 2 0 1.0 relative to levels in vehicle treated rats mrna was reduced by approximately 25% for inos 30% for cox 2 and 50% for il 1_amp_#x3b2; n = 4 for each group . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 107912 16781706 139928 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mutations in cu/zn superoxide dismutase sod1 are the primary cause of up to 20% of familial als cases rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 108388 16785600 140295 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 estrogens are thought to play a role in the sex difference observed in many neurological diseases with inflammatory components including stroke alzheimer's and parkinson's diseases multiple sclerosis or amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 108715 16793728 140897 10452 6001 IL2 interleukin 2 interleukin 2 0 1.0 antigens cd|antigens cd3|glial fibrillary acidic protein|intermediate filament proteins|nerve tissue proteins|protein hydrolysates|receptors interleukin 2|tubulin|nestin| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100381 16877542 128958 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 herein we show that nadph oxidase the main reactive oxygen species producing enzyme during inflammation is activated in spinal cords of als patients and in spinal cords in a genetic animal model of this disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100382 16877542 128959 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we demonstrate that inactivation of nadph oxidase in als mice delays neurodegeneration and extends survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100383 16877542 128960 10601 6081 INS insulin insulin 0 0.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100384 16877542 128960 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100385 16877542 128960 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100386 16877542 128960 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100387 16877542 128966 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 transgenic sod1 g93a mice [c57bl/6j tgn sod1 g93a 1gur dl ] were crossed with gp91 phox deficient mice b6.129s6 cybb tm1din . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100388 16877542 128972 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 primer sequences for gp91 phox glial fibrillary acidic protein macrophage antigen complex 1 and gapdh and pcr conditions are presented in supporting text . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100389 16877542 128972 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 primer sequences for gp91 phox glial fibrillary acidic protein macrophage antigen complex 1 and gapdh and pcr conditions are presented in supporting text . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100390 16877542 129014 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is up regulated in inflamed spinal cords of als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100391 16877542 129015 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 to determine the role of nadph oxidase in motor neuron degeneration we first evaluated its expression at different stages of the disease in transgenic mice expressing mutant human sod1 with a substitution of glycine to alanine in position 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100392 16877542 129016 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 expression of nadph oxidase in the spinal cord which carries the brunt of the pathology in this als model was determined by analyzing its catalytic subunit gp91 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100393 16877542 129016 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 expression of nadph oxidase in the spinal cord which carries the brunt of the pathology in this als model was determined by analyzing its catalytic subunit gp91 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100394 16877542 129017 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 both gp91 phox message and protein contents in whole tissue extracts of spinal cord rose over time in transgenic sod1 g93a mice fig 1 a b d and e in concert with the development of a glial response fig 6 which is p 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100395 16877542 129018 14170 7661 NCF2 p67 phox p67 phox 0 1.0 the levels of the p67 phox subunit that contains the nadph binding site of the nadph oxidase complex 10 were increased in membrane fractions of spinal cord extracts from symptomatic transgenic sod1 g93a mice fig 1 c indicating 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100396 16877542 129018 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 the levels of the p67 phox subunit that contains the nadph binding site of the nadph oxidase complex 10 were increased in membrane fractions of spinal cord extracts from symptomatic transgenic sod1 g93a mice fig 1 c indicating that this cytosolic subunit did translocate to the plasma membran 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100397 16877542 129019 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 conversely none of these nadph oxidase alterations were seen in age matched nontransgenic littermates fig 1 a _amp_#x02013; e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100398 16877542 129020 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 histological evaluation of the spinal cord of symptomatic transgenic sod1 g93a mice showed numerous gp91 phox positive cells primarily in the gray matter of the anterior horn fig 1 g whereas sparse staining was observed in the spinal cord of age matched nontransgenic controls fig 1 f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100399 16877542 129021 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 consistent with nadph oxidase expression by professional phagocytes confocal microscopy demonstrated the colocalization of the gp91 phox subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013; j ; no gp91 phox colocalization was detected with the motor neuron marker nonphosphorylated neurofilament 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100400 16877542 129021 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013; j ; no gp91 phox colocalization was detected with the motor neuron marker nonphosphorylated neurofilament heavy chain or with the astrocyte marker glial fibrillary acid protein data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100401 16877542 129021 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consistent with nadph oxidase expression by professional phagocytes confocal microscopy demonstrated the colocalization of the gp91 phox subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100402 16877542 129023 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase causes protein oxidation in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100403 16877542 129024 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we further characterized the status of spinal cord nadph oxidase in transgenic sod1 g93a mice by probing for formation of ros and evidence of protein oxidation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100404 16877542 129026 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 in contrast in symptomatic transgenic sod1 g93a mice carrying the wild type gp91 phox allele sod g93a /gp91 phox+ spinal cord ethidium fluorescence was intense fig 1 l and coincided anatomically with the areas of gp91 phox expression fig 1 g and microglial activation fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100405 16877542 129026 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 + spinal cord ethidium fluorescence was intense fig 1 l and coincided anatomically with the areas of gp91 phox expression fig 1 g and microglial activation fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100406 16877542 129029 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 symptomatic transgenic sod1 g93a /gp91 phox+ mice but not age matched sod1 g93a /gp91 phox_amp_#x02212; mice had increased levels of spinal cord protein carbonyl adducts compared with nontransgenic controls expressing either wild type or null 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100407 16877542 129029 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 but not age matched sod1 g93a /gp91 phox_amp_#x02212; mice had increased levels of spinal cord protein carbonyl adducts compared with nontransgenic controls expressing either wild type or null mutant gp91 phox fig 1 n . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100408 16877542 129030 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 immunohistochemically the most robust labeling for protein carbonyl adducts occurred in spinal cord sections from sod1 g93a /gp91 phox+ mice at the level of cells with mixed morphology including large motor neurons fig 1 o _amp_#x02013; q . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100409 16877542 129031 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase induction and neuronal protein carbonylation in sporadic als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100410 16877542 129032 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we then sought to determine whether the nadph oxidase alterations identified in transgenic sod1 g93a mice were also present in human sporadic als the most common form of the disease 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100411 16877542 129033 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 consistent with the mouse data gp91 phox content was low fig 2 a and b and its immunoreactivity was faint in control postmortem spinal cords fig 2 d whereas gp91 phox content was _amp_#x02248;3 fold higher and its immunoreactivity robust in sporadic als spinal cords fig 2 e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100412 16877542 129034 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 in the latter gp91 phox positive cells colocalized with the microglial associated antigen cd68 fig 2 f and were identified in all of the typical als loci of neurodegeneration including the anterior horn and the lateral cort 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100413 16877542 129038 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox mitigates the disease phenotype in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100414 16877542 129039 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 next we explored the contribution of nadph oxidase activation on the disease phenotype in the sod1 g93a mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100415 16877542 129040 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 transgenic sod1 g93a /gp91 phox_amp_#x02212; mice reached end stage paralysis defined as a loss of the righting reflex later than their transgenic sod1 g93a /gp91 phox+ counterparts fig 3 a which resulted in a longer lifespan of transgenic sod1 g93a /gp91 phox_amp_#x02212; mice log rank test = 15.3; p _amp_#x0003c; 0.001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100416 16877542 129041 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in addition to the prolonged survival inactivation of nadph oxidase did mitigate neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100417 16877542 129042 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 compared with end stage transgenic sod1 g93a /gp91 phox+ mice age matched transgenic sod1 g93a /gp91 phox_amp_#x02212; mice had _amp_#x02248;50% more anterior horn motor neurons in the spinal cord fig 3 b _amp_#x02013; e and myelinated axons in the fifth 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100418 16877542 129043 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 spinal cord microgliosis evidenced by macrophage antigen complex 1 immunostaining and levels of the glial cytokine il 1_amp_#x003b2; did not differ between age matched transgenic sod1 g93a /gp91 phox+ mice and sod1 g93a /gp91 phox_amp_#x02212; mice fig 7 which is published as supporting information on the pnas web site . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100419 16877542 129044 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 also not affected by the deficit of gp91 phox were the levels of human sod1 in transgenic sod1 g93a mice fig 7 or the size of muscle fibers in the fibularis and peroneus longus muscles in nontransgenic mice fig 3 t . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100420 16877542 129045 13949 7577 MYH7 myosin heavy chain myosin heavy chain 0 1.0 the selected muscles are mainly composed of fast twitch fibers and by immunostaining for myosin heavy chain we did not observe any obvious alteration in the makeup of muscle fiber types among the different mouse groups fig 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100421 16877542 129047 10601 6081 INS insulin insulin 0 0.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100422 16877542 129047 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100423 16877542 129047 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100424 16877542 129047 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100425 16877542 129048 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we then explored whether nadph oxidase mediated protein modifications might promote neurodegeneration in als by damaging essential surviving pathways for motor neurons such as igf1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100426 16877542 129051 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however protein carbonyl adducts were evident in the _amp_#x003b1; chain of the igf1 tyrosine kinase cognate receptor in the spinal cord of symptomatic transgenic sod1 g93a /gp91 phox+ mice fig 4 a and b ; similar results were obtained for the _amp_#x003b2; chain of igf1 receptor data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100427 16877542 129058 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however there were fewer phospho igf1 receptor immunoreactive cells in spinal cord sections from symptomatic transgenic sod1 g93a /gp91 phox+ mice than from age matched sod1 g93a /gp91 phox_amp_#x02212; mice fig 4 c _amp_#x02013; e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100428 16877542 129059 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 as fewer cells that were immunoreactive for a downstream target of akt phospho bad fig 4 h _amp_#x02013; j and smaller phospho bad:total bad ratios fig 4 k and l in symptomatic transgenic sod1 g93a /gp91 phox+ mice compared with their age matched sod1 g93a /gp91 phox_amp_#x02212; counterparts. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100429 16877542 129060 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 these data further support the idea that oxidative modification of igf1 receptor in symptomatic transgenic sod1 g93a /gp91 phox+ mice is associated with a range of molecular perturbations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100430 16877542 129062 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 to test the idea that nadph oxidase derived ros could impair igf1 pathway function an in vitro cell system using the neuron like cell lines sh sy5y and imr32 was used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100431 16877542 129065 3544 1516 CAT catalase catalase 0 1.0 to conditioned medium containing 0.1 milliunits/ml glucose oxidase generating an average stable concentration of 75 _amp_#x003bc;m h 2 o 2 fig 5 e ; this effect was abolished by adding 1 000 units/ml catalase to the medium data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100432 16877542 129069 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 however both the alteration of igf1 mediated akt phosphorylation and the loss of cell viability mediated by lps activated microglia were counteracted by the specific nadph oxidase inhibitor apocynin fig 5 c d and f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100433 16877542 129073 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 germane to the molecular basis of this deleterious effect on motor neurons is our finding that virtually all spinal cord microglial cells express the gp91 phox subunit of the oxidant producing enzyme nadph oxidase fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100434 16877542 129073 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 germane to the molecular basis of this deleterious effect on motor neurons is our finding that virtually all spinal cord microglial cells express the gp91 phox subunit of the oxidant producing enzyme nadph oxidase fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100435 16877542 129074 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 agreeing with the fact that in nonactivated phagocytes nadph oxidase is quiescent 7 gp91 phox positive cells in spinal cords from 1 to 4 month old nontransgenic mice had a morphology of resting microglia and did not seem to produce ros figs 1 and 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100436 16877542 129074 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 agreeing with the fact that in nonactivated phagocytes nadph oxidase is quiescent 7 gp91 phox positive cells in spinal cords from 1 to 4 month old nontransgenic mice had a morphology of resting microglia and did not seem to produce ros figs 1 and 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100437 16877542 129075 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 conversely in transgenic sod1 g93a mice paralleling the worsening of the als phenotype there was an intensification of spinal cord microgliosis accompanied by an up regulation and activation of nadph oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100438 16877542 129077 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 corroborating this view are the levels of protein carbonyls which were markedly elevated in spinal cord extracts of symptomatic transgenic sod1 g93a mice for the most part in a nadph oxidase dependent manner fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100439 16877542 129078 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 evidence of microgliosis nadph oxidase up regulation and protein carbonylation was also found in postmortem spinal cords from human sporadic als cases fig 2 supporting the conclusion that the occurrence of inflammation mediated oxidative 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100440 16877542 129079 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 our results also show that abrogation of the gp91 phox subunit of nadph oxidase in transgenic sod1 g93a mice eliminates the production of microglial derived ros fig 1 m and importantly prolongs survival and retards neurodegeneration in this als model fig 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100441 16877542 129079 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our results also show that abrogation of the gp91 phox subunit of nadph oxidase in transgenic sod1 g93a mice eliminates the production of microglial derived ros fig 1 m and importantly prolongs survival and retards neurodegeneration in this als model fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100442 16877542 129080 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox in transgenic sod1 g93a mice did not alter the spinal cord microglial response or the expression of human sod1 in transgenic sod1 g93a mice fig 7 which is a known determinant of disease severity in t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100443 16877542 129081 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consequently the attenuated phenotype seen in transgenic sod1 g93a /gp91 phox_amp_#x02212; mice is attributable to the lack of nadph oxidase activity and not to either an impaired microglial response or expression of the human sod1 g93a transgene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100444 16877542 129082 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 these data provide compelling evidence that nadph oxidase contributes to the degeneration of motor neurons in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100445 16877542 129084 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however the magnitude of benefit afforded by gp91 phox deletion in transgenic sod1 g93a mice argues that targeting neuroinflammation by inhibiting just one of its mediators such as nadph oxidase may not be sufficient to produce robust and lasting neuropr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100446 16877542 129084 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 however the magnitude of benefit afforded by gp91 phox deletion in transgenic sod1 g93a mice argues that targeting neuroinflammation by inhibiting just one of its mediators such as nadph oxidase may not be sufficient to produce robust and lasting neuroprotection in als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100447 16877542 129085 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 all cells not motor neurons only which are located in the vicinity of activated microglia may indiscriminately have their plasma membrane proteins and lipids damaged by nadph oxidase derived ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100448 16877542 129091 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in this study we indeed found that receptors for igf1 were primarily expressed on motor neurons in mouse spinal cords fig 8 and that the igf1 signaling pathway was impaired by a nadph oxidase dependent mechanism in symptomatic transgenic sod1 g93a mice fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100449 16877542 129092 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 although igf1 per se did not seem to be damaged by inflammation nadph oxidase did stimulate the oxidative modification of igf1 receptors fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100450 16877542 129095 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 ggregate show that several molecular events that are normally elicited by ligation of the igf1 receptor including autophosphorylation and akt phosphorylation were indeed abated by ros in a microglial nadph oxidase dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100451 16877542 129096 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our data also show that microglial nadph oxidase by impairing the igf1 signaling pathway renders sh sy5y cells in our in vitro system more prone to die upon exposure to a hostile environment such as that emulated by lps activated microglial conditi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100452 16877542 129099 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in our study however we did not find any evidence that the rescue of the igf1 pathway by abrogating nadph oxidase was associated with muscle hypertrophy fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100453 16877542 129100 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 nevertheless whether transgenic sod1 g93a mice carrying the gp91 phox null mutation reach end stage paralysis later and exhibit an attenuated neurodegenerative process because of some effects at the skeletal muscle level is an interesting possibility that cannot be exc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100454 16877542 129114 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 microglial nadph oxidase stimulates carbonylation of spinal cord motor neurons in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100455 16877542 129115 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a _amp_#x02013; e spinal cord gp91 phox mrna a and d and protein b and e in 1 month old asymptomatic to 4 month old end stage transgenic sod1 more ... 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100456 16877542 129117 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is up regulated and associated with motor neuron carbonylation in the spinal cord of sporadic als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100457 16877542 129118 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a and b immunoblots and bar graph for gp91 phox using spinal cord extracts from six normal controls and six age matched als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100458 16877542 129121 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox increases lifespan and lessens neurodegeneration in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100459 16877542 129122 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a survival comparison of transgenic sod1 g93a /gp91 phox+ mice red 122.0 _amp_#x000b1; 1.7 days; n = 19 and transgenic sod1 g93a /gp91 phox_amp_#x02212; littermates more ... 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100460 16877542 129124 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 modulation of the igf1/akt pathway by nadph oxidase derived ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100461 16877542 129130 10601 6081 INS insulin insulin 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100462 16877542 129130 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100463 16877542 129130 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100464 16877542 129130 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100465 16877542 129130 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100466 16877542 129133 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 insights into its neurodegenerative mechanisms followed the discovery that dominant mutations in the gene for superoxide dismutase 1 sod1 cause familial als 2 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100467 16877542 129133 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 insights into its neurodegenerative mechanisms followed the discovery that dominant mutations in the gene for superoxide dismutase 1 sod1 cause familial als 2 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100468 16877542 129138 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 among the microglia derived mediators that could promote neurodegeneration are reactive oxygen species ros produced by the enzyme nadph oxidase complex 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100469 16877542 129140 4848 30998 CPAT1 cerebral palsy cerebral palsy 0 1.0 such bystander cytotoxicity is thought to lead to the death of developing oligodendrocytes in periventricular leukomalacia 9 one of the most important causes of cerebral palsy. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 100470 16877542 129141 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in light of these facts we undertook the study of nadph oxidase in both human als and one of its genetic models. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100471 16877542 129142 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our results for both human and mouse postmortem tissues indicate that spinal cord microgliosis in als is accompanied with an up regulation of nadph oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100472 16877542 129143 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 furthermore by using mutant deficient mice in functional nadph oxidase as well as in neuron like cell culture systems we provide compelling evidence that supports the concept that this microglial ros generating enzymatic complex promotes spinal cord motor neuron degener 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 101426 16892030 129923 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 1|superoxide dismutase|cre recombinase|integrases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 101427 16892030 129923 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 superoxide dismutase 1|superoxide dismutase|cre recombinase|integrases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 101978 16909005 130933 22551 11892 TNF tnf alpha tnf alpha 0 1.0 celastrol treatment reduced tnf alpha inos cd40 and gfap immunoreactivity in the lumbar spinal cord sections of celastrol treated g93a mice compared to untreated g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 101979 16909005 130934 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha immunoreactivity co localized with smi 32 neuronal marker and gfap astrocyte marker . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 101980 16909005 130935 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 immunoreactivity was increased in lumbar spinal cord neurons of celastrol treated g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 93461 16983747 120731 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 neurodegeneration and neuroprotection in multiple sclerosis and other neurodegenerative diseases. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 93462 16983747 120732 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is considered a disease of myelin destruction; parkinson's disease pd one of dopaminergic neuron depletion; als a disease of motor neuron death; and alzheimer's a disease of plaques and tangles. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 94289 17008387 122180 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 because inflammation and oxidative damage are also hallmarks of amyotrophic lateral sclerosis als we studied the effect of oral pdtc treatment on g93a superoxide dismutase 1 sod1 transgenic tg rat model of human als and observed that pdtc treatment significantly decreases the survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94290 17008387 122180 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 because inflammation and oxidative damage are also hallmarks of amyotrophic lateral sclerosis als we studied the effect of oral pdtc treatment on g93a superoxide dismutase 1 sod1 transgenic tg rat model of human als and observed that pdtc treatment significantly decreases the survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94291 17008387 122188 10436 5991 IL1A interleukin 1 interleukin 1 0 0.0 r use in the treatment of aids reisinger et al. 1990 kappa b nf kappab that regulates the expression of several proinflammatory genes and some genes related to apoptosis schreck et al. 1992 alpha and interleukin 1 beta nurmi et al. 2004a beta signaling nurmi et al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94292 17008387 122188 10437 5992 IL1B interleukin 1, beta interleukin 1 beta 0 1.0 r use in the treatment of aids reisinger et al. 1990 kappa b nf kappab that regulates the expression of several proinflammatory genes and some genes related to apoptosis schreck et al. 1992 alpha and interleukin 1 beta nurmi et al. 2004a beta signaling nurmi et al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94293 17008387 122217 5131 2524 CTRL chymotrypsin-like chymotrypsin like 0 1.0 proteasomal activity was measured from cytosolic fractions of the spinal cord samples as chymotrypsin like activity by cleavage of n succinyl leu leu val tyr 7 amino 4 methylcoumarin sigma . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94294 17008387 122221 551 399 ALB albumin albumin 0 0.0 proteasomal activity was measured in aliquots of 10 microg of protein in 50 microl volume of assay buffer 20 mm tris hcl ph 7.5 1 mm atp 2 mm mgcl 2 and 0.1% bovine serum albumin containing 100 microm n succinyl leu leu val tyr 7 amino 4 methylcoumarin . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94295 17008387 122221 551 399 ALB serum albumin serum albumin 0 1.0 proteasomal activity was measured in aliquots of 10 microg of protein in 50 microl volume of assay buffer 20 mm tris hcl ph 7.5 1 mm atp 2 mm mgcl 2 and 0.1% bovine serum albumin containing 100 microm n succinyl leu leu val tyr 7 amino 4 methylcoumarin . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94296 17008387 122225 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 polyclonal anti proteasome 20s x dilution 1:1000; abcam rabbit polyclonal anti glt 1 dilution 1:1000; calbiochem la jolla ca monoclonal anti beta actin dilution 1:4000 sigma or rabbit polyclonal anti ubiquitin antibodies dilution 1:1000; dakocytomation denmark a/s glostrup denmark and horseradish peroxidase labeled anti mouse igg dilution 1:4000; ge healthcare or horseradish peroxidase labeled anti rabbit 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94297 17008387 122225 211 132 ACTB beta actin beta actin 0 1.0 easome 20s lmp7 dilution 1:1000; abcam cambridge uk rabbit polyclonal anti proteasome 20s x dilution 1:1000; abcam rabbit polyclonal anti glt 1 dilution 1:1000; calbiochem la jolla ca monoclonal anti beta actin dilution 1:4000 sigma or rabbit polyclonal anti ubiquitin antibodies dilution 1:1000; dakocytomation denmark a/s glostrup denmark and horseradish peroxidase labeled anti mouse igg dilution 1:4000; ge 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94298 17008387 122225 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 structions and immunostained using rabbit polyclonal anti proteasome 20s lmp7 dilution 1:1000; abcam cambridge uk rabbit polyclonal anti proteasome 20s x dilution 1:1000; abcam rabbit polyclonal anti glt 1 dilution 1:1000; calbiochem la jolla ca monoclonal anti beta actin dilution 1:4000 sigma or rabbit polyclonal anti ubiquitin antibodies dilution 1:1000; dakocytomation denmark a/s glostrup denmark an 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94299 17008387 122233 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 the effect of pdtc was not mediated through nf kappa b inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94300 17008387 122237 10436 5991 IL1A interleukin 1 interleukin 1 0 0.0 ranscription factor nf kappab serving as a strong antioxidant or by activating akt gsk3 beta pathway cuzzocrea et al. 2002 kappab driven genes such as cyclooxygenase 2 tumor necrosis factor alpha and interleukin 1 beta drachman et al. 2002 beta pathway reduced mutant sod1 mediated motor neuron cell death in vitro koh et al. 2005 we found that pdtc treatment does not provide protection but instead significantly 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94301 17008387 122237 10437 5992 IL1B interleukin 1, beta interleukin 1 beta 0 1.0 ranscription factor nf kappab serving as a strong antioxidant or by activating akt gsk3 beta pathway cuzzocrea et al. 2002 kappab driven genes such as cyclooxygenase 2 tumor necrosis factor alpha and interleukin 1 beta drachman et al. 2002 beta pathway reduced mutant sod1 mediated motor neuron cell death in vitro koh et al. 2005 we found that pdtc treatment does not provide protection but instead significantly decr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94302 17008387 122237 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 y inhibiting the activation of transcription factor nf kappab serving as a strong antioxidant or by activating akt gsk3 beta pathway cuzzocrea et al. 2002 kappab driven genes such as cyclooxygenase 2 tumor necrosis factor alpha and interleukin 1 beta drachman et al. 2002 beta pathway reduced mutant sod1 mediated motor neuron cell death in vitro koh et al. 2005 we found that pdtc treatment does not provide protection b 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94303 17008387 122237 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 y inhibiting the activation of transcription factor nf kappab serving as a strong antioxidant or by activating akt gsk3 beta pathway cuzzocrea et al. 2002 kappab driven genes such as cyclooxygenase 2 tumor necrosis factor alpha and interleukin 1 beta drachman et al. 2002 beta pathway reduced mutant sod1 mediated motor neuron cell death in vitro koh et al. 2005 we found that pdtc treatment does not provide protection but ins 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94304 17008387 122238 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the fact that pdtc treatment prevented the reduction of the glutamate transporter glt 1 a potential therapeutic target verified in numerous animal studies of als gurney et al. 1996 ; howland et al. 2002 and that pdtc treatment did not induce toxic side effects in the tg or wt rats the n 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94305 17008387 122242 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 ducts in rat peripheral nerves calviello et al. 2005 beta lactams such as ceftriaxone which have been reported to be neuroprotective in models of als by increasing expression of glutamate transporter glt 1 rothstein et al. 2005 beta lactams because it significantly increases the expression of glt 1 and cu concentration in the spinal cord we hypothesize that even though beta lactams and pdtc might both 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94306 17008387 122242 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 rothstein et al. 2005 beta lactams because it significantly increases the expression of glt 1 and cu concentration in the spinal cord we hypothesize that even though beta lactams and pdtc might both be able to modulate glt 1 and cu concentration only pdtc but not beta lactams inhibits immunop 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94307 17008387 122242 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 and cu concentration in the spinal cord we hypothesize that even though beta lactams and pdtc might both be able to modulate glt 1 and cu concentration only pdtc but not beta lactams inhibits immunoproteasome because induction of immunoproteasome may be a rather selective characteristic for als models compared with models of isc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94308 17008387 122244 1576 990 BCL2 bcl 2 bcl 2 0 1.0 ed with tissue and cellular protection inhibition of nf kappab may also accelerate neurodegeneration because of the survivalsupporting role of some nf kappab regulated genes such as manganese sod and bcl 2 mattson and camandola 2001 kappab binding activity in the spinal cords of g93a sod1 tg rats no statistically significant differences between any of the untreated/pdtc treated tg and wt rat groups wer 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94309 17008387 122247 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in summary we report that pdtc a multipotent drug providing protection in various animal models by inhibiting nf kappab acting as an antioxidant and activating akt gsk3 beta pathway also induces glt 1 a potential drug target in brain diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94310 17008387 122268 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 pdtc led to decreased immunoproteasome levels and increased glt 1 levels in tg rats at the end stage whereas pdtc had no effect on the levels of constitutive proteasome immunoproteasome or glt 1 in wt rats. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94311 17008387 122271 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 pdtc also had an effect on the levels of astrocyte specific glutamate transporter glt 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94312 17008387 122272 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 a and c in the spinal cords of untreated tg rats the levels of glt 1 were decreased whereas in pdtc treated tg rats the levels of glt 1 were at the same levels as in wt rats. p _lt_ 0.05 n = 5 results shown are mean _amp_#177; s.d. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94313 17008387 122279 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 a constitutive proteasome 20s x was expressed in astrocytes stained with glial fibrillary acidic protein neurons stained with neun and microglia stained with cd68 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94314 17008387 122286 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 immunohistochemistry with rabbit polyclonal anti proteasome 20s lmp7 dilution 1:500; abcam or rabbit polyclonal anti proteasome 20s x antibodies dilution 1:500; abcam and with cell markers monoclonal glial fibrillary acidic protein dilution 1:500; chemicon temecula ca monoclonal neun dilution 1:500; chemicon or monoclonal cd68 dilution 1:500; serotec oxford uk antibodies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94315 17008387 122300 5131 2524 CTRL chymotrypsin-like chymotrypsin like 0 1.0 to find out whether proteasomal activity is changed in g93a sod1 tg rats or by pdtc treatment we measured chymotrypsin like activity in the spinal cord tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94316 17008387 122301 5131 2524 CTRL chymotrypsin-like chymotrypsin like 0 1.0 chymotrypsin like activity was approximately on the same level in untreated wt group 902 _amp_#177; 85 n = 5 and untreated g93a sod1 tg group at the presymptomatic stage 1015 _amp_#177; 167 n = 5 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94317 17008387 122310 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the changes in immunoproteasome levels after pdtc treatment were not due to common reduction of astroglial functions because pdtc also increased the levels of astrocyte specific glutamate transporter glt 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94318 17008387 122311 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in the spinal cords of untreated tg rats the levels of glt 1 were decreased whereas in pdtc treated tg rats the levels of glt 1 were at the same levels as in wt rats fig 5 a and c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 94319 17008387 122318 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 abbreviations: pdtc pyrrolidine dithiocarbamate; als amyotrophic lateral sclerosis; emsa electrophoretic mobility shift assay; nf kappab nuclear factor kappab; sod superoxide dismutase; wt wild type; tg transgenic; glt glutamate transporter. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82162 17015226 105768 694 483 ANG angiogenin angiogenin 0 1.0 mutations in genes encoding angiogenin ang and vegf and sequence variants in neurofilament genes have also been reported for more detailed consideration of the genetics see gros louis et_amp_#xa0;al [2006] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82163 17015226 105769 694 483 ANG angiogenin angiogenin 0 1.0 although all have in common disease that affects motor neurons the nomenclature is misleading since only als1 als3 als6 als7 mutations in angiogenin and vegf and a small proportion of incidences of als8 represent the classic late onset neurodegenerative disease with selective killing of upper and lower motor neurons leading to progressive paralys 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82164 17015226 105773 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the lion's share of work has focused on als1 caused by_amp_#xa0;mutations in cu/zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82165 17015226 105781 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 vascular endothelial growth factor vegf 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82166 17015226 105782 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 vascular endothelial growth factor vegf an established regulator of developmental hypoxia induced and tumor induced angiogenesis gained interest as a contributor to als when deletion of the hypoxia response element hre in the murine v 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82167 17015226 105783 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 vegf is widely expressed throughout the central nervous system cns and can function as a neurotrophic factor for multiple neuronal cell types including motor neurons oosthuyse et_amp_#xa0;al. 2001 and van den bosch et_amp_#xa0;al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82168 17015226 105786 694 483 ANG angiogenin angiogenin 0 1.0 angiogenin ang 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82169 17015226 105790 694 483 ANG angiogenin angiogenin 0 1.0 the manner in which the identified mutations affect angiogenin function and provoke motor neuron disease is still unknown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82170 17015226 105791 694 483 ANG angiogenin angiogenin 0 1.0 angiogenin which is expressed within the cns including the motor neurons has a known intranuclear rnase activity that can facilitate rrna synthesis at least in endothelial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82171 17015226 105792 694 483 ANG angiogenin angiogenin 0 1.0 ingly the majority of the mutations found in als patients are located within the catalytic core and one of them is in the nuclear localization signal both predicting a loss of function of the mutated angiogenin although this remains to be confirmed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82172 17015226 105793 694 483 ANG angiogenin angiogenin 0 1.0 whether angiogenin is endowed with neurotrophic properties like vegf in addition to its angiogenic activity is not yet established. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82173 17015226 105796 20478 11117 SMN1 spinal muscular atrophy spinal muscular atrophy 0 1.0 about one fourth of affected individuals in the same families develop a late onset spinal muscular atrophy and a small proportion of patients develop symptoms of classic als. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 82174 17015226 105802 14282 7739 NEFL nf l nf l 0 1.0 in addition mice with increased levels of wild type nf h or nf l subunits develop age dependent motor neuron pathology cote et_amp_#xa0;al. 1993 and xu et_amp_#xa0;al. 1993 while expression of a point mutation in nf l at levels corresponding to that expected for d 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82175 17015226 105802 14282 7739 NEFL nf l nf l 0 1.0 subunits develop age dependent motor neuron pathology cote et_amp_#xa0;al. 1993 and xu et_amp_#xa0;al. 1993 while expression of a point mutation in nf l at levels corresponding to that expected for dominantly inherited disease produces fatal progressive paralysis lee et_amp_#xa0;al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82176 17015226 105803 14282 7739 NEFL nf l nf l 0 1.0 ations in the three neurofilament genes in patient dnas failed to yield conclusive linkage to either sporadic or familial als patients garcia et_amp_#xa0;al. 2006 although dominant point mutations in nf l have been linked to a milder motor neuron disease charcot marie tooth cmt disease de jonghe et_amp_#xa0;al. 2001 and jordanova et_amp_#xa0;al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82177 17015226 105808 17381 9461 PRPH peripherin peripherin 0 1.0 a proposal for the involvement of a peripherin variant in which an intronic sequence is retained in the final mrna that is_amp_#xa0;produced during the disease course may also contribute to human disease robertson et_amp_#xa0;al. 2003 albeit dele 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82178 17015226 105808 17381 9461 PRPH peripherin peripherin 0 1.0 which an intronic sequence is retained in the final mrna that is_amp_#xa0;produced during the disease course may also contribute to human disease robertson et_amp_#xa0;al. 2003 albeit deletion of the peripherin gene has no affect on disease course in mice having an als causing sod1 mutation lariviere et_amp_#xa0;al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82179 17015226 105829 17381 9461 PRPH peripherin peripherin 0 1.0 in some instances it refers to abnormal accumulations of intermediate filaments including neurofilaments and peripherin as detected by immunostaining of spinal cord tissue hirano et_amp_#xa0;al. 1984b mendonca et_amp_#xa0;al. 2005 mizusawa et_amp_#xa0;al. 1989 rouleau et_amp_#xa0;al. 1996 sobue et_amp_#xa0;al. 1990 an 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82180 17015226 105830 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 it has also been used to define accumulations of detergent insoluble forms of proteins including sod1 that are detected by immunoblotting of filter trappable material as well as small sod1 or ubiquitin positive fibrillar inclusions in spinal cord sections deng et_amp_#xa0;al. 2006 furukawa et_amp_#xa0;al. 2006 johnston et_amp_#xa0;al. 2000 jonsson et_amp_#xa0;al. 2004 jonsson et_amp_#xa0;al. 2006 w 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82181 17015226 105842 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 aggregates found in als patients as well as mouse models contain ubiquitin ince et_amp_#xa0;al. 1998 wang et_amp_#xa0;al. 2003 and watanabe et_amp_#xa0;al. 2001 a protein adduct which typically targets proteins for disposal via the proteasome. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82182 17015226 105852 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 hsp40 and hsp90 are also elevated but only in the spinal cords of hsod1 g85r mice liu et_amp_#xa0;al. 2005 vleminckx et_amp_#xa0;al. 2002 and wang et_amp_#xa0;al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82183 17015226 105854 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 mutant sod1 mediated depletion of hsps is a plausible possibility given that hsp70 and hsp25 preferentially bind mutant sod1 okado matsumoto and fridovich 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82184 17015226 105855 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 expression of several different hsps hsp70 hsp40 hsp27 in cultured cells and primary motor neurons decreases aggregate content and apoptosis and improves axonal outgrowth bruening et_amp_#xa0;al. 1999 patel et_amp_#xa0;al. 2005 and takeuchi e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82185 17015226 105856 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 unfortunately applying this strategy in vivo by increased expression of hsp70 in four different mutant sod1 mouse lines did not ameliorate disease or pathology liu et_amp_#xa0;al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82186 17015226 105857 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 a small cohort of hsod1 g93a mice after treatment with arimoclomol a drug which induces the phosphorylation mediated activation of the hsp inducing factor hsf 1 thereby leading to increased levels of hsp70 and hsp90 in spinal cords kieran et_amp_#xa0;al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82187 17015226 105894 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondria are the gatekeepers of apoptosis with opening of the permeability transition pore and release of cytochrome c central to the cascade of caspase activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82188 17015226 105895 1576 990 BCL2 bcl 2 bcl 2 0 1.0 activation of the executioner caspase 3 is found in mouse models contemporaneous with neuronal death li et_amp_#xa0;al. 2000 and pasinelli et_amp_#xa0;al. 2000 and lowered levels of the antiapoptotic bcl 2 have been reported in spinal cord motor neurons of als patients ekegren et_amp_#xa0;al. 1999 and mu et_amp_#xa0;al. 1996 and mutant sod1 mice gonzalez de aguilar et_amp_#xa0;al. 2000 and vukosavic et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82189 17015226 105895 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 a final apoptotic mechanism is probably a central aspect of neuronal death as activation of the executioner caspase 3 is found in mouse models contemporaneous with neuronal death li et_amp_#xa0;al. 2000 and pasinelli et_amp_#xa0;al. 2000 and lowered levels of the antiapoptotic bcl 2 have been reported in spinal cord 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82190 17015226 105896 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 intriguingly it has recently been demonstrated that caspase 3 activation in glial cells proteolytically inactivates the glutamate transporter eaat2 boston howes et_amp_#xa0;al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82191 17015226 105898 1576 990 BCL2 bcl 2 bcl 2 0 1.0 an alternate mechanism in which sod1 is proposed to interact with bcl 2 and possibly interferes with bcl 2 antiapoptotic activity pasinelli et_amp_#xa0;al. 2004 is attractive but has recently been disputed gould et_amp_#xa0;al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82192 17015226 105899 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however both constitutively increased expression of bcl 2 kostic et_amp_#xa0;al. 1997 and virally driven overexpression of bcl 2 in motor neurons azzouz et_amp_#xa0;al. 2000 protect motor neurons delaying disease onset but not progression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82193 17015226 105900 14282 7739 NEFL nf l nf l 0 1.0 bcl 2 is unable to similarly rescue motor neuron death in other models such as wobbler and transgenic mice expressing a point mutation in the nf l gene coulpier et_amp_#xa0;al. 1996 and houseweart and cleveland 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82194 17015226 105900 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 is unable to similarly rescue motor neuron death in other models such as wobbler and transgenic mice expressing a point mutation in the nf l gene coulpier et_amp_#xa0;al. 1996 and houseweart and clev 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82195 17015226 105915 14282 7739 NEFL nf l nf l 0 1.0 neurofilaments are obligate heteropolymers of nf light nf l nf medium nf m and nf heavy nf h subunits and interestingly transgenic mice expressing a point mutation in nf l develop motor neuron disease lee et_amp_#xa0;al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82196 17015226 105915 14285 7734 NEFM nf m nf m 0 1.0 neurofilaments are obligate heteropolymers of nf light nf l nf medium nf m and nf heavy nf h subunits and interestingly transgenic mice expressing a point mutation in nf l develop motor neuron disease lee et_amp_#xa0;al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82197 17015226 105917 14282 7739 NEFL nf l nf l 0 1.0 removal of all axonal neurofilaments by deletion of nf l substantially prolonged survival of hsod1 g85r and hsod1 g37r mice nguyen et_amp_#xa0;al. 2001 and williamson et_amp_#xa0;al. 1998 as did removal of most axonal neurofilaments by excessive levels of 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82198 17015226 105919 14285 7734 NEFM nf m nf m 0 1.0 this was demonstrated to be the case by use of gene replacement to remove the phosphorylated _amp_#x201c;tail_amp_#x201d; domains of nf m and nf h that normally provide intra axonal crosslinking of adjacent filaments. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82199 17015226 105922 5514 2711 DCTN1 p150-glued p150 glued 0 1.0 additional evidence for a link between transport and motor neuron disease arose from the discovery of a mutation in the p150 glued subunit of dynactin in a family affected with a slowly progressive autosomal dominant form of lower motor neuron disease puls et_amp_#xa0;al. 2003 . p150 glued is responsible for providing processivi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82200 17015226 105922 5514 2711 DCTN1 p150-glued p150 glued 0 1.0 subunit of dynactin in a family affected with a slowly progressive autosomal dominant form of lower motor neuron disease puls et_amp_#xa0;al. 2003 . p150 glued is responsible for providing processivity by bridging between microtubules and cytoplasmic dynein vaughan and vallee 1995 and waterman storer et_amp_#xa0;al. 1995 a motor powering retrograde axonal t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82201 17015226 105927 10545 6047 IMMT motor protein motor protein 0 0.0 these include loss of the kinesin motor protein kif1b_amp_#x3b2; as causative for cmt type 2a zhao et_amp_#xa0;al. 2001 loss of kif5a in hereditary spastic paraplegia reid et_amp_#xa0;al. 2002 and loss of kif21a in a rare disorder affecting the oc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82202 17015226 105927 11169 15869 KIF16B kinesin motor protein kinesin motor protein 0 1.0 these include loss of the kinesin motor protein kif1b_amp_#x3b2; as causative for cmt type 2a zhao et_amp_#xa0;al. 2001 loss of kif5a in hereditary spastic paraplegia reid et_amp_#xa0;al. 2002 and loss of kif21a in a rare disorder affecting the oc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82203 17015226 105939 10704 6132 ISL1 islet-1 islet 1 0 1.0 excision of the floxed mutant sod1 gene exclusively within motor neurons by action of cre recombinase expressed under control of the motor neuron specific promoter islet 1 extended survival by slowing onset and an early phase of disease progression. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 82204 17015226 105940 14285 7734 NEFM nf m nf m 0 1.0 hin neurons i.e. gene disruption to remove all neurofilaments [ williamson et_amp_#xa0;al. 1998 ] or gene replacement to alter axonal structure and volume after elimination of the tail domains of the nf m and nf h subunits [ lobsiger et_amp_#xa0;al. 2005 ] provide extended survival of sod1 mutant mice but only by slowing disease onset. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82205 17015226 105964 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cyclooxygenase 2 cox 2 produced in abundance by microglia and other inflammatory cells but also by neurons and astrocytes plays a key role in stimulating production of proinflammatory cytokines and cox 2 expression is induced in spinal cords of als patients yasojima et_amp_#xa0;al. 2001 and yiangou et_amp_#xa0;al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82206 17015226 105965 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in mice use of a cox 2 inhibitor celecoxib prolonged survival by slowing disease onset drachman et_amp_#xa0;al. 2002 but disappointingly did not alter progression after onset. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82207 17015226 105972 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 one particularly interesting cytokine upregulated in mutant sod1 mouse spinal cords which could play a role in motor neuron degeneration is tumor necrosis factor _amp_#x3b1; tnf_amp_#x3b1; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82208 17015226 105976 7334 11936 FASLG fas ligand fas ligand 0 1.0 microglial cells could therefore be an important player in a fas ligand fasl induced apoptosis pathway within motor neurons that is driven by nitric oxide synthesis discussed in more detail below . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82209 17015226 105986 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 ential partners of motor neurons providing them with trophic support and mediating rapid recovery of synaptic glutamate through the action of the glial glutamate transporter eaat2 also referred to as glt 1 in rodents . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82210 17015226 105995 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 this includes an increase in assembly of their intermediate filaments assembled from glial fibrillary acidic protein gfap and an increase in the number and size of processes extended from the cell body figure_amp_#xa0;3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82211 17015226 106009 13714 4223 MSTN myostatin myostatin 0 1.0 a test of whether enhanced muscle mass and strength per se can be beneficial in als has been attempted by repetitive injection into hsod1 g93a mice of an antibody to myostatin a secreted protein whose action inhibits muscle growth. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82212 17015226 106011 10601 6081 INS insulin insulin 0 0.0 on the other hand muscle hypertrophy induced by agents such as insulin like growth factor 1 igf 1 or growth hormone dobrowolny et_amp_#xa0;al. 2005 kaspar et_amp_#xa0;al. 2003 and kaspar et_amp_#xa0;al. 2005 has led to significant life extensions in als transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82213 17015226 106011 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 on the other hand muscle hypertrophy induced by agents such as insulin like growth factor 1 igf 1 or growth hormone dobrowolny et_amp_#xa0;al. 2005 kaspar et_amp_#xa0;al. 2003 and kaspar et_amp_#xa0;al. 2005 has led to significant life extensions in als transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82214 17015226 106011 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 on the other hand muscle hypertrophy induced by agents such as insulin like growth factor 1 igf 1 or growth hormone dobrowolny et_amp_#xa0;al. 2005 kaspar et_amp_#xa0;al. 2003 and kaspar et_amp_#xa0;al. 2005 has led to significant life extensions in als transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82215 17015226 106087 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 a key improvement seems to be use of dibutyryl camp as an anti myelin repulsion factor and grafting of neural stem cells expressing glial derived neurotrophic factor gdnf into the nerve. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82216 17015226 106087 8240 4232 GDNF glial derived neurotrophic factor glial derived neurotrophic factor 0 1.0 a key improvement seems to be use of dibutyryl camp as an anti myelin repulsion factor and grafting of neural stem cells expressing glial derived neurotrophic factor gdnf into the nerve. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82217 17015226 106094 14307 7756 NES nestin nestin 0 1.0 furthermore the endogenous recruitment of neural progenitors as determined by nestin staining was initiated on the predominantly symptomatic side of asymmetrically paralyzed hsod1 g93a rats de hemptinne et_amp_#xa0;al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82218 17015226 106102 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82219 17015226 106102 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82454 17018025 106123 10601 6081 INS insulin insulin 0 0.0 tivated by lipopolysaccharide as well as to activated microglia cocultured with primary motoneurons. lipopolysaccharide increased nitric oxide and superoxide o 2 _amp_middot;_amp_#8722; and decreased insulin like growth factor 1 igf 1 release from microglial cultures and induced motoneuron injury in microglia motoneuron cocultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82455 17018025 106123 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 tivated by lipopolysaccharide as well as to activated microglia cocultured with primary motoneurons. lipopolysaccharide increased nitric oxide and superoxide o 2 _amp_middot;_amp_#8722; and decreased insulin like growth factor 1 igf 1 release from microglial cultures and induced motoneuron injury in microglia motoneuron cocultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82456 17018025 106123 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 tivated by lipopolysaccharide as well as to activated microglia cocultured with primary motoneurons. lipopolysaccharide increased nitric oxide and superoxide o 2 _amp_middot;_amp_#8722; and decreased insulin like growth factor 1 igf 1 release from microglial cultures and induced motoneuron injury in microglia motoneuron cocultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82457 17018025 106123 10458 6014 IL4 interleukin 4 interleukin 4 0 1.0 to explore the neuroprotective mechanism of anti inflammatory cytokines we applied interleukin 4 il 4 to primary microglial cultures activated by lipopolysaccharide as well as to activated microglia cocultured with primary motoneurons. lipopolysaccharide increased nitric oxide and superoxide o 2 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82458 17018025 106123 10458 6014 IL4 il 4 il 4 0 1.0 to explore the neuroprotective mechanism of anti inflammatory cytokines we applied interleukin 4 il 4 to primary microglial cultures activated by lipopolysaccharide as well as to activated microglia cocultured with primary motoneurons. lipopolysaccharide increased nitric oxide and superoxide o 2 _amp 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82459 17018025 106125 10458 6014 IL4 il 4 il 4 0 1.0 il_amp_#8722;4 interaction with microglial il 4 receptors suppressed and nitric oxide release and lessened lipopolysaccharide induced microglia mediated motoneuron injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82460 17018025 106127 10458 6014 IL4 il 4 il 4 0 1.0 although il 4 enhanced release of free igf 1 from microglia in the absence of lipopolysaccharide it did not enhance free igf 1 release in the presence of lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82461 17018025 106128 10458 6014 IL4 il 4 il 4 0 1.0 these data suggest that il 4 may provide a significant immunomodulatory signal which can protect against microglia mediated neurotoxicity by suppressing the production and release of free radicals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82462 17018025 106137 10458 6014 IL4 interleukin 4 interleukin 4 0 1.0 we hypothesized that the th2 lymphocyte derived anti inflammatory cytokine interleukin 4 il 4 may be one of the potential neuroprotective signals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82463 17018025 106137 10458 6014 IL4 il 4 il 4 0 1.0 we hypothesized that the th2 lymphocyte derived anti inflammatory cytokine interleukin 4 il 4 may be one of the potential neuroprotective signals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82464 17018025 106138 10458 6014 IL4 il 4 il 4 0 1.0 il 4 is an important immunosuppressive mediator in the cns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82465 17018025 106140 10437 5992 IL1B il 1 il 1 0 1.0 4 has also been shown to reduce the production of pro inflammatory cytokines such as il 6 il 8 tumor necrosis factor alpha tnf a mip 1a and rantes in glial cultures treated with lipopolysaccharide or il 1 ledeboer et al 2000 ; ehrlich et al 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82466 17018025 106140 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 il 4 has also been shown to reduce the production of pro inflammatory cytokines such as il 6 il 8 tumor necrosis factor alpha tnf a mip 1a and rantes in glial cultures treated with lipopolysaccharide or il 1 ledeboer et al 2000 ; ehrlich et al 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82467 17018025 106140 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 il 4 has also been shown to reduce the production of pro inflammatory cytokines such as il 6 il 8 tumor necrosis factor alpha tnf a mip 1a and rantes in glial cultures treated with lipopolysaccharide or il 1 ledeboer et al 2000 ; ehrlich et al 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82468 17018025 106140 10458 6014 IL4 il 4 il 4 0 1.0 il 4 has also been shown to reduce the production of pro inflammatory cytokines such as il 6 il 8 tumor necrosis factor alpha tnf a mip 1a and rantes in glial cultures treated with lipopolysaccharide or i 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82469 17018025 106140 10470 6025 IL8 il 8 il 8 0 1.0 il 4 has also been shown to reduce the production of pro inflammatory cytokines such as il 6 il 8 tumor necrosis factor alpha tnf a mip 1a and rantes in glial cultures treated with lipopolysaccharide or il 1 ledeboer et al 2000 ; ehrlich et al 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82470 17018025 106140 10463 6018 IL6 il 6 il 6 0 1.0 il 4 has also been shown to reduce the production of pro inflammatory cytokines such as il 6 il 8 tumor necrosis factor alpha tnf a mip 1a and rantes in glial cultures treated with lipopolysaccharide or il 1 ledeboer et al 2000 ; ehrlich et al 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82471 17018025 106141 10601 6081 INS insulin insulin 0 0.0 recently it has been documented that protection of il 4 was attributed to down regulation of tnf a and up regulation of insulin like growth factor 1 igf 1 from microglia butovsky et al 2005 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82472 17018025 106141 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 recently it has been documented that protection of il 4 was attributed to down regulation of tnf a and up regulation of insulin like growth factor 1 igf 1 from microglia butovsky et al 2005 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82473 17018025 106141 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 recently it has been documented that protection of il 4 was attributed to down regulation of tnf a and up regulation of insulin like growth factor 1 igf 1 from microglia butovsky et al 2005 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82474 17018025 106141 10458 6014 IL4 il 4 il 4 0 1.0 recently it has been documented that protection of il 4 was attributed to down regulation of tnf a and up regulation of insulin like growth factor 1 igf 1 from microglia butovsky et al 2005 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82475 17018025 106143 10458 6014 IL4 il 4 il 4 0 1.0 in the present study we examined the effects of il 4 in primary microglia cultures and in microglia cocultured with primary motoneurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82476 17018025 106145 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 following activation with lipopolysaccharide microglia were noted to release more nitric oxide and and lower levels of free igf 1 an active form of the neurotrophic factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82477 17018025 106146 10458 6014 IL4 il 4 il 4 0 1.0 the addition of il 4 protected against the activated microglia mediated motoneuron injury by reducing nitric oxide production and suppressing microglial production. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82478 17018025 106154 551 399 ALB albumin albumin 0 0.0 after centrifugation at 800 g for 15 min the sharp band on top of the histodenz cushion was collected and centrifuged through a 4% bovine serum albumin bsa cushion at 400 g for 10 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82479 17018025 106154 551 399 ALB serum albumin serum albumin 0 1.0 after centrifugation at 800 g for 15 min the sharp band on top of the histodenz cushion was collected and centrifuged through a 4% bovine serum albumin bsa cushion at 400 g for 10 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82480 17018025 106155 10601 6081 INS insulin insulin 0 1.0 the cells were resuspended in the l 15 culture medium supplemented with sodium bicarbonate 0.2% glucose 3.6 mg/ml progesterone 20 n m insulin 5 _amp_#x03bc;g/ml putrescine 0.1 m m conalbumin 0.1 mg/ml sodium selenite 30 n m penicillin 100 iu/ml streptomycin 100 _amp_#x03bc;g/ml and horse serum 2% . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82481 17018025 106167 10458 6014 IL4 il 4 il 4 0 1.0 il 4 additions were made either 2 h prior to or after the addition of lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82482 17018025 106168 10458 6014 IL4 il 4 il 4 0 1.0 noc 18 nitric oxide donor and pyrogallol donor were added to culture medium 1 h after the addition of il 4 and lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82483 17018025 106175 14374 7809 NGFR low affinity nerve growth factor receptor low affinity nerve growth factor receptor 0 1.0 as a specific marker for motoneurons p75 the low affinity nerve growth factor receptor immunocytochemistry provides a clear labeling of the motoneurons over microglia layer and simplifies identification and counting under brightfield microscope. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82484 17018025 106175 14373 7808 NGF nerve growth factor nerve growth factor 0 0.0 as a specific marker for motoneurons p75 the low affinity nerve growth factor receptor immunocytochemistry provides a clear labeling of the motoneurons over microglia layer and simplifies identification and counting under brightfield microscope. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82485 17018025 106175 14374 7809 NGFR nerve growth factor receptor nerve growth factor receptor 0 0.0 as a specific marker for motoneurons p75 the low affinity nerve growth factor receptor immunocytochemistry provides a clear labeling of the motoneurons over microglia layer and simplifies identification and counting under brightfield microscope. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82486 17018025 106183 10458 6014 IL4 il 4 il 4 0 1.0 briefly microglia cultures 4 _amp_#x00d7; 10 4 cells/well grown in 96 well plates were treated with lipopolysaccharide 1 ng/ml followed by il 4 10 ng/ml 2 h later. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82487 17018025 106185 3544 1516 CAT catalase catalase 0 1.0 to each well ferricytochrome c 80 _amp_#x03bc; m catalase 10 u/ml lipopolysaccharide 1 ng/ml and il 4 10 ng/ml in hbss were then added. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82488 17018025 106185 10458 6014 IL4 il 4 il 4 0 1.0 to each well ferricytochrome c 80 _amp_#x03bc; m catalase 10 u/ml lipopolysaccharide 1 ng/ml and il 4 10 ng/ml in hbss were then added. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82489 17018025 106225 10458 6014 IL4 il 4 il 4 0 1.0 il 4 protected motoneurons from injury induced by activated microglia to determine the effects of il 4 on microglia mediated motoneuron injury il 4 was added to mn + mc cocultures 2 h before the addition of lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82490 17018025 106227 10458 6014 IL4 il 4 il 4 0 1.0 in the presence of il 4 10 ng/ml neurite length 92.8% _amp_plusmn; 7.82 increased significantly compared with mn + mc + lipopolysaccharide fig 3a b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82491 17018025 106228 10458 6014 IL4 il 4 il 4 0 1.0 in coculture supernatants levels of nitrite + nitrate increased after 24 h treatment with lipopolysaccharide and il 4 significantly reduced nitric oxide production even in the presence of lipopolysaccharide fig 3c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82492 17018025 106230 10458 6014 IL4 il 4 il 4 0 1.0 addition of il 4 1 10 ng/ml significantly prevented motoneuron loss induced by lipopolysaccharide activated microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82493 17018025 106231 10458 6014 IL4 il 4 il 4 0 1.0 this protective effect of il 4 was dose dependent fig 3d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82494 17018025 106232 10458 6014 IL4 il 4 il 4 0 1.0 with increasing concentrations of il 4 nitrite + nitrate levels in the supernatant decreased fig 3e and motoneuron survival increased fig 3d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82495 17018025 106233 10458 6014 IL4 il 4 il 4 0 1.0 to test whether il 4 has any survival effects on motoneurons alone motoneurons were treated with il 4 10 ng/ml for 48 h. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82496 17018025 106234 10458 6014 IL4 il 4 il 4 0 1.0 the survival of motoneurons with il 4 99.93 _amp_plusmn; 2.48% was similar to survival of motoneurons in the absence of il 4 100% as control . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82497 17018025 106235 10458 6014 IL4 il 4 il 4 0 1.0 therefore il 4 had no direct survival effects on motoneurons supporting that the neuroprotective effects of il 4 in microglia motoneuron cocultures are mediated indirectly through microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82498 17018025 106236 10458 6014 IL4 il 4 il 4 0 1.0 nitric oxide was a key factor modulated by il 4 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82499 17018025 106237 10458 6014 IL4 il 4 il 4 0 1.0 to provide further evidence that the neuroprotective effects of il 4 may be mediated by reducing nitric oxide production we plotted the nitrite + nitrate content at different concentrations of il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82500 17018025 106238 10458 6014 IL4 il 4 il 4 0 1.0 in mn + mc cocultures treated with lipopolysaccharide the suppression of nitrite + nitrate generation by il 4 was dose dependent fig 4a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82501 17018025 106241 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 we have previously demonstrated that activated microglia produce nitric oxide by up regulation of inducible nitric oxide synthase inos zhao et al 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82502 17018025 106242 10458 6014 IL4 il 4 il 4 0 1.0 to further define the mechanisms of il 4 neuroprotection microglia were treated with lipopolysaccharide in the presence or absence of il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82503 17018025 106244 10458 6014 IL4 il 4 il 4 0 1.0 figure 5 demonstrates that lipopolysaccharide enhanced inos protein expression and il 4 significantly inhibited inos expression induced by lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82504 17018025 106245 10458 6014 IL4 il 4 il 4 0 1.0 most strikingly the inhibitory effect of il 4 added 2 h after lipopolysaccharide lipopolysaccharide + il 4 was even greater than when il 4 was added 2 h before lipopolysaccharide il 4 + lipopolysaccharide p _lt_ 0.05 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82505 17018025 106246 10458 6014 IL4 il 4 il 4 0 1.0 il 4 receptor was up regulated by lipopolysaccharide and il 4 mediated neuroprotection was increased to help explain why il 4 was more effective when added after lipopolysaccharide lipopolysaccharide + il 4 expression of il 4 receptor il 4r was assayed by real time rt pcr in microglia cultures fig 6a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82506 17018025 106246 10458 6014 IL4 il 4 il 4 0 1.0 was more effective when added after lipopolysaccharide lipopolysaccharide + il 4 expression of il 4 receptor il 4r was assayed by real time rt pcr in microglia cultures fig 6a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82507 17018025 106247 10458 6014 IL4 il 4 il 4 0 1.0 charide significantly increased the expression of il 4r compared with untreated microglia 9 fold increase p _lt_ 0.001 which provides a possible explanation for why adding lipopolysaccharide prior to il 4 enhanced the protective effects of il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82508 17018025 106247 10458 6014 IL4 il 4 il 4 0 1.0 enhanced the protective effects of il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82509 17018025 106248 10458 6014 IL4 il 4 il 4 0 1.0 in the absence of lipopolysaccharide il 4 did not significantly change il 4r mrna levels compared with untreated control p = 0.91 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82510 17018025 106249 10458 6014 IL4 il 4 il 4 0 1.0 furthermore il 4r mrna levels were not statistically changed by il 4 in lipopolysaccharide activated microglia il 4 + lipopolysaccharide compared with the group treated with lipopolysaccharide only p = 0.13 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82511 17018025 106250 10458 6014 IL4 il 4 il 4 0 1.0 cultures treated with il 4 2 h after the addition of lipopolysaccharide led to 104.6% _amp_plusmn; 7.62 motoneuron survival which was significantly higher than the motoneuron survival 83.5% _amp_plusmn; 4.05 when il 4 was adde 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82512 17018025 106250 10458 6014 IL4 il 4 il 4 0 1.0 2 h after the addition of lipopolysaccharide led to 104.6% _amp_plusmn; 7.62 motoneuron survival which was significantly higher than the motoneuron survival 83.5% _amp_plusmn; 4.05 when il 4 was added 2 h prior to the addition of lipopolysaccharide fig 6b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82513 17018025 106251 10458 6014 IL4 il 4 il 4 0 1.0 il 4 inhibited superoxide production from microglia the effect of the anti inflammatory cytokine on microglial production is shown in fig. 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82514 17018025 106253 10458 6014 IL4 il 4 il 4 0 1.0 il 4 significantly suppressed the microglial release of in the presence of lipopolysaccharide mc + lipopolysaccharide + il 4: 105.6% _amp_plusmn; 24.5 vs mc + lipopolysaccharide 183.3% _amp_plusmn; 11.8 p = 0.005 and the level of mc + lipopolysaccharide + il 4 was not significantly different from control p = 0.79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82515 17018025 106253 10458 6014 IL4 il 4 il 4 0 1.0 : 105.6% _amp_plusmn; 24.5 vs mc + lipopolysaccharide 183.3% _amp_plusmn; 11.8 p = 0.005 and the level of mc + lipopolysaccharide + il 4 was not significantly different from control p = 0.79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82516 17018025 106254 10458 6014 IL4 il 4 il 4 0 1.0 exogenous nitric oxide and reversed the neuroprotective effects of il 4 to further prove that neuroprotective effects of il 4 are through reducing nitric oxide and release from microglia exogenous nitric oxide and were added to the motoneuron and microglia cocultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82517 17018025 106255 10458 6014 IL4 il 4 il 4 0 1.0 figure 8 showed that in the presence of lipopolysaccharide and il 4 addition of nitric oxide donor noc 18 25 _amp_#x03bc; m and donor pyrogallol pyr 30 _amp_#x03bc; m significantly decreased motoneuron survival to levels similar to those of mn + mc + lipopolysacchari 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82518 17018025 106255 10458 6014 IL4 il 4 il 4 0 1.0 p_#x03bc; m significantly decreased motoneuron survival to levels similar to those of mn + mc + lipopolysaccharide showing that exogenous nitric oxide and could reverse the neuroprotective effects of il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82519 17018025 106256 10458 6014 IL4 il 4 il 4 0 1.0 free igf 1 did not increase after addition of il 4 to lipopolysaccharide activated microglia in fig. 1b we noted less free igf 1 in the culture media following microglial activation with lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82520 17018025 106257 10458 6014 IL4 il 4 il 4 0 1.0 to determine whether igf 1 production was influenced by il 4 the levels of free igf 1 were measured in microglia monocultures or mn + mc cocultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82521 17018025 106258 10458 6014 IL4 il 4 il 4 0 1.0 in cultures without lipopolysaccharide il 4 significantly increased levels of free igf 1 fig 9a b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82522 17018025 106259 10458 6014 IL4 il 4 il 4 0 1.0 the free igf 1 of motoneuron only cultures were close to background level in the presence or absence of il 4 data not shown indicating that microglia were the source of the increased free igf 1 after il 4 treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82523 17018025 106260 10458 6014 IL4 il 4 il 4 0 1.0 however the levels of free igf 1 did not change significantly in lipopolysaccharide activated microglia or in mn + mc + lipopolysaccharide cocultures regardless of whether il 4 was added before or after lipopolysaccharide fig 9a b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82524 17018025 106261 10458 6014 IL4 il 4 il 4 0 1.0 similar results were seen when igf 1 mrna levels were measured with and without il 4 data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82525 17018025 106263 10458 6014 IL4 il 4 il 4 0 1.0 the present study demonstrates that the anti inflammatory cytokine il 4 can protect motoneurons from injury induced by lipopolysaccharide activated microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82526 17018025 106265 10458 6014 IL4 il 4 il 4 0 1.0 to our knowledge this is the first report that il 4 has beneficial effects on motoneuron injury mediated by microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82527 17018025 106267 10458 6014 IL4 il 4 il 4 0 1.0 our present results reveal a strong negative correlation between nitric oxide levels measured by nitrite + nitrate levels and motoneuron survival in cocultures treated with il 4 and exogenously added nitric oxide reversed neuroprotection of il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82528 17018025 106267 10458 6014 IL4 il 4 il 4 0 1.0 and exogenously added nitric oxide reversed neuroprotection of il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82529 17018025 106268 10458 6014 IL4 il 4 il 4 0 1.0 these suggest that nitric oxide is a key factor modulated by il 4 in our cell culture system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82530 17018025 106269 10458 6014 IL4 il 4 il 4 0 1.0 nitric oxide is synthesized by inos in microglia. inos protein expression was down regulated by il 4 in activated microglia when il 4 was given either before or after the triggering signal lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82531 17018025 106270 10458 6014 IL4 il 4 il 4 0 1.0 more strikingly we found that il 4 increased motoneuron survival to a greater extent when added to mn + mc cocultures after lipopolysaccharide than when added prior to lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82532 17018025 106271 10458 6014 IL4 il 4 il 4 0 1.0 in an effort to investigate the cause of this increase we examined the levels of il 4 mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82533 17018025 106273 10458 6014 IL4 il 4 il 4 0 1.0 thus the greater expression of il 4r with the subsequent greater efficacy of the available il 4 could provide one potential explanation of the increased suppressive effects of il 4 on inos expression in activated microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82534 17018025 106274 10458 6014 IL4 il 4 il 4 0 1.0 two studies have reported the inhibitory effects of il 4 on inos in lipopolysaccharide stimulated astrocytes and mixed glial cultures brodie et al 1998 ; kitamura et al 2000 although in their studies the cells were all treated with il 4 first and then stim 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82535 17018025 106274 10458 6014 IL4 il 4 il 4 0 1.0 on inos in lipopolysaccharide stimulated astrocytes and mixed glial cultures brodie et al 1998 ; kitamura et al 2000 although in their studies the cells were all treated with il 4 first and then stimulated cell with other triggering signals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82536 17018025 106278 10458 6014 IL4 il 4 il 4 0 1.0 our present findings that il 4 also inhibits production in lipopolysaccharide activated microglia and that neuroprotection of il 4 was reversed by exogenous illustrate another potential neuroprotective aspect of this particular anti inflammatory cytokine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82537 17018025 106280 10458 6014 IL4 il 4 il 4 0 1.0 1995 reported that il 4 suppressed production in human microglia activated by tnf a or interferon ifn g. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82538 17018025 106281 10458 6014 IL4 il 4 il 4 0 1.0 it has been shown that il 4 reduces formation in macrophages via down regulation of gp9l phox at the mrna level zhou et al 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82539 17018025 106285 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 however simultaneous activation of inos to produce nitric oxide and nadph oxidase to produce resulted in massive microglia mediated neuronal death mander and brown 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82540 17018025 106288 10458 6014 IL4 il 4 il 4 0 1.0 the ability of il 4 to suppress the production of both nitric oxide and suggests that il 4 can decrease the formation of peroxynitrite. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82541 17018025 106294 10458 6014 IL4 il 4 il 4 0 1.0 it has also been documented that neuroprotection of il 4 was attributed to down regulation of tnf a butovsky et al 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82542 17018025 106295 10458 6014 IL4 il 4 il 4 0 1.0 in accordance with this we did find lipopolysaccharide dramatically enhanced tnf a produced by microglia zhao et al 2004 and il 4 significantly decreased tnf a levels in mn + mc + lipopolysaccharide cocultures data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82543 17018025 106296 10458 6014 IL4 il 4 il 4 0 1.0 therefore down regulation of tnf a is one of mechanisms by which il 4 inhibited nitric oxide and production and protected motoneurons from microglia mediated toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82544 17018025 106297 10458 6014 IL4 il 4 il 4 0 1.0 another finding in the current study is that il 4 increased free igf 1 the active form of this neuroprotective factor in untreated microglia cultures and that lipopolysaccharide decreased free igf 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82545 17018025 106298 10458 6014 IL4 il 4 il 4 0 1.0 at first we hypothesized that the induction of free igf 1 in microglia might be another aspect of il 4 neuroprotection; however our subsequent results suggested it might not be. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82546 17018025 106299 10458 6014 IL4 il 4 il 4 0 1.0 il 4 increased motoneuron survival in both lipopolysaccharide treated mn + mc cocultures; however il 4 did not increase free igf 1 levels in the same cocultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82547 17018025 106300 10458 6014 IL4 il 4 il 4 0 1.0 in addition we saw no increase in igf 1 mrna in these lipopolysaccharide activated cultures although it has been reported that il 4 up regulated igf 1 mrna in both untreated and lipopolysaccharide activated microglia butovsky et al 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82548 17018025 106301 10458 6014 IL4 il 4 il 4 0 1.0 additionally even though free igf 1 was up regulated by il 4 in untreated microglia cocultured with motoneurons il 4 did not increase motoneuron survival under the same conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82549 17018025 106303 10458 6014 IL4 il 4 il 4 0 1.0 therefore these results suggest that igf 1 may not be the primary mechanism of il 4 neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82550 17018025 106306 10458 6014 IL4 il 4 il 4 0 1.0 gh we cannot discount the possibility that there may have been an immediate local increase in igf 1 that was quickly sequestered by binding proteins it is likely that the free igf 1 levels induced by il 4 either before or after lipopolysaccharide in our system were not sufficient to elicit the neuroprotective effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82551 17018025 106309 10458 6014 IL4 il 4 il 4 0 1.0 several studies have demonstrated the beneficial effects of il 4 in the cns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82552 17018025 106311 10458 6014 IL4 il 4 il 4 0 1.0 1993 reported that il 4 blocked microglia mediated cerebral neuron injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82553 17018025 106312 10458 6014 IL4 il 4 il 4 0 1.0 it has also been reported that il 4 increased neuronal survival in hippocampal mixed cultures araujo and cotman 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82554 17018025 106313 10458 6014 IL4 il 4 il 4 0 1.0 il 4 delivered by transfected cells inhibited the progression and the severity of experimental autoimmune encephalomyelitis shaw et al 1997 ; furlan et al 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82555 17018025 106314 10458 6014 IL4 il 4 il 4 0 1.0 furthermore gene transfer of il 4 to the retina enhanced the survival of axotomized retinal ganglion cells koeberle et al 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82556 17018025 106315 10458 6014 IL4 il 4 il 4 0 1.0 while these studies demonstrate that il 4 can be neuroprotective few studies have examined the mechanisms of neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82557 17018025 106316 10458 6014 IL4 il 4 il 4 0 1.0 our present study provides evidence that il 4 protects motoneurons from injury partly by decreasing free radicals released from microglia and may not involve free igf 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82558 17018025 106317 10458 6014 IL4 il 4 il 4 0 1.0 whereas one paper reported that il 4 did not significantly suppress nitric oxide production from microglia when given 24 h after the triggering signals ifn g and lipopolysaccharide chao et al 1993 we found that il 4 was more neuroprotec 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82559 17018025 106317 10458 6014 IL4 il 4 il 4 0 1.0 did not significantly suppress nitric oxide production from microglia when given 24 h after the triggering signals ifn g and lipopolysaccharide chao et al 1993 we found that il 4 was more neuroprotective when added 2 h after lipopolysaccharide than before lipopolysaccharide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82560 17018025 106319 10480 5962 IL10 il 10 il 10 0 1.0 besides il 4 il 10 and transforming growth factor beta tgf b are two other major anti inflammatory cytokines. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82561 17018025 106319 22058 11765 TGFA transforming growth factor transforming growth factor 0 0.0 besides il 4 il 10 and transforming growth factor beta tgf b are two other major anti inflammatory cytokines. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82562 17018025 106319 22059 11766 TGFB1 transforming growth factor-beta transforming growth factor beta 0 1.0 besides il 4 il 10 and transforming growth factor beta tgf b are two other major anti inflammatory cytokines. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82563 17018025 106319 10458 6014 IL4 il 4 il 4 0 1.0 besides il 4 il 10 and transforming growth factor beta tgf b are two other major anti inflammatory cytokines. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82564 17018025 106320 10480 5962 IL10 il 10 il 10 0 1.0 we had detected the effects of il 10 and tgf b in our mn + mc coculture system as well as il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82565 17018025 106320 10458 6014 IL4 il 4 il 4 0 1.0 we had detected the effects of il 10 and tgf b in our mn + mc coculture system as well as il 4. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82566 17018025 106322 10480 5962 IL10 il 10 il 10 0 1.0 we found that il 4 had stronger protective effects on motoneurons than il 10. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82567 17018025 106322 10458 6014 IL4 il 4 il 4 0 1.0 we found that il 4 had stronger protective effects on motoneurons than il 10. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82568 17018025 106323 10480 5962 IL10 il 10 il 10 0 1.0 like il 4 il 10 inhibited inos expression and nitric oxide production from microglia data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82569 17018025 106323 10458 6014 IL4 il 4 il 4 0 1.0 like il 4 il 10 inhibited inos expression and nitric oxide production from microglia data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82570 17018025 106324 10480 5962 IL10 il 10 il 10 0 1.0 however il 10 increased microglial release and also decreased rather than increased igf 1 release from microglia data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82571 17018025 106325 10480 5962 IL10 il 10 il 10 0 1.0 further studies are clearly necessary to define the mechanism of il 10 effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82572 17018025 106326 10458 6014 IL4 il 4 il 4 0 1.0 one potential source of the neuroprotective signal il 4 is th2 lymphocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82573 17018025 106333 10458 6014 IL4 il 4 il 4 0 1.0 our present data suggest that il 4 may be one of the significant signals in t cell mediated neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82574 17018025 106334 10458 6014 IL4 il 4 il 4 0 1.0 accordingly immunological strategies to increase the presence of th2 lymphocytes and the release of il 4 would be a promising direction for treatment of neurodegenerative disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82575 17018025 106337 10458 6014 IL4 il 4 il 4 0 1.0 in vivo studies will clearly be required to determine whether il 4 achieves neuroprotection by mitigating the neurotoxic effects of microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 82576 17018025 106340 10458 6014 IL4 interleukin 4 interleukin 4 0 1.0 anti inflammatory agents|inflammation mediators|lipopolysaccharides|neuroprotective agents|receptors interleukin 4|nitric oxide|superoxides|interleukin 4|insulin like growth factor i| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 83593 17034351 107852 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mouse models of familial amyotrophic lateral sclerosis als based on overexpressed mutant human cu zn superoxide dismutase sod1 are cases in point. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 83594 17034351 107856 22551 11892 TNF tnf alpha tnf alpha 0 1.0 genes including arachidonic acid metabolizing enzymes [e.g. cyclooxygenase ii cox ii and 5 lipoxygenase 5lox ]; nitric oxide synthase nos isoforms; cytokines particularly tumor necrosis factor alpha tnf alpha ; chemokines; and immunoglobulin fc receptors fcgammars . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 83595 17034351 107856 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 egulation of proinflammatory genes including arachidonic acid metabolizing enzymes [e.g. cyclooxygenase ii cox ii and 5 lipoxygenase 5lox ]; nitric oxide synthase nos isoforms; cytokines particularly tumor necrosis factor alpha tnf alpha ; chemokines; and immunoglobulin fc receptors fcgammars . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 83596 17034351 107856 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 egulation of proinflammatory genes including arachidonic acid metabolizing enzymes [e.g. cyclooxygenase ii cox ii and 5 lipoxygenase 5lox ]; nitric oxide synthase nos isoforms; cytokines particularly tumor necrosis factor alpha tnf alpha ; chemokines; and immunoglobulin fc receptors fcgammars . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 83597 17034351 107856 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 n mutant sod1+ glial cells may stimulate broad spectrum upregulation of proinflammatory genes including arachidonic acid metabolizing enzymes [e.g. cyclooxygenase ii cox ii and 5 lipoxygenase 5lox ]; nitric oxide synthase nos isoforms; cytokines particularly tumor necrosis factor alpha tnf alpha ; chemokines; and immunoglobulin fc receptors fcgammars . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 79605 17114826 102829 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 apoptotic neurons were identified in aluminum injected animals that showed significantly increased activated caspase 3 labeling in lumbar spinal cord 255% and primary motor cortex 192% compared with the controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 79977 17127558 103273 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 d with transcription followed by those involved in antioxidant systems inflammation regulation of motor neuron function lipid metabolism protease inhibition and protection against apoptosis including vascular endothelial growth factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74835 17190960 96008 8757 4552 GPT alanine aminotransferase alanine aminotransferase 0 1.0 his liver enzymes at that time demonstrated a modest elevation: ast of 92 normal 12 to 31 alanine aminotransferase of 166 normal 10 to 45 alkaline phosphatase of 140 normal 45 to 115 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74836 17190960 96008 614 437 ALPI alkaline phosphatase alkaline phosphatase 0 1.0 his liver enzymes at that time demonstrated a modest elevation: ast of 92 normal 12 to 31 alanine aminotransferase of 166 normal 10 to 45 alkaline phosphatase of 140 normal 45 to 115 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75166 17191135 96090 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 an inducible and redox regulated enzyme has having an important role in cellular antioxidant defense. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75167 17191135 96102 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mccord and fridovich first described superoxide dismutase implying a potential physiological role of superoxide [ 2 ] subsequently confirmed in numerous studies [ 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75168 17191135 96104 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in defense against this the cell has developed a number of antioxidant defense systems including superoxide dismutase the peroxidases the glutathione redox cycle with its associated constitutive enzymes as well as glutathione itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75169 17191135 96113 9462 5013 HMOX1 ho 1 ho 1 0 1.0 heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75170 17191135 96113 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75171 17191135 96116 9462 5013 HMOX1 ho 1 ho 1 0 1.0 fig. 1 a cellular stress response and the interplay between ho 1 and trxr. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75172 17191135 96120 9462 5013 HMOX1 ho 1 ho 1 0 1.0 acetylcarnitine through activation via acetylation of the redox sensitive transcription factor nrf2 and its consequent binding to the antioxidant responsive element are in the ho gene up regulates ho 1 and trxr thus counteracting nitrosative stress and no mediated neurotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75173 17191135 96122 23454 12435 TXN thioredoxin thioredoxin 0 1.0 oxs oxidative stress; ho 1 heme oxygenase; trxr thioredoxin reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75174 17191135 96122 9462 5013 HMOX1 ho 1 ho 1 0 1.0 oxs oxidative stress; ho 1 heme oxygenase; trxr thioredoxin reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75175 17191135 96123 23454 12435 TXN thioredoxin thioredoxin 0 1.0 trx thioredoxin sh reduced form s s oxidized form. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75176 17191135 96124 9462 5013 HMOX1 ho 1 ho 1 0 1.0 b regulation of ho 1 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75177 17191135 96125 12211 6782 MAFK nuclear factor erythroid-2 nuclear factor erythroid 2 0 1.0 nuclear factor erythroid 2 related factor 2 nrf2 is a transcription factor responsible for the induction of several genes related to the cellular stress response including ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75178 17191135 96125 9462 5013 HMOX1 ho 1 ho 1 0 1.0 nuclear factor erythroid 2 related factor 2 nrf2 is a transcription factor responsible for the induction of several genes related to the cellular stress response including ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75179 17191135 96126 11267 25888 KLHL22 kelch-like kelch like 0 1.0 under normal conditions nrf2 is sequestered in the cytoplasm by an actin binding protein kelch like ech associating protein 1 keap1 but upon exposure of cells to oxidative stress nrf2 dissociates from keap1 translocates to the nucleus binds to antioxidant responsive elements ares and activates ho 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75180 17191135 96126 9462 5013 HMOX1 ho 1 ho 1 0 1.0 like ech associating protein 1 keap1 but upon exposure of cells to oxidative stress nrf2 dissociates from keap1 translocates to the nucleus binds to antioxidant responsive elements ares and activates ho 1 gene this review will emphasize the role of free radicals in the pathogenesis of neurodegenerative disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75181 17191135 96127 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in addition the key role played by members of the vitagene system such as ho 1 and thioredoxin fig 1 a in modulating the onset and progression of major neurodegenerative diseases such as ad and pd are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75182 17191135 96127 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition the key role played by members of the vitagene system such as ho 1 and thioredoxin fig 1 a in modulating the onset and progression of major neurodegenerative diseases such as ad and pd are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75183 17191135 96139 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75184 17191135 96139 20997 11180 SOD2 mn sod mn sod 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75185 17191135 96139 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75186 17191135 96140 9462 5013 HMOX1 ho 1 ho 1 0 1.0 hat the antioxidant protein heme oxygenase could _amp_#8220;sense_amp_#8221; no and thus protect against ros and rns insults is supported by the following findings: a no and no related species induce ho 1 expression and increase heme oxygenase activity in human glioblastoma cells hepatocytes and aortic vascular cells; b cells pre treated with various no releasing molecules acquire increased resistance 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75187 17191135 96141 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 the conception that no and rns can be directly involved in the modulation of ho 1 expression in eukaryotes is based on the evidence that different no releasing agents can markedly increase ho 1 and hsp70 in a variety of tissues including brain cells [ 19 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75188 17191135 96141 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the conception that no and rns can be directly involved in the modulation of ho 1 expression in eukaryotes is based on the evidence that different no releasing agents can markedly increase ho 1 and hsp70 in a variety of tissues including brain cells [ 19 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75189 17191135 96142 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 in rat glial cells treatment with lipopolysaccaride lps and interferon g ifn g promotes a rapid increase in both inos expression and nitrite levels followed by enhancement of hsp70 [ 3 20 ] whereas the modulation of ho 1 mrna expression by inos derived no following stimulation with lps has also been reported in different brain regions particularly in the hippocampus and substan 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75190 17191135 96142 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ls treatment with lipopolysaccaride lps and interferon g ifn g promotes a rapid increase in both inos expression and nitrite levels followed by enhancement of hsp70 [ 3 20 ] whereas the modulation of ho 1 mrna expression by inos derived no following stimulation with lps has also been reported in different brain regions particularly in the hippocampus and substantia nigra in an in vivo rat model of sep 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75191 17191135 96143 9462 5013 HMOX1 ho 1 ho 1 0 1.0 moreover the early increase in inos protein levels observed in endothelial cells exposed to low oxygen tension seems to precede the stimulation of ho 1 expression and activity an effect that appears to be finely regulated by redox reactions involving glutathione [ 18 21 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75192 17191135 96144 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 taken together these findings point to a possible role of the no as a signaling molecule which by triggering expression of cytoprotective genes such as ho 1 and hsp70 may lead to adaptation and resistance of brain cells to subsequent more severe nitrosative and oxidative stress [ 21 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75193 17191135 96144 9462 5013 HMOX1 ho 1 ho 1 0 1.0 taken together these findings point to a possible role of the no as a signaling molecule which by triggering expression of cytoprotective genes such as ho 1 and hsp70 may lead to adaptation and resistance of brain cells to subsequent more severe nitrosative and oxidative stress [ 21 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75194 17191135 96145 7683 3796 FOS activator protein 1 activator protein 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or nitrosant species might be crucial for deter 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75195 17191135 96145 7683 3796 FOS ap 1 ap 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or nitrosant species might be crucial for determinin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75196 17191135 96145 9462 5013 HMOX1 ho 1 ho 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or ni 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75197 17191135 96147 14424 19374 NKRF transcription factor nrf transcription factor nrf 0 1.0 eatment of astrocytes exposed to cytokine induced nitrosative stress restores gsh/gssg ratio and complex iv inhibition an effect associated with up regulation of ho 1 and nuclear translocation of the transcription factor nrf 2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75198 17191135 96147 9462 5013 HMOX1 ho 1 ho 1 0 1.0 acetylcarnitine treatment of astrocytes exposed to cytokine induced nitrosative stress restores gsh/gssg ratio and complex iv inhibition an effect associated with up regulation of ho 1 and nuclear translocation of the transcription factor nrf 2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75199 17191135 96156 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75200 17191135 96156 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75201 17191135 96156 9462 5013 HMOX1 ho 1 ho 1 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75202 17191135 96159 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75203 17191135 96159 8888 4646 GTF2A1 glucose regulated protein glucose regulated protein 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75204 17191135 96160 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after a variety of central nervous system cns insults hsp70 is synthesized at high levels and is present in cytosol nucleus and endoplasmic reticulum [ 24 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75205 17191135 96164 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after heat shock synthesis of hsp70 may increase to become the most abundant protein in the cell. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75206 17191135 96165 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 once synthesized hsp70 binds to denaturated proteins in an atp dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75207 17191135 96169 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increase in hsp70 protein expression was also found after treatment of cells with the no generating compound sodium nitroprusside snp thus suggesting a role for no in inducing hsp70 proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75208 17191135 96172 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in these conditions exogenous antioxidant treatment with ferulic acid ethyl ester faee afforded protection of cortical neurons from b amyloid toxicity by acting at three different levels: i inducing ho 1 and hsp72 proteins ii decreasing the neuronal 3 nitrotyrosine levels and therefore inducible nos activity; and iii by the well known direct free radical quenching activity [ 38 ] fig 1 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75209 17191135 96175 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 during translocation this proteins interact with hsp70 atp dependent binding and the release of hsp70 provide the major driving force for complete transport of polypeptides into the matrix. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75210 17191135 96176 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 although most imported polypeptides are released from soluble hsp70 however a subset of aggregation sensitive polypeptides must be transferred from hsp70 to hsp60 for folding [ 40 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75211 17191135 96177 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 owing to the close functional interaction between this chaperonin system and the hsp70 system it is likely that up regulation of hsp60 may be a fundamental site targeted by lac action with consequent restoration of complex iv function under conditions of nitrosative stress dependent pe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75212 17191135 96177 9718 5261 HSPD1 chaperonin chaperonin 0 1.0 owing to the close functional interaction between this chaperonin system and the hsp70 system it is likely that up regulation of hsp60 may be a fundamental site targeted by lac action with consequent restoration of complex iv function under conditions of nitrosativ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75213 17191135 96178 9462 5013 HMOX1 ho 1 ho 1 0 1.0 heme oxygenase system until 1997 two heme oxygenase ho isoforms were described: an inducible isoform ho 1 and a constitutive isoform ho 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75214 17191135 96178 9463 5014 HMOX2 ho 2 ho 2 0 1.0 heme oxygenase system until 1997 two heme oxygenase ho isoforms were described: an inducible isoform ho 1 and a constitutive isoform ho 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75215 17191135 96183 9462 5013 HMOX1 ho 1 ho 1 0 1.0 apart from the identity between the active centers of the enzyme ho 1 and ho 2 broadly differ in cell and tissue regulation and distribution. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75216 17191135 96183 9463 5014 HMOX2 ho 2 ho 2 0 1.0 apart from the identity between the active centers of the enzyme ho 1 and ho 2 broadly differ in cell and tissue regulation and distribution. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75217 17191135 96184 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is induced by various stimuli including ros rns ischemia heat shock lps hemin and the neuroprotective agent neotrofin [ 41 44 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75218 17191135 96185 9462 5013 HMOX1 ho 1 ho 1 0 1.0 furthermore in cultured human cells ho 1 expression can be repressed by hypoxia or by the treatment with interferon g or desferrioxamine [ 47 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75219 17191135 96186 9463 5014 HMOX2 ho 2 ho 2 0 1.0 on the contrary ho 2 the constitutive form is responsive to developmental factors adrenal glucocorticoids [ 41 45 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75220 17191135 96187 9462 5013 HMOX1 ho 1 ho 1 0 1.0 although ho 1 and ho 2 catalyze the same reaction they play different roles in protecting tissues against injuries. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75221 17191135 96187 9463 5014 HMOX2 ho 2 ho 2 0 1.0 although ho 1 and ho 2 catalyze the same reaction they play different roles in protecting tissues against injuries. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75222 17191135 96188 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the current hypothesis suggests that ho 1 induction is one of the earlier cellular responses to tissue damage and is responsible for the rapid transformation of the pro oxidant heme into carbon monoxide co and bilirubin br two molecules with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75223 17191135 96189 9463 5014 HMOX2 ho 2 ho 2 0 1.0 on the contrary ho 2 constitutively expressed is primarily involved in maintaining cell heme homeostasis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75224 17191135 96191 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the induction of ho 1 is regulated principally by two upstream enhancers e1 and e2 [ 52 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75225 17191135 96193 14345 7782 NFE2L2 nf e2 nf e2 0 1.0 there is now evidence to suggest that heterodimers of nf e2 related factors 2 nrf2 and one or another of the small maf proteins i.e mafk maff and mafg are directly involved in induction of ho 1 gene through these mares [ 53 ]. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 14343 7780 NFE2 0 75226 17191135 96193 9462 5013 HMOX1 ho 1 ho 1 0 1.0 there is now evidence to suggest that heterodimers of nf e2 related factors 2 nrf2 and one or another of the small maf proteins i.e mafk maff and mafg are directly involved in induction of ho 1 gene through these mares [ 53 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75227 17191135 96195 9462 5013 HMOX1 ho 1 ho 1 0 1.0 hence regulation of ho 1 gene expression by bach1 and heme occurs through antagonism between transcription activators and the repressor bach1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75228 17191135 96196 14345 7782 NFE2L2 nf e2 nf e2 0 1.0 mal physiological conditions expression of ho 1 is repressed by bach1/maf complex while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with the transcriptional promotion of ho 1 [ 33 ]. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 14343 7780 NFE2 0 75229 17191135 96196 9462 5013 HMOX1 ho 1 ho 1 0 1.0 under normal physiological conditions expression of ho 1 is repressed by bach1/maf complex while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75230 17191135 96196 9462 5013 HMOX1 ho 1 ho 1 0 1.0 x while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with the transcriptional promotion of ho 1 [ 33 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75231 17191135 96200 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in the rat brain bvr is co expressed in cells that display ho 1 and/or ho 2 under normal conditions as well as in regions and cell types that have the potential to express heat shock inducible ho 1 protein [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75232 17191135 96200 9463 5014 HMOX2 ho 2 ho 2 0 1.0 in the rat brain bvr is co expressed in cells that display ho 1 and/or ho 2 under normal conditions as well as in regions and cell types that have the potential to express heat shock inducible ho 1 protein [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75233 17191135 96203 9463 5014 HMOX2 ho 2 ho 2 0 1.0 heme oxygenase 1 is ubiquitary and particularly abundant in reticuloendothelial organs such as liver and spleen whereas ho 2 is localized in specific organs such as brain kidney and testis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75234 17191135 96203 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is ubiquitary and particularly abundant in reticuloendothelial organs such as liver and spleen whereas ho 2 is localized in specific organs such as brain kidney and testis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75235 17191135 96204 9463 5014 HMOX2 ho 2 ho 2 0 1.0 the cns is endowed with very high ho activity under basal conditions mostly accounted for by ho 2 the latter being expressed in neuronal populations in forebrain hippocampus hypothalamus midbrain basal ganglia thalamus cerebellum and brainstem. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75236 17191135 96206 9462 5013 HMOX1 ho 1 ho 1 0 1.0 this finding indicates that the activation of ho 1 and the following formation of co can be induced by many noxious stimuli within the nuclei that are primarily involved in the central regulation of the stress response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75237 17191135 96208 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is also found within cells of glial lineage where its gene expression can be induced by oxidative stress [ 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75238 17191135 96213 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the thioredoxin system the thioredoxin trx system trx and trx reductase has received a considerable attention in the last years as a stress responsive gene [ 60 ] fig 1 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75239 17191135 96215 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 originally identified in escherichia coli in 1964 as a hydrogen donor for ribonucleotide reductase required for dna synthesis trx plays an essential role in cell function by limiting oxidative stress directly via antioxidant effects and indirectly by protein protein interactions [ 61 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75240 17191135 96217 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 in fact trx and gsh systems are involved in a variety of redox dependent pathways such as supplying reducing equivalents for ribonucleotide reductase the first step in dna biosynthesis and peptide methionine sulfoxide reductase an enzyme involved in antioxidant defenses and regulation of the cellular redox state [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75241 17191135 96217 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 in fact trx and gsh systems are involved in a variety of redox dependent pathways such as supplying reducing equivalents for ribonucleotide reductase the first step in dna biosynthesis and peptide methionine sulfoxide reductase an enzyme involved in antioxidant defenses and regulation of the cellular redox state [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75242 17191135 96221 23454 12435 TXN thioredoxin thioredoxin 0 1.0 thioredoxin itself is kept in a reduced form by trxr and nadph collectively known as the trx system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75243 17191135 96236 23454 12435 TXN thioredoxin thioredoxin 0 1.0 trx 1 and trxr the most extensively studied eukaryotic thioredoxin proteins were first localized immunohistochemically in the rat sciatic nerve. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75244 17191135 96239 22027 11742 TFAP2A ap 2 ap 2 0 1.0 ene contains a series of stress responsive elements various transcription factor binding sites such as sp1 gcf and wt zfp conferring constitutive expression inducible expression elements such as ap 1 ap 2 nf kb oct 1 pea 3 myb and the antioxidant responsive element are [ 71 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75245 17191135 96239 7683 3796 FOS ap 1 ap 1 0 1.0 trx gene contains a series of stress responsive elements various transcription factor binding sites such as sp1 gcf and wt zfp conferring constitutive expression inducible expression elements such as ap 1 ap 2 nf kb oct 1 pea 3 myb and the antioxidant responsive element are [ 71 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75246 17191135 96243 7683 3796 FOS ap 1 ap 1 0 1.0 in has been reported to cause the translocation of trx from the cytoplasm to the nucleus where it regulates the redox activation and dna binding activity of critical transcription factors such as the ap 1 family members nf kb jun fos p53 creb pebp2/cbf myb all involved in fundamental processes such as gene expression cell growth and apoptosis [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75247 17191135 96248 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 ngf a neurotrophic factor regulating development maintenance and function of the cns has been shown to activate trx 1 expression via cyclic amp camp response elements cres present in the trx 1 gene promoter and also to induce 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75248 17191135 96249 9462 5013 HMOX1 ho 1 ho 1 0 1.0 that beyond its ability to regulate the function of proteins through thiol disulfide exchange reactions trx may also have beneficial effects during oxidative stress by transcriptionally upregulating ho 1 with important cytoprotective pleiotropic effects deriving from heme degradation biliverdin and bilirubin formation as well as carbon monoxide generation [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75249 17191135 96254 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the prxs also called thioredoxin peroxidases are a relatively newly discovered family of antioxidant enzymes most of which use the reducing activity of trx or other electron donors to catalyze the reduction of peroxides including h 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75250 17191135 96269 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 onal changes of the protein and ubiquitination clearing misfolded proteins to the proteasome and segregation of tau aggregates from the cellular machinery and recruitment of chaperone pairs including hsp70 and hsp27 endowed with anti apoptotic properties [ 85 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75251 17191135 96270 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 binding of phosphorylated tau to hsp70 implies that the complex may be a substrate for the e3 ligase carboxyl terminus of heat shock cognate hsc 70 interacting protein chip [ 86 88 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75252 17191135 96271 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 chip_amp_#8217;s is a ubiquitin e3 ligase that can collaborate with molecular chaperones to facilitate protein folding and prevent protein aggregation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75253 17191135 96272 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 together with hsp70 chip can regulate tau ubiquitination and degradation in a cell culture system [ 87 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75254 17191135 96273 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increased levels of chip and hsp70 has ben detected in ad compared with normal controls [ 86 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75255 17191135 96279 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 mass spectrometry analysis of proteins that specifically coimmunoprecipitate with ab has identified chaperone proteins such as hsp70 and alpha b crystallin related small hsp hsp16 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75256 17191135 96281 9462 5013 HMOX1 ho 1 ho 1 0 1.0 recently the involvement of ho 1 in the antidegenerative mechanisms operating in ad has received considerable attention as it has been demonstrated that the amyloid precursor protein app decreases ho activity thus reducing the intra 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75257 17191135 96282 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 induction which occurs together with the induction of other stress proteins during various physiopathological conditions represents a strong protective system potentially active against brain oxidati 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75258 17191135 96283 9462 5013 HMOX1 ho 1 ho 1 0 1.0 significant increases in the levels of ho 1 have been observed in ad brains in association with neurofibrillary tangles and also ho 1 mrna was found increased in ad neocortex and cerebral vessels [ 92 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75259 17191135 96284 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [ 94 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75260 17191135 96284 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [ 94 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75261 17191135 96285 12369 6893 MAPT tau protein tau protein 0 1.0 in addition takeda et al. explored the relationship between ho 1 and tau protein this latter being the major component of intraneuronal neurofibrillary tangles in ad [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75262 17191135 96285 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition takeda et al. explored the relationship between ho 1 and tau protein this latter being the major component of intraneuronal neurofibrillary tangles in ad [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75263 17191135 96286 12369 6893 MAPT tau protein tau protein 0 1.0 in transfected neuroblastoma cells overexpressing ho 1 the activity of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense ho 1 or vector transfected cells [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75264 17191135 96286 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in transfected neuroblastoma cells overexpressing ho 1 the activity of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense ho 1 or vector transfected cells [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75265 17191135 96287 12369 6893 MAPT tau protein tau protein 0 1.0 the suppression of tau protein expression was almost completely counteracted by zinc deuteroporphyrin a specific inhibitor of ho activity [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75266 17191135 96288 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the activated forms of erks extracellular signal regulated kinases were also decreased in cells overexpressing ho 1 although no changes in the expression of total erks were observed [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75267 17191135 96291 9462 5013 HMOX1 ho 1 ho 1 0 1.0 consistently recent data from our laboratory has provided clear evidence in the inferior parietal brain of ad patients of a significant increase in the expression of ho 1 and trxr whereas this latter was not increased in the cerebellum of ad brains compared to controls [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75268 17191135 96294 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 in addition ad lymphocytes showed an increased expression of inducible nitric oxide synthase ho 1 hsp72 hsp60 and trxr [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75269 17191135 96294 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition ad lymphocytes showed an increased expression of inducible nitric oxide synthase ho 1 hsp72 hsp60 and trxr [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75270 17191135 96301 23454 12435 TXN thioredoxin thioredoxin 0 1.0 these observations strongly support a role for nitrosative stress in the pathogenesis of ad and indicate that the stress responsive genes such as heme oxygenase and thioredoxin reductase may represent important targets for novel cytoprotective strategies [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75271 17191135 96302 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the protective role played by ho 1 in ad in fact raises new possibilities regarding the use of natural substances which are able to increase ho 1 levels as potential drugs for the treatment of ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75272 17191135 96306 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition curcumin has been shown to significantly increase ho 1 in astrocytes and vascular endothelial cells [ 100 101 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75273 17191135 96307 9462 5013 HMOX1 ho 1 ho 1 0 1.0 this latter effect on ho 1 can explain at least in part the strong antioxidant properties of curcumin in particular keeping in mind that ho 1 derived br has the ability to efficiently scavenge both ros and rns [ 8 11 13 99 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75274 17191135 96322 1316 841 ATP5G1 atp synthase lipid-binding protein atp synthase lipid binding protein 0 1.0 bundant ones it has reported that lac modulates specific genes in the rat cns such as the hsp72 gene the gene for the isoform of 14 3 3 protein and that encoding for the precursor mitochondrial p3 of atp synthase lipid binding protein [ 107 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75275 17191135 96324 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 these results have shown for the first time that acetylcarnitine induces heme oxygenase 1 and hsp60 heat shock proteins with a mechanism involving activation and nuclear translocation of the transcription factor nrf2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75276 17191135 96326 20997 11180 SOD2 mn sod mn sod 0 1.0 e alone in unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75277 17191135 96326 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75278 17191135 96326 9462 5013 HMOX1 ho 1 ho 1 0 1.0 is conceivable that acetylcarnitine alone in unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75279 17191135 96354 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the evidence that phenolic compounds such as curcumin and ferulic acid can induce ho 1 and trxr and thus reduce ad strongly indicates the therapeutic potential of nutritional compounds against nd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 76083 17214440 97706 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in most cases the cause of als is unknown although in a number of familial als cases mutations in the superoxide dismutase 1 sod1 gene were discovered. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 76084 17214440 97706 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 in most cases the cause of als is unknown although in a number of familial als cases mutations in the superoxide dismutase 1 sod1 gene were discovered. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 76737 17240849 98799 13714 4223 MSTN myostatin myostatin 0 1.0 as pharmacological drug therapies increasing skeletal muscle mass by myostatin inhibition is quite promising and will be applied clinically in the near future. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 76738 17240849 98801 13714 4223 MSTN growth differentiation factor 8 growth differentiation factor 8 0 1.0 als2 protein human|guanine nucleotide exchange factors|transforming growth factor beta|growth differentiation factor 8|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 76751 17241118 98807 4644 2159 CNR1 cannabinoid receptor 1 cannabinoid receptor 1 0 1.0 cannabinoids produce anti inflammatory actions via cannabinoid receptor 1 cb1 and cannabinoid receptor 2 cb2 and delay the progression of neuroinflammatory diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 76752 17241118 98807 4645 2160 CNR2 cannabinoid receptor 2 cannabinoid receptor 2 0 1.0 cannabinoids produce anti inflammatory actions via cannabinoid receptor 1 cb1 and cannabinoid receptor 2 cb2 and delay the progression of neuroinflammatory diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67383 17306794 84900 5141 2536 CTSK cathepsin x cathepsin x 0 1.0 in the present study we analyzed the regional cellular and subcellular localization and the activity of the recently discovered cathepsin x in the normal developing and pathological mouse brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67384 17306794 84902 5141 2536 CTSK cathepsin x cathepsin x 0 1.0 these results strongly suggest that cathepsin x is an important player in degenerative processes during normal aging and in pathological conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67385 17306794 84905 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 all cells are dependent on the two major proteolytic systems within cells the ubiquitin proteasome and the lysosomal system to control the stability function and intracellular localization of a wide variety of proteins rivett 1990 and bohley 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67386 17306794 84913 5141 2536 CTSK cathepsin x cathepsin x 0 1.0 cathepsin x catx; synonyms y z p is one of the more recently identified lysosomal cysteine proteases n_amp_#xe4;gler and m_amp_#xe9;nard 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67387 17306794 84933 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 transgenic mice expressing the human amyloid precursor protein app with the swedish mutation k670m/n671l and the human presenilin 1 ps1 carrying the mutation m146l under the control of the murine thy1 promoter were generated on the b6d2f1 genetic background in our department. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67388 17306794 84966 5134 2527 CTSB cathepsin b cathepsin b 0 1.0 second with recombinant mouse cathepsin b catb and cathepsin l catl both r_amp_#x26;d systems loaded membranes were incubated with goat anti mouse catx as primary antibody. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67389 17306794 84966 5142 2537 CTSL1 cathepsin l cathepsin l 0 1.0 second with recombinant mouse cathepsin b catb and cathepsin l catl both r_amp_#x26;d systems loaded membranes were incubated with goat anti mouse catx as primary antibody. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67390 17306794 84990 3532 1509 CASP8 cysteine protease cysteine protease 0 1.0 in parallel assays the reaction was followed in the presence of the specific catb inhibitor ca 074 1_amp_#xa0;_amp_#x3bc;m bachem weil am rhein germany and the non specific cysteine protease inhibitor e 64 5_amp_#xa0;_amp_#x3bc;m sigma in order to inactivate catb which is also able to hydrolyze the substrate at these conditions and to evaluate the total cysteine protease activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67391 17306794 84990 3532 1509 CASP8 cysteine protease cysteine protease 0 1.0 inhibitor e 64 5_amp_#xa0;_amp_#x3bc;m sigma in order to inactivate catb which is also able to hydrolyze the substrate at these conditions and to evaluate the total cysteine protease activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67392 17306794 84997 5142 2537 CTSL1 cathepsin l cathepsin l 0 1.0 cathepsin l cathepsin s as well as ece 1 activity could be excluded data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67393 17306794 84997 5153 2545 CTSS cathepsin s cathepsin s 0 1.0 cathepsin l cathepsin s as well as ece 1 activity could be excluded data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67394 17306794 84998 5134 2527 CTSB cathepsin b cathepsin b 0 1.0 the relation of ca 074 to the non inhibited fraction is adequate to cathepsin b activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67395 17306794 85004 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 form proform and mature form of catx the microglia/macrophage marker rat anti mouse cd11b anti cd11b; 1:50; alpha chain of a leukocyte associated protein; serotec the astrocyte marker rabbit anti cow glial fibrillary acidic protein anti gfap; 1:2500; acris and the neuronal marker mouse anti mouse neun 1:700; chemicon hampshire uk . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67396 17306794 85097 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 at the age of 9_amp_#xa0;months mice overexpressing both mutant app and mutant presenilin 1 app/ps1 showed numerous thioflavine s positive plaques in the cerebral cortex and the hippocampus and this plaque load increased substantially with age data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67397 17306794 85109 5141 2536 CTSK cathepsin x cathepsin x 0 1.0 in the present study we characterized the regional and cellular expression as well as the activity of the recently discovered lysosomal cysteine protease cathepsin x in the normal developing and pathological nervous system of the c57bl/6 mouse. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67398 17306794 85109 3532 1509 CASP8 cysteine protease cysteine protease 0 1.0 in the present study we characterized the regional and cellular expression as well as the activity of the recently discovered lysosomal cysteine protease cathepsin x in the normal developing and pathological nervous system of the c57bl/6 mouse. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67399 17306794 85227 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein precursor|nerve tissue proteins|presenilin 1|sod1 g93a protein|superoxide dismutase|cathepsins| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69242 17350694 88332 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 alzheimer's disease ad parkinson's disease pd and amyotrophic lateral sclerosis als are among the best examples of neurodegenerative disorders associated with intense inflammation whereas multiple sclerosis ms and hiv associated dementia are inflammatory disorders that lead to diffuse neuronal damage see glossary . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 69243 17350694 88375 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 69244 17350694 88386 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 in addition microglia and macrophages activated by hiv seem to damage neurons through the release of neurotoxins such as arachidonic acid glutamate tumor necrosis factor _amp_#x3b1; and interleukin 1 [25] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69245 17350694 88386 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 in addition microglia and macrophages activated by hiv seem to damage neurons through the release of neurotoxins such as arachidonic acid glutamate tumor necrosis factor _amp_#x3b1; and interleukin 1 [25] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69246 17350694 88394 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ion of voltage gated l n and p/q type ca 2+ channels activation of k + channels activation of focal adhesion kinase activation of cytosolic phospholipase a 2 activation cb 1 r or inhibition cb 2 r of nitric oxide synthase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69247 17350694 88394 345 238 ADCY7 adenylyl cyclase adenylyl cyclase 0 1.0 inhibition of adenylyl cyclase activation of mitogen activated protein kinase inhibition of voltage gated l n and p/q type ca 2+ channels activation of k + channels activation of focal adhesion kinase activation of cytosolic phosp 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69248 17350694 88398 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 activation of non selective ion channels activation of protein kinases opening of intracellular ca 2+ stores dissipation of mitochondrial membrane potential mitochondrial uncoupling cytochrome c release from mitochondria activation of caspases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69249 17350694 88411 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 cascades; iii antioxidant activity mainly owing to the phenol group of various resorcinol type cannabinoids; iv suppression of the production of tumor necrosis factor _amp_#x3b1;; v activation of the phosphatidylinositol 3 kinase and protein kinase b pathway; vi induction of phosphorylation of extracellular regulated kinases; and vii induction of the expression of transcription factors and neurotrophins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69250 17350694 88411 543 391 AKT1 protein kinase b protein kinase b 0 1.0 mainly owing to the phenol group of various resorcinol type cannabinoids; iv suppression of the production of tumor necrosis factor _amp_#x3b1;; v activation of the phosphatidylinositol 3 kinase and protein kinase b pathway; vi induction of phosphorylation of extracellular regulated kinases; and vii induction of the expression of transcription factors and neurotrophins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69251 17350694 88411 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 tic level followed by inhibition of subsequent noxious cascades; iii antioxidant activity mainly owing to the phenol group of various resorcinol type cannabinoids; iv suppression of the production of tumor necrosis factor _amp_#x3b1;; v activation of the phosphatidylinositol 3 kinase and protein kinase b pathway; vi induction of phosphorylation of extracellular regulated kinases; and vii induction of the expression of 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69252 17350694 88425 6901 3553 FAAH fatty acid amide hydrolase fatty acid amide hydrolase 0 1.0 pharmacological agonists of cb receptors and increased levels of endocannabinoids obtained through genetic ablation of fatty acid amide hydrolase faah [38] exert robust anti inflammatory and neuroprotective effects in hsod1g93a mice delaying disease progression 39 and 40 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69253 17350694 88427 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 69254 17350694 88453 5439 1165 DAGLA diacylglycerol lipase diacylglycerol lipase 0 1.0 by contrast the recent discovery of potent and specific inhibitors of diacylglycerol lipase dagl such as o3841 [53] table 1 suggests that it could become possible to dissect the contribution of 2 arachidonoylglycerol 2 ag and that of aea to neurological disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69255 17350694 88463 14093 21683 NAPEPLD nape pld nape pld 0 1.0 d dagl regulation and the role of these lipases in maintaining the endocannabinoid tone in vivo is of utmost importance as it has been for n acylphosphatidylethanolamine nape specific phospholipase d nape pld [59] and faah 60 and 61 with respect to aea. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69256 17350694 88463 8615 4459 GPLD1 phospholipase d phospholipase d 0 1.0 nding of magl and dagl regulation and the role of these lipases in maintaining the endocannabinoid tone in vivo is of utmost importance as it has been for n acylphosphatidylethanolamine nape specific phospholipase d nape pld [59] and faah 60 and 61 with respect to aea. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69257 17350694 88475 14093 21683 NAPEPLD nape pld nape pld 0 1.0 for example control of the cellular activity of aea seems to be largely dependent on its hydrolysis by faah rather than on its synthesis by ca 2+ dependent n acyltransferase or nape pld. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69258 17350694 88477 14093 21683 NAPEPLD nape pld nape pld 0 1.0 if not therapeutic agents per se inhibitors of nape pld faah amt dagl or magl could be used together with aea or 2 ag analogs to lower the doses or to shorten the treatment necessary in vivo to observe an effect and thus to minimize the possible psychotro 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69259 17350694 88487 14093 21683 NAPEPLD nape pld nape pld 0 1.0 narpe is then cleaved by nape pld a recently characterized phospholipase d which releases aea and phosphatidic acid. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69260 17350694 88487 8615 4459 GPLD1 phospholipase d phospholipase d 0 1.0 narpe is then cleaved by nape pld a recently characterized phospholipase d which releases aea and phosphatidic acid. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 69261 17350694 88501 14093 21683 NAPEPLD nape pld nape pld 0 1.0 on the one hand aea might control inflammatory processes by binding to trpv1 such that drugs that are able to modulate the aea metabolic enzymes nape pld and faah might be exploited to curb neuroinflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60886 17418957 76946 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 motor neuron mn mitochondrial abnormalities and elevation in spinal fluid levels of the inflammatory cytokine tumor necrosis factor alpha tnf _amp_#x3b1; have been implicated in the pathogenesis of amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60887 17418957 76946 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 motor neuron mn mitochondrial abnormalities and elevation in spinal fluid levels of the inflammatory cytokine tumor necrosis factor alpha tnf _amp_#x3b1; have been implicated in the pathogenesis of amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60888 17418957 76960 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 serum levels of the cytokine tumor necrosis factor alpha tnf _amp_#x3b1; and its soluble receptors have been reported to be elevated in als patients as compared with healthy controls poloni et al 2000 and strong 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60889 17418957 76960 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 serum levels of the cytokine tumor necrosis factor alpha tnf _amp_#x3b1; and its soluble receptors have been reported to be elevated in als patients as compared with healthy controls poloni et al 2000 and strong 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60890 17418957 76974 10601 6081 INS insulin insulin 0 1.0 vitrogen 10 ng/ml each of bdnf cntf and gdnf peprotech rocky hill nj usa 100 _amp_#x3bc;g/ml transferrin 60 ng/ml progesterone 16 _amp_#x3bc;g/ml putrescine 40 ng/ml sodium selenite 5 _amp_#x3bc;g/ml insulin 1 mm sodium pyruvate 2 mm l glutamine 40 ng/ml triiodo thyronine 1 _amp_#x3bc;g/ml laminin 2.2 _amp_#x3bc;g/ml isobutylmethylxanthine 417 ng/ml forskolin 5 _amp_#x3bc;g/ml n acetyl cysteine 100 u/ml 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60891 17418957 76974 22023 11740 TF transferrin transferrin 0 1.0 neurobasal base media invitrogen carlsbad ca usa was supplemented with b27 invitrogen 10 ng/ml each of bdnf cntf and gdnf peprotech rocky hill nj usa 100 _amp_#x3bc;g/ml transferrin 60 ng/ml progesterone 16 _amp_#x3bc;g/ml putrescine 40 ng/ml sodium selenite 5 _amp_#x3bc;g/ml insulin 1 mm sodium pyruvate 2 mm l glutamine 40 ng/ml triiodo thyronine 1 _amp_#x3bc;g/ml laminin 2.2 _ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60892 17418957 76983 551 399 ALB albumin albumin 0 0.0 triton x 100 0.1% bovine serum albumin 1% and normal goat serum 1% were used to permeate the cells and limit non specific binding. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60893 17418957 76983 551 399 ALB serum albumin serum albumin 0 1.0 triton x 100 0.1% bovine serum albumin 1% and normal goat serum 1% were used to permeate the cells and limit non specific binding. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60894 17418957 77056 12296 6839 MAP2 microtubule-associated protein 2 microtubule associated protein 2 0 1.0 although this characteristic itself is not reliable confirmation of this distinction can be made with immunohistochemical staining where at certain stages of development microtubule associated protein 2 is exclusively located in the somatodendritic domain matus et al. 1986 and the dephosphorylated form of tau 1 is exclusively found in the axons mandell and banker 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60895 17418957 77075 5693 2770 DES intermediate filament protein intermediate filament protein 0 1.0 previous studies have shown that tnf _amp_#x3b1; mediates apoptosis in cultured mn and drg neurons that over express the intermediate filament protein peripherin that associates with axonal spheroid inclusions in degenerating mn of als patients robertson et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60896 17418957 77075 17381 9461 PRPH peripherin peripherin 0 1.0 previous studies have shown that tnf _amp_#x3b1; mediates apoptosis in cultured mn and drg neurons that over express the intermediate filament protein peripherin that associates with axonal spheroid inclusions in degenerating mn of als patients robertson et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60897 17418957 77109 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 tumor necrosis factor alpha| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 60898 17418957 77109 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 tumor necrosis factor alpha| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 63138 17439481 80138 6708 3415 EPO erythropoietin erythropoietin 0 1.0 recombinant human erythropoietin suppresses symptom onset and progression of g93a sod1 mouse model of als by preventing motor neuron death and inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 63139 17439481 80140 6708 3415 EPO erythropoietin erythropoietin 0 1.0 erythropoietin epo has recently been highlighted as a cytokine with various potent neuroprotective effects including reduction of inflammation enhancement of survival signals and prevention of neuronal cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 63140 17439481 80146 6708 3415 EPO erythropoietin erythropoietin 0 1.0 erythropoietin recombinant|dinoprostone|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54654 17497670 67901 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 ative stress neuroinflammation and excitotoxicity are frequently considered distinct but common hallmarks of several neurological disorders including parkinson's disease amyotrophic lateral sclerosis multiple sclerosis and alzheimer's disease. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 57388 17555556 72109 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 recent studies suggest that microglia over expressing mutant human superoxide dismutase msod1 g93a may contribute to motoneuron death in a transgenic mouse model of familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57389 17555556 72111 10601 6081 INS insulin insulin 0 0.0 following activation with lipopolysaccharide msod1 g93a microglia released more nitric oxide more superoxide and less insulin like growth factor 1 than wild type microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57390 17555556 72111 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 following activation with lipopolysaccharide msod1 g93a microglia released more nitric oxide more superoxide and less insulin like growth factor 1 than wild type microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57391 17555556 72111 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 following activation with lipopolysaccharide msod1 g93a microglia released more nitric oxide more superoxide and less insulin like growth factor 1 than wild type microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57392 17555556 72120 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in transgenic mice over expressing human mutant cu 2+ /zn 2+ superoxide dismutase msod1 an animal model of familial als immune/inflammatory changes have been observed at early symptomatic stages almer et al 1999 ; alexianu et al 2001 ; henkel et al 2006 further suggesting a role f 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57393 17555556 72126 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 our previous in vitro studies have demonstrated that primary microglia activated by lipopolysaccharide lps up regulated inducible nitric oxide synthase inos expression and released nitric oxide and superoxide which were cytotoxic to co cultured primary motoneurons le et al 2001 ; zhao et al 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57394 17555556 72133 10601 6081 INS insulin insulin 0 0.0 our results demonstrate that msod1 g93a mouse microglia release more nitric oxide more superoxide and less insulin like growth factor 1 igf 1 than wild type microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57395 17555556 72133 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 our results demonstrate that msod1 g93a mouse microglia release more nitric oxide more superoxide and less insulin like growth factor 1 igf 1 than wild type microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57396 17555556 72133 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 our results demonstrate that msod1 g93a mouse microglia release more nitric oxide more superoxide and less insulin like growth factor 1 igf 1 than wild type microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57397 17555556 72152 551 399 ALB albumin albumin 0 0.0 the cells were collected and centrifuged through a 4% bovine serum albumin cushion at 450 g for 10 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57398 17555556 72152 551 399 ALB serum albumin serum albumin 0 1.0 the cells were collected and centrifuged through a 4% bovine serum albumin cushion at 450 g for 10 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57399 17555556 72153 10601 6081 INS insulin insulin 0 1.0 the cells were then re suspended in the l 15 culture medium supplemented with sodium bicarbonate 0.2% glucose 3.6 mg/ml progesterone 20 nmol/l insulin 5 _amp_#x03bc;g/ml putrescine 0.1 mmol/l conalbumin 0.1 mg/ml sodium selenite 30 nmol/l penicillin 100 iu/ml streptomycin 100 _amp_#x03bc;g/ml and horse serum 2% . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57400 17555556 72192 3544 1516 CAT catalase catalase 0 1.0 to each well 800 nmol/l phorbol 12 myristate 13 acetate 10 u/ml catalase and 80 _amp_#x03bc;mol/l ferricytochrome c in 200 _amp_#x03bc;l hanks_amp_#8217; balanced salt solution was added. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57401 17555556 72196 10601 6081 INS insulin insulin 0 0.0 elisa for igf 1 insulin like growth factor 1 elisa duoset kit r _amp_ d systems minneapolis mn usa was used to determine the concentrations of igf 1 in cell culture supernatants. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57402 17555556 72196 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 elisa for igf 1 insulin like growth factor 1 elisa duoset kit r _amp_ d systems minneapolis mn usa was used to determine the concentrations of igf 1 in cell culture supernatants. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57403 17555556 72196 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 elisa for igf 1 insulin like growth factor 1 elisa duoset kit r _amp_ d systems minneapolis mn usa was used to determine the concentrations of igf 1 in cell culture supernatants. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57404 17555556 72217 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 because superoxide production from the microglia is assayed by the reduction of ferricytochrome c we added superoxide dismutase sod to the assay to test if the reduction of ferricytochrome c is due to superoxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57405 17555556 72219 10601 6081 INS insulin insulin 0 0.0 insulin like growth factor 1 is a potent motoneuron trophic and survival factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57406 17555556 72219 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 insulin like growth factor 1 is a potent motoneuron trophic and survival factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57407 17555556 72219 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 insulin like growth factor 1 is a potent motoneuron trophic and survival factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57408 17555556 72261 10437 5992 IL1B il 1b il 1b 0 1.0 microglial activation can be associated with increased production of potentially cytotoxic substances such as nitric oxide superoxide and pro inflammatory cytokines including tnf a il 1b and il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57409 17555556 72261 10463 6018 IL6 il 6 il 6 0 1.0 microglial activation can be associated with increased production of potentially cytotoxic substances such as nitric oxide superoxide and pro inflammatory cytokines including tnf a il 1b and il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57410 17555556 72272 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 although two earlier reports demonstrated that gene deletion of inos or neuronal nitric oxide synthase nnos does not alter motoneuron disease in double transgenic inos _amp_#8722;/_amp_#8722; /msod1 g93a or nnos _amp_#8722;/_amp_#8722; /msod1 g93a mice facchinetti et al 1999 ; son et al 2001 a recent 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57411 17555556 72272 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 although two earlier reports demonstrated that gene deletion of inos or neuronal nitric oxide synthase nnos does not alter motoneuron disease in double transgenic inos _amp_#8722;/_amp_#8722; /msod1 g93a or nnos _amp_#8722;/_amp_#8722; /msod1 g93a mice facchinetti et al 1999 ; son et al 2001 a recent 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57412 17555556 72293 10463 6018 IL6 il 6 il 6 0 1.0 2004 found that adult 60 days msod1 g93a microglia produced significantly more tnf a and less il 6 than wild type microglia after lps treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57413 17555556 72298 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 they reported that microglia derived from mutant presenilin 1 mice were more sensitive to lps treatment than wild type microglia; microglia expressing mutant presenilin 1 exhibited a heightened sensitivity to lps as demonstrated by superinduction of inos and activation of mitogen activated protein kinase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57414 17555556 72316 3544 1516 CAT catalase catalase 0 1.0 these results could possibly be related to the increased oxidative stress and increased protein oxidation due to an over expression of h 2 o 2 and the inability of catalase to compensate fullerton et al 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57415 17555556 72321 4413 1984 CISH suppressor of cytokine signaling suppressor of cytokine signaling 0 1.0 for example the suppressor of cytokine signaling socs group of proteins has been implicated in a negative feedback of cytokine release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57416 17555556 72322 20987 19383 SOCS1 socs 1 socs 1 0 1.0 socs 1 and socs 3 are critical factors down regulating the toxic effects of lps berlato et al 2002 ; nakagawa et al 2002 and may well influence the toxic effects of msod1 microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 57417 17555556 72322 20991 19391 SOCS3 socs 3 socs 3 0 1.0 socs 1 and socs 3 are critical factors down regulating the toxic effects of lps berlato et al 2002 ; nakagawa et al 2002 and may well influence the toxic effects of msod1 microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58501 17569578 73494 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 activation of all ppar isoforms but especially of ppar_amp_#x3b3; has been found to be protective in murine in vitro and in vivo models of multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 58502 17569578 73495 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 the verification of these findings in human cells prompted the initiation of clinical studies evaluating ppar_amp_#x3b3; activation in multiple sclerosis patients. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 58503 17569578 73499 10601 6081 INS insulin insulin 0 1.0 the ability of ppar agonists to elicit anti amyloidogenic anti inflammatory and insulin sensitizing effects may account for the observed effects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58504 17569578 73525 14187 7672 NCOR1 n cor n cor 0 1.0 nf_amp_#x3ba;b regulated inflammatory genes are maintained in a repressed state through their association with n cor containing corepressor complexes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58505 17569578 73576 193 26101 ACSF2 acyl-coa synthetase 2 acyl coa synthetase 2 0 1.0 acyl coa synthetase 2 which is crucial in fatty acid utilization is regulated by ppar_amp_#x3b2;/_amp_#x3b4; at the transcriptional level providing a facile measure of ppar_amp_#x3b2;/_amp_#x3b4; action. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58506 17569578 73593 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis and experimental allergic encephalitis 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 58507 17569578 73594 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis ms is a chronic autoimmune disorder of the cns that affects most commonly young adults and is characterized pathologically by multiple areas of white matter inflammation demyelination and glial scarr 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 58508 17569578 73596 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 several cytokines including tumor necrosis factor _amp_#x3b1;_amp_#xa0; tnf_amp_#x3b1; interferon _amp_#x3b3;_amp_#xa0; ifn_amp_#x3b3; and interleukin 6 il 6 are regularly found in multiple sclerosis brain lesions and in spinal cord infiltrates of eae mice [124] . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 58509 17569578 73596 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 several cytokines including tumor necrosis factor _amp_#x3b1;_amp_#xa0; tnf_amp_#x3b1; interferon _amp_#x3b3;_amp_#xa0; ifn_amp_#x3b3; and interleukin 6 il 6 are regularly found in multiple sclerosis brain lesions and in spinal cord infiltrates of eae mice [124] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58510 17569578 73596 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 several cytokines including tumor necrosis factor _amp_#x3b1;_amp_#xa0; tnf_amp_#x3b1; interferon _amp_#x3b3;_amp_#xa0; ifn_amp_#x3b3; and interleukin 6 il 6 are regularly found in multiple sclerosis brain lesions and in spinal cord infiltrates of e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58511 17569578 73596 10463 6018 IL6 il 6 il 6 0 1.0 several cytokines including tumor necrosis factor _amp_#x3b1;_amp_#xa0; tnf_amp_#x3b1; interferon _amp_#x3b3;_amp_#xa0; ifn_amp_#x3b3; and interleukin 6 il 6 are regularly found in multiple sclerosis brain lesions and in spinal cord infiltrates of eae mice [124] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58512 17569578 73600 13374 7197 MOG myelin oligodendrocyte glycoprotein myelin oligodendrocyte glycoprotein 0 1.0 using the synthetic ppar_amp_#x3b3; ligand troglitazone niino et al. first demonstrated in the myelin oligodendrocyte glycoprotein peptide 35_amp_#x2013;55 mog 35_amp_#x2013;55 induced eae model that activation of ppar_amp_#x3b3; limits the development of clinical symptoms and infiltration of brain parenchyma by peripherial leuk 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58513 17569578 73603 10480 5962 IL10 il 10 il 10 0 1.0 c implication of this finding was further supported by a study of diab et al. showing that the endogenous ppar_amp_#x3b3; ligand 15d pgj 2 inhibited t cell proliferation and suppressed ifn_amp_#x3b3; il 10 and il 4 generation by activated lymphocytes [53] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58514 17569578 73603 10458 6014 IL4 il 4 il 4 0 1.0 ion of this finding was further supported by a study of diab et al. showing that the endogenous ppar_amp_#x3b3; ligand 15d pgj 2 inhibited t cell proliferation and suppressed ifn_amp_#x3b3; il 10 and il 4 generation by activated lymphocytes [53] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58515 17569578 73612 5198 10637 CXCL10 ip 10 ip 10 0 1.0 ppar_amp_#x3b3; agonists have been shown to reduce the expression of the monocytic chemoattractant mcp1 [95] ip 10 cxcl3 mig and i tac [117] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58516 17569578 73612 3758 10618 CCL2 mcp 1 mcp1 0 1.0 ppar_amp_#x3b3; agonists have been shown to reduce the expression of the monocytic chemoattractant mcp1 [95] ip 10 cxcl3 mig and i tac [117] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58517 17569578 73612 5199 10638 CXCL11 i tac i tac 0 1.0 ppar_amp_#x3b3; agonists have been shown to reduce the expression of the monocytic chemoattractant mcp1 [95] ip 10 cxcl3 mig and i tac [117] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58518 17569578 73629 10452 6001 IL2 il 2 il 2 0 1.0 importantly ppar_amp_#x3b1; is expressed by t lymphocytes and its activation results in suppression of il 2 production and proliferation [44] and [116] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58519 17569578 73632 10463 6018 IL6 il 6 il 6 0 1.0 in the same study splenocytes derived from wy14 643 treated mice showed an impaired generation of ifn_amp_#x3b3; tnf_amp_#x3b1; and il 6 in response to mog peptide in vitro restimulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58520 17569578 73634 10458 6014 IL4 il 4 il 4 0 1.0 the authors showed that gemfibrozil and ciprofibrate induced il 4 production in murine and human lymphocytes while ifn_amp_#x3b3; production was decreased. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58521 17569578 73637 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 human multiple sclerosis 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 58522 17569578 73643 1576 990 BCL2 bcl 2 bcl 2 0 1.0 electron microscopy and western blot analysis revealed dna condensation and down regulation of bcl 2 suggesting the induction of apoptosis in activated t lymphocytes [151] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58523 17569578 73678 17610 9605 PTGS2 cox 2 cox2 0 1.0 ppar_amp_#x3b3; activation in microglial cells suppressed inflammatory cytokine expression inos expression and no production and inhibition of cox2 and subsequent generation of immunostimulated prostanoid synthesis [38] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58524 17569578 73679 7683 3796 FOS ap 1 ap 1 0 1.0 s are a result of the ability of ppar_amp_#x3b3; to suppress the promoters of proinflammatory genes through antagonism of the actions of the transcription factor nf_amp_#x3ba;b and to a lesser extent ap 1 and stats [46] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58525 17569578 73693 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 a series of independent studies found that ppar_amp_#x3b3; activation regulated both cellular app levels and a_amp_#x3b2; production by stimulating the ubiquitin mediated degradation of app [45] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58526 17569578 73697 10827 6207 JUP catenin catenin 0 1.0 in addition to the aforementioned mechanisms modulation of the wnt/_amp_#x3b2; catenin signaling pathway may also account for some ppar_amp_#x3b3; mediated beneficial effects in ad since recent findings show that ppar_amp_#x3b3; mediated protection of hippocampal neurons against a_amp_ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58527 17569578 73697 10827 6207 JUP catenin catenin 0 1.0 effects in ad since recent findings show that ppar_amp_#x3b3; mediated protection of hippocampal neurons against a_amp_#x3b2; induced toxicity directly correlates with the modification of _amp_#x3b2; catenin levels inhibition of gsk 3_amp_#x3b2; activity and increased levels of wnt target genes [63] and [83] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58528 17569578 73702 10601 6081 INS insulin insulin 0 1.0 the reduced a_amp_#x3b2; 1_amp_#x2013;42 was argued to arise from an increase in the levels of insulin degrading enzyme ide in rosiglitazone treated transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58529 17569578 73702 9847 5381 IDE insulin-degrading enzyme insulin degrading enzyme 0 1.0 the reduced a_amp_#x3b2; 1_amp_#x2013;42 was argued to arise from an increase in the levels of insulin degrading enzyme ide in rosiglitazone treated transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58530 17569578 73707 10601 6081 INS insulin insulin 0 1.0 these data were interpreted as evidence for a significant role for peripheral insulin sensitivity in cognition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58531 17569578 73708 10601 6081 INS insulin insulin 0 1.0 ad risk and memory impairment is associated with hyperinsulinemia and insulin resistance features which characterize type ii diabetes [110] and [170] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58532 17569578 73710 10601 6081 INS insulin insulin 0 1.0 these linkages led to the initiation of clinical investigations of insulin sensitizing tzds currently in clinical use for the treatment of type ii diabetes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58533 17569578 73735 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 in this study pioglitazone also protected tyrosine hydroxylase positive substantia nigra neurons from mptp induced cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58534 17569578 73740 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 in addition to the observed effects with ppar_amp_#x3b3; agonists in the mptp model ppar_amp_#x3b1; has been demonstrated in tyrosine hydroxylase th positive cells of the snpc and preventive treatment of mice with the ppar_amp_#x3b1; agonist fenofibrate protected from mptp induced loss of th positive neurons in the snpc and th immunoreactivity 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58535 17569578 73756 17610 9605 PTGS2 cox 2 cox 2 0 1.0 activated microglia were significantly reduced at sites of neurodegeneration in pioglitazone treated sod1 g93a mice as were the protein levels of cox 2 and inos. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58536 17569578 73758 4413 1984 CISH suppressor of cytokine signaling suppressor of cytokine signaling 0 0.0 interestingly mrna levels of the suppressor of cytokine signaling 1 and 3 genes were increased by pioglitazone whereas both the mrna and protein levels of endogenous mouse sod1 and of transgenic human sod1 remained unaffected [154] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58537 17569578 73758 20987 19383 SOCS1 suppressor of cytokine signaling 1 suppressor of cytokine signaling 1 0 1.0 interestingly mrna levels of the suppressor of cytokine signaling 1 and 3 genes were increased by pioglitazone whereas both the mrna and protein levels of endogenous mouse sod1 and of transgenic human sod1 remained unaffected [154] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58538 17569578 73766 17610 9605 PTGS2 cox 2 cox2 0 1.0 the peripheral leukocytes and microglia mount a robust inflammatory response with the induction of cytokine and chemokine expression as well as elevated expression of adhesion molecules inos cox2 and other inflammatory mediators which act to exacerbate the tissue damage [9] [12] and [181] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58539 17569578 73772 17610 9605 PTGS2 cox 2 cox2 0 1.0 the salutary actions of the drugs were associated with reduced infiltration of peripheral leukocytes diminished microglial activation and reduction of inos cox2 and cytokine expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58540 17569578 73773 23633 12518 UCP2 uncoupling protein 2 uncoupling protein 2 0 1.0 additional mechanisms include the regulation of uncoupling protein 2 a subsequent decrease of lipid peroxidation and improved neuronal survival [30] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58541 17569578 73786 10601 6081 INS insulin insulin 0 1.0 an nih sponsored trial is currently testing the ability of pioglitazone to decrease stroke incidence in non diabetic patients with insulin resistance. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58542 17569578 73802 19641 10739 SEMA6B semaphorin 6b semaphorin 6b 0 1.0 these ligands strongly downregulated the expression of semaphorin 6b a member of the semaphorin family of axon guidance molecules [34] suggesting suppression of glioma invasion mechanisms by these ppar_amp_#x3b1; agonists. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58543 17569578 73807 13323 7166 MMP2 matrix metalloproteinase 2 matrix metalloproteinase 2 0 1.0 furthermore ppar_amp_#x3b3; agonist ligands increased cell adhesion cell migration and tumor invasion that was associated with a decrease in matrix metalloproteinase 2 mmp2 levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58544 17569578 73819 13262 7107 MKI67 ki 67 ki 67 0 1.0 furthermore proliferation in rat glioma cells was inhibited as measured by ki 67 expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58545 17569578 73824 13327 7176 MMP9 mmp 9 mmp9 0 1.0 the authors also observed decreased tumor invasion in vivo that were correlated with reduced mmp9 levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58546 17569578 73834 1666 593 BIRC5 survivin survivin 0 1.0 troglitazone treatment led to a marked down regulation of the anti apoptotic proteins flip and survivin [152] as well bcl 2 [2] and so could possibly counteract the capability of tumor cells to become resistant to apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58547 17569578 73834 1576 990 BCL2 bcl 2 bcl 2 0 1.0 troglitazone treatment led to a marked down regulation of the anti apoptotic proteins flip and survivin [152] as well bcl 2 [2] and so could possibly counteract the capability of tumor cells to become resistant to apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58548 17569578 73846 2167 13716 C4orf6 expressed in neuroblastoma expressed in neuroblastoma 0 1.0 regardless of the phenotype ppar_amp_#x3b3; is expressed in neuroblastoma cell lines [155] as well as in primary neuroblastoma cells [67] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58935 17574754 74300 17610 9605 PTGS2 cox 2 cox 2 0 1.0 induction of cyclooxygenase 2 cox 2 with production of prostaglandins occurs in a wide spectrum of acute and chronic neurodegenerative diseases and is associated with neuronal death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58936 17574754 74301 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inhibition of the cox 2 pathway and downstream production of prostaglandins protect neurons in rodent models of cerebral ischemia and neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58937 17574754 74302 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 recent studies investigating the functions of selected prostaglandin receptor pathways in mediating cox 2 neurotoxicity have demonstrated both toxic and paradoxically neuroprotective effects of several receptors in models of excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58938 17574754 74302 17610 9605 PTGS2 cox 2 cox 2 0 1.0 recent studies investigating the functions of selected prostaglandin receptor pathways in mediating cox 2 neurotoxicity have demonstrated both toxic and paradoxically neuroprotective effects of several receptors in models of excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58939 17574754 74306 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the inducible isoform of cyclooxygenase cox 2 is rapidly upregulated in vivo in hippocampal and cerebral cortical neurons following n methyl d aspartate nmda receptor dependent synaptic activity [23] consistent with a physiologic role in modulat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58940 17574754 74307 17610 9605 PTGS2 cox 2 cox 2 0 1.0 however in pathologic conditions caused by either excitotoxicity or inflammation cox 2 expression and activity are increased in neurons and glial cells and can promote either primary or secondary neuronal injury respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58941 17574754 74308 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus increased cox 2 activity and prostaglandin production are hallmarks of a wide range neurological disease models including acute excitotoxic events such as cerebral ischemia traumatic brain or spinal cord injury as w 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58942 17574754 74309 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 in humans increased cox 2 and prostaglandin production have been observed in ad als multiple sclerosis and pd [1] [10] [22] and [24] . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 58943 17574754 74309 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in humans increased cox 2 and prostaglandin production have been observed in ad als multiple sclerosis and pd [1] [10] [22] and [24] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58944 17574754 74310 17610 9605 PTGS2 cox 2 cox 2 0 1.0 thus cox 2 appears to function physiologically in promoting synaptic activity and pathologically in diseases characterized by excitotoxicity or inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58945 17574754 74311 17610 9605 PTGS2 cox 2 cox 2 0 1.0 because inhibition of cox 2 either genetically or pharmacologically decreases neuronal injury in rodent models of nmda dependent excitotoxicity there is considerable interest in defining the downstream mechanisms by which cox 2 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58946 17574754 74311 17610 9605 PTGS2 cox 2 cox 2 0 1.0 either genetically or pharmacologically decreases neuronal injury in rodent models of nmda dependent excitotoxicity there is considerable interest in defining the downstream mechanisms by which cox 2 exerts its neurotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58947 17574754 74312 17610 9605 PTGS2 cox 2 cox 2 0 1.0 a primary focus has been the examination of prostaglandin signaling cascades downstream of cox 2 and the identification of neurotoxic prostaglandin receptors [4] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58948 17574754 74313 17610 9605 PTGS2 cox 2 cox 2 0 1.0 prostaglandins are lipid signaling molecules derived from the metabolism of arachidonic acid by cox 1 and the inducible cox 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58949 17574754 74316 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 cox 2 neurotoxicity is presumed to be mediated by one or more of these prostaglandin receptor signaling cascades. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58950 17574754 74316 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 neurotoxicity is presumed to be mediated by one or more of these prostaglandin receptor signaling cascades. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58951 17574754 74317 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 recent studies using genetic models have begun to shed light on the function of prostaglandin receptor signaling in models of neuronal damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58952 17574754 74324 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 these divergent effects of prostaglandin receptor signaling on neuronal survival occur in models of excitotoxicity where neuronal injury occurs in large part from overactivation of glutamate ionotropic receptors and downstream disruptions in intrace 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58953 17574754 74335 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 prostaglandin receptor agonists were prepared as a 10 mm stock in 100% ethanol and frozen at _amp_#x2212;70 _amp_#xb0;c until use. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58954 17574754 74344 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 slices were then stimulated with 10 _amp_#x3bc;m nmda for 1 h in the presence of prostaglandin receptor agonists or vehicle; after stimulation media was replaced with fresh media containing either receptor agonist or vehicle ethanol _amp_#x2264;0.1% and pi 5 _amp_#x3bc;g/ml for 23 h. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58955 17574754 74365 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 taken together these data indicate that additional prostaglandin receptor signaling cascades exert significant neuroprotective effects in excitoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58956 17574754 74374 17610 9605 PTGS2 cox 2 cox 2 0 1.0 induction of cox 2 activity and production of downstream prostaglandins is associated in a wide range of neurological disease models with neuronal injury [9] and [18] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58957 17574754 74376 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 in this study we identify additional prostaglandin receptor signaling pathways that rescue neurons in two organotypic models of excitotoxic neuronal injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58958 17574754 74378 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 inhibition has been shown to be protective in this in vitro model as well as in the transgenic model of familial als [3] [7] and [8] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58959 17574754 74379 17610 9605 PTGS2 cox 2 cox 2 0 1.0 this would suggest that the dp fp and ip receptors do not mediate cox 2 toxicity in this in vitro model and from our previous studies [3] the ep2 and ep3 receptors can also be excluded since they too rescue motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58960 17574754 74380 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 in a second model using hippocampal slices we have identified three additional prostaglandin receptor signaling pathways that confer neuroprotection in the setting of nmda toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58961 17574754 74392 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 the increased toxicity of lps with addition of ep2/ep3 receptor agonists is relevant to recent in vivo studies demonstrating that in the setting of inflammation prostaglandin receptor signaling can exhibit an opposite and toxic effect on neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58962 17574754 74403 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in models of in vitro and in vivo excitotoxicity cox 2 inhibition is clearly neuroprotective. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59274 17582695 74871 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 0.0 autoimmune dysfunction of endogenous vasoactive neuropeptides vns such as vasoactive intestinal peptide vip and pituitary adenylate cyclase activating polypeptide pacap has been postulated as a cause for some fatigue related conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59275 17582695 74871 349 241 ADCYAP1 adenylate cyclase activating polypeptide adenylate cyclase activating polypeptide 0 1.0 autoimmune dysfunction of endogenous vasoactive neuropeptides vns such as vasoactive intestinal peptide vip and pituitary adenylate cyclase activating polypeptide pacap has been postulated as a cause for some fatigue related conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59276 17582695 74871 23936 12693 VIP vasoactive intestinal peptide vasoactive intestinal peptide 0 1.0 autoimmune dysfunction of endogenous vasoactive neuropeptides vns such as vasoactive intestinal peptide vip and pituitary adenylate cyclase activating polypeptide pacap has been postulated as a cause for some fatigue related conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59277 17582695 74872 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 1.0 vn receptors are class ii g protein coupled receptors gpcrs which couple primarily to the adenylate cyclase ac cyclic amp camp pathway and camp has a central role in neurological metabolism including influencing blood brain barrier bbb and blood spinal barrier bsb permeability coordinating neuroregulatory 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59278 17582695 74873 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 complex clinical signs occur in multiple sclerosis ms and amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 59279 17582695 74878 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 apoptotic mechanisms are associated with activation of caspase pathways and functional interplay between proinflammatory cytokines interferon gamma and nitric oxide is suggested associated with oxidative stress and glial activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59280 17582695 74884 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 0.0 autoimmune dysfunction of endogenous vasoactive neuropeptides vns such as vasoactive intestinal peptide vip and pituitary adenylate cyclase activating polypeptide pacap has been postulated as a cause for some fatigue related conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59281 17582695 74884 349 241 ADCYAP1 adenylate cyclase activating polypeptide adenylate cyclase activating polypeptide 0 1.0 autoimmune dysfunction of endogenous vasoactive neuropeptides vns such as vasoactive intestinal peptide vip and pituitary adenylate cyclase activating polypeptide pacap has been postulated as a cause for some fatigue related conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59282 17582695 74884 23936 12693 VIP vasoactive intestinal peptide vasoactive intestinal peptide 0 1.0 autoimmune dysfunction of endogenous vasoactive neuropeptides vns such as vasoactive intestinal peptide vip and pituitary adenylate cyclase activating polypeptide pacap has been postulated as a cause for some fatigue related conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59283 17582695 74887 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 1.0 vn receptors are class ii g protein coupled receptors gpcrs which couple primarily to the adenylate cyclase ac cyclic amp pathway [2] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59284 17582695 74892 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 complex clinical signs occur in multiple sclerosis ms and amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 59285 17582695 74904 10480 5962 IL10 il 10 il 10 0 1.0 importantly vitamin d 3 and 1 25 dihydroxyvitamin d 3 may protect against ms via il 10 [11] a cytokine associated with vn activity in inflammatory contexts [12] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59286 17582695 74916 9230 4910 HIF1A hypoxia-inducible factor 1 hypoxia inducible factor 1 0 1.0 il 1beta and hypoxia inducible factor 1 hif 1 play important roles in influencing vessel plasticity along with vascular endothelial growth factor vegf [22] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59287 17582695 74916 19746 18420 SETD2 hif 1 hif 1 0 1.0 il 1beta and hypoxia inducible factor 1 hif 1 play important roles in influencing vessel plasticity along with vascular endothelial growth factor vegf [22] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59288 17582695 74916 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 il 1beta and hypoxia inducible factor 1 hif 1 play important roles in influencing vessel plasticity along with vascular endothelial growth factor vegf [22] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59289 17582695 74919 6708 3415 EPO erythropoietin erythropoietin 0 1.0 high erythropoietin and low vegf in csf from hypoxemic als patients suggest an abnormal response to hypoxia compared with hypoxic controls [26] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59290 17582695 74924 10463 6018 IL6 il 6 il 6 0 1.0 biochemical mediators such as glutamate are modulated by certain cytokines in neurodegenerative disorders such as als and pd e.g. il 1beta and il 6 [32] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59291 17582695 74925 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 apoptotic mechanisms are associated with activation of caspase pathways and functional interplay between proinflammatory cytokines interferon gamma and nitric oxide is suggested associated with oxidative stress and glial activation in als [33] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59292 17582695 74928 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 the p38 mitogen activated protein kinase p38mapk is activated by a variety of stimuli including oxidative stress excitotoxicity and inflammatory cytokines. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59293 17582695 74932 22551 11892 TNF tnf alpha tnf alpha 0 1.0 activation of p38 mapk is associated with upregulation of tnf alpha receptors in the spinal motor neurons of mouse models of familial als [38] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59294 17582695 74933 22551 11892 TNF tnf alpha tnf alpha 0 1.0 thus tnf alpha signalling is postulated to have a key role in als [39] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59295 17582695 74936 22217 11848 TLR2 toll-like receptor 2 toll like receptor 2 0 1.0 innate immune receptor toll like receptor 2 and proinflammatory cytokines are implicated in a lipopolysaccharide model of als suggesting that environmental factors and innate immunity are linked [42] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59296 17582695 74949 23937 12694 VIPR1 vip receptor vip receptor 0 1.0 interestingly sun et al. [54] noted impaired vip receptor vpac2 production in activated t cells in ms patients suggesting transcription irregularity at promoter regions of the vpac2 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59297 17582695 74960 158 108 ACHE acetylcholinesterase acetylcholinesterase 0 1.0 the use of selective acetylcholinesterase inhibitors in ms and eae [63] and [64] would also be consistent with postulated vn autoimmunity [65] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59298 17582695 74963 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 therapies aimed at haematopoietic stem cells may involve glial cell line derived neurotrophic factor gdnf around host motor neurons produced by grafted cells [68] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59299 17582695 74963 8240 4232 GDNF glial cell line derived neurotrophic factor glial cell line derived neurotrophic factor 0 1.0 therapies aimed at haematopoietic stem cells may involve glial cell line derived neurotrophic factor gdnf around host motor neurons produced by grafted cells [68] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59300 17582695 74970 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 0.0 adcyap1 protein human|neuropeptides|pituitary adenylate cyclase activating polypeptide|receptors g protein coupled|vasoactive intestinal peptide| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59301 17582695 74970 349 241 ADCYAP1 adenylate cyclase activating polypeptide adenylate cyclase activating polypeptide 0 1.0 adcyap1 protein human|neuropeptides|pituitary adenylate cyclase activating polypeptide|receptors g protein coupled|vasoactive intestinal peptide| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47062 17597167 59369 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 some of our studies on cytokines particularly the interleukin 1 system are summarised and discussed in relation to neurodegeneration cognition and temperature changes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47063 17597167 59384 10437 5992 IL1B il 1 il 1 0 1.0 the proinflammatory cytokines of which interleukin 1 il 1 il 6 and tumour necrosis factor _amp_#x3b1; tnf _amp_#x3b1; are involved in the initial immune response help to drive the elimination of pathogens and resolution of the inflammatory process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47064 17597167 59384 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 the proinflammatory cytokines of which interleukin 1 il 1 il 6 and tumour necrosis factor _amp_#x3b1; tnf _amp_#x3b1; are involved in the initial immune response help to drive the elimination of pathogens and resolution of the inflammatory process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47065 17597167 59384 10463 6018 IL6 il 6 il 6 0 1.0 the proinflammatory cytokines of which interleukin 1 il 1 il 6 and tumour necrosis factor _amp_#x3b1; tnf _amp_#x3b1; are involved in the initial immune response help to drive the elimination of pathogens and resolution of the inflammatory process. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47066 17597167 59390 10437 5992 IL1B il 1 il 1 0 1.0 in the case of il 1 there is an endogenous competitive antagonist of il 1 receptor il 1r mediated activity il 1 receptor antagonist il 1ra that binds to the receptor without the association of the il 1r accessory protein il 1racp and hence without an ensuing biological activity see [1] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47067 17597167 59390 10448 5997 IL1RAPL2 il-1 receptor il 1 receptor 0 1.0 in the case of il 1 there is an endogenous competitive antagonist of il 1 receptor il 1r mediated activity il 1 receptor antagonist il 1ra that binds to the receptor without the association of the il 1r accessory protein il 1racp and hence without an ensuing biological activity see [1] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47068 17597167 59390 10446 5995 IL1RAP il 1racp il 1racp 0 1.0 here is an endogenous competitive antagonist of il 1 receptor il 1r mediated activity il 1 receptor antagonist il 1ra that binds to the receptor without the association of the il 1r accessory protein il 1racp and hence without an ensuing biological activity see [1] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47069 17597167 59391 10437 5992 IL1B il 1 il 1 0 1.0 in addition the soluble il 1r type ii il 1rii acts as a so called decoy receptor by binding il 1 and preventing the binding to the signalling type i receptor il 1ri see [1] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47070 17597167 59392 10437 5992 IL1B il 1 il 1 0 1.0 the existence of two endogenous inhibitors sil 1rii and il 1ra underlines the potency of il 1 both with regard to the binding affinity and the fact that this cytokine acts on many different cells and tissues see [1] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47071 17597167 59396 10437 5992 IL1B il 1 il 1 0 1.0 cytokines such as il 1 also activate the hypothalamo_amp_#x2013;pituitary_amp_#x2013;adrenal hpa axis see [3] resulting in the release of corticotrophin releasing factor crf adrenocorticotrophic hormone acth and corticoste 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47072 17597167 59398 10437 5992 IL1B il 1 il 1 0 1.0 the occurrence of both il 1 isoforms il 1_amp_#x3b1; and il 1_amp_#x3b2; in the adrenal gland constitutively as well as inducible by lipopolysaccharides lps [4] provides another source of agonists as well as antagonists for il 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47073 17597167 59398 10437 5992 IL1B il 1 il 1 0 1.0 isoforms il 1_amp_#x3b1; and il 1_amp_#x3b2; in the adrenal gland constitutively as well as inducible by lipopolysaccharides lps [4] provides another source of agonists as well as antagonists for il 1 receptors in a situation when the immune system is activated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47074 17597167 59400 10437 5992 IL1B il 1 il 1 0 1.0 interestingly il 1 has been shown to exert modulatory effects on learning and memory however with negative effects such as impairment of spatial navigation learning in the morris water maze in rodents [6] but also posi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47075 17597167 59401 10437 5992 IL1B il 1 il 1 0 1.0 ain directed overexpression of hsil 1ra [8] it was found that blocking il 1r mediated signalling in the brain resulted in an inhibitory effect on the habituation in the open field [9] suggesting that il 1 may be an important modulator of hippocampus dependent learning. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47076 17597167 59403 9749 5294 HTR2B 5 ht 5 ht 0 1.0 analysis of dopamine da 5 hydroxytryptamine 5 ht and their metabolites in different brain regions showed that the levels were lower in the hsil 1ra transgenic mice [9] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47077 17597167 59405 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 the interleukin 1 system and neurodegeneration 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47078 17597167 59407 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 bi and stroke and for chronic disorders such as alzheimer's disease ad epilepsy amyotrophic lateral sclerosis als and parkinson's disease as well as diseases with autoimmune characteristics including multiple sclerosis ms myasthenia gravis mg and guillain barr_amp_#xe9; syndrome. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 47079 17597167 59412 10437 5992 IL1B il 1 il 1 0 1.0 cytokines such as il 1 and other inflammatory molecules may be causative or protective or merely bystanders or all of these alternatives depending on the circumstances including the length of exposure levels age of the ind 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47080 17597167 59413 10437 5992 IL1B il 1 il 1 0 1.0 the endogenous antagonist of il 1 receptors il 1ra is a useful tool to study the role of il 1r mediated activity in both physiological and pathophysiological conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47081 17597167 59416 10451 6000 IL1RN icil 1ra icil 1ra 0 1.0 il 1ra exists in three isoforms i.e. two intracellular forms icil 1ra and one secreted form sil 1ra see [1] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47082 17597167 59422 10437 5992 IL1B il 1 il 1 0 1.0 the finding that brain atrophy increased with gene dosage suggests that it is dependent on the degree of central blockade of il 1 transmission [12] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47083 17597167 59424 10437 5992 IL1B il 1 il 1 0 1.0 this conclusion is supported by the fact that il 1 promotes astroglial proliferation during embryogenesis and that it has immunomodulatory actions during brain development [2] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47084 17597167 59426 10437 5992 IL1B il 1 il 1 0 1.0 it has been suggested that il 1 released from amoeboid microglia during development is involved in regulating the growth of the cns during embryogenesis [2] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47085 17597167 59427 10437 5992 IL1B il 1 il 1 0 1.0 interestingly il 1 has been shown to stimulate the differentiation of mesencephalic progenitor cells to dopaminergic neurons [16] and to increase the neuronal survival in dissociated spinal cord cultures derived from f 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47086 17597167 59429 10463 6018 IL6 il 6 il 6 0 1.0 the levels of il 1_amp_#x3b2; il 6 and tnf _amp_#x3b1; in different brain regions of the tg hsil 1ra mice were analysed in view of possible compensatory upregulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47087 17597167 59430 10437 5992 IL1B il 1 il 1 0 1.0 however these cytokines were essentially unaffected by the chronic blocking of il 1 receptors in the brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47088 17597167 59432 10437 5992 IL1B il 1 il 1 0 1.0 furthermore a modulatory role of il 1 signalling in the brain on the production of amyloid precursor protein app was suggested by the finding that the heterozygotic but not homozygotic mice had decreased levels of app in the cerebellum [ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47089 17597167 59437 10437 5992 IL1B il 1 il 1 0 1.0 experimental studies have shown the reciprocal interactions between cytokines il 1 and il 6 and app/_amp_#x3b2; amyloid a_amp_#x3b2; peptide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47090 17597167 59437 10463 6018 IL6 il 6 il 6 0 1.0 experimental studies have shown the reciprocal interactions between cytokines il 1 and il 6 and app/_amp_#x3b2; amyloid a_amp_#x3b2; peptide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47091 17597167 59439 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 1.0 dels of ad exemplified by the early expression of il 6 mrna prior to the appearance of amyloid plaques in mice with overexpression of human app with the so called swedish mutation [31] and gliosis in apolipoprotein apoe knock out mice [32] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47092 17597167 59439 10463 6018 IL6 il 6 il 6 0 1.0 gliosis and an increased expression of proinflammatory cytokines are also found in the brain of transgenic mouse models of ad exemplified by the early expression of il 6 mrna prior to the appearance of amyloid plaques in mice with overexpression of human app with the so called swedish mutation [31] and gliosis in apolipoprotein apoe knock out mice [32] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47093 17597167 59444 10437 5992 IL1B il 1 il 1 0 1.0 cognitive dysfunction [37] but not in ad patients with severe dementia or patients with mild cognitive impairment mci [38] possibly indicating an attempt of the brain to modulate effects of increased il 1 levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47094 17597167 59447 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 excessive glutamate receptor stimulation results in increased intracellular ca 2+ levels which gives rise to neuronal cell death excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47095 17597167 59453 10437 5992 IL1B il 1 il 1 0 1.0 immuno and in situ hybridisation histochemistry demonstrated that in addition to the proinflammatory cytokine il 1 the excitotoxic injury is accompanied by an induction of a cytokine with antiinflammatory properties the endogenous receptor antagonist il 1ra see [41] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47096 17597167 59454 10437 5992 IL1B il 1 il 1 0 1.0 ka mainly induced the production of the secreted form sil 1ra [42] thus available for blocking il 1 binding to the signalling il 1ri. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47097 17597167 59456 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the induction sequence showed that the proinflammatory cytokine il 1_amp_#x3b2; preceded both the antiinflammatory il 1ra and the synthesising enzyme caspase 1 see [41] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47098 17597167 59457 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspase 1 or il 1_amp_#x3b2; converting enzyme ice is one of several cystein proteases that cleave the substrate at an aspartate_amp_#x2013;alanine site see [1] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47099 17597167 59458 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspases have in common to exert apoptotic activity and caspase 1 was shown to be the mammalian homologue of ced 3 in the nematode caenorhabditis elegans [43] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47100 17597167 59459 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 inhibition of caspase 1 activity was shown to prevent apoptotic cell death of cultured neurons [44] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47101 17597167 59460 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 in addition to its inducible production in microglia see [41] caspase 1 is found constitutively in arcuate neurons see fig 2 co localised with _amp_#x3b1; melanocyte stimulating hormone _amp_#x3b1; msh [45] whereas both il 1ra and il 1ri were found to be expressed in vas 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47102 17597167 59461 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 temic administration of ka is mediated not only by the ka receptor subtype of glutamate receptors but also indirectly by the release of the endogenous transmitter see [39] that can bind to all of the glutamate receptor subtypes including n methyl d aspartate nmda receptors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47103 17597167 59467 10463 6018 IL6 il 6 il 6 0 1.0 the ratios between the levels of il 1_amp_#x3b2; and those of il 1ra and il 6 respectively in response to ka changed over time in such a way as to indicate an imbalance at time points when the body temperature was altered [51] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47104 17597167 59474 10437 5992 IL1B il 1 il 1 0 1.0 however glucocorticoids known to have inhibitory effects on immune responses and the synthesis of il 1 [1] have been shown to block ka induced il 1_amp_#x3b2; mrna expression in cerebral cortex hippocampus and hypothalamus [53] and to enhance ka induced neuronal damage in the hippocampus [54] without 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47105 17597167 59478 10437 5992 IL1B il 1 il 1 0 1.0 these findings are somewhat surprising given the stimulatory effects of ka on cytokine synthesis [42] [47] [51] and [53] see [41] and that _amp_#x3b1; msh has been shown to reduce the levels of il 1 and other pyrogenic proinflammatory cytokines see [55] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47106 17597167 59488 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 it is conceivable that the antiinflammatory properties of _amp_#x3b1; msh are responsible for its neuroprotective activities but other properties such as neurotrophic actions via e.g. brain derived neurotrophic factor bdnf or vascular effects may also be considered. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47107 17597167 59488 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 it is conceivable that the antiinflammatory properties of _amp_#x3b1; msh are responsible for its neuroprotective activities but other properties such as neurotrophic actions via e.g. brain derived neurotrophic factor bdnf or vascular effects may also be considered. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47108 17597167 59498 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 fig. 2._amp_#xa0;micrographs of sections of the rat hypothalamus after incubation with antibodies to the p10 subunit of caspase 1 showing immunoreactive nerve cell bodies in the arcuate nucleus arrows on some neurons in a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 47109 17597167 59499 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 a dense network of varicose nerve fibres with caspase 1 immunoreactivity can be seen in the dorsomedial hypothalamic nucleus and less dense networks are seen in the ventromedial hypothalamic nucleus and the posterior hypothalamic area b . 3v = third ventr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51662 17678953 64374 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 d in a final common pathway contributing to neuronal injury and death in a wide range of acute and chronic neurological disorders ranging from parkinson's disease pd amyotrophic lateral sclerosis als multiple sclerosis and alzheimer's disease ad to stroke and trauma. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 51663 17678953 64378 15951 8548 P4HB protein disulfide isomerase protein disulfide isomerase 0 1.0 one such molecule affected is protein disulfide isomerase pdi an enzyme responsible for normal protein folding in the endoplasmic greticulum er . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51664 17678953 64378 23469 20652 TXNDC15 disulfide isomerase disulfide isomerase 0 0.0 one such molecule affected is protein disulfide isomerase pdi an enzyme responsible for normal protein folding in the endoplasmic greticulum er . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51665 17678953 64382 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51666 17678953 64382 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 0.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51667 17678953 64382 16060 8607 PARK2 e3 ubiquitin ligase e3 ubiquitin ligase 0 1.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 42219 17805244 52994 17034 9236 PPARG ppar gamma ppar gamma 0 1.0 ppar gamma|pharmaceutical preparations| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44036 17853944 55223 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 amyotrophic lateral sclerosis als is a fatal neurodegenerative disease that can be caused by dominant mutations in superoxide dismutase 1 sod1 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44037 17853944 55223 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 amyotrophic lateral sclerosis als is a fatal neurodegenerative disease that can be caused by dominant mutations in superoxide dismutase 1 sod1 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44038 17853944 55235 5279 2577 CYBA p22-phox p22 phox 0 1.0 nox1 and nox2 are closely related homologs in the nox gene family and share many of the same regulatory characteristics including a requirement for rac1 and p22 phox coactivators 10 _amp_#x02013; 12 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44039 17853944 55239 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 here we show that disrupting either of these nadph oxidase genes nox1 or nox2 significantly delayed the progression of motor neuron disease in a sod1 g93a transgenic mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44040 17853944 55291 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase activities were analyzed by measuring the rate of superoxide generation using a chemiluminescent lucigenin based system 27 with modification as previously described 28 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44041 17853944 55296 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 the initial slope of the luminescence curve rlu/min was used to calculate the rate of luminescence product formation and compared between samples as an index of nadph oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44042 17853944 55374 14170 7661 NCF2 chronic granulomatous disease chronic granulomatous disease 0 1.0 however biased x chromosome inactivation has been previously reported in female patients with x linked chronic granulomatous disease caused by nox2 gene mutations 17 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44043 17853944 55437 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 footnotes nonstandard abbreviations used: als amyotrophic lateral sclerosis; ct threshold cycle; het heterozygous; sod superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44044 17853944 55441 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 figure 1 deletion of nadph oxidase genes nox1 or nox2 enhances survival and survival index in als mice and significantly reduces superoxide production in spinal cords of end stage sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44045 17853944 55444 14554 14874 NOX5 nadph oxidase nadph oxidase 0 0.0 membrane glycoproteins|superoxide dismutase 1|superoxide dismutase|nadh nadph oxidoreductases|cybb protein mouse|nadph oxidase|nadph oxidase 1| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 44046 17853944 55444 14551 7889 NOX1 nadph oxidase 1 nadph oxidase 1 0 1.0 membrane glycoproteins|superoxide dismutase 1|superoxide dismutase|nadh nadph oxidoreductases|cybb protein mouse|nadph oxidase|nadph oxidase 1| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 45278 17896980 57305 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 nerve growth factor ngf and brain derived neurotrophic factor bdnf belong to the protein family of neurotrophins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 45279 17896980 57305 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 nerve growth factor ngf and brain derived neurotrophic factor bdnf belong to the protein family of neurotrophins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 45280 17896980 57305 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 nerve growth factor ngf and brain derived neurotrophic factor bdnf belong to the protein family of neurotrophins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46116 17901552 58245 17610 9605 PTGS2 cox 2 cox 2 0 1.0 function of cox 2 and prostaglandins in neurological disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46117 17901552 58246 17610 9605 PTGS2 cox 2 cox 2 0 1.0 induction of cox 2 expression and enzymatic activity promotes neuronal injury in a number of models of neurological disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46118 17901552 58247 17610 9605 PTGS2 cox 2 cox 2 0 1.0 inhibition of cox 2 activity either genetically or pharmacologically has been shown to be neuroprotective in rodent models of stroke parkinson's disease and amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46119 17901552 58249 17605 9600 PTGFR prostaglandin receptor prostaglandin receptor 0 1.0 umed be due to downstream effects of one or more prostaglandin products including pge2 pgd2 pgf2alpha pgi2 prostacylin and txa2 thromboxane that effect cellular changes through activation of specific prostaglandin receptor subtypes and second messenger systems. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46120 17901552 58250 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in this proceeding we review recent data demonstrating effects of prostaglandin signaling on neuronal viability that are paradoxically protective when taken in the context that cox 2 induces neuronal injury in the setting of excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46165 17908040 58278 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha inhibition as a treatment strategy for neurodegenerative disorders: new drug candidates and targets. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46166 17908040 58283 22551 11892 TNF tnf alpha tnf alpha 0 1.0 one strong candidate trigger protein and thus a potential target for therapeutic manipulation is the potent pro inflammatory / pro apoptotic cytokine tumor necrosis factor alpha tnf alpha . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46167 17908040 58283 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 one strong candidate trigger protein and thus a potential target for therapeutic manipulation is the potent pro inflammatory / pro apoptotic cytokine tumor necrosis factor alpha tnf alpha . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46168 17908040 58283 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 one strong candidate trigger protein and thus a potential target for therapeutic manipulation is the potent pro inflammatory / pro apoptotic cytokine tumor necrosis factor alpha tnf alpha . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46169 17908040 58284 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha is secreted by the brain resident marcophage the microglial cell in response to various stimuli. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46170 17908040 58286 22551 11892 TNF tnf alpha tnf alpha 0 1.0 recently agents that modulate the levels of circulating peripheral tnf alpha protein have been shown to be worthwhile therapeutic agents with the use of enbrel etanercept and remicade infliximab both of which display beneficial properties against rheumatoid arthritis and othe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46171 17908040 58288 22551 11892 TNF tnf alpha tnf alpha 0 1.0 however thalidomide a small molecule drug can inhibit tnf alpha protein synthesis and unlike larger molecules is readily capable of crossing the blood brain barrier. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46172 17908040 58289 22551 11892 TNF tnf alpha tnf alpha 0 1.0 thus thalidomide and its analogs are excellent candidate agents for use in determining the potential value of anti tnf alpha therapies in a variety of diseases underpinned by inflammation within the nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46173 17908040 58290 22551 11892 TNF tnf alpha tnf alpha 0 1.0 consequently we have chosen to discuss the relevance of unregulated tnf alpha expression in illnesses of the cns and to an extent the peripheral nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 46174 17908040 58291 22551 11892 TNF tnf alpha tnf alpha 0 1.0 additionally we consider the utilization of thalidomide derived agents as anti tnf alpha therapeutics in the setting of neuroinflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 38609 17969353 48256 5514 2711 DCTN1 dynactin 1 dynactin 1 0 1.0 downregulated genes in motor neurons included those associated with cytoskeleton/axonal transport transcription and cell surface antigens/receptors such as dynactin 1 dctn1 and early growth response 3 egr3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 38610 17969353 48256 6452 3240 EGR3 early growth response 3 early growth response 3 0 1.0 downregulated genes in motor neurons included those associated with cytoskeleton/axonal transport transcription and cell surface antigens/receptors such as dynactin 1 dctn1 and early growth response 3 egr3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 38611 17969353 48258 22568 11905 TNFRSF10B death receptor 5 death receptor 5 0 1.0 promoters for cell death pathway death receptor 5 dr5 cyclins c ccnc and a1 ccna and caspases were upregulated whereas cell death inhibitors acetyl coa transporter acatn and nf kappab nfkb were also upregulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27785 17997855 32893 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the anti oxidant enzyme cu zn superoxide dismutase ec 1.15.1.1 sod1 are associated with familial als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27786 17997855 32894 22217 11848 TLR2 toll-like receptor 2 toll like receptor 2 0 1.0 s pneumoniae the most frequent respiratory pathogen causes damage by the action of the cholesterol binding virulence factor pneumolysin and by stimulation of the innate immune system particularly via toll like receptor 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27787 17997855 32895 22217 11848 TLR2 toll-like receptor 2 toll like receptor 2 0 1.0 typical for familial als g93a sod1 and sh sy5y neuroblastoma cells transfected with wildtype sod1 were both exposed to pneumolysin and in co cultures with cultured human macrophages treated with the toll like receptor 2 agonist n palmitoyl s [2 3 bis palmitoyloxy 2rs propyl] [r] cysteinyl [s] seryl [s] lysyl [s] lysyl [s] lysyl [s] lysyl [s] lysine _amp_#x000d7; 3 hcl pam 3 csk 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27788 17997855 32912 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mitochondrial function can be disturbed by mutations in the gene encoding cu zn superoxide dismutase ec 1.15.1.1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27789 17997855 32927 22217 11848 TLR2 toll-like receptor 2 toll like receptor 2 0 1.0 s damage by the direct action of the cholesterol binding pore forming hemolysin pneumolysin and through microglia/monocyte activation by agonists of receptors of the innate immune system particularly toll like receptor 2 tlr2 [ 18 19 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27790 17997855 32973 551 399 ALB albumin albumin 0 0.0 bathing solutions were either rpmi 1640 or in mm nacl 140 kcl 2 cacl 2 2.5 mgcl 2 1 hepes 10 glucose 40 and bovine serum albumin 0.05% at ph 7.3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27791 17997855 32973 551 399 ALB serum albumin serum albumin 0 1.0 bathing solutions were either rpmi 1640 or in mm nacl 140 kcl 2 cacl 2 2.5 mgcl 2 1 hepes 10 glucose 40 and bovine serum albumin 0.05% at ph 7.3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27792 17997855 32976 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 methods hemalum staining cd68 and activated caspase 3 immunocytochemistry and light green staining pneumolysin stimulated sh sy5y cell mono cultures wt sod1 and g93a sod1 were plated on glass coverslips and were fixated with 4% formaldehyde dehydrated t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27793 17997855 32977 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 cd68 and light green staining was used to distinguish between human macrophages and the sh sy5y cells in co culture and to visualize the morphology of the cells; immunostaining for activated caspase 3 was used to detect apoptosis in pneumolysin treated g93a sod1 cells: fixated cells were permeabilised with triton x 0.1% in pbs for 30 minutes and then incubated with cd68 antibody clone kp1 dilution 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27794 17997855 32977 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 sin treated g93a sod1 cells: fixated cells were permeabilised with triton x 0.1% in pbs for 30 minutes and then incubated with cd68 antibody clone kp1 dilution 1:50 dako glostrup denmark or activated caspase 3 antibody [rabbit anti caspase 3 cleaved dilution 1:100 kindly donated by zytomed systems berlin germany] for 90 minutes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27795 17997855 32977 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 antibody [rabbit anti caspase 3 cleaved dilution 1:100 kindly donated by zytomed systems berlin germany] for 90 minutes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27796 17997855 32979 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 biotin complex abc vector burlingame ca for 30 min and diaminobenzidine was used for visualisation 5 minutes resulting in a brown staining of the somata of macrophages cd68 /apoptotic g93a sod1 cells caspase 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27797 17997855 32980 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 sh sy5y cells were counterstained by light green sf yellowish solution chroma gesellschaft schmidt _amp_#x00026; co stuttgart germany after cd68 immunocytochemistry and with hemalum after caspase 3 immunocytochemistry for 1_amp_#x02013;2 minutes rinsed in water dehydrated and mounted with depex serva heidelberg germany . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27798 17997855 32981 6054 2983 DNTT terminal transferase terminal transferase 0 1.0 37_amp_#x000b0;c in a reaction mixture that contained 10 _amp_#x003bc;l of 5_amp_#x000d7; tailing buffer 1 _amp_#x003bc;l of digoxigenin dna labeling mix 2 _amp_#x003bc;l of cobalt chloride 12.5 u of terminal transferase and the amount of distilled water necessary to give a volume of 50 _amp_#x003bc;l. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27799 17997855 32983 614 437 ALPI alkaline phosphatase alkaline phosphatase 0 1.0 a solution of alkaline phosphatase labeled anti digoxigenin antibody in 10% fcs 1:250 was placed on the sections for 60 min at 37_amp_#x000b0;c. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27800 17997855 32996 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 by in situ tailing morphology arrows fig 3 and by immunocytochemistry for activated caspase 3 fig 4 of g93a sod1 neuroblastoma cells it became apparent that a large proportion of these cells died by apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27801 17997855 33017 22217 11848 TLR2 toll-like receptor 2 toll like receptor 2 0 1.0 results increased vulnerability of neuroblastoma cells transfected with g93a sod1 to the attack of monocytes stimulated with the toll like receptor 2 agonist pam 3 csk 4 after stimulation of human neuroblastoma and macrophage co cultures with the tlr2 agonist pam 3 csk 4 for a period of 72 hours the release of neuron specific enolase nse was measu 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 27802 17997855 33084 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 apoptotic g93a sod1 sh sy5y cells after incubation with 0.5 _amp_#x003bc;g/ml ply for three hours detected by immunocytochemistry for activated caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29863 18040778 35370 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 at both serve important defense functions against invading neurotropic pathogens and have been implicated in brain damage in infectious as well as neuroinflammatory/neurodegenerative diseases such as multiple sclerosis alzheimer's disease parkinson's disease and amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 29864 18040778 35417 10437 5992 IL1B il 1b il 1b 0 1.0 indeed it is now recognized that hiv 1 infected microglia and other brain macrophages actively secrete both neurotoxins such as tumor necrosis factor tnf a interleukin il 1b cxcl8 glutamate quinolinic acid platelet activating factor eicosanoids and nitric oxide no as well as neurotoxic viral proteins such as tat gp120 and gp41. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29865 18040778 35417 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 indeed it is now recognized that hiv 1 infected microglia and other brain macrophages actively secrete both neurotoxins such as tumor necrosis factor tnf a interleukin il 1b cxcl8 glutamate quinolinic acid platelet activating factor eicosanoids and nitric oxide no as well as neurotoxic viral proteins such as tat gp120 and gp41. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29866 18040778 35421 13327 7176 MMP9 mmp 9 mmp 9 0 1.0 the drugs indinavir and zidovudine have been shown to inhibit lipopolysaccharide lps stimulated microglial production of matrix metalloproteinase mmp 9 thereby demonstrating an effect on microglia that extends beyond pure antiviral activity liuzzi et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29867 18040778 35438 10437 5992 IL1B il 1 il 1 0 1.0 dy demonstrated that human microglia are more efficient at ingesting m. tuberculosis than virulent and avirulent strains of m. avium and that following infection there is a lasting inhibition of both il 1 and il 10 production curto et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29868 18040778 35438 10480 5962 IL10 il 10 il 10 0 1.0 trated that human microglia are more efficient at ingesting m. tuberculosis than virulent and avirulent strains of m. avium and that following infection there is a lasting inhibition of both il 1 and il 10 production curto et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29869 18040778 35443 10437 5992 IL1B il 1b il 1b 0 1.0 in these experiments m. tuberculosis infected microglia elicited robust amounts of several cytokines/chemokines including tnf a il 6 il 1b ccl2 ccl5 and cxcl10. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29870 18040778 35443 10463 6018 IL6 il 6 il 6 0 1.0 in these experiments m. tuberculosis infected microglia elicited robust amounts of several cytokines/chemokines including tnf a il 6 il 1b ccl2 ccl5 and cxcl10. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29871 18040778 35453 7431 24692 FCAMR fc receptor fc receptor 0 1.0 also in the presence of specific antibody human microglia produce ccl3 ccl4 ccl2 cxcl8 and low levels of ccl5 via fc receptor activation goldman et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29872 18040778 35462 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 ailable such as imaging with [11c]pk 11195 a ligand for peripheral benzodiazepine receptors their presence has been demonstrated in a variety of neuroinflammatory/neurodegenerative diseases including multiple sclerosis ms chen et al. 2004 alzheimer's disease ad cagnin et al. 2001 and amyotrophic lateral sclerosis als turner et al. 2004 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 29873 18040778 35471 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 lipopolysaccharide lps tumor necrosis factor tnf a reactive oxygen intermediates roi reactive nitrogen intermediates rni quinolinic acid qa multiple sclerosis ms alzheimer's disease ad parkinson's disease pd amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 29874 18040778 35471 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 lipopolysaccharide lps tumor necrosis factor tnf a reactive oxygen intermediates roi reactive nitrogen intermediates rni quinolinic acid qa multiple sclerosis ms alzheimer's disease ad parkinson's disease pd amyotrophic lateral sclerosis als . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29875 18040778 35482 22058 11765 TGFA transforming growth factor transforming growth factor 0 1.0 evidence supporting this neuroprotective role includes the microglial production of transforming growth factor b1 in an acute neuronal injury model lehrmann et al. 1998 in vitro studies demonstrating microglial production of neurotrophic factors nakajima and kohsaka 2002 and evidence that transplanted microgl 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29876 18040778 35484 10458 6014 IL4 interleukin 4 interleukin 4 0 1.0 2006 have advanced the concept of _amp_#8220;protective autoimmunity_amp_#8221; by demonstrating that whereas microglia activated by endotoxin block neurogenesis microglia activated by interleukin 4 or interferon g associated with cd4 lymphocyte infiltration induces neurogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29877 18040778 35497 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 the role of these receptors in neuronal microglial cell communication is not understood; however the production of glutamate and the glutamate receptor ligand quinolinic acid by activated microglia has been implicated in excitotoxicity of neurons in several neurodegenerative diseases matute et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29878 18040778 35498 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cyclooxygenase 2 cox 2 is an enzyme central to the production of prostaglandins a family of powerful inflammatory mediators produced by activated microglia that can have both deleterious and neuroprotective effects in the 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29879 18040778 35499 17610 9605 PTGS2 cox 2 cox 2 0 1.0 cox 2 and prostaglandin e 2 are elevated in the cns of patients with als and recent studies have implicated activated microglia in this _amp_#8220;neuron only_amp_#8221; disease weydt and moller 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29880 18040778 35500 17610 9605 PTGS2 cox 2 cox 2 0 1.0 prostaglandin production by activated microglia has been implicated in other neuroinflammatory/neurodegenerative diseases and not surprisingly cox 2 has been considered a major therapeutic target. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29881 18040778 35505 17610 9605 PTGS2 cox 2 cox 2 0 1.0 hypothetically by inhibiting microglial cell cyclooxygenases cox 1 or cox 2 the metabolism of arachadonic acid is curtailed and production of deleterious proinflammatory prostaglandins is suppressed hoozemans and o'banion 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 29882 18040778 35507 17610 9605 PTGS2 cox 2 cox 2 0 1.0 although preclinical and early clinical data suggested that cox 2 inhibitors may have a beneficial role in ad results of subsequent studies and the development of unanticipated side effects of cox 2 inhibitors have dampened enthusiasm for the use of these agents in the management of ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 32207 18077562 39882 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 er perspective and indicates a more active role of neuroinflammation in the pathophysiology of progressive neurodegenerative disorders such as ad parkinson's disease amyotrophic lateral sclerosis and multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 32208 18077562 39888 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 for example long term use of nonsteroidal anti inflammatory drugs is correlated with a protective effect against ad and certain polymorphisms in the genes for interleukin 1 and other proinflammatory mediator genes are associated with increased risk. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25075 18246426 29676 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 we evaluated tumor necrosis factor alpha tnf a interferon g ifn g and nitric oxide no levels in the serum of 22 als patients and 20 controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25076 18246426 29676 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 we evaluated tumor necrosis factor alpha tnf a interferon g ifn g and nitric oxide no levels in the serum of 22 als patients and 20 controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25077 18246426 29683 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 keywords amyotrophic lateral sclerosis tumor necrosis factor a interferon g nitric oxide inflammation 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25078 18246426 29690 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 the role of proinflammatory cytokines such as tumor necrosis factor a tnf a and interferon g ifn g as potential mediators during the progression of brain injury is not clear. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25079 18246426 29698 12436 6925 MBP myelin basic protein myelin basic protein 0 1.0 four days of treatment with ifn g failed to alter cell survival or myelin basic protein gene expression in cultured human oligodendrocytes but these cells are more susceptible to fas mediated apoptosis and this effect is augmented in presence of tnf a [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25080 18246426 29700 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 no is synthesized from l arginine by nitric oxide synthase nos [ 22 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25081 18246426 29720 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 since there were several reports that neurological disorders such as multiple sclerosis alzheimer_amp_#8217;s disease parkinson_amp_#8217;s disease guillian barre syndrome japanese encephalitis tuberculous meningitis epilepsy stroke migraine and others were having an inflammatory compon 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 25082 18246426 29762 10463 6018 IL6 il 6 il 6 0 1.0 czlonkowska et al. [ 28 ] showed that neuroprotective activity of estrogen could be partially a result of its anti inflammatory action on cytokines such as il 6. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 25083 18246426 29765 10463 6018 IL6 il 6 il 6 0 1.0 moreau et al. [ 29 ] measured il 6 and tnf a in patients with als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15960 18312546 18852 14354 7797 NFKBIA ikappabalpha ikappabalpha 0 1.0 effects of the ppargamma activator pioglitazone on p38 map kinase and ikappabalpha in the spinal cord of a transgenic mouse model of amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15961 18312546 18852 12355 6872 MAPK10 map kinase map kinase 0 0.0 effects of the ppargamma activator pioglitazone on p38 map kinase and ikappabalpha in the spinal cord of a transgenic mouse model of amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15962 18312546 18852 12359 6876 MAPK14 p38 map kinase p38 map kinase 0 1.0 effects of the ppargamma activator pioglitazone on p38 map kinase and ikappabalpha in the spinal cord of a transgenic mouse model of amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15963 18312546 18854 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 to assess molecular pathological effects of the anti inflammatory peroxisome proliferator activated receptor gamma ppargamma agonist pioglitazone in als we verified changes in the population of neurons astrocytes and microglia in the ventral horns of spinal cord lumbar segments from the pioglitazone treated and n 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15964 18312546 18854 14354 7797 NFKBIA ikappabalpha ikappabalpha 0 1.0 mice performed immunohistochemical and immunoblot analyses of ppargamma active form of phosphorylated p38 mitogen activated protein kinase p p38 and inhibitor of nuclear factor kappab nf kappab alpha ikappabalpha in the spinal cords and compared the results between the different groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15965 18312546 18854 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ulation of neurons astrocytes and microglia in the ventral horns of spinal cord lumbar segments from the pioglitazone treated and non treated groups of mice carrying a transgene for g93a mutant human superoxide dismutase 1 sod1 als mice and non transgenic littermates control mice performed immunohistochemical and immunoblot analyses of ppargamma active form of phosphorylated p38 mitogen activated protein kinase p p38 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15966 18312546 18854 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 ulation of neurons astrocytes and microglia in the ventral horns of spinal cord lumbar segments from the pioglitazone treated and non treated groups of mice carrying a transgene for g93a mutant human superoxide dismutase 1 sod1 als mice and non transgenic littermates control mice performed immunohistochemical and immunoblot analyses of ppargamma active form of phosphorylated p38 mitogen activated protein kinase p p38 a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15967 18312546 18854 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 for g93a mutant human superoxide dismutase 1 sod1 als mice and non transgenic littermates control mice performed immunohistochemical and immunoblot analyses of ppargamma active form of phosphorylated p38 mitogen activated protein kinase p p38 and inhibitor of nuclear factor kappab nf kappab alpha ikappabalpha in the spinal cords and compared the results between the different groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15968 18312546 18856 14354 7797 NFKBIA ikappabalpha ikappabalpha 0 1.0 immunohistochemical analysis demonstrated that immunoreactivities for ppargamma and p p38 were mainly localized in neurons and that ikappabalpha immunoreactivity was mainly localized in astrocytes and microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15969 18312546 18857 14354 7797 NFKBIA ikappabalpha ikappabalpha 0 1.0 tazone treatment resulted in no significant change in nuclear ppargamma immunoreactive density a significant decrease in cytosolic p p38 immunoreactive density and a significant increase in cytosolic ikappabalpha immunoreactive density. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 19010 18370853 22359 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the etiology of als remains unknown but one fifth of instances are due to specific gene defects the best characterized of which is point mutations in the gene coding for cu/zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 19153 18375019 22632 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 interferon gamma dependent cytotoxic activation of human astocytes and astrocytoma cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 19154 18375019 22638 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 other powerful inflammatory stimulants such as lipopolysaccharide 0.5mug/ml tumor necrosis factor alpha 10ng/ml and interleukin 1beta 10ng/ml alone or in combination were without effect. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 19155 18375019 22638 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 other powerful inflammatory stimulants such as lipopolysaccharide 0.5mug/ml tumor necrosis factor alpha 10ng/ml and interleukin 1beta 10ng/ml alone or in combination were without effect. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 19156 18375019 22644 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 inally using human postmortem material we showed sharp upregulation of the ifngr on activated astrocytes in affected areas in alzheimer's disease parkinson's disease amyotrophic lateral sclerosis and multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 19229 18384649 22738 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 rt neuroprotective activity against oxidative damage inflammation and apoptosis in several neurodegenerative disorders including alzheimer's parkinson's huntington's amyotrophic lateral sclerosis and multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 20067 18397603 23527 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 local expression of migf 1 modulates ubiquitin caspase and cdk5 expression in skeletal muscle of an als mouse model. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 20068 18397603 23533 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 results and discussion: ubiquitin expression and caspase activity resulted markedly increased in sod g93a muscle but maintained at very low levels in the sod g93a x mlc/migf 1 sod g93a /migf 1 transgenic muscle. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9662 18414597 11013 10437 5992 IL1B il 1 il 1 0 1.0 pro inflammatory cytokines tnf alpha and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9663 18414597 11013 22551 11892 TNF tnf alpha tnf alpha 0 1.0 pro inflammatory cytokines tnf alpha and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9664 18414597 11015 10437 5992 IL1B il 1 il 1 0 1.0 tnf alpha and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9665 18414597 11015 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9666 18414597 11018 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9667 18414597 11018 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9668 18414597 11020 14569 7897 NPC1 niemann-pick disease niemann pick disease 0 1.0 niemann pick diseases a and b are due to acidic sphingomyelinase deficiency resulting in sphingomyelin accumulation while niemann pick disease c is due to mutations in either the npc1 or npc2 genes resulting in defective cholesterol transport and cholesterol accumulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9669 18414597 11021 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is an autoimmune inflammatory demyelinating condition of the cns. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 9762 18422522 11246 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 endothelial nitric oxide synthase overexpression by neuronal cells in neurodegeneration: a link between inflammation and neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9763 18422522 11246 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 endothelial nitric oxide synthase overexpression by neuronal cells in neurodegeneration: a link between inflammation and neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9764 18422522 11247 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 the roles of neuronal and inducible nitric oxide synthases in neurones have been extensively investigated; by contrast the biological significance of endothelial nitric oxide synthase enos overexpression that occurs in several pathological conditions has not yet been studied. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9765 18422522 11247 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 the roles of neuronal and inducible nitric oxide synthases in neurones have been extensively investigated; by contrast the biological significance of endothelial nitric oxide synthase enos overexpression that occurs in several pathological conditions has not yet been studied. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9766 18422522 11249 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found that enos which is endogenously expressed by these cells was activated by tumour necrosis factor alpha tnf alpha a proinflammatory cytokine that plays important roles in als2 and several neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9767 18422522 11250 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the tnf alpha dependent enos activation occurred through generation by sphingosine kinase 1 of sphingosine 1 phosphate stimulation of its membrane receptors and activation of akt as determined using small interfer 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9768 18422522 11250 22551 11892 TNF tnf alpha tnf alpha 0 1.0 hate stimulation of its membrane receptors and activation of akt as determined using small interference rna and dominant negative constructs specific for the enzymes and receptors. enos activation by tnf alpha conferred cytoprotection from excitotoxicity and neurotoxic cues such as reactive oxygen species endoplasmic reticulum stress dna damage and mutated alsin itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9769 18422522 11250 21157 11240 SPHK1 sphingosine kinase 1 sphingosine kinase 1 0 1.0 the tnf alpha dependent enos activation occurred through generation by sphingosine kinase 1 of sphingosine 1 phosphate stimulation of its membrane receptors and activation of akt as determined using small interference rna and dominant negative constructs specific for the enzymes and recepto 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11144 18436268 12689 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in copper/zinc superoxide dismutase sod1 account for 20% cases of familial als fals but the underlying pathogenetic mechanisms are largely unknown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11145 18436268 12693 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 t fa or fa + b12 treatment significantly attenuated the plasma hcy level suppressed the activation of microglia and astrocytes and inhibited the expression of inducible nitric oxide synthase inos and tumor necrosis factor alpha tnf _amp_#x3b1; in spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11146 18436268 12693 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 t fa or fa + b12 treatment significantly attenuated the plasma hcy level suppressed the activation of microglia and astrocytes and inhibited the expression of inducible nitric oxide synthase inos and tumor necrosis factor alpha tnf _amp_#x3b1; in spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11147 18436268 12693 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 furthermore we found that fa or fa + b12 treatment significantly attenuated the plasma hcy level suppressed the activation of microglia and astrocytes and inhibited the expression of inducible nitric oxide synthase inos and tumor necrosis factor alpha tnf _amp_#x3b1; in spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11148 18436268 12694 1576 990 BCL2 bcl 2 bcl 2 0 1.0 moreover fa or fa + b12 treatment decreased the levels of cleaved caspase 3 and poly adp ribose polymerase parp but up regulated the level of anti apoptotic protein bcl 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11149 18436268 12694 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 moreover fa or fa + b12 treatment decreased the levels of cleaved caspase 3 and poly adp ribose polymerase parp but up regulated the level of anti apoptotic protein bcl 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11150 18436268 12694 16068 270 PARP1 poly (adp-ribose) polymerase poly adp ribose polymerase 0 1.0 moreover fa or fa + b12 treatment decreased the levels of cleaved caspase 3 and poly adp ribose polymerase parp but up regulated the level of anti apoptotic protein bcl 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11151 18436268 12701 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 around 10% cases of als patients are autosomal dominant referred as fals and 20% patients with fals have missense mutations in the gene encoding for cu/zn superoxide dismutase sod1 al chalabi and leigh 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11152 18436268 12779 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 we used the primary antibody of glial fibrillary acidic protein gfap 1:2000 sigma st louis mo usa and cd11b 1:100 serotec oxford uk to examine the activation of astrocyte and microglia respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11153 18436268 12788 1576 990 BCL2 bcl 2 bcl 2 0 1.0 each sample was separated in 8% sds gel transferred onto 0.45 _amp_#x3bc;m pvdf membrane incubated with primary antibodies of inos 1:5000 chemicon ca usa tnf _amp_#x3b1; 1:1000 cell signaling ma usa bcl 2 1:1000 santa cruz biotechnology inc. santa cruz cleaved caspase 3 1:1000 cell signaling ma usa parp and cleavage 1:1000 cell signaling ma usa respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11154 18436268 12788 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 _amp_#x3bc;m pvdf membrane incubated with primary antibodies of inos 1:5000 chemicon ca usa tnf _amp_#x3b1; 1:1000 cell signaling ma usa bcl 2 1:1000 santa cruz biotechnology inc. santa cruz cleaved caspase 3 1:1000 cell signaling ma usa parp and cleavage 1:1000 cell signaling ma usa respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11155 18436268 12790 211 132 ACTB beta actin beta actin 0 1.0 afterwards the blots were stripped and stained with beta actin antibody 1:4000 cell signaling ma usa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11156 18436268 12835 1576 990 BCL2 bcl 2 bcl 2 0 1.0 to investigate whether hcy lowering drugs fa and b12 had the anti apoptotic effects in the sod1 g93a transgenic mice we determined the protein level of bcl 2 cleaved caspase 3 and parp in the spinal cord after fa b12 or fa + b12 treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11157 18436268 12835 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 to investigate whether hcy lowering drugs fa and b12 had the anti apoptotic effects in the sod1 g93a transgenic mice we determined the protein level of bcl 2 cleaved caspase 3 and parp in the spinal cord after fa b12 or fa + b12 treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11158 18436268 12836 1576 990 BCL2 bcl 2 bcl 2 0 1.0 we found that fa or fa + b12 treatment can increase the level of bcl 2 and reduce the level of cleaved caspase 3 and cleaved parp fig._amp_#xa0;5 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11159 18436268 12836 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we found that fa or fa + b12 treatment can increase the level of bcl 2 and reduce the level of cleaved caspase 3 and cleaved parp fig._amp_#xa0;5 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11160 18436268 12837 1576 990 BCL2 bcl 2 bcl 2 0 1.0 especially we found fa + b12 treatment can elevate the level of bcl 2 in sod1 g93a mice up to the level of wild type which could suggest that fa + b12 is effective in suppressing apoptosis in the sod1 mice model. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11161 18436268 12845 1576 990 BCL2 bcl 2 bcl 2 0 1.0 moreover we demonstrated that fa or fa + b12 treatment has significant anti apoptotic effects by increasing bcl 2 expression and inhibiting cleaved caspase 3 and cleaved parp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11162 18436268 12845 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 moreover we demonstrated that fa or fa + b12 treatment has significant anti apoptotic effects by increasing bcl 2 expression and inhibiting cleaved caspase 3 and cleaved parp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11163 18436268 12848 10463 6018 IL6 interleukin 6 interleukin 6 0 1.0 it is suggested that hcy can enhance pro inflammatory cytokines production such as interleukin 6 tnf _amp_#x3b1; and c reactive protein holven et_amp_#xa0;al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11164 18436268 12848 4959 2367 CRP c-reactive protein c reactive protein 0 1.0 it is suggested that hcy can enhance pro inflammatory cytokines production such as interleukin 6 tnf _amp_#x3b1; and c reactive protein holven et_amp_#xa0;al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11165 18436268 12856 1576 990 BCL2 bcl 2 bcl 2 0 1.0 hcy could induce apoptosis by regulating the expression of several important proteins such as bcl 2 cleaved caspase 3 and cleaved parp [baydas et_amp_#xa0;al. 2005] and [kruman et_amp_#xa0;al. 2000] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11166 18436268 12856 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 hcy could induce apoptosis by regulating the expression of several important proteins such as bcl 2 cleaved caspase 3 and cleaved parp [baydas et_amp_#xa0;al. 2005] and [kruman et_amp_#xa0;al. 2000] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11167 18436268 12857 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 plays a prominent role in als pathogenesis which is involved in the oxidative stress and in the mitochondria mediated apoptosis pasinelli et_amp_#xa0;al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11168 18436268 12858 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 family is implicated in the regulation of motor neuron death in sod1 g93a transgenic mice model and over expression of bcl 2 can significantly protect motor neurons in sod1 g93a mice kostic et_amp_#xa0;al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11169 18436268 12859 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in our study we found that fa or fa + b12 treatment can increase the expression of bcl 2 which provided an evidence for the neuroprotective effect of fa or fa + b12 treatment in sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11170 18436268 12860 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 cleaved caspase 3 and cleaved parp represent the downstream signals of apoptosis which may contribute to the motor neuron death in sod1 g93a mice pasinelli et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11171 18436268 12864 1576 990 BCL2 bcl 2 bcl 2 0 1.0 our study suggested that fa or fa + b12 treatment could up regulate the expression of anti apoptotic protein bcl 2 as well as down regulated the expression of apoptosis related proteins such as cleaved caspase 3 and cleaved parp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11172 18436268 12864 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 r study suggested that fa or fa + b12 treatment could up regulate the expression of anti apoptotic protein bcl 2 as well as down regulated the expression of apoptosis related proteins such as cleaved caspase 3 and cleaved parp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11173 18436268 12870 1576 990 BCL2 bcl 2 bcl 2 0 1.0 moreover we found that fa or fa + b12 treatment can significantly inhibit the levels of cleaved caspase 3 and cleaved parp as well as up regulate the levels of bcl 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11174 18436268 12870 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 moreover we found that fa or fa + b12 treatment can significantly inhibit the levels of cleaved caspase 3 and cleaved parp as well as up regulate the levels of bcl 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11175 18436268 12893 1576 990 BCL2 bcl 2 bcl 2 0 1.0 b western blot of bcl 2 cleaved caspase 3 and cleaved parp from spinal cord samples. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11176 18436268 12893 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 b western blot of bcl 2 cleaved caspase 3 and cleaved parp from spinal cord samples. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11177 18436268 12894 1576 990 BCL2 bcl 2 bcl 2 0 1.0 c_amp_#x2013;g quantitative data of the expression of inos tnf _amp_#x3b1; bcl 2 cleaved caspase 3 and cleaved parp in five groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 11178 18436268 12894 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 c_amp_#x2013;g quantitative data of the expression of inos tnf _amp_#x3b1; bcl 2 cleaved caspase 3 and cleaved parp in five groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12202 18464922 14222 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 ppar _amp_#x003b3; coactivator 1 _amp_#x003b1; pgc 1 _amp_#x003b1; is a transcriptional coactivator that works together with combination of other transcription factors like ppar _amp_#x003b3; in the regulation of mitochondrial biogenesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12203 18464922 14223 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 therefore ppar _amp_#x003b3; is a possible target for als and hd as it functions as transcription factor that interacts with pgc 1 _amp_#x003b1; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12204 18464922 14229 19272 10477 RXRA retinoid x receptor retinoid x receptor 0 1.0 another ligand activated transcription factor is retinoid x receptor from the same superfamily that forms heterodimeric complexes with ppars in response to ligand binding. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12205 18464922 14245 13327 7176 MMP9 mmp 9 mmp 9 0 1.0 tzds inhibit the expression of various inflammatory proteins like inducible nitric oxide synthase inos tumor necrosis factor _amp_#x003b1; tnf _amp_#x003b1; and matrix metalloproteinase 9 mmp 9 in macrophages [ 26 ] and are beneficial in disorders such as inflammatory bowel disease [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12206 18464922 14245 13327 7176 MMP9 matrix metalloproteinase 9 matrix metalloproteinase 9 0 1.0 tzds inhibit the expression of various inflammatory proteins like inducible nitric oxide synthase inos tumor necrosis factor _amp_#x003b1; tnf _amp_#x003b1; and matrix metalloproteinase 9 mmp 9 in macrophages [ 26 ] and are beneficial in disorders such as inflammatory bowel disease [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12207 18464922 14245 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 tzds inhibit the expression of various inflammatory proteins like inducible nitric oxide synthase inos tumor necrosis factor _amp_#x003b1; tnf _amp_#x003b1; and matrix metalloproteinase 9 mmp 9 in macrophages [ 26 ] and are beneficial in disorders such as inflammatory bowel disease [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12208 18464922 14245 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 tzds inhibit the expression of various inflammatory proteins like inducible nitric oxide synthase inos tumor necrosis factor _amp_#x003b1; tnf _amp_#x003b1; and matrix metalloproteinase 9 mmp 9 in macrophages [ 26 ] and are beneficial in disorders such as inflammatory bowel disease [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12209 18464922 14247 7683 3796 FOS activator protein 1 activator protein 1 0 1.0 several anti inflammatory mechanisms have been suggested including inhibition of nuclear factor kappa b nf _amp_#x003ba; b activator protein 1 ap 1 in addition to signal transducers and activators of transcription stat transcription factors by ppar _amp_#x003b3; [ 31 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12210 18464922 14247 14352 7794 NFKB1 nuclear factor kappa-b nuclear factor kappa b 0 1.0 several anti inflammatory mechanisms have been suggested including inhibition of nuclear factor kappa b nf _amp_#x003ba; b activator protein 1 ap 1 in addition to signal transducers and activators of transcription stat transcription factors by ppar _amp_#x003b3; [ 31 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12211 18464922 14247 7683 3796 FOS ap 1 ap 1 0 1.0 several anti inflammatory mechanisms have been suggested including inhibition of nuclear factor kappa b nf _amp_#x003ba; b activator protein 1 ap 1 in addition to signal transducers and activators of transcription stat transcription factors by ppar _amp_#x003b3; [ 31 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12212 18464922 14250 14187 7672 NCOR1 n cor n cor 0 1.0 of ppar _amp_#x003b3; is susceptible to ligand dependent sumoylation covalent attachment of small ubiquitin like modifier at lysine 365 leading to recruitment and stabilization of nuclear corepressor n cor complexes at the promoters of proinflammatory genes thereby repressing them [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12213 18464922 14250 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 recently an alternative mechanism suggested that a functionally distinct pool of ppar _amp_#x003b3; is susceptible to ligand dependent sumoylation covalent attachment of small ubiquitin like modifier at lysine 365 leading to recruitment and stabilization of nuclear corepressor n cor complexes at the promoters of proinflammatory genes thereby repressing them [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12214 18464922 14264 17610 9605 PTGS2 cox 2 cox 2 0 1.0 ; has been identified as a key regulatory factor in the modulation of target genes with ppar response element ppre in their promoters including those encoding for inflammation inos nf _amp_#x003ba; b cox 2 oxidative stress and apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12215 18464922 14267 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 additionally ppar _amp_#x003b3; agonists are reported to be neuroprotective in tyrosine hydroxylase positive neurons in substantia nigra when exposed to 1 methyl 4 phenyl 1 2 3 6 tetrahydropyridine mptp [ 18 19 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12216 18464922 14277 17610 9605 PTGS2 cox 2 cox 2 0 1.0 they also showed significant reduction in microglial activation as well as reduction in the expression of cox 2 and inos [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12217 18464922 14278 20987 19383 SOCS1 socs 1 socs 1 0 1.0 ulation of proinflammatory markers by pioglitazone were reported by sch_amp_#x000fc;tz et al. which suggests that mrna levels of two cytokine suppressor genes suppressor of cytokine signaling 1 and 3 socs 1 and 3 were increased as assessed by semiquantitative rt pcr [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12218 18464922 14278 4413 1984 CISH suppressor of cytokine signaling suppressor of cytokine signaling 0 0.0 further evidence in the modulation of proinflammatory markers by pioglitazone were reported by sch_amp_#x000fc;tz et al. which suggests that mrna levels of two cytokine suppressor genes suppressor of cytokine signaling 1 and 3 socs 1 and 3 were increased as assessed by semiquantitative rt pcr [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12219 18464922 14278 20987 19383 SOCS1 suppressor of cytokine signaling 1 suppressor of cytokine signaling 1 0 1.0 further evidence in the modulation of proinflammatory markers by pioglitazone were reported by sch_amp_#x000fc;tz et al. which suggests that mrna levels of two cytokine suppressor genes suppressor of cytokine signaling 1 and 3 socs 1 and 3 were increased as assessed by semiquantitative rt pcr [ 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12220 18464922 14279 20987 19383 SOCS1 socs 1 socs 1 0 1.0 others have reported similar increase in socs 1 and 3 in response to tzds in microglia and astrocytes in vitro [ 40 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12221 18464922 14280 20987 19383 SOCS1 socs 1 socs 1 0 1.0 the increase in socs 1 and 3 is implicated with the inhibition of janus kinase signal transducer and activator of transcription jak stat in inflammatory signal transduction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12222 18464922 14282 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 recently xu and drew demonstrated that ppar _amp_#x003b3; agonists suppress cytokines like il 12 family in eae an experimental model of multiple sclerosis when treated with 15 d pgj 2 and rosiglitazone [ 35 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 12223 18464922 14303 1576 990 BCL2 bcl 2 bcl 2 0 1.0 both mutant and wild type sod1 bind to antiapoptotic protein bcl 2 on the outer mitochondrial membrane blocking its antiapoptotic activity [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12224 18464922 14304 1576 990 BCL2 bcl 2 bcl 2 0 1.0 ii the presence of mutant sod1 in the mitochondria leads to formation of sod1 aggregates entrapping bcl 2 blocking protein importation to mitochondria which may trigger neuronal cell death due to mitochondrial dysfunction [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12225 18464922 14305 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 since pgc 1 _amp_#x003b1; is known to coordinate mitochondrial biogenesis and regulates mitochondrial function it is possible to predict that pgc 1 _amp_#x003b1; could play an important role in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12226 18464922 14306 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 impairment of pgc 1 _amp_#x003b1; could contribute to mitochondrial dysfunction in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12227 18464922 14307 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 to date there is no published data on the role of pgc 1 _amp_#x003b1; or its expression in the transgenic mouse model of als or human als postmortem tissues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12228 18464922 14308 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 however there are reports on the altered or impaired expression of genes in als that some of them fit in the pgc 1 _amp_#x003b1; target genes category [ 29 48 ] suggesting that there may be a prominent role for pgc 1 _amp_#x003b1; translational machinery in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12229 18464922 14308 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 _amp_#x003b1; target genes category [ 29 48 ] suggesting that there may be a prominent role for pgc 1 _amp_#x003b1; translational machinery in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12230 18464922 14309 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 since pgc 1 _amp_#x003b1; is a ppar _amp_#x003b3; coactivator it is possible that ppar _amp_#x003b3; agonists may be able to activate pgc 1 _amp_#x003b1; and also the pgc 1 _amp_#x003b1; target genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12231 18464922 14310 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 like in hd a reduction of pgc 1 _amp_#x003b1; and its target genes expression is attributed to mutant huntingtin similarly mutant sod1 could impair pgc 1 _amp_#x003b1; and expression of its target genes in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12232 18464922 14310 9766 4851 HTT huntingtin huntingtin 0 1.0 like in hd a reduction of pgc 1 _amp_#x003b1; and its target genes expression is attributed to mutant huntingtin similarly mutant sod1 could impair pgc 1 _amp_#x003b1; and expression of its target genes in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12233 18464922 14312 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 future studies on pgc 1 _amp_#x003b1; and ppar _amp_#x003b3; in als patients and transgenic mice will shed some lights on these pathways in disease development. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12234 18464922 14316 9766 4851 HTT huntingtin huntingtin 0 1.0 the etiology of hd is shown to be the unstable cag repeat expansion in the huntingtin gene on chromosome 4 resulting in polyglutamine expansion in huntingtin protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12235 18464922 14317 9766 4851 HTT huntingtin huntingtin 0 1.0 the polyglutamine expansion causes the aggregation of huntingtin protein and formation of neuronal inclusion bodies as reviewed by ortega et al. [ 50 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12236 18464922 14319 9766 4851 HTT huntingtin huntingtin 0 1.0 ively been studied and in spite of some new and novel discoveries and hypotheses it is not fully understood how mitochondrial dysfunction and oxidative stress and expansion of unstable cag repeats in huntingtin gene cause hd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12237 18464922 14320 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 recent reports show that mutant huntingtin interferes with transcriptional ppar _amp_#x003b3; coactivator 1 _amp_#x003b1; pgc 1 _amp_#x003b1; causing impairment on its function in hd suggesting that mutant huntingtin plays a role in the dysregulation of pgc 1 _amp_#x003b1; mediated transcription and activity impairing mitocho 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12238 18464922 14320 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 _amp_#x003b1; causing impairment on its function in hd suggesting that mutant huntingtin plays a role in the dysregulation of pgc 1 _amp_#x003b1; mediated transcription and activity impairing mitochondrial function and leading to hd pathogenesis [ 56 _amp_#x02013; 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12239 18464922 14320 9766 4851 HTT huntingtin huntingtin 0 1.0 recent reports show that mutant huntingtin interferes with transcriptional ppar _amp_#x003b3; coactivator 1 _amp_#x003b1; pgc 1 _amp_#x003b1; causing impairment on its function in hd suggesting that mutant huntingtin plays a role in the dysre 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12240 18464922 14320 9766 4851 HTT huntingtin huntingtin 0 1.0 interferes with transcriptional ppar _amp_#x003b3; coactivator 1 _amp_#x003b1; pgc 1 _amp_#x003b1; causing impairment on its function in hd suggesting that mutant huntingtin plays a role in the dysregulation of pgc 1 _amp_#x003b1; mediated transcription and activity impairing mitochondrial function and leading to hd pathogenesis [ 56 _amp_#x02013; 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12241 18464922 14321 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 weydt et al. found that pgc 1 _amp_#x003b1; target genes ndufs3 cycs cox6a1 ndufb5 acadm tfam and ldhb had reduced expression in hd patient and mouse striatum [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12242 18464922 14323 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 an interesting finding was that the pgc 1 _amp_#x003b1; and uncoupling protein 1 ucp 1 circuit was found to be disrupted in the brown adipose tissue bat of hd transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12243 18464922 14323 23632 12517 UCP1 uncoupling protein 1 uncoupling protein 1 0 1.0 an interesting finding was that the pgc 1 _amp_#x003b1; and uncoupling protein 1 ucp 1 circuit was found to be disrupted in the brown adipose tissue bat of hd transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12244 18464922 14327 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 in hd and wild type mice challenged with cold pgc 1 _amp_#x003b1; expression increased but in hd mice ucp 1 expression was not upregulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12245 18464922 14328 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 however they showed that pgc 1 _amp_#x003b1; expression is decreased in the striatum of human hd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12246 18464922 14329 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 they also examined the expression of unclear hormone receptors ppar _amp_#x003b1; rxr _amp_#x003b1; and transcription factors nrf 1 that known to rely upon pgc 1 _amp_#x003b1; for target gene activation these genes were upregulated suggesting possible compensatory upregulation of pgc 1 _amp_#x003b1; dependent transcription factors in human hd caudate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12247 18464922 14329 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 _amp_#x003b1; for target gene activation these genes were upregulated suggesting possible compensatory upregulation of pgc 1 _amp_#x003b1; dependent transcription factors in human hd caudate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12248 18464922 14331 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 weydt et al. and cui et al. studies provide further support that the reduction of pgc 1 _amp_#x003b1; and its target genes in hd striatum are caused by mutant huntingtin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12249 18464922 14332 9766 4851 HTT huntingtin huntingtin 0 1.0 weydt et al. stated from personal communication with j. boats and r.e. hughes that their yeast two hybrid screen identified that ppar _amp_#x003b3; is a huntingtin interactor and the interaction was validated for its biological significance by demonstrating an effect of ppar _amp_#x003b3; dosage upon hd neurodegeneration in the fly eye [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12250 18464922 14335 10601 6081 INS insulin insulin 0 1.0 rosiglitazone a ppar _amp_#x003b3; agonist that induces sensitization to insulin was tested in r6/2 transgenic mouse model of hd for the treatment of atypical diabetes in these mice [ 61 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12251 18464922 14336 10601 6081 INS insulin insulin 0 1.0 the effect of glibenclamide a sulfonylurea that depolarizes pancreatic beta cells by blocking atp sensitive potassium channels to induce exocytosis of insulin leading to increase in insulin levels was also tested in r6/2 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12252 18464922 14349 17290 9376 PRKAA1 amp-activated protein kinase amp activated protein kinase 0 1.0 metformin has numerous effects on metabolism including insulin sensitization [ 63 ] increased glucose uptake [ 64 ] decrease hepatic glucose synthesis [ 65 ] activation of amp activated protein kinase ampk an enzyme involved in glucose and fatty acid metabolism [ 66 ] and mitochondrial inhibition [ 67 68 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12253 18464922 14349 10601 6081 INS insulin insulin 0 1.0 metformin has numerous effects on metabolism including insulin sensitization [ 63 ] increased glucose uptake [ 64 ] decrease hepatic glucose synthesis [ 65 ] activation of amp activated protein kinase ampk an enzyme involved in glucose and fatty acid metabolism 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12254 18464922 14354 10601 6081 INS insulin insulin 0 1.0 metformin was also considered to be effective in r6/2 mice because of its ability to sensitize insulin which leads to facilitation of glucose utilization. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12255 18464922 14356 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 the protective effect of metformin in r6/2 mice could be the synergistic effect from several pathways including regulation of pgc 1 _amp_#x003b1; activity through its direct activation of ampa kinase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12256 18464922 14359 22024 11741 TFAM mitochondrial transcription factor a mitochondrial transcription factor a 0 1.0 been implicated in mitochondrial biogenesis through its ability to control number of genes such as nuclear respiratory factor 1 2 nrf 1 2 estrogen related receptor _amp_#x003b1; err _amp_#x003b1; and mitochondrial transcription factor a tfam [ 70 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12257 18464922 14359 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 pgc 1 _amp_#x003b1; has been implicated in mitochondrial biogenesis through its ability to control number of genes such as nuclear respiratory factor 1 2 nrf 1 2 estrogen related receptor _amp_#x003b1; err 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12258 18464922 14359 14668 7996 NRF1 nuclear respiratory factor 1 nuclear respiratory factor 1 0 1.0 pgc 1 _amp_#x003b1; has been implicated in mitochondrial biogenesis through its ability to control number of genes such as nuclear respiratory factor 1 2 nrf 1 2 estrogen related receptor _amp_#x003b1; err _amp_#x003b1; and mitochondrial transcription factor a tfam [ 70 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12259 18464922 14361 19981 14929 SIRT1 sirtuin 1 sirtuin 1 0 1.0 resveratrol has been shown to activate sirtuin 1 sirt1 and results in ppar _amp_#x003b3; mediated transcriptional repression inhibition of adipogenesis enhanced lipolysis and the release of free fatty acids [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12260 18464922 14362 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 activated sirt1 leads to deactylation of pgc 1 _amp_#x003b1; resulting in an activation of pgc 1 _amp_#x003b1; [ 73 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12261 18464922 14363 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 by deacetylating pgc 1 _amp_#x003b1; sirt1 represses glycolysis increase hepatic glucose output and modulates mitochondrial function and biogenesis [ 73 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12262 18464922 14364 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 pgc 1 _amp_#x003b1; is known as master regulator of mitochondrial biogenesis and is shown to modulate a number of metabolically relevant transcription factors that collectively help in mitochondrial biogen 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12263 18464922 14367 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 moreover the effect of ppar _amp_#x003b3; agonists on the expression and activation of pgc 1 _amp_#x003b1; in cell culture models of hd may provide preliminary data to plan full scale studies in animal models of hd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12264 18464922 14368 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 the rationale for that is based on the increasing evidence that pgc 1 _amp_#x003b1; expression which is downregulated in patients with huntington's disease and in several animal models of this neurodegenerative disorder [ 70 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12265 18464922 14369 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 thiazolidiones and rexinoids induce pgc 1 _amp_#x003b1; gene transcription in brown and white adipocytes [ 75 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12266 18464922 14371 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 based on the studies on pgc 1 _amp_#x003b1; knockout mice that shown to have neurodegenerative lesions particularly in striatum suggest that pgc 1 _amp_#x003b1; may have an important function in neurons [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12267 18464922 14372 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 however the neurodegenerative lesions in pgc 1 _amp_#x003b1; knockout mice do not mimic lesions in hd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12268 18464922 14375 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 considering recent results on thermoregulation and mitochondrial biogenesis impairment in hd and potential neuroprotective role of pgc 1 _amp_#x003b1; in hd ppar _amp_#x003b3; desperately seeking further attention and these types of studies could provide essential data on the role of ppar _amp_#x003b3; in hd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12269 18464922 14377 10601 6081 INS insulin insulin 0 1.0 studies in patients treated with ppar _amp_#x003b3; agonists indicate that the reduction of insulin resistance is resulted from the activation of ppar _amp_#x003b3; [ 78 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12270 18464922 14378 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 ppar _amp_#x003b3; 's natural coactivator is pgc 1 _amp_#x003b1; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12271 18464922 14379 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 tzds can mimic the effect of pgc 1 _amp_#x003b1; on ppar _amp_#x003b3; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12272 18464922 14380 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 if pgc 1 _amp_#x003b1; levels reduces or become inactivated by acetylation then the activity of ppar _amp_#x003b3; could be affected. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12273 18464922 14391 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 the activation of pgc 1 _amp_#x003b1; in hd mouse models or overexpression of pgc 1 _amp_#x003b1; in hd mouse models show efficacy in blockage of neuronal death and lead to improvement in behavioral phenotypes and increase in survival in several hd mouse models. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12274 18464922 14392 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 if these are confirmed then there is bonafide evidence that activation of pgc 1 _amp_#x003b1; could be a great therapeutic strategy for hd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12275 18464922 14393 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 the lack of report on the role of pgc 1 _amp_#x003b1; in als is a limiting step on the hypothesis that pgc 1 _amp_#x003b1; could be a target of investigation or therapeutic for als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12276 18464922 14394 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 mitochondria have been implicated in als and pgc 1 _amp_#x003b1; has possible role in mitochondrial biogenesis therefore it would be informative to examine mitochondrial abnormalities and pgc 1 _amp_#x003b1; in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12277 18464922 14395 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 however since ppar _amp_#x003b3; agonist shown to activate pgc 1 _amp_#x003b1; therefore there is an indirect possibility that pgc 1 _amp_#x003b1; in connection with ppar _amp_#x003b3; could play some role in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12490 18464925 14399 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 s and few nonsteroidal anti inflammatory drugs have shown anti inflammatory and protective effects in several experimental models of alzheimer's and parkinson's diseases amyotrophic lateral sclerosis multiple sclerosis and stroke as well as in few clinical studies. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 12491 18464925 14406 10601 6081 INS insulin insulin 0 1.0 ir role in the regulation of genes involved in lipid and carbohydrate metabolism ppar _amp_#x003b3; and the other two isoforms ppar _amp_#x003b1; and _amp_#x003b4; deeply affect lipid homeostasis and insulin sensitivity [ 1 _amp_#x02013; 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12492 18464925 14416 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 _#x003b3; could be targeted to control inflammation and treat invalidating diseases such as diabetic retinopathy and optic neuritis a demyelinating disease of the optic nerve frequently associated to multiple sclerosis ms see for review [ 26 ] . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 12493 18464925 14434 7683 3796 FOS activator protein 1 activator protein 1 0 1.0 15d pj 2 = 15 deoxy _amp_#x00394; 12 14 prostaglandin j 2 ad= alzheimer disease als= amyotrophic lateral sclerosis ap 1= activator protein 1 cns= central nervous system cox= cyclooxygenase dbd= dna binding domain eae= experimental autoimmune encephalomyelitis hode= hydroxy octadecadienoic acids ifn= interferon il= interleukin inos= induci 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12494 18464925 14434 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 janus activated kinases lbd= ligand binding domain lps= lipopolysaccharide mapk= mitogen activated protein kinase mcp 1= monocyte chemoattractrant protein 1 mhc= major histocompatibility complex ms= multiple sclerosis nf _amp_#x003ba; b= nuclear factor _amp_#x003ba; b no= nitric oxide nsaids= nonsteroidal anti inflammatory drugs oxldl= oxidized low density lipoprotein pd= parkinson disease ppar= peroxisome prolife 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 12495 18464925 14434 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 noic acids ifn= interferon il= interleukin inos= inducible nitric oxide synthase jak= janus activated kinases lbd= ligand binding domain lps= lipopolysaccharide mapk= mitogen activated protein kinase mcp 1= monocyte chemoattractrant protein 1 mhc= major histocompatibility complex ms= multiple sclerosis nf _amp_#x003ba; b= nuclear factor _amp_#x003ba; b no= nitric oxide nsaids= nonsteroidal anti inflamm 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12496 18464925 14434 7683 3796 FOS ap 1 ap 1 0 1.0 15d pj 2 = 15 deoxy _amp_#x00394; 12 14 prostaglandin j 2 ad= alzheimer disease als= amyotrophic lateral sclerosis ap 1= activator protein 1 cns= central nervous system cox= cyclooxygenase dbd= dna binding domain eae= experimental autoimmune encephalomyelitis hode= hydroxy octadecadienoic acids ifn= interferon il= int 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12497 18464925 14434 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 = central nervous system cox= cyclooxygenase dbd= dna binding domain eae= experimental autoimmune encephalomyelitis hode= hydroxy octadecadienoic acids ifn= interferon il= interleukin inos= inducible nitric oxide synthase jak= janus activated kinases lbd= ligand binding domain lps= lipopolysaccharide mapk= mitogen activated protein kinase mcp 1= monocyte chemoattractrant protein 1 mhc= major histocompatibility complex 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12498 18464925 14435 19272 10477 RXRA retinoid x receptor retinoid x receptor 0 1.0 rxr= retinoid x receptor socs= suppressor of cytokine signalling stat= signal transducer and activators of transcription th= t helper cell tnf= tumour necrosis factor tzds= thiazolidinediones 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12499 18464925 14456 10601 6081 INS insulin insulin 0 1.0 a major group of synthetic ppar _amp_#x003b3; agonists is represented by the antidiabetic drugs tzds originally identified for their ability to improve the insulin sensitivity of diabetic animals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12500 18464925 14486 12436 6925 MBP myelin basic protein myelin basic protein 0 1.0 and delayed brain damage in the newborn [ 47 48 ] and is characterized by early oxidative stress delayed behavioral deficits and alteration in myelin formation as indicated by the strong reduction of myelin basic protein mbp expression figure 2 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12501 18464925 14500 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 reactive astrocytes which are characterized by increased expression of glial fibrillary acidic protein gfap a constituent of the intermediate filaments are typical of most brain pathologies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12502 18464925 14514 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in addition rosiglitazone and the non tzd agonist l 796 449 induced a concentration dependent increase in glutamate transporter glt 1 expression and [ 3 h] glutamate uptake in rat astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12503 18464925 14515 20017 10940 SLC1A2 glt 1 glt1 0 1.0 in addition the authors identified six putative ppres in the promoter region of glt1/eaat2 gene suggesting glt1/eaat2 glutamate transporter is a novel ppar _amp_#x003b3; target gene [ 56 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12504 18464925 14516 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 finally 15d pgj 2 remarkably increase the synthesis and release of neurotrophic factor nerve growth factor ngf in mouse primary astrocytes which could further contribute to neuroprotection [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12505 18464925 14516 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 finally 15d pgj 2 remarkably increase the synthesis and release of neurotrophic factor nerve growth factor ngf in mouse primary astrocytes which could further contribute to neuroprotection [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12506 18464925 14519 17610 9605 PTGS2 cox 2 cox2 0 1.0 the two tzd compounds np00111 and np01138 were reported to inhibit the production of nitric oxide no il 6 and tnf _amp_#x003b1; as well as expression of the inducible enzymes inos and cox2 induced in lps stimulated astrocyte and microglial cultures [ 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12507 18464925 14519 10463 6018 IL6 il 6 il 6 0 1.0 the two tzd compounds np00111 and np01138 were reported to inhibit the production of nitric oxide no il 6 and tnf _amp_#x003b1; as well as expression of the inducible enzymes inos and cox2 induced in lps stimulated astrocyte and microglial cultures [ 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12508 18464925 14522 10437 5992 IL1B il 1 il 1 0 1.0 in contrast to the above described tzds the natural ligand 15d pgj 2 prevented the il 1 _amp_#x003b2; induced cox 2 mrna accumulation in human astrocytes through a ppar _amp_#x003b3; independent mechanism [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12509 18464925 14522 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in contrast to the above described tzds the natural ligand 15d pgj 2 prevented the il 1 _amp_#x003b2; induced cox 2 mrna accumulation in human astrocytes through a ppar _amp_#x003b3; independent mechanism [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12510 18464925 14523 12355 6872 MAPK10 map kinase map kinase 0 0.0 similarly lennon and colleagues [ 61 ] showed that ciglitazone and 15d pgj 2 activated the map kinase cascades erk jnk and p38 map kinase in astrocytes by a ppar _amp_#x003b3; independent mechanism which required the presence of ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12511 18464925 14523 12359 6876 MAPK14 p38 map kinase p38 map kinase 0 1.0 similarly lennon and colleagues [ 61 ] showed that ciglitazone and 15d pgj 2 activated the map kinase cascades erk jnk and p38 map kinase in astrocytes by a ppar _amp_#x003b3; independent mechanism which required the presence of ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12512 18464925 14524 10781 6190 JAK1 janus kinase 1 janus kinase 1 0 1.0 again independently of ppar _amp_#x003b3; 15d pgj 2 and rosiglitazone reduced the phosphorylation of signal transducers and activators of transcription stat 1 and 3 as well as janus kinase 1 jak1 and jak2 in activated astrocytes and microglia [ 62 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12513 18464925 14526 10521 15488 IL23A il 23 il 23 0 1.0 they found that in primary astrocytes lps induced the production of il 12p40 il 23 and il 27p28 proteins which was significantly reduced in the presence of 15d pgj 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12514 18464925 14527 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 since these cytokines play critical roles in the differentiation of t helper th 1 and th17 cells and are likely to contribute to the development of multiple sclerosis this observation further support the potential role of ppar _amp_#x003b3; agonists in ms treatment [ 5 64 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 12515 18464925 14528 10458 6014 IL4 il 4 il 4 0 1.0 in line with the beneficial effect of ppar _amp_#x003b3; agonists in experimental models of inflammatory diseases ppar _amp_#x003b3; has also been involved in anti inflammatory functions of il 4 a th2 type cytokine which plays an important role in controlling th1 cell responses and resolution of inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12516 18464925 14529 10458 6014 IL4 il 4 il 4 0 1.0 paintlia et al. [ 65 ] demonstrated that the inhibition of inos expression and the increase of survival of differentiating ops induced by il 4 in inflammatory cytokine stimulated mixed cultures are mediated by ppar _amp_#x003b3; activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12517 18464925 14530 10458 6014 IL4 il 4 il 4 0 1.0 in support of their conclusions the authors describe a coordinate increase in the expression of both ppar _amp_#x003b3; and its natural ligand producing enzyme 12/15 lipoxygenase 12/15 lox in il 4 treated glial cells and show that il 4 induced ppar _amp_#x003b3; activation antagonizes nf _amp_#x003ba; b transactivation in inflammatory cytokine stimulated astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12518 18464925 14530 10458 6014 IL4 il 4 il 4 0 1.0 treated glial cells and show that il 4 induced ppar _amp_#x003b3; activation antagonizes nf _amp_#x003ba; b transactivation in inflammatory cytokine stimulated astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12519 18464925 14531 10458 6014 IL4 il 4 il 4 0 1.0 a similar upregulation of ppar _amp_#x003b3; by il 4 was demonstrated in cultured microglial cells [ 66 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12520 18464925 14532 10458 6014 IL4 il 4 il 4 0 1.0 to link between il 4 and ppar _amp_#x003b3; is completed by the observation that the anti inflammatory activity of the tzd troglitazone was mediated by its ability to increase il 4 expression in glial cultures [ 67 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12521 18464925 14534 10437 5992 IL1B il 1 il 1 0 1.0 in a recent study 15d pgj 2 and ciglitazone suppress the production of il 1 _amp_#x003b2; and no in staphylococcus aureus stimulated astrocytes [ 68 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12522 18464925 14554 10437 5992 IL1B il 1 il 1 0 1.0 the same authors then demonstrated that 15d pgj 2 decreases the production of tnf _amp_#x003b1; il 1 _amp_#x003b2; and the expression of cox 2 in the same cell system while increasing the expression of the antioxidant enzyme hemeoxygenase 1 and the intracellular levels of glutathione [ 75 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12523 18464925 14554 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the same authors then demonstrated that 15d pgj 2 decreases the production of tnf _amp_#x003b1; il 1 _amp_#x003b2; and the expression of cox 2 in the same cell system while increasing the expression of the antioxidant enzyme hemeoxygenase 1 and the intracellular levels of glutathione [ 75 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12524 18464925 14558 7683 3796 FOS ap 1 ap 1 0 1.0 in human microglial cells 15d pgj 2 did not affect nf _amp_#x003ba; b binding activity although it decreased stat 1 expression and enhanced expression and binding activity of the ap 1 proteins j jun and c fos [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12525 18464925 14558 7683 3796 FOS c fos c fos 0 1.0 human microglial cells 15d pgj 2 did not affect nf _amp_#x003ba; b binding activity although it decreased stat 1 expression and enhanced expression and binding activity of the ap 1 proteins j jun and c fos [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12526 18464925 14559 3758 10618 CCL2 mcp 1 mcp 1 0 1.0 microglial activation also when elicited by gram positive bacteria staphylococcus aureus by inhibiting the expression of proinflammatory cytokines and the chemokine monocyte chemoattractant protein 1 mcp 1 [ 73 78 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12527 18464925 14559 3758 10618 CCL2 monocyte chemoattractant protein-1 monocyte chemoattractant protein 1 0 1.0 1; [ 63 77 ]. 15d pgj 2 attenuated microglial activation also when elicited by gram positive bacteria staphylococcus aureus by inhibiting the expression of proinflammatory cytokines and the chemokine monocyte chemoattractant protein 1 mcp 1 [ 73 78 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12528 18464925 14562 17610 9605 PTGS2 cox 2 cox 2 0 1.0 in this cell system cox 2 specific inhibitors failed to promote neuronal survival suggesting protective mechanisms independent of cox 2 metabolism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12529 18464925 14565 10437 5992 IL1B il 1 il 1 0 1.0 these effects were paralleled by a transient reduction of tnf _amp_#x003b1; and no production and a protracted inhibition of il 1 _amp_#x003b2; and pge 2 synthesis suggesting a dynamic regulation of the functional state of activated microglia by ncx 2216. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12530 18464925 14569 17610 9605 PTGS2 cox 2 cox 2 0 1.0 at concentrations several fold lower than those required for ppar _amp_#x003b3; activation effectively reduced the lps stimulated production of pgj 2 by directly preventing the enzymatic activity of cox 2 rather than its expression as previously described in activated monocytic cell lines [ 80 83 ] and in bv 2 cells [ 75 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12531 18464925 14570 17610 9605 PTGS2 cox 2 cox 2 0 1.0 the reduction of cox 2 enzymatic activity could be achieved through the modifications of key cysteine residues [ 84 ] as suggested by the ability of 15d pgj 2 electrophilic _amp_#x003b1; _amp_#x003b2; unsaturated ketones t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12532 18464925 14581 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 in a second recent trial the improvement in cognition after 6 months of rosiglitazone treatment was significant only in ad patients who did not have the _amp_#x003b5; 4 allele of the apolipoprotein e [ 92 ] a genotype associate with a higher risk to develop ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 12533 18464925 14581 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 in a second recent trial the improvement in cognition after 6 months of rosiglitazone treatment was significant only in ad patients who did not have the _amp_#x003b5; 4 allele of the apolipoprotein e [ 92 ] a genotype associate with a higher risk to develop ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2678 18513389 3484 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 this latter approach allowed the identification of seven genetic variants essential to differentiate cases from controls: apolipoprotein e arg158cys; hepatic lipase 480 c/t; endothelial nitric oxide synthase 690 c/t and glu298asp; vitamin k dependent coagulation factor seven arg353glu glycoprotein ia/iia 873 g/a and e selectin ser128a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2679 18513389 3484 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 this latter approach allowed the identification of seven genetic variants essential to differentiate cases from controls: apolipoprotein e arg158cys; hepatic lipase 480 c/t; endothelial nitric oxide synthase 690 c/t and glu298asp; vitamin k dependent coagulation factor seven arg353glu glycoprotein ia/iia 873 g/a and e selectin ser128arg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2680 18513389 3484 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 this latter approach allowed the identification of seven genetic variants essential to differentiate cases from controls: apolipoprotein e arg158cys; hepatic lipase 480 c/t; endothelial nitric oxide synthase 690 c/t and glu298asp; vitamin k dependent coagulation factor seven arg353glu glycoprotein ia/iia 873 g/a and e selectin ser128arg. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2681 18513389 3484 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 this latter approach allowed the identification of seven genetic variants essential to differentiate cases from controls: apolipoprotein e arg158cys; hepatic lipase 480 c/t; endothelial nitric oxide synthase 690 c/t and glu298asp; vitamin k dependent coagulation factor seven arg353glu glycoprotein ia/iia 873 g/a and e selectin ser128arg. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2682 18513389 3490 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the gene coding for copper/zinc superoxide dismutase 1 sod1 appears to be mutated in 10_amp_#x02013;20% in the familial form [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2683 18513389 3490 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 the gene coding for copper/zinc superoxide dismutase 1 sod1 appears to be mutated in 10_amp_#x02013;20% in the familial form [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2684 18513389 3496 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 among the genetic factors that may predispose to sporadic als neurofilaments apolipoprotein epsilon 4 genotype excitotoxicity genes ciliary neurotrophic factor ctnf cytochrome p450 debrisoquine hydroxylase cyp2d6 apurinic apyrimidinic endonuclease apex mitochondrial manganese superoxide dismutase sod2 monoamine oxidase allele b and paraoxonases have been re 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2685 18513389 3496 4649 2169 CNTF ciliary neurotrophic factor ciliary neurotrophic factor 0 1.0 among the genetic factors that may predispose to sporadic als neurofilaments apolipoprotein epsilon 4 genotype excitotoxicity genes ciliary neurotrophic factor ctnf cytochrome p450 debrisoquine hydroxylase cyp2d6 apurinic apyrimidinic endonuclease apex mitochondrial manganese superoxide dismutase sod2 monoamine oxidase allele b and paraoxonases have been re 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2686 18513389 3496 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 1.0 among the genetic factors that may predispose to sporadic als neurofilaments apolipoprotein epsilon 4 genotype excitotoxicity genes ciliary neurotrophic factor ctnf cytochrome p450 debrisoquine hydroxylase cyp2d6 apurinic apyrimidinic endonuclease apex mitochondrial manganese superoxide dis 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 2687 18513389 3496 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 filaments apolipoprotein epsilon 4 genotype excitotoxicity genes ciliary neurotrophic factor ctnf cytochrome p450 debrisoquine hydroxylase cyp2d6 apurinic apyrimidinic endonuclease apex mitochondrial manganese superoxide dismutase sod2 monoamine oxidase allele b and paraoxonases have been reported in different studies partly with contradictory results [ 2 4 7 9 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2688 18513389 3496 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 among the genetic factors that may predispose to sporadic als neurofilaments apolipoprotein epsilon 4 genotype excitotoxicity genes ciliary neurotrophic factor ctnf cytochrome p450 debrisoquine hydroxylase cyp2d6 apurinic apyrimidinic endonuclease apex mitochondrial manganese superoxide dismutase sod2 monoamine oxidase allele b and paraoxonases have been reported in different s 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2689 18513389 3496 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 apolipoprotein epsilon 4 genotype excitotoxicity genes ciliary neurotrophic factor ctnf cytochrome p450 debrisoquine hydroxylase cyp2d6 apurinic apyrimidinic endonuclease apex mitochondrial manganese superoxide dismutase sod2 monoamine oxidase allele b and paraoxonases have been reported in different studies partly with contradictory results [ 2 4 7 9 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2690 18513389 3527 22551 11892 TNF tnf alpha tnf alpha 0 1.0 gly adrb2 gln27glu mmp3 1171 5a/6a fii 20210 g/a fv arg506gln fvii 230 10 bp del/ins arg353glu pai 675 g5/g4 11053 g/t fgb 455 g/a itga2 873 g/a itgb3 leu33pro sele ser128arg leu554phe icam gly214arg tnf alpha 376 g/a 308g/a 244 g/a 238 g/a. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2691 18513389 3527 13324 7173 MMP3 mmp 3 mmp3 0 1.0 r 677 c/t nos3 922 a/g 690 c/t glu298asp dcp1 ivs16 ins/del agtr1 1166a/c agt met235thr nppa 664 g/a nppa 2238 t/c add1 gly460trp scnn1a trp493arg ala663thr gnb3 825 c/t adrb2 arg16gly adrb2 gln27glu mmp3 1171 5a/6a fii 20210 g/a fv arg506gln fvii 230 10 bp del/ins arg353glu pai 675 g5/g4 11053 g/t fgb 455 g/a itga2 873 g/a itgb3 leu33pro sele ser128arg leu554phe icam gly214arg tnf alpha 376 g/a 308g/ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2692 18513389 3649 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 genetic variants selected by the five twist procedures seven genetic variants were always independently selected by the five twist procedures: apolipoprotein e apoe chromosome 19q13.2 arg158cys; hepatic lipase lipc chromosome 15q21 23 480 c/t; endothelial nitric oxide synthase nos3 chromosome 7q36 690 c/t and glu298asp; vitamin k dependent coagulation fac 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2693 18513389 3649 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 genetic variants selected by the five twist procedures seven genetic variants were always independently selected by the five twist procedures: apolipoprotein e apoe chromosome 19q13.2 arg158cys; hepatic lipase lipc chromosome 15q21 23 480 c/t; endothelial nitric oxide synthase nos3 chromosome 7q36 690 c/t and glu298asp; vitamin k dependent coagulation facto 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2694 18513389 3649 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 procedures seven genetic variants were always independently selected by the five twist procedures: apolipoprotein e apoe chromosome 19q13.2 arg158cys; hepatic lipase lipc chromosome 15q21 23 480 c/t; endothelial nitric oxide synthase nos3 chromosome 7q36 690 c/t and glu298asp; vitamin k dependent coagulation factor seven f7 chromosome 13q34 arg353glu glycoprotein ia/iia itga2 chromosome 5q23 q31 873 g/a; e selectin sele chromosom 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2695 18513389 3649 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 even genetic variants were always independently selected by the five twist procedures: apolipoprotein e apoe chromosome 19q13.2 arg158cys; hepatic lipase lipc chromosome 15q21 23 480 c/t; endothelial nitric oxide synthase nos3 chromosome 7q36 690 c/t and glu298asp; vitamin k dependent coagulation factor seven f7 chromosome 13q34 arg353glu glycoprotein ia/iia itga2 chromosome 5q23 q31 873 g/a; e selectin sele chromosom 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2696 18513389 3652 16981 9204 PON1 paraoxonase paraoxonase 0 1.0 genetic variants selected four times over five experiments consisted of: peroxisome proliferator activated receptor gamma pparg pro12ala chromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2697 18513389 3652 16981 9204 PON1 paraoxonase paraoxonase 0 1.0 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2698 18513389 3652 16981 9204 PON1 paraoxonase 1 paraoxonase 1 0 1.0 genetic variants selected four times over five experiments consisted of: peroxisome proliferator activated receptor gamma pparg pro12ala chromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2699 18513389 3652 16982 9205 PON2 paraoxonase 2 paraoxonase 2 0 1.0 imes over five experiments consisted of: peroxisome proliferator activated receptor gamma pparg pro12ala chromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2700 18513389 3652 17034 9236 PPARG peroxisome proliferator activated-receptor gamma peroxisome proliferator activated receptor gamma 0 1.0 genetic variants independently selected by four twist procedures the number of genetic variants selected four times over five experiments consisted of: peroxisome proliferator activated receptor gamma pparg pro12ala chromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2701 18513389 3652 14612 7939 NPPA atrial natriuretic peptide atrial natriuretic peptide 0 1.0 mosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromosome 12p13 fvii 232 ins/del sele leu554phe tumor necrosis factor alpha tnfalpha 376 g/a and 308 g/a chromosome 6p21.3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2702 18513389 3652 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 some proliferator activated receptor gamma pparg pro12ala chromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2703 18513389 3652 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromosome 12p13 fvii 232 ins/del sele leu554phe tumor necrosis factor alpha tnfalpha 376 g/a and 308 g/a chromosome 6p21.3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2704 18513389 3652 22551 11892 TNF tumor necrosis factor alpha tumor necrosis factor alpha 0 1.0 receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromosome 12p13 fvii 232 ins/del sele leu554phe tumor necrosis factor alpha tnfalpha 376 g/a and 308 g/a chromosome 6p21.3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2705 18513389 3652 12108 6709 LTA tumor necrosis factor beta tumor necrosis factor beta 0 1.0 some proliferator activated receptor gamma pparg pro12ala chromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2706 18513389 3652 13818 7436 MTHFR methylenetetrahydrofolate reductase methylenetetrahydrofolate reductase 0 1.0 hromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromos 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2707 18513389 3652 11959 6677 LPL lipoprotein lipase lipoprotein lipase 0 1.0 elected by four twist procedures the number of genetic variants selected four times over five experiments consisted of: peroxisome proliferator activated receptor gamma pparg pro12ala chromosome 3p25 lipoprotein lipase lpl asp9asn chromosome 8p22 paraoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reducta 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2708 18513389 3652 452 333 AGT angiotensin ii angiotensin ii 0 0.0 araoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromosome 12p13 fvii 232 ins/del sele leu554phe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2709 18513389 3652 454 336 AGTR1 angiotensin ii receptor angiotensin ii receptor 0 1.0 araoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromosome 12p13 fvii 232 ins/del sele leu554phe tumor nec 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2710 18513389 3652 454 336 AGTR1 angiotensin ii receptor, type 1 angiotensin ii receptor type1 0 1.0 araoxonase 1 pon1 met55leu and paraoxonase 2 pon2 ser311cys chromosome 7q21.3 tumor necrosis factor beta tnf beta thr26 asn chrom 6p21.3 methylenetetrahydrofolate reductase mthfr 677 c/t chrom 1p36.3 angiotensin ii receptor type1 agtr1 1166 a/c chromosome 3q21 25 atrial natriuretic peptide nppa 664 g/a chrom 1p36 21 epithelial na channel subunit scnn1a trp493arg chromosome 12p13 fvii 232 ins/del sele leu554phe tumor necrosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2711 18513389 3655 11736 6547 LDLR low density lipoprotein receptor low density lipoprotein receptor 0 1.0 otein a4 apoa4 chromosome 11q23 thr347ser; apolipoprotein c3 apoc3 chromosome 11q23.1 q23.2 641 c/a and 482 c/t; beta 3 adrenergic receptor adrb3 trp64arg 8p12 p11.2 ; lpl ser447term; pon1 gln192arg; low density lipoprotein receptor ldlr chromosome 19p13.3 exon 18 ncoi +/ ; cholesteryl ester transfer protein cetp 631 c/a and 629 c/a chromosome 16q21 ; nos3 922 a/g; g protein beta 3 subunit gnb3 825 c/t chromosome 12p13 ; beta 2 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2712 18513389 3655 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 1.0 genetic variants never selected by any twist procedures the following gene/genetic variants were never selected by the five twist procedures: apolipoprotein a4 apoa4 chromosome 11q23 thr347ser; apolipoprotein c3 apoc3 chromosome 11q23.1 q23.2 641 c/a and 482 c/t; beta 3 adrenergic receptor adrb3 trp64arg 8p12 p11.2 ; lpl ser447term; pon1 gln192arg; low density lipoprotein receptor ldlr chromosome 19p13.3 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 2713 18513389 3655 4240 1869 CETP cholesteryl ester transfer protein cholesteryl ester transfer protein 0 1.0 me 11q23.1 q23.2 641 c/a and 482 c/t; beta 3 adrenergic receptor adrb3 trp64arg 8p12 p11.2 ; lpl ser447term; pon1 gln192arg; low density lipoprotein receptor ldlr chromosome 19p13.3 exon 18 ncoi +/ ; cholesteryl ester transfer protein cetp 631 c/a and 629 c/a chromosome 16q21 ; nos3 922 a/g; g protein beta 3 subunit gnb3 825 c/t chromosome 12p13 ; beta 2 adrenergic receptor adbr2 arg16gly chromosome 5q31 q32 ; beta fibrinogen fgb 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2714 18513389 3655 396 286 ADRB2 beta-2 adrenergic receptor beta 2 adrenergic receptor 0 1.0 eceptor ldlr chromosome 19p13.3 exon 18 ncoi +/ ; cholesteryl ester transfer protein cetp 631 c/a and 629 c/a chromosome 16q21 ; nos3 922 a/g; g protein beta 3 subunit gnb3 825 c/t chromosome 12p13 ; beta 2 adrenergic receptor adbr2 arg16gly chromosome 5q31 q32 ; beta fibrinogen fgb 455 g/a chromosome 4q28 ; tnf alfa 238 g/a and tnf beta thr26asn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2715 18513389 3655 397 288 ADRB3 beta-3 adrenergic receptor beta 3 adrenergic receptor 0 1.0 owing gene/genetic variants were never selected by the five twist procedures: apolipoprotein a4 apoa4 chromosome 11q23 thr347ser; apolipoprotein c3 apoc3 chromosome 11q23.1 q23.2 641 c/a and 482 c/t; beta 3 adrenergic receptor adrb3 trp64arg 8p12 p11.2 ; lpl ser447term; pon1 gln192arg; low density lipoprotein receptor ldlr chromosome 19p13.3 exon 18 ncoi +/ ; cholesteryl ester transfer protein cetp 631 c/a and 629 c/a chro 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2716 18513389 3655 8499 4400 GNB3 g protein, beta-3 subunit g protein beta 3 subunit 0 1.0 lpl ser447term; pon1 gln192arg; low density lipoprotein receptor ldlr chromosome 19p13.3 exon 18 ncoi +/ ; cholesteryl ester transfer protein cetp 631 c/a and 629 c/a chromosome 16q21 ; nos3 922 a/g; g protein beta 3 subunit gnb3 825 c/t chromosome 12p13 ; beta 2 adrenergic receptor adbr2 arg16gly chromosome 5q31 q32 ; beta fibrinogen fgb 455 g/a chromosome 4q28 ; tnf alfa 238 g/a and tnf beta thr26asn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2717 18513389 3678 6885 3544 F7 factor vii factor vii 0 1.0 the two factor vii and selectin sele genetic variants both containing the information necessary for the correct attribution to the disease vs healthy status were selected five times fvii arg353glu and sele ser128arg an 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2718 18513389 3681 17381 9461 PRPH peripherin peripherin 0 1.0 in addition we noticed for example that in the same tnf locus 6p21.3 lies also the hfe gene for hemocromatosis and the peripherin gene both previously involved in als disease [ 35 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 5146 18539342 5527 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 in multiple sclerosis ms brains cps show immunohistochemistry to hla dr cd3 cd20 cd68 vcam 1 cd138 t lymphocytes in vessels and stroma vcam 1 expression on endothelia intense hla dr immunostaining on cells in cp stroma am 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 5147 18539342 5534 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 recent studies have contributed to characterize the involvement of cns structures outside the brain parenchyma such as the leptomeninges and the cerebrospinal fluid csf in the pathogenetic process of multiple sclerosis ms and experimental allergic encephalomyelitis eae kutzelnigg et al. 2005 ; pedemonte et al. 2006 ; magliozzi et al. 2007 . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 5148 18539342 5556 12436 6925 MBP myelin basic protein myelin basic protein 0 1.0 six of the ms brains used in this study had been already characterized as pertaining the pattern and extension of wm and grey matter gm demyelinating lesions in previous studies using myelin basic protein mbp immunostaining [vercellino et al. 2005] and [vercellino et al. 2007] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 5149 18539342 5648 4840 2295 CP cp 2 cp 2 0 1.0 the most striking change was the intense expression of hla dr on three different cell populations: 1 elongated cells in the stroma of the cp 2 round cells located among the cp epithelial cells 3 epiplexus cells on the ventricular side of the cp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 5150 18539342 5663 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 epiplexus cells have been shown to respond to lps or ifn gamma injection blast injury and other stimuli with ultrastructural modifications increased number hla dr and nitric oxide synthase upregulation eng ang et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8082 18598679 9080 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase was activated upon lps challenge and apocynin the selective inhibitor of this enzyme prevented inflammation mediated toxicity to motor neurons suggesting that nadph oxidase may play a critical role in motor neuron death caused by lps induced inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8083 18598679 9103 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase acting as the functional enzyme in the respiratory burst generates ros not as a byproduct but rather as the primary function of the enzyme system bedard and krause 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8084 18598679 9104 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 recent studies indicate that ros produced by nadph oxidase could promote neurodegeneration [block and hong 2005] and [li et al. 2005] but the role of nadph oxidase in als remains largely unexplored. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8085 18598679 9127 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 to study the involvement of reactive oxygen species in inflammation induced effects nadph oxidase selective inhibitor apocynin 0.5 and 1_amp_#xa0;mm was coapplied with lps 30_amp_#xa0;_amp_#x3bc;g/ml for 2_amp_#xa0;weeks in the culture medium. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8086 18598679 9142 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 nadph oxidase subunits gp91 phox p47 phox and il 1_amp_#x3b2; mrna expression were evaluated by semiquantitative rt pcr using gapdh gene as internal standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8087 18598679 9142 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase subunits gp91 phox p47 phox and il 1_amp_#x3b2; mrna expression were evaluated by semiquantitative rt pcr using gapdh gene as internal standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8088 18598679 9154 3471 1473 CANX calnexin calnexin 0 1.0 bodies were applied and the bands of interest were detected using an odyssey infrared imaging system li cor lincoln nebraska . _amp_#x3b2; actin was used as internal standard of cytosolic protein and calnexin was used as internal standard of membrane protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8089 18598679 9203 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 fig. 5._amp_#xa0;changes in the message level of il 1_amp_#x3b2; gp91 phox and p47 phox in slice cultures after lps exposure. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8090 18598679 9206 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 c representative bands of nadph oxidase subunits gp91 phox and p47 phox mrna expression in slices treated with medium alone or 30_amp_#xa0;_amp_#x3bc;g/ml lps for 2_amp_#xa0;weeks after 1_amp_#xa0;week in culture. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8091 18598679 9206 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 c representative bands of nadph oxidase subunits gp91 phox and p47 phox mrna expression in slices treated with medium alone or 30_amp_#xa0;_amp_#x3bc;g/ml lps for 2_amp_#xa0;weeks after 1_amp_#xa0;week in culture. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8092 18598679 9207 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 d ratio of pcr product from gp91 phox and p47 phox to that of gapdh mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8093 18598679 9214 3471 1473 CANX calnexin calnexin 0 1.0 immunoblots a for p47 phox using cytosolic and membranous extracts prepared from the slice cultures. _amp_#x3b2; actin was used as internal standard of cytosolic protein and calnexin was used as internal standard of membrane protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8094 18598679 9217 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase inhibitor apocynin prevented lps induced toxicity to motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8095 18598679 9262 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase and il 1_amp_#x3b2; mrna expression in spinal cord slices treated with lps 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8096 18598679 9267 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 we also investigated the message levels of nadph oxidase subunits gp91 phox and p47 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8097 18598679 9267 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we also investigated the message levels of nadph oxidase subunits gp91 phox and p47 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8098 18598679 9269 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 the mrna expression of gp91 phox in the slices treated with lps significantly increased compared to the controls figs 5 c and d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8099 18598679 9273 5279 2577 CYBA p22-phox p22 phox 0 1.0 nadph oxidase also known as phagocytic oxidase phox is a dormant enzyme in resting cells composed of two membrane bound components gp91 phox and p22 phox and several cytosolic components including p47 phox p40 phox p67 phox and rac1/2 babior et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8100 18598679 9273 14170 7661 NCF2 p67 phox p67 phox 0 1.0 lso known as phagocytic oxidase phox is a dormant enzyme in resting cells composed of two membrane bound components gp91 phox and p22 phox and several cytosolic components including p47 phox p40 phox p67 phox and rac1/2 babior et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8101 18598679 9273 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 nadph oxidase also known as phagocytic oxidase phox is a dormant enzyme in resting cells composed of two membrane bound components gp91 phox and p22 phox and several cytosolic components including p47 phox p40 phox p67 phox and rac1/2 babior et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8102 18598679 9273 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase also known as phagocytic oxidase phox is a dormant enzyme in resting cells composed of two membrane bound components gp91 phox and p22 phox and several cytosolic components including p47 phox p40 pho 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8103 18598679 9274 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 gp91 phox is the catalytic core of the enzyme. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8104 18598679 9276 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 due to its particular construction the functional change of nadph oxidase relies more importantly on subcellular distribution of cytosolic subunits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8105 18598679 9277 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 so we next investigated the function of nadph oxidase at protein level and whether it was required for neurotoxicity induced by lps mediated inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8106 18598679 9278 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we first determined whether nadph oxidase formed an assembled and activated enzyme complex upon lps challenge. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8107 18598679 9279 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 two weeks after application of lps cytosolic subunit p47 phox translocated to the plasma membrane fig 6 a indicating that nadph oxidase became activated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8108 18598679 9280 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 next we examined the effect of nadph oxidase inhibitor apocynin which significantly reduced lps induced phox cytosolic subunit p47 phox translocation to the cell membrane fig 6 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8109 18598679 9305 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is a membrane bound enzyme consisting of multiple subunits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8110 18598679 9309 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in addition nadph oxidase derived ros can mediate proinflammatory gene expression and lead to the production of inflammatory cytokines qin et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8111 18598679 9310 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is therefore considered a key factor in oxidative stress and inflammatory processes both of which are implicated in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8112 18598679 9311 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we speculated that nadph oxidase might mediate the toxicity to motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8113 18598679 9312 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 this hypothesis is supported by two recent reports that nadph oxidase is up regulated in the spinal cords of als patients and sod1 g93a transgenic mice wu et al. 2006 and deletion of either nox1 or nox2 gene significantly slowed disease progression and improved surviva 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8114 18598679 9313 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 in the present study we found that nadph oxidase was activated as indicated by the up regulation of membranous subunit gp91 phox mrna expression and the translocation of cytosolic component p47 phox to the membrane following lps challenge. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8115 18598679 9313 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in the present study we found that nadph oxidase was activated as indicated by the up regulation of membranous subunit gp91 phox mrna expression and the translocation of cytosolic component p47 phox to the membrane following lps challenge. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8116 18598679 9314 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 more importantly lps induced inflammation mediated toxicity to motor neurons was markedly ameliorated by the nadph oxidase inhibitor apocynin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8117 18598679 9316 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 these data provide evidence that nadph oxidase plays an important role in mediating motor neuron injury under inflammatory conditions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 8118 18598679 9334 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase contributes to the demise of motor neurons caused by lps induced inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2048 18751914 3073 10437 5992 IL1B il 1 il 1 0 1.0 pro inflammatory cytokines tnf _amp_#945; and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2049 18751914 3071 10437 5992 IL1B il 1 il 1 0 1.0 tnf _amp_#945; and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2050 18751914 3068 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2051 18751914 3068 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2052 18751914 3066 14569 7897 NPC1 niemann-pick disease niemann pick disease 0 1.0 niemann pick diseases a and b are due to acidic sphingomyelinase deficiency resulting in sphingomyelin accumulation while niemann pick disease c is due to mutations in either the npc1 or npc2 genes resulting in defective cholesterol transport and cholesterol accumulation. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2053 18751914 3064 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is an autoimmune inflammatory demyelinating condition of the cns. 7 SciMiner_v2.2 2 0 1 0 0 0 0 0 0 0