#sen2geneID pmid senID geneID hgncID approvedSymbol matchString actualString startPos score flankingText matchCodeID tag SciMinerVersion SciMinerMethod inExClude inExCludeCond phenotypeOnly conflictCode hgncIDbyNR NRText editTag editUser oldGeneID oldHgncID oldApprovedSymbol oldInExClude oldInExCludeCond 300594 7764323 431540 1576 990 BCL2 bcl 2 bcl 2 0 1.0 free radical scavengers|free radicals|proteins|proto oncogene proteins|proto oncogene proteins c bcl 2|reactive oxygen species|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299739 7841373 429640 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 protein expression in aged brain and neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299740 7841373 429641 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the proto oncogene bcl 2 is involved in the regulation of cell death and is able to block apoptosis in neurones through reduced generation of reactive oxygen species ros . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299741 7841373 429642 1576 990 BCL2 bcl 2 bcl 2 0 1.0 we have studied the immunohistochemical expression of bcl 2 protein in the aged brain and in various human neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299742 7841373 429643 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in all cases bcl 2 was strongly enriched within lipofuscin and autophagic vacuoles of neurones glial and vascular cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299743 7841373 429644 1576 990 BCL2 bcl 2 bcl 2 0 1.0 our data show that accumulation of bcl 2 is not disease specific and represents a general cellular response which accompanies the increased formation of lipofuscin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299744 7841373 429645 1576 990 BCL2 bcl 2 bcl 2 0 1.0 since oxidative stress is directly involved in lipofuscinogenesis accumulation of bcl 2 may reflect a mechanism for counterbalancing ros mediated damage or it might represent the impairment of bcl 2 dependent protection from ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299745 7841373 429646 1576 990 BCL2 bcl 2 bcl 2 0 1.0 lipofuscin|proto oncogene proteins|proto oncogene proteins c bcl 2|gtp binding proteins| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297957 8588576 425850 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297139 8841988 424205 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 decreased cytochrome c oxidase activity but unchanged superoxide dismutase and glutathione peroxidase activities in the spinal cords of patients with amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297140 8841988 424205 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 decreased cytochrome c oxidase activity but unchanged superoxide dismutase and glutathione peroxidase activities in the spinal cords of patients with amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297142 8841988 424208 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 we measured the antioxidant actions of superoxide dismutase sod glutathione peroxidase gsh px and cytochrome c oxidase co of the human spinal cord in patients with als in comparison with those in control patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297143 8841988 424208 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we measured the antioxidant actions of superoxide dismutase sod glutathione peroxidase gsh px and cytochrome c oxidase co of the human spinal cord in patients with als in comparison with those in control patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297164 8858182 424247 9766 4851 HTT huntingtin huntingtin 0 1.0 3 nitropropionic acid as a toxin model for huntington's disease together with the demonstration of reduced mitochondrial function in huntington's disease caudate supports the proposition that mutant huntingtin may exert its effect through an abnormality of energy metabolism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297165 8858182 424249 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein precursor|dna mitochondrial|free radicals|hd protein human|nerve tissue proteins|nuclear proteins|reactive oxygen species|electron transport complex iv| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297270 8899665 424391 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 evidence against increased oxidative stress in fibroblasts from patients with non superoxide dismutase 1 mutant familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297272 8899665 424393 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 in parallel fibroblasts were examined for signs of abnormal oxidative stress by study of reactive oxygen species metabolism and concurrently leukocyte dna from the same patients was examined for superoxide dismutase 1 sod1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297273 8899665 424401 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c group|free radicals|hemostatics|reactive oxygen species|thiobarbituric acid reactive substances|vitamin k|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296647 8910880 423324 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein precursor|reactive oxygen species|calcium| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295172 8922414 420724 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the importance of ros in programmed cell death also has been suggested from the neuroprotective effects of bcl 2 family proteins which seem to act by inhibiting ros induced cell damage kane et al. 1993 ; zhong et al. 1993 ; myers et al. 1995 ; lawrence et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295174 8922414 420734 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 histological analysis of the cervical spinal cord of wobbler mice demonstrates wallerian degeneration reductions in axon caliber and decreases in choline acetyltransferase chat activity within the anterior horn by 8 weeks of age bird et al. 1971 ; mitsumoto and bradley 1982 ; baulac et al. 1983 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295175 8922414 420843 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 then every fifth section was stained for choline acetyltransferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295176 8922414 420875 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 within the cervical spinal cord nac reduced losses of choline acetyltransferase positive neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295177 8922414 420934 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 total numbers of choline acetyltransferase positive neurons are indicated for each group n = 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295565 9007410 421584 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase and oxygen radical neurotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295566 9007410 421586 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cytosolic cu zn superoxide dismutase normally defends against damage by reactive oxygen species; however mutant forms of the enzyme might instead contribute to damage of motor neurons n some amyotrophic lateral sclerosis patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295567 9007410 421587 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 possible mechanisms of oxidative injury to neurons are discussed with reference to cytosolic cu zn superoxide dismutase mutations and other factors which might enhance oxygen radical toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297783 9044305 425429 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative stress caused by glycation of cu zn superoxide dismutase and its effects on intracellular components. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297784 9044305 425433 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 accumulating evidence supports the concept that decreases in cu zn superoxide dismutase sod activity causes apoptotic cell death in neuronal cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294101 9092140 418544 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 [amyotrophic lateral sclerosis and superoxide dismutase a review] 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294102 9092140 418545 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the recent observation that mutations in cytosolic cuzn superoxide dismutase cuzn sod are associated with amyotrophic lateral sclerosis als suggests that the disease arises from a perturbation of the homeostasis of free radicals resulting in neuronal degeneration by reactive 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294103 9092140 418550 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294710 9172131 419812 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 frontal cortical levels and activity of the pivotal ber protein apurinic/apyrimidinic endonuclease ape were determined in 11 patients with sporadic als and six age matched control subjects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294711 9172131 419812 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 frontal cortical levels and activity of the pivotal ber protein apurinic/apyrimidinic endonuclease ape were determined in 11 patients with sporadic als and six age matched control subjects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294713 9172131 419821 13410 7211 MPG n-methylpurine-dna glycosylase n methylpurine dna glycosylase 0 1.0 dna base excision repair ber is considered to be the predominant pathway for repair of oxidative dna damage. 9 the damaged base is removed by a glycosylase e.g formamidopyrimidine or n methylpurine dna glycosylase and the resulting abasic site is repaired by apurinic/apyrimidinic endonuclease ape . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294714 9172131 419821 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 inant pathway for repair of oxidative dna damage. 9 the damaged base is removed by a glycosylase e.g formamidopyrimidine or n methylpurine dna glycosylase and the resulting abasic site is repaired by apurinic/apyrimidinic endonuclease ape . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294715 9172131 419821 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 inant pathway for repair of oxidative dna damage. 9 the damaged base is removed by a glycosylase e.g formamidopyrimidine or n methylpurine dna glycosylase and the resulting abasic site is repaired by apurinic/apyrimidinic endonuclease ape . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294716 9172131 419835 878 587 APEX1 ape 1 ape 1 0 1.0 membranes were immunoprobed by incubating blots with blocking solution containing anti ape 1:2000 for 1 h at room temperature. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294717 9172131 419847 13410 7211 MPG n-methylpurine-dna glycosylase n methylpurine dna glycosylase 0 1.0 for comparison protein extracts 50 microg from several control n _amp_#61; 4 and als n _amp_#61; 3 subjects were analyzed by western blotting using a monoclonal antibody to the human ber protein n methylpurine dna glycosylase mpg and purified human mpg positive control both provided by dr sankar mitra utmb galveston tx . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294718 9172131 419847 13410 7211 MPG n-methylpurine-dna glycosylase, mpg n methylpurine dna glycosylase mpg 0 1.0 for comparison protein extracts 50 microg from several control n _amp_#61; 4 and als n _amp_#61; 3 subjects were analyzed by western blotting using a monoclonal antibody to the human ber protein n methylpurine dna glycosylase mpg and purified human mpg positive control both provided by dr sankar mitra utmb galveston tx . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293112 9311102 416575 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein|cytokines|excitatory amino acids|nerve growth factors|reactive oxygen species| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293242 9337068 416920 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein|amyloid beta protein precursor|reactive oxygen species|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293756 9350962 417497 551 399 ALB serum albumin serum albumin 0 1.0 r describes an immunocytochemical method for localization of central nervous system cns lipid peroxidation lp that employs a rabbit derived antibody raised against malondialdehyde mda modified rabbit serum albumin rsa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293758 9350962 417521 551 399 ALB serum albumin serum albumin 0 1.0 five milliliters of the solution was mixed with 5 ml of rabbit serum albumin rsa; 10 mg/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293760 9350962 417531 551 399 ALB serum albumin serum albumin 0 1.0 malondialdehyde rabbit serum albumin elisa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293762 9350962 417533 551 399 ALB serum albumin serum albumin 0 1.0 the mda rsa solution was poured out and the plates blocked with 200 _amp_#x3bc; l of a solution of 1% bovine serum albumin bsa in phosphate buffered saline pbs for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293765 9350962 417588 551 399 ALB serum albumin serum albumin 0 1.0 specificity of anti malondialdehyde rabbit serum albumin antibody 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291077 9462746 412763 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 a novel neurological phenotype in mice lacking mitochondrial manganese superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291079 9462746 412766 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 genetic inactivation of the mitochondrial form of superoxide dismutase in mice results in dilated cardiomyopathy hepatic lipid accumulation and early neonatal death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291080 9462746 412767 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we report that treatment with the superoxide dismutase sod mimetic manganese 5 10 15 20 tetrakis 4 benzoic acid porphyrin mntbap rescues these sod2tm1cje / mutant mice from this systemic pathology and dramatically prolongs their survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 289762 9620775 410133 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the association between mutations in the gene encoding the oxygen radical metabolizing enzyme cuzn superoxide dismutase sod1 and loss of motorneurons in the brain and spinal cord that occurs in the life shortening paralytic disease familial amyotrophic lateral sclerosis fals; ref 4 suggests that chronic and unrepaired 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 290134 9633809 410561 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 transgenic mice that highly over express a mutated human cuzn superoxide dismutase sod1 gene [gly93 >ala; tgn sod1 g93a g1h line] found in some patients with familial als fals have been shown to develop motor neuron disease that is characterized by motor neuron loss in the lumbar a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 290135 9633809 410564 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 in the present study we investigated the time course of microglial major histocompatibility ii antigen immunoreactivity and astrocytic glial fibrillary acidic protein immunoreactivity activation in relation to the course of motor neuron disease in the tgn sod1 g93a g1h fals mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 285043 9675268 403196 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 oxidative insult to normal neurons also results from catalytically active redox metal ions i.e iron and copper and particular ros generating enzymes and peptides e.g nitric oxide synthase xanthine oxidase _amp_#x3b2; amyloid etc. present in the brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 285044 9675268 403196 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 oxidative insult to normal neurons also results from catalytically active redox metal ions i.e iron and copper and particular ros generating enzymes and peptides e.g nitric oxide synthase xanthine oxidase _amp_#x3b2; amyloid etc. present in the brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 286999 9745361 405674 20017 10940 SLC1A2 glt 1 glt1 0 1.0 specific _amp_#x2018;redox sensing' elements consisting of cysteine residues have been identified in the structures of at least three transporter subtypes glt1 glast and eaac1 and shown to regulate transport rate via thiol disulphide redox interconversion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287000 9745361 405679 20017 10940 SLC1A2 glt 1 glt1 0 1.0 five different isoforms of glutamate transporters or excitatory amino acid carriers have now been identified: glast eaat1 glt1 eaat2 eaac1 eaat3 eaat4 and eaat5 refs [ 1 2 3 4 5 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287001 9745361 405687 20017 10940 SLC1A2 glt 1 glt1 0 1.0 in studies to localize the isoforms glt1 and glast appear to be restricted to brain astrocytes [ 11 12 ] and are expressed in different proportions in different regions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287002 9745361 405688 20017 10940 SLC1A2 glt 1 glt1 0 1.0 glt1 is the most abundant glutamate transporter and represents about 1% of the total brain membrane protein[ 6 13 ] with highest concentrations in the hippocampus and cerebral cortex. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287003 9745361 405690 20017 10940 SLC1A2 glt 1 glt1 0 1.0 in astrocytic membranes glt1 and glast localize preferentially to the parts of the plasma membrane that face neuropil with lower levels in the parts facing pia mater capillary endothelium other astrocytes and neuronal cell bodie 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287004 9745361 405691 20017 10940 SLC1A2 glt 1 glt1 0 1.0 moreover the expression of glt1 and glast is under the control of neuronal soluble factors including glutamate itself [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287005 9745361 405710 20017 10940 SLC1A2 glt 1 glt1 0 1.0 the most dramatic elevation of extracellular glutamate levels and tissue damage resulted from loss of the glial transporters particularly glt1 ref [ 25 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287006 9745361 405711 20017 10940 SLC1A2 glt 1 glt1 0 1.0 indeed knockout mice lacking glt1 undergo lethal spontaneous seizures increased susceptibility to acute brain injury and die prematurely with virtually no survivors three months after birth [ 26 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287007 9745361 405716 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 toxic pathways include ca 2+ dependent activation of nitric oxide no synthase phospholipase a 2 and xanthine oxidase which can all contribute to an aberrant formation of reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287008 9745361 405723 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 reactive oxygen species generated by hydrogen peroxide h 2 o 2 or by xanthine oxidase activation inhibit [ 3 h]glutamate uptake in cultured astrocytes and reduce the transport associated current under voltage clamp with minor or no effect on the resting membrane conductance [ 34 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287009 9745361 405727 20017 10940 SLC1A2 glt 1 glt1 0 1.0 indeed the transport activities of glt1 eaac1 and glast are equally inhibited by oxidants via a direct action on the transporter proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287010 9745361 405742 20017 10940 SLC1A2 glt 1 glt1 0 1.0 eaac1 glt1 and glast exhibit redox sensing properties. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287011 9745361 405745 20017 10940 SLC1A2 glt 1 glt1 0 1.0 eaac1 glast glt1 eaat4 and eaat5 carry different cysteine residues in their sequences ranging from a minimum of two for eaat4 to a maximum of 11 for eaat5 ref [ 5 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287012 9745361 405781 20017 10940 SLC1A2 glt 1 glt1 0 1.0 sporter defect and neurodegeneration has been demonstrated by rothstein and collegues [ 50 ]: they have reported a remarkable loss of glutamate uptake activity apparently owing to a selective loss of glt1 in the spinal cord and motor cortex of patients with the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287013 9745361 405782 20017 10940 SLC1A2 glt 1 glt1 0 1.0 the mechanism s leading to loss of glt1 are not fully understood. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287014 9745361 405783 20017 10940 SLC1A2 glt 1 glt1 0 1.0 the steady state level of glt1 mrna was apparently unchanged leading investigators initially to suspect a block of translation or the internalization and/or degradation of post translationally damaged glt1 ref [ 51 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287015 9745361 405783 20017 10940 SLC1A2 glt 1 glt1 0 1.0 mrna was apparently unchanged leading investigators initially to suspect a block of translation or the internalization and/or degradation of post translationally damaged glt1 ref [ 51 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287016 9745361 405784 20017 10940 SLC1A2 glt 1 glt1 0 1.0 of abnormal glt1mrnas including intron retention and exon skipping whose processing could lead to unstable proteins undergoing rapid degradation and/or producing a dominant negative effect on normal glt1 ref [ 52 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287017 9745361 405785 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 ies by rosen and colleagues [ 53 ] linked als to reactive oxygen species toxicity since they showed that 15_amp_#x2013;20% of fals patients carry mis sense mutations in the gene encoding cu 2+ /zn 2+ superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287018 9745361 405790 20017 10940 SLC1A2 glt 1 glt1 0 1.0 s of sod1 may result in defective glutamate transport since transgenic mice expressing an als linked sod1 mutation show increased tyrosine nitration of glutamate transporters[ 43 ] and marked loss of glt1 in the spinal cord [ 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287019 9745361 405807 20017 10940 SLC1A2 glt 1 glt1 0 1.0 ion of 4 hydroxynonenal an aldehydic product of lipid peroxidative processes which by itself mimicked uptake inhibition. 4 hydroxynomenal was shown to form adducts with a number of proteins including glt1 by reaction at sulphydryls or other vulnerable groups [ 66 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287020 9745361 405816 20017 10940 SLC1A2 glt 1 glt1 0 1.0 as the glutamate transporters glt1 in particular are crucial in maintaining glutamate homeostasis[ 6 32 33 ] eventual oxidative damage of the transporters in vivo is predicted to have major neurotoxic consequences. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287021 9745361 405826 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 ber of different mechanisms may contribute to [ca 2+ ] i rise including direct influx via n methyl aspartate nmda or rs amino 3 hydroxy 5 methyl 4 isoxazole propionic acid ampa receptors metabotropic glutamate receptor mediated release from the internal stores activation of voltage dependent ca 2+ channels and reversal of na + /ca 2+ exchange. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287022 9745361 405830 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in amyotrophic lateral sclerosis peroxynitrite onoo _amp_#x2212; or other noxious ros can be formed as a result of altered function of mutant superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 284187 9856861 401492 3544 1516 CAT catalase catalase 0 1.0 iron iii /ascorbate toxicity was completely prevented with the hydrogen peroxide detoxifying enzyme catalase and partially prevented with the antioxidant vitamin e. sod1 the enzyme that removes superoxide did not protect against iron iii /ascorbate toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280474 10077670 394958 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 abstract it has been reported that expression of familial amyotrophic lateral sclerosis fals associated mutant cu/zn superoxide dismutase 1 sod induces apoptosis of neuronal cells in culture associated with an increase in reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280475 10077670 394963 7592 3711 FKBP1A rotamase rotamase 0 1.0 because both groups of drugs inhibit the rotamase activity of cyclophilins cyp but only the immunosuppressant analogs inhibit calcineurin activity these data suggest that rotamase inhibition underlies the enhanced cell death after sodv148g expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280476 10077670 394964 7592 3711 FKBP1A rotamase rotamase 0 1.0 the importance of rotamase activity in mutant sod mediated apoptosis was supported by experiments showing that overexpressed wild type cyclophilin a cypa but not cypa with a rotamase active site point mutation protected cells from death after sodv148g expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280477 10077670 394965 7592 3711 FKBP1A rotamase rotamase 0 1.0 these data suggest that mutant sod produces a greater need for rotamase and also highlights possible new therapeutic strategies in fals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280478 10077670 394975 614 437 ALPI alkaline phosphatase alkaline phosphatase 0 1.0 cypa histidine tagged 17 expression was detected by immunostaining with his probe h 15 rabbit polyclonal antiserum santa cruz biotechnology followed by anti rabbit igg alkaline phosphatase and x phosphate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280479 10077670 394991 17300 9388 PRKAR1A camp-dependent protein kinase camp dependent protein kinase 0 1.0 in brief r ii peptide dldvpipgrfdrrvsvaae; 0.25 _amp_#x003bc;m containing the phosphorylation site of type ii camp dependent protein kinase lc services woburn ma was phosphorylated by bovine brain protein kinase a catalytic subunit 30 _amp_#x003bc;g/ml plus _amp_#x0005b;_amp_#x003b3; 32 p_amp_#x0005d;atp 0.5 mm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280481 10077670 394991 17294 9380 PRKACA protein kinase a catalytic subunit protein kinase a catalytic subunit 0 1.0 in brief r ii peptide dldvpipgrfdrrvsvaae; 0.25 _amp_#x003bc;m containing the phosphorylation site of type ii camp dependent protein kinase lc services woburn ma was phosphorylated by bovine brain protein kinase a catalytic subunit 30 _amp_#x003bc;g/ml plus _amp_#x0005b;_amp_#x003b3; 32 p_amp_#x0005d;atp 0.5 mm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280482 10077670 394998 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase activity assay. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280483 10077670 394999 7592 3711 FKBP1A rotamase rotamase 0 1.0 a previously published 21 chymotrypsin coupled assay was used to measure rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280484 10077670 395003 7592 3711 FKBP1A rotamase rotamase 0 1.0 cells were treated with csa and were harvested as described above for the rotamase assay. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280485 10077670 395034 7592 3711 FKBP1A rotamase rotamase 0 1.0 fig. 3 a shows that csa csg and fk506 immunosuppressant drugs known to inhibit calcineurin and the rotamase activity of immunophilin potentiated cell death induced by sodv148g expression fig 3 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280486 10077670 395041 7592 3711 FKBP1A rotamase rotamase 0 1.0 we also examined the effect of pkf 211_amp_#x02013;811 and psc 833 nonimmunosuppressant csa analogs that inhibit cyclophilin rotamase activity but not calcineurin 22 23 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280487 10077670 395043 7592 3711 FKBP1A rotamase rotamase 0 1.0 the results suggest that csa enhances sodv148g induced cell death by inhibiting cyclophilin rotamase activity and not because of calcineurin inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280488 10077670 395052 7592 3711 FKBP1A rotamase rotamase 0 1.0 effect of csa on rotamase activity levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280489 10077670 395053 7592 3711 FKBP1A rotamase rotamase 0 1.0 the above studies suggested that csa and its immunosuppressive analogs might enhance sod mutant induced cell death through its interference with rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280490 10077670 395054 7592 3711 FKBP1A rotamase rotamase 0 1.0 it also raised the question as to whether there is a preexisting difference in the level of rotamase activity between sodv148g expressing and mock cells making the former cells more sensitive to csa. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280491 10077670 395055 7592 3711 FKBP1A rotamase rotamase 0 1.0 therefore we measured rotamase activity in mock wt and mutant sod expressing cells before and after csa treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280492 10077670 395056 7592 3711 FKBP1A rotamase rotamase 0 1.0 the data show that all cells had a similar amount of rotamase activity before csa treatment and that csa decreased rotamase activity to a similar level in all three groups table 1 with no significant differences in this inhibition in the sodv148g expressing cells vs. other csa treated groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280493 10077670 395058 7592 3711 FKBP1A rotamase rotamase 0 1.0 these results suggested that mutant sod expressing cells might be more sensitive to effects of decreased rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280494 10077670 395060 7592 3711 FKBP1A rotamase rotamase 0 1.0 our interpretation of these studies is that human sod/rodent sod heterodimers that are formed in the transiently expressing cells may be more sensitive to conformational changes resulting from rotamase inhibition than the homogeneous rodent homodimers present in controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280495 10077670 395063 7592 3711 FKBP1A rotamase rotamase 0 1.0 to further examine the role of cyclophilin rotamase activity on mutant sod induced cell death we transfected ngf differentiated pc12 cells with wild type cypa cypawt cdna or cypa r55a cdna that contains a point mutation in the putative rotamase active 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280496 10077670 395063 7592 3711 FKBP1A rotamase rotamase 0 1.0 activity on mutant sod induced cell death we transfected ngf differentiated pc12 cells with wild type cypa cypawt cdna or cypa r55a cdna that contains a point mutation in the putative rotamase active site. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280497 10077670 395067 7592 3711 FKBP1A rotamase rotamase 0 1.0 these results suggest that the rotamase function of cypa protects cells from death induced by sodv148g. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280498 10077670 395073 7592 3711 FKBP1A rotamase rotamase 0 1.0 these results suggest that modulating the rotamase activity is vital for the survival of mutant sod expressing cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280499 10077670 395093 16630 8988 PIN1 prolyl isomerase prolyl isomerase 0 1.0 in addition to inhibiting calcineurin and blocking the mptp csa blocks peptidyl prolyl isomerase rotamase activity of cyclophilins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280500 10077670 395093 7592 3711 FKBP1A rotamase rotamase 0 1.0 in addition to inhibiting calcineurin and blocking the mptp csa blocks peptidyl prolyl isomerase rotamase activity of cyclophilins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280501 10077670 395094 7592 3711 FKBP1A rotamase rotamase 0 1.0 immunophilin rotamase activity is believed to have a variety of actions in neurons 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280502 10077670 395095 7592 3711 FKBP1A rotamase rotamase 0 1.0 to test whether csa enhanced sodv148g toxicity through rotamase inhibition we examined the effect of immunosuppressants csa csg and fk506 as well as nonimmunosuppressants pkf 211_amp_#x02013;811 or psc 833 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280503 10077670 395096 7592 3711 FKBP1A rotamase rotamase 0 1.0 nonimmunosuppressants do not influence calcineurin activity but do inhibit rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280504 10077670 395097 7592 3711 FKBP1A rotamase rotamase 0 1.0 we found that both drug classes enhanced apoptosis induced by mutant sod indicating that the action of csa may be related to rotamase inhibition and not to calcineurin inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280505 10077670 395098 7592 3711 FKBP1A rotamase rotamase 0 1.0 a role for rotamase in mutant sod toxicity was supported by experiments comparing mutant sod induced cell death after expression of cypawt vs. an isomerase activity deficient mutant cypa r55a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280506 10077670 395100 7592 3711 FKBP1A rotamase rotamase 0 1.0 although a recent report concluded that cypa r55a may have more rotamase activity than previously suspected 33 34 it appears that this residual activity is insufficient to permit folding of fully functional proteins 17 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280507 10077670 395101 7592 3711 FKBP1A rotamase rotamase 0 1.0 our data highlight the importance of rotamase activity in modifying the effect of mutant sod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280508 10077670 395102 7592 3711 FKBP1A rotamase rotamase 0 1.0 the findings that rotamase activity protects cells from mutant sod induced cell death and that there is roughly similar rotamase activity after csa treatment in wt and mutant sod expressing cells suggests that cells expressing mutant sod have a greater reliance on rotamase activity and has implications on our understanding of 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280509 10077670 395102 7592 3711 FKBP1A rotamase rotamase 0 1.0 activity after csa treatment in wt and mutant sod expressing cells suggests that cells expressing mutant sod have a greater reliance on rotamase activity and has implications on our understanding of the mechanism of this toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280510 10077670 395105 7592 3711 FKBP1A rotamase rotamase 0 1.0 the increased protein turnover may enhance the need for rotamase function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280511 10077670 395106 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase also may be needed to refold proteins that are partly denatured by oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280512 10077670 395108 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase may be required to maintain proteins in a correct conformation during their transport in motor axons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280513 10077670 395110 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase also may have a role in the normal folding of sod itself to help stabilize the enzyme or its dimers. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280514 10077670 395113 7592 3711 FKBP1A rotamase rotamase 0 1.0 mutant sod expression than after sodwt expression suggesting that the mutant enzyme was more sensitive than wt to the effects of csa perhaps because the mutant sod was more sensitive to a decline in rotamase activity and the consequences of misfolding. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280515 10077670 395114 7592 3711 FKBP1A rotamase rotamase 0 1.0 it also may be that other proteins perhaps ones that interact with sod are more sensitive to decreased rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280516 10077670 395115 7592 3711 FKBP1A rotamase rotamase 0 1.0 our observations have implications regarding possible therapy of fals suggesting the potential use of chaperone proteins or of agents that modulate rotamase activity to correct the deficits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280517 10077670 395120 7592 3711 FKBP1A rotamase rotamase 0 1.0 rather our studies suggest that these drugs worsen the fals mediated cell death because of rotamase inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280518 10077670 395141 7592 3711 FKBP1A rotamase rotamase 0 1.0 table 1 mean rotamase and sod activity _amp_#x0005b;percent of control mock infected pc12 cells_amp_#x0005d; 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280519 10077670 395143 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 als amyotrophic lateral sclerosis sod cu/zn superoxide dismutase 1 fals familial als cyp cyclophilin wt wild type ngf nerve growth factor adv adenovirus csa cyclosporin a nmda n methyl d aspartate mptp mitochondrial permeability transition pore 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280521 10077670 395143 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 als amyotrophic lateral sclerosis sod cu/zn superoxide dismutase 1 fals familial als cyp cyclophilin wt wild type ngf nerve growth factor adv adenovirus csa cyclosporin a nmda n methyl d aspartate mptp mitochondrial permeability transition pore 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280523 10077670 395146 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 in 1993 mutations in cu/zn superoxide dismutase 1 sod were found to be associated with 20_amp_#x00025; of cases of familial als fals 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280524 10077670 395153 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 it recently has been reported that the expression of fals associated mutant sod in nerve growth factor ngf differentiated pc12 cells primary sympathetic neurons and hippocampal neurons leads to altered o 2 content and an apoptotic cell death 12 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280525 10077670 395155 7592 3711 FKBP1A rotamase rotamase 0 1.0 suppressants bind immunophilins _amp_#x0005b;the drug receptor: e.g. cyclophilins cyp or fk binding protein_amp_#x0005d; and the drug immunophilin complex inhibits calcineurin activity as well as the rotamase peptidyl prolyl cis_amp_#x02013;trans isomerase activity of the immunophilins 13 14 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280526 10077670 395156 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase facilitates cis_amp_#x02013;trans isomerization of the peptide bond on the n terminal side of proline residues aids normal folding and assembly of proteins including sod and has other cellular functi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280527 10077670 395160 7592 3711 FKBP1A rotamase rotamase 0 1.0 most importantly we show that immunosuppressant drugs csa csg and fk506 enhance cell death induced by mutant sod and that this enhancement depends on rotamase inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280528 10077670 395161 7592 3711 FKBP1A rotamase rotamase 0 1.0 these findings suggest that mutant sod may lead to increased protein damage or turnover and a greater reliance on rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280529 10077670 395162 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase|calcineurin|immunophilins| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 272059 10544701 379957 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 lateral amyotrophic sclerosis: the discovery of a mutation in the copper zinc superoxide dismutase gene in patients with lateral amyotrophic sclerosis has made it possible to analyze the events leading to neuron death in transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273154 10593879 381898 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 tive oxygen species ros play a role in the pathogenesis of amyotrophic lateral sclerosis als a unique microdialysis or microcannula sampling technique was used in mice transfected with a mutant cu zn superoxide dismutase sod1 gene from humans with familial als mice transfected with the normal human sod1 gene and normal mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273155 10593879 381905 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 key words: mutation of cu zn superoxide dismutase gene _amp_#149; transgenic mouse _amp_#149; hydrogen peroxide _amp_#149; hydroxyl radical _amp_#149; superoxide anion 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273156 10593879 381907 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the finding of a single site mutation in the cu zn superoxide dismutase sod1 gene in familial als fals patients 2 3 linked this disease to free radicals 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273157 10593879 381913 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations of the sod1 gene reduce superoxide dismutase activity 2 3 8 9 10 11 ; this should elevate levels of o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273158 10593879 381970 3544 1516 CAT catalase catalase 0 1.0 h 2 o 2 produced from o 2 is converted to h 2 o by catalase and glutathione peroxidase gsh px the normal detoxification pathway of h 2 o 2 although some h 2 o 2 may be converted to oh by sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273159 10593879 381972 3544 1516 CAT catalase catalase 0 1.0 this is probably due to efficient h 2 o 2 removal which is the normal catalytic function of gsh px and catalase. msod1 mice had significantly higher levels of h 2 o 2 and oh than did the sod1 and nc mice and significantly lower levels of o 2 than the nc mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273160 10593879 381984 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the sod1 dimer may act in tandem as a superoxide dismutase and a peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273161 10593879 381985 3544 1516 CAT catalase catalase 0 1.0 it may work together with the detoxification enzymes such as catalase and gsh px to remove the h 2 o 2 produced from o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273162 10593879 382041 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 acsf was first pumped through the system at 15 microl/min for 1 h after placement of the perfusing loop then cytochrome c 50 microm in acsf was administered through the loop. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273163 10593879 382043 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the perfusates were centrifuged and reduced cytochrome c in the supernatant was measured by a spectrophotometer at a wavelength of 550 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273164 10593879 382044 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 to determine the levels of o 2 in the spinal cord tissue 500 microm cytochrome c was infused into the intrathecal space by the loop through the holes made in the wall at a flow rate of 1 microl/min for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273165 10593879 382046 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the tissue was dropped into a vial containing 500 microm cytochrome c in acsf then homogenized and centrifuged; the supernatant was passed through a 30 000 molecular weight ultrafiltration membrane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273166 10593879 382049 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 a the absorbance of reduced cytochrome c measured in the perfusates collected from msod1 n =6 sod1 n =3 and nc mice n =6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273167 10593879 382051 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 b the absorbance of reduced cytochrome c measured in spinal cord tissue in msod1 n =3 sod1 n =3 and nc mice n =4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273168 10593879 382101 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the levels of o 2 in the terminal cistern were sampled by a microcannula and determined by measuring reduced cytochrome c in the perfusates using our unique method 40 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273169 10593879 382102 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after the initial acsf perfusion the perfusing fluid was changed to cytochrome c 50 microm in acsf solution and equilibrated for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273170 10593879 382105 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 reduced cytochrome c in the supernatant was measured by a spectrophotometer at a wavelength of 550 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273171 10593879 382106 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 to determine the level of o 2 in the spinal cord tissue 500 microm cytochrome c was infused into the intrathecal space by the loop through the holes made on the wall at a flow rate of 1 microl/min for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273172 10593879 382108 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the tissue was removed and transferred into a vial containing 500 microm cytochrome c in acsf homogenized centrifuged at 13 000 x g for 15 min and the supernatant was passed through a 30 000 molecular weight ultrafiltration membrane micron separation inc. westborough mass. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273173 10593879 382148 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the average absorbance of reduced cytochrome c mean_amp_#177; sd is 0.060 _amp_#177; 0.011 in msod1 mice n =6 0.037 _amp_#177; 0.004 in sod1 mice n =3 and 0.130 _amp_#177; 0.030 in nc mice n =6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273174 10593879 382152 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the average absorbance of reduced cytochrome c mean_amp_#177; sd absorbance/g wet weight tissue is 158 _amp_#177; 10 in msod1 mice n =3 138 _amp_#177; 10 in sod1 mice n =3 and 186 _amp_#177; 12 in nc mice n =4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267190 10627601 370983 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 considerable evidence supports a link between ca influx and glutamate receptor mediated neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267191 10627601 371012 6438 3229 EGF epidermal growth factor epidermal growth factor 0 1.0 glial cultures were prepared similarly except that tissue was obtained from early postnatal 1 3 d mice and plating media was supplemented with epidermal growth factor 10 ng/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267192 10627601 371024 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 exposures were terminated by replacing the exposure solution with mem + glucose along with the ionotropic glutamate receptor antagonists mk 801 and nbqx both at 10 micro m and returning the cultures to the 37degreec 5% co 2 incubator. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267193 10627601 371099 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 indeed gabaergic interneurons are characterized by the strong expression of cbps including parvalbumin celio 1986 calretinin rogers 1992 and calbindin d28k hendry and jones 1991 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267194 10627601 371110 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 although one must be careful in extrapolating findings in murine cultures to human disease it is notable that even across species motor neurons in vitro and in vivo seem to express similar glutamate receptor profiles and vulnerabilities to ampa/kainate receptor mediated injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267926 10643818 372644 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 this pathway is relevant for induction of long term potentiation while protein kinase c pkc causes maintenance of long term potentiation and protein kinase c can be induced by calcium arachidonate and reactive oxygen species fig 1b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267927 10643818 372646 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 in functional synergism 12 lipoxygenase is directly inhibited by reduced glutathione [ 5 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267928 10643818 372654 7333 11920 FAS fas antigen fas antigen 0 1.0 erm potentiation has been attributed to programmed cell death in t lymphocytes [ 7 and 8 ] and has been inferred from studies of tnf receptor dependent signaling [ 9 10 and 11 ] and engagement of the fas antigen [ 12 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267929 10643818 372655 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 two markers of oxidative stress in the central nervous system expression of heme oxygenase 1 and nuclear localization of nf kb p50 [ 13 ] are intimately associated with the outlined pathway because heme oxygenase 1 may activate cgmp kinase [ 7 ] while the nf kb proteins p50 and p49 are substrates for this enzyme weber unpublished results . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267930 10643818 372656 7683 3796 FOS c fos c fos 0 1.0 cyclic gmp dependent kinase also induces expression of c fos possibly via activation of sre creb or fap [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267931 10643818 372658 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 this is accomplished by the redox cycle catalyzed by glutathione peroxidase and glutathione reductase which can scavenge reactive oxygen intermediates including hpete during glutathione oxidation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267932 10643818 372659 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 in conjunction with direct inhibition of 12 lipoxygenase by glutathione [ 5 ] this mechanism may account for protection from excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267934 10643818 372664 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267935 10643818 372664 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267936 10643818 372664 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267937 10643818 372669 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 during apoptosis they may be cleaved distal to their normal cleavage sites and a mutation in presenilin 2 that is related to familial alzheimer's disease favors this alternative cleavage which may either directly enhance apoptosis or diminish the apoptosis regulating function of the wild type fragments [ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267938 10643818 372670 10827 6207 JUP catenin catenin 0 1.0 furthermore a complex of presenilin and _amp_#x3b2; or _amp_#x3b4; catenin can activate _amp_#x3b3; secretase the enzyme that releases the amyloid fragment a_amp_#x3b2; 1 42 with a consequent increase in the excreted amyloid _amp_#x3b2;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267940 10643818 372671 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e apoe protects neurons from hydrogen peroxide toxicity and binds specific metal ions including iron which could otherwise catalyze the generation of hydroxyl radicals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267942 10643818 372672 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 the gene product of apolipoprotein e allele epsilon 4 has decreased anti oxidant activity compared to alleles epsilon 2 and 3 [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267944 10643818 372673 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e may also protect from _amp_#x3b2; amyloid peptide toxicity by binding to amyloid _amp_#x3b2; and under certain circumstances acting as kinetic inhibitor of amyloid formation [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267945 10643818 372682 9434 4983 HMGB1 amphoterin amphoterin 0 1.0 this receptor can also be engaged by amphoterin and is physiologically involved in neurite outgrowth. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267946 10643818 372697 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 some cases of familial amyotrophic lateral sclerosis are characterized by mutations of copper_amp_#x2013;zinc superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267947 10643818 372699 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 this question arises particularly in view of the observation that superoxide dismutase activities in erythrocytes from patients may be reduced by 50% compared with healthy controls [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267948 10643818 372701 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase may act as a peroxidase [ 33 and 34 ] with mutated superoxide dismutase catalyzing substrate oxidation by hydrogen peroxide at a higher rate than wild type enzyme [ 35 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267949 10643818 372710 3544 1516 CAT catalase catalase 0 1.0 peroxidase and catalase activities are reduced in the substantia nigra caudate and putamen in parkinson's disease [ 43 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267950 10643818 372720 8759 4553 GPX1 cellular glutathione peroxidase cellular glutathione peroxidase 0 1.0 furthermore around 10% of cellular glutathione peroxidase are mitochondrial and there prevent oxidative damage by hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267951 10643818 372724 8278 4250 GGT1 glutamyl transpeptidase glutamyl transpeptidase 0 1.0 of the glutathione cycle is particularly important in the central nervous system because deficiency of enzymes associated with it glutathione synthetase _amp_#x3b3; glutamyl synthetase or _amp_#x3b3; glutamyl transpeptidase leads to defective brain function [ 49 and 50 ] in addition to acidosis and a tendency to hemolysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267952 10643818 372724 8857 4624 GSS glutathione synthetase glutathione synthetase 0 1.0 the regulatory role of the glutathione cycle is particularly important in the central nervous system because deficiency of enzymes associated with it glutathione synthetase _amp_#x3b3; glutamyl synthetase or _amp_#x3b3; glutamyl transpeptidase leads to defective brain function [ 49 and 50 ] in addition to acidosis and a tendency to hemolysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267953 10643818 372740 16737 15917 PLCB1 phospholipase c phospholipase c 0 1.0 pla 2 : phopholipase a 2 plc: phospholipase c dag: diacyl glycerol aa: arachidonic acid pkc: protein kinase c gpx: glutathione peroxidase nos: no synthetase ltp: long term potentiation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267954 10643818 372740 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 pla 2 : phopholipase a 2 plc: phospholipase c dag: diacyl glycerol aa: arachidonic acid pkc: protein kinase c gpx: glutathione peroxidase nos: no synthetase ltp: long term potentiation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267955 10643818 372743 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 maintenance dashed arrows of long term potentiation is mediated by protein kinase c which can be activated by calcium arachidonate or hydroxyl radical from the pathway to induction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267956 10643818 372755 8278 4250 GGT1 glutamyl transpeptidase glutamyl transpeptidase 0 1.0 glutathione is then transported and converted by membrane bound _amp_#x3b3; glutamyl transpeptidase followed by cleavage by membrane bound dipeptidase. _amp_#x3b3; glutamyl amino acids are transported into the cell and converted to glutamate via oxoproline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268278 10671549 373491 7568 3701 FHIT tumor suppressor protein tumor suppressor protein 0 1.0 tumor suppressor protein p53 and cell cycle inhibitor p21 accumulate as an early sign of s nitrosoglutathione mediated toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268279 10671549 373492 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 cytochrome c release from mitochondria and caspase 3 activation also occurred. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268280 10671549 373492 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c release from mitochondria and caspase 3 activation also occurred. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268281 10671549 373493 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cells transfected with either wild type wt or mutant g93a cu zn superoxide dismutase cu zn sod produced comparable amounts of nitrite/nitrate but showed different degree of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268282 10671549 373495 1576 990 BCL2 bcl 2 bcl 2 0 1.0 we linked decreased susceptibility of the wt cells to higher and more stable bcl 2 and decreased reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268283 10671549 373497 1576 990 BCL2 bcl 2 bcl 2 0 1.0 furthermore g93a cells showed a significant decrease of bcl 2 expression and as target of no derived radicals showed lower cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268285 10671549 373497 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 furthermore g93a cells showed a significant decrease of bcl 2 expression and as target of no derived radicals showed lower cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268286 10671549 373510 1576 990 BCL2 bcl 2 bcl 2 0 1.0 among these the protein product of bcl 2 protooncogene plays a pivotal role in apoptosis by regulating cytochrome c efflux from mitochondria which in turn activates cysteine proteases caspases ultimately leading to specific dna fragmentatio 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268287 10671549 373510 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 among these the protein product of bcl 2 protooncogene plays a pivotal role in apoptosis by regulating cytochrome c efflux from mitochondria which in turn activates cysteine proteases caspases ultimately leading to specific dna fragmentation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268288 10671549 373511 1576 990 BCL2 bcl 2 bcl 2 0 1.0 constitutive expression of high bcl 2 protein levels by transfection experiments has proven that bcl 2 or related family members can protect from no mediated apoptosis 15 16 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268289 10671549 373518 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the enzyme superoxide dismutase sod may play a fundamental role in modulating no toxicity since it acts as an antioxidant dismutating o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268290 10671549 373524 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the results obtained showed that gsno mediated apoptosis in these cells is associated with a canonical sequence of events including bcl 2 p53 and p21 modulation cytochrome c release in the cytosol and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268291 10671549 373524 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 he results obtained showed that gsno mediated apoptosis in these cells is associated with a canonical sequence of events including bcl 2 p53 and p21 modulation cytochrome c release in the cytosol and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268292 10671549 373524 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the results obtained showed that gsno mediated apoptosis in these cells is associated with a canonical sequence of events including bcl 2 p53 and p21 modulation cytochrome c release in the cytosol and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268293 10671549 373529 1576 990 BCL2 bcl 2 bcl 2 0 1.0 se inhibitor mixture dithiothreitol dtt sulfanilamide p aminobenzenesulfonamide phenylmethylsulfonyl fluoride n 1 naphthyl ethylenediamine dihydrochloride bathocuproinedisulfonic acid monoclonal anti bcl 2 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268294 10671549 373529 1576 990 BCL2 bcl 2 bcl 2 0 1.0 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268295 10671549 373529 9950 5472 IGFBP3 bp 53 bp53 0 1.0 amide p aminobenzenesulfonamide phenylmethylsulfonyl fluoride n 1 naphthyl ethylenediamine dihydrochloride bathocuproinedisulfonic acid monoclonal anti bcl 2 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268296 10671549 373529 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 obenzenesulfonamide phenylmethylsulfonyl fluoride n 1 naphthyl ethylenediamine dihydrochloride bathocuproinedisulfonic acid monoclonal anti bcl 2 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268297 10671549 373530 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 ac devd amc caspase 3 inhibitor i ac devd cho hoechst 33342 diethylamine nonoate nono and 3 [ _amp_#177; e ethyl 2' [ e hydroxyimino] 5 nitro 3 exenecarbamoyl]pyridine nor 4 were purchased from calbiochem. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268298 10671549 373531 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 anti cytochrome c monoclonal antibody clone 7h8.2c12 was from pharmingen san diego ca . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268299 10671549 373542 20997 11180 SOD2 mn sod mn sod 0 1.0 transfected cells had the same antioxidant pattern such as of mn sod as sh sy5y cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268300 10671549 373574 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytosolic cytochrome c determination cells detached and attached were washed with pbs and collected by centrifugation at 700 _amp_#215; g for 5 min at 4 degreec. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268301 10671549 373578 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 purified cytochrome c from horse heart was used as standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268302 10671549 373579 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 purified mouse anti cytochrome c monoclonal antibody was used as primary antibody 1:5000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268303 10671549 373581 1576 990 BCL2 bcl 2 bcl 2 0 1.0 p53 p21 and bcl 2 proteins detection cell pellet was resuspended in lysis buffer containing 10 m m tris/hcl ph 7.4 5 m m edta 150 m m nacl 0.5% octyphenoxy polyethoxyethanol igepal ca 630 sigma and protease inhibitors 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268304 10671549 373583 1576 990 BCL2 bcl 2 bcl 2 0 1.0 sates were then centrifuged at 14 000 _amp_#215; g for 15 min at 4 degreec and supernatants were removed and stored at 80 degreec. 50 microg of proteins were loaded on a 10 for p53 or 12% for p21 and bcl 2 polyacrylamide gel. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268305 10671549 373584 1576 990 BCL2 bcl 2 bcl 2 0 1.0 monoclonal anti bcl 2 1:5000 monoclonal anti p53 1:5000 or polyclonal anti p21 1:500 was used as primary antibodies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268306 10671549 373587 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activation cells attached and detached were washed and collected by centrifugation at 700 _amp_#215; g for 5 min at 4 degreec. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268307 10671549 373590 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 supernatants were used for caspase 3 assay in lysis buffer containing the specific substrate ac devd amc 12 micro m at 30 degreec. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268308 10671549 373592 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 specific activity was demonstrated by the use of the caspase 3 inhibitor i ac devd cho that completely impedes the development of fluorescence due to the cleaved product. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268309 10671549 373593 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cu zn superoxide dismutase activity cells attached and detached were washed and collected by centrifugation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268310 10671549 373598 20997 11180 SOD2 mn sod mn sod 0 1.0 under these conditions the activity of mn sod is almost fully inhibited 33 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268312 10671549 373603 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 cytochrome c oxidase activity cells attached and detached were washed and collected by centrifugation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268314 10671549 373605 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 lysates were used for cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268315 10671549 373606 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the activity was measured spectrophotometrically monitoring the oxidation of cytochrome c horse heart which had previously been reduced by treatment with excess ascorbate followed by passage on sephadex g 25 resin amersham pharmacia biotech . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268316 10671549 373608 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 activity was expressed as micromoles of cytochrome c oxidized per min mg protein using an extinction coefficient of 27.6 m m cm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268317 10671549 373648 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 the reaction between gsh and no has been suggested to be catalyzed by ceruloplasmin a multicopper oxidase involved in iron metabolism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268318 10671549 373653 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 it has been demonstrated that p21 cleavage could be reproduced in extracts prepared from irradiated cells or by recombinant caspase 3 suggesting that a caspase like activity is responsible for this cleavage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268319 10671549 373656 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 nuclear apoptosis is preceded by the disruption of the mitochondrial transmembrane potential which in turn can facilitate the release of pro apoptotic proteins such as cytochrome c through the opening of the mitochondrial permeability transition pore 54 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268320 10671549 373658 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in a previous report regarding another cell model system undergoing apoptosis 56 we demonstrated that cytochrome c release from mitochondria followed oxidative stress consequent to glutathione depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268321 10671549 373659 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 furthermore this phenomenon could be observed in healthy cells as well suggesting that cytochrome c release is part of a more general mechanism related to redox unbalance. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268322 10671549 373660 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in contrast to this hypothesis in the present report gsno treatment led to cytochrome c release with the maintenance of high intracellular glutathione concentration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268323 10671549 373662 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 moreover in the g93a cells a small level of released cytochrome c was also detected in the untreated cells indicating that these cells in culture may spontaneously die by apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268324 10671549 373663 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 taken together these results point to a mechanism for cytochrome c release different from that related to glutathione depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268326 10671549 373664 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 a specific marker of no toxicity was the decrease of cytochrome c oxidase activity which paralleled the extent of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268327 10671549 373666 1576 990 BCL2 bcl 2 bcl 2 0 1.0 an alternative model for protein export from mitochondria depends on bax and/or bid two members of the bcl 2 protein family 57 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268328 10671549 373667 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 it involves the translocation of bid or bax from cytosol to mitochondria where they may possibly form a pore as shown for the related protein bcl xl 58 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268329 10671549 373668 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in our experiments bcl 2 was down regulated by the gsno treatment in sh sy5y cells whereas the resistance of wt cells to apoptosis was associated with a higher level of this protein in the treated cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268330 10671549 373670 1576 990 BCL2 bcl 2 bcl 2 0 1.0 since they were the most prone to no induced apoptosis we propose a causative role for bcl 2 in the increased susceptibility of g93a cells to apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268331 10671549 373671 1576 990 BCL2 bcl 2 bcl 2 0 1.0 it has been suggested that the antiapoptotic effects of bcl 2 be at least in part due to its antioxidant activity 59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268332 10671549 373672 1576 990 BCL2 bcl 2 bcl 2 0 1.0 t known it is established that the cytosolic steady state of reactive oxygen species which are potentially threatening species and modulators of physiological signal transduction 60 is increased when bcl 2 is down regulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268333 10671549 373687 1576 990 BCL2 bcl 2 bcl 2 0 1.0 a vicious circle including down regulation of bcl 2 and deviating redox activity of copper in the g93a mutant may be the amplification factor leading to ros unbalance in g93a cells and may explain how and why an als mutant cause a pro apoptotic respon 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268334 10671549 373705 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 a cytochrome c released in the cytosol was detected by western blotting using a monoclonal antibody as described under "experimental procedures." 50 microg of cytosolic protein were loaded on each lane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268335 10671549 373706 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 lane 1 sh sy5y cells; lane 2 gsno treated; lane 3 g93a cells; lane 4 gsno treated; lane 5 wt cells; lane 6 gsno treated; lane 7 purified cytochrome c. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268336 10671549 373707 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 b caspase 3 activity was measured fluorometrically with ac devd amc as substrate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268337 10671549 373709 9600 5173 HRAS p21 protein p21 protein 0 1.0 immunoreactive p53 protein c and immunoreactive p21 protein d were measured by western blotting using monoclonal antibody as detailed under "experimental procedures." 50 microg protein of cell extracts was applied to each lane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268338 10671549 373712 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 content of sh sy5y cells and effects on it by cu zn sod and gsno treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268339 10671549 373713 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 immunoreactive protein was detected by western blotting using a monoclonal antibody as described under "experimental procedures." 50 microg protein of cell extracts was loaded on each lane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268341 10671549 373733 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 b activity of cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268343 10671549 373734 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 spectrophotometric determination of cytochrome c oxidase activity was performed as described under "experimental procedures." 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268344 10671549 373742 1576 990 BCL2 bcl 2 bcl2 0 1.0 apoptotic markers: cytochrome c release caspase activation p53 accumulation p21 increase and bcl2 down regulation to examine the sequence of events occurring upon gsno toxicity we measured some of the molecular markers of apoptotic cell death at 48 h from the apoptogenic stimulus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268345 10671549 373742 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 apoptotic markers: cytochrome c release caspase activation p53 accumulation p21 increase and bcl2 down regulation to examine the sequence of events occurring upon gsno toxicity we measured some of the molecular markers of apoptotic 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268346 10671549 373743 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytosolic extracts were prepared under conditions that keep mitochondria intact and cytosolic cytochrome c protein levels were measured by immunoblot analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268347 10671549 373744 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the cytosol from untreated sh sy5y and wt cells contained no detectable amounts of cytochrome c whereas untreated g93a cells had a small level of released cytochrome c probably as result of spontaneous apoptotic death fig 3 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268348 10671549 373745 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytosolic cytochrome c accumulated after gsno treatment; the release was highest for g93a cells and almost at the limit of detection for wt cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268349 10671549 373746 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 proteolytic activity associated to caspases was measured by testing the cytosolic extracts for their ability to cleave the fluorimetric substrate ac devd amc which is specific for caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268350 10671549 373747 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activation is important in the cascade of proteolytic events of apoptosis in that it is considered one of the points of no return in the process leading to cell destruction 40 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268351 10671549 373748 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activation followed the same trend as cytochrome c release with higher activity in the cytosolic extracts of g93a cells than in sh sy5y and wt cells fig 3 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268352 10671549 373748 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 caspase 3 activation followed the same trend as cytochrome c release with higher activity in the cytosolic extracts of g93a cells than in sh sy5y and wt cells fig 3 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268353 10671549 373751 2167 13716 C4orf6 expressed in neuroblastoma expressed in neuroblastoma 0 1.0 fig. 3 c shows that the p53 protein was stably expressed in neuroblastoma cells to a varying extent; in particular wt cells showed a lower p53 protein level with respect to sh sy5y cells and g93a cells which showed the higher level. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268354 10671549 373761 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 protein modulation is responsible for cell survival or suicide; constitutive expression of high bcl 2 protein levels by transfection experiments has proven that bcl 2 or related family members can protect cells from no mediated apoptosis 44 45 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268355 10671549 373762 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in our experiments as evidenced by western blot analysis untreated sh sy5y and wt cells express high levels of bcl 2 protein whereas g93a cells show a much lower content fig 4 . 48 h of gsno treatment decreased bcl 2 expression although to a different extent; in particular bcl 2 content of g93a cells was at the lim 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268356 10671549 373762 1576 990 BCL2 bcl 2 bcl 2 0 1.0 protein whereas g93a cells show a much lower content fig 4 . 48 h of gsno treatment decreased bcl 2 expression although to a different extent; in particular bcl 2 content of g93a cells was at the limit of detection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268358 10671549 373777 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 among the above mentioned molecular target of no toxicity the hemoprotein cytochrome c oxidase appears to be the only one strongly affected by gsno insult and protected by native cu zn sod fig 7 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268359 10671549 373783 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 nono diethylamine nonoate; nor 4 3 [ _amp_#177; e ethyl 2' [ e hydroxyimino] 5 nitro 3 exenecarbamo yl]pyridine; dcf da 2' 7' dichlorodihydrofluorescein diacetate; ac devd amc ac asp glu val asp amc caspase 3 substrate ii fluorogenic; ac devd cho ac asp glu val asp cho caspase 3 inhibitor i; ros reactive oxygen species; fals familial amyotrophic lateral sclerosis; pipes piperazine n n ' bis[2 ethanesulfon 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268360 10671549 373783 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 substrate ii fluorogenic; ac devd cho ac asp glu val asp cho caspase 3 inhibitor i; ros reactive oxygen species; fals familial amyotrophic lateral sclerosis; pipes piperazine n n ' bis[2 ethanesulfonic acid]; chaps 3 [cholamindopropyl dimethylammonio] 1 propanesulfonate 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268361 10671549 373783 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the abbreviations used are: no nitric oxide; wt sh sy5y transfected with wild type cu zn sod; g93a sh sy5y transfected with mutant g93a cu zn sod; cu zn sod copper zinc superoxide dismutase; gsno s nitrosoglutathione; nono diethylamine nonoate; nor 4 3 [ _amp_#177; e ethyl 2' [ e hydroxyimino] 5 nitro 3 exenecarbamo yl]pyridine; dcf da 2' 7' dichlorodihydrofluorescein diacetate; ac devd 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268362 10671549 373784 1576 990 BCL2 bcl 2 bcl 2 0 1.0 cytochrome c group|nitroso compounds|proto oncogene proteins c bcl 2|tumor suppressor protein p53|nitric oxide|s nitrosoglutathione|glutathione|superoxide dismutase|caspases|oncogene protein p2| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268363 10671549 373784 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c group|nitroso compounds|proto oncogene proteins c bcl 2|tumor suppressor protein p53|nitric oxide|s nitrosoglutathione|glutathione|superoxide dismutase|caspases|oncogene protein p2| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264089 10742195 364686 17649 9655 PTPN3 tyrosine phosphatase tyrosine phosphatase 0 1.0 enzymes: caspase 3 critical for initiating apoptosis was inhibited by zn 2+ with an ic 50 _amp_#x3c; 10 nm 1:1 stoichiometry ; and the ic 50 for fructose 1 6 diphosphatase aldehyde dehydrogenase and tyrosine phosphatase were 100_amp_#x2013;200 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264090 10742195 364686 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 vallee_amp_#x2019;s group [ 3 ] has now shown that nanomolar levels of zn 2+ modulated by mt regulate the activities of metabolically critical enzymes: caspase 3 critical for initiating apoptosis was inhibited by zn 2+ with an ic 50 _amp_#x3c; 10 nm 1:1 stoichiometry ; and the ic 50 for fructose 1 6 diphosphatase aldehyde dehydrogenase and tyrosine phosphatas 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264091 10742195 364686 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 s of metabolically critical enzymes: caspase 3 critical for initiating apoptosis was inhibited by zn 2+ with an ic 50 _amp_#x3c; 10 nm 1:1 stoichiometry ; and the ic 50 for fructose 1 6 diphosphatase aldehyde dehydrogenase and tyrosine phosphatase were 100_amp_#x2013;200 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264092 10742195 364693 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the most important recent contribution to understanding basic neuronal cu 2+ metabolism has been the elaboration of the copper chaperone of superoxide dismutase ccs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264093 10742195 364695 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 recently ccs was reported to play an essential role in loading cu 2+ onto superoxide dismutase sod 1 under conditions of low cytosolic cu 2+ [ 8 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264094 10742195 364701 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh _amp_#x2022; [ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264095 10742195 364701 23482 12442 TYR tyrosinase tyrosinase 0 1.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264097 10742195 364701 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh _amp_#x2022; [ 10 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264098 10742195 364733 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 familial ad linked mutations of amyloid precursor protein app presenilin 1 and presenilin 2 increase both cerebral a_amp_#x3b2; burden and a_amp_#x3b2;1 42 production underscoring the role that a_amp_#x3b2; metabolism plays in ad pathogenesis see [ 10 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264099 10742195 364733 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 familial ad linked mutations of amyloid precursor protein app presenilin 1 and presenilin 2 increase both cerebral a_amp_#x3b2; burden and a_amp_#x3b2;1 42 production underscoring the role that a_amp_#x3b2; metabolism plays in ad pathogenesis see [ 10 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264101 10742195 364742 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 we have also reported [ 25 ] that apolipoprotein e apoe modulates the precipitation of a_amp_#x3b2; by cu 2+ and zn 2+ which is important because apoe isoforms segregate with the genetic risk for ad; inheritance of the apoe4 isoform carries the great 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264102 10742195 364792 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 in familial pd a mutation of the alpha synuclein gene has been identified which is important because alpha synuclein is a component of lewy bodies which typify the neuropathology. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264103 10742195 364793 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 one recent report [ 49 ] proposes abnormal interaction of alpha synuclein with cu 2+ in the formation of lewy bodies but the concentrations of cu 2+ used in the study were far in excess of what is likely in the tissue. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264104 10742195 364795 7975 3951 FXN frataxin frataxin 0 1.0 friedrich_amp_#x2019;s ataxia fa is a disease characterized by neurodegeneration and cardiomyopathy and is caused by a mutation of frataxin a mitochondrial protein involved in iron homeostasis and respiratory function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264105 10742195 364796 7975 3951 FXN frataxin frataxin 0 1.0 frataxin has recently been shown to export non heme bound iron from the mitochondria hence the mutation appears to cause a loss of function that raises iron levels in the mitochondria [ 50 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 261647 10899935 360029 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 calcineurin activity is regulated both by redox compounds and by mutant familial amyotrophic lateral sclerosis superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 261648 10899935 360033 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 evidence for the existence of a redox regulation of this enzyme has been also obtained by overexpression of wild type antioxidant cu zn superoxide dismutase sod1 that promotes cn activity and protects it from oxidative inactivation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262352 10930589 361587 3544 1516 CAT catalase catalase 0 1.0 further cells incubated with vitamin c catalase or the flavinoid quercetin significantly reduced ros in all groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262353 10930589 361588 3544 1516 CAT catalase catalase 0 1.0 the catalase inhibitor 3 amino 1 2 4 triazole resulted in a ten fold increase of ros in all groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262354 10930589 361589 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 neither nitroarginine a nitric oxide synthase inhibitor or vitamin e altered the ros levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262355 10930589 361596 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 about 2% of als cases are associated with missense mutations in the gene for cytosolic cu zn superoxide dismutase sod1 cuznsod [ 1 and 2 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262356 10930589 361621 3544 1516 CAT catalase catalase 0 1.0 lactate dehydrogenase ldh activity was used to calculate the specific fluorescence. nitroarginine aldrich catalase boehringer mannheim and other chemicals sigma studied were added 15 min before loading of the cells with c dcdhf da am table 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262357 10930589 361665 3544 1516 CAT catalase catalase 0 1.0 sod1 is a major source of h 2 o 2 in cells [ 20 ] and catalase and glutathione peroxidase are the primary enzymes responsible for decomposition of h 2 o 2 [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262358 10930589 361668 3544 1516 CAT catalase catalase 0 1.0 catalase reduced the c dcf fluorescence in resting or menadione stimulated cells in all three groups of cells tested. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262359 10930589 361669 3544 1516 CAT catalase catalase 0 1.0 however the reduction was more pronounced in menadione stimulated cells. 3 amino 1 2 4 triazole 3 at an inhibitor of catalase [ 22 and 23 ] increased the c dcf fluorescence of all three types of cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262360 10930589 361674 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 quercetin a bio flavonoid molecule with antioxidant properties [ 26 ] showed effects similar to ascorbic acid. nitroarginine an inhibitor of nitric oxide synthase nos [ 27 ] did not affect the c dcf fluorescence in resting cells of any group. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262361 10930589 361702 3544 1516 CAT catalase catalase 0 1.0 reduction of c dcf fluorescence by catalase and other antioxidants vitamin c and the flavinoid quercetin but not inhibitor of nos supports the conclusion that c dcdhf was oxidized by h 2 o 2 table 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257639 11050436 352940 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the transformation of this superoxide into hydrogen peroxide and under certain conditions then into hydroxyl radicals is important in diseases where respiratory chain function is abnormal or where superoxide dismutase function is altered as in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257640 11050436 352949 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 ubiquinol cytochrome c oxidoreductase is responsible for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the rieske iron sulphur protein and cytochrome c 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257641 11050436 352949 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 complex iii ubiquinol cytochrome c oxidoreductase is responsible for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the riesk 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257642 11050436 352949 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ble for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the rieske iron sulphur protein and cytochrome c 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257643 11050436 352949 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257644 11050436 352949 5283 2579 CYC1 cytochrome c-1 cytochrome c 1 0 1.0 ble for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the rieske iron sulphur protein and cytochrome c 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257645 11050436 352951 23742 30862 UQCR ubiquinol-cytochrome c reductase ubiquinol cytochrome c reductase 0 1.0 the q cycle mechanism proposed for the operation of the ubiquinol cytochrome c reductase operates as follows. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257647 11050436 352952 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 iquinol donates one electron to the rieske iron sulphur protein a myxathiazol inhibitor site generating a semiquinone in proximity to the outer face of the inner membrane which then reduces the first cytochrome b haem b l . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257648 11050436 352953 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 the second cytochrome b haem b h situated closer to the matrix side of the membrane accepts an electron from the first haem and reduces ubiquinone to form ubisemiquinone and subsequently with passage of another electron to 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257649 11050436 352955 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 blocking electron passage out of cytochrome b h prevents the semiquinone at the q o site from donating its electron and so inhibition with antimycin produces a >tenfold increase in superoxide production from complex iii fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257650 11050436 352982 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the mutations seen in cuznsod in als patients are odd in that they do not destroy superoxide dismutase activity even though they sometimes affect enzyme stability [ 5 6 and 29 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257651 11050436 352997 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in transgenic mice bearing cuznsod mutations known to cause als in humans the protective bcl 2 protein when overexpressed transgenically can protect against neuronal death brought about by als mutations in experimental animals [ 37 and 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257652 11050436 352998 4770 2244 COQ7 clk 1 clk 1 0 1.0 one intriguing example of the link between the ros generating function of the respiratory chain and life span is that provided by the clk 1 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257653 11050436 352999 4770 2244 COQ7 clk 1 clk 1 0 1.0 the clk 1 protein is responsible for one of the final steps in ubiquinone synthesis so that defective activity results in low endogenous synthesis of ubiquinone for the mitochondrial respiratory chain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257654 11050436 353008 3544 1516 CAT catalase catalase 0 1.0 thus transgenic drosophila with increased expression of cuznsod did not show increased life span unless accompanied by increased expression of catalase to remove the hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257655 11050436 353010 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in mammals increased life span by transgenic modulation of levels of superoxide dismutase has not been observed [ 42 and 43 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257656 11050436 353035 4770 2244 COQ7 clk 1 clk 1 0 1.0 interference with ubiquinone synthesis in some organisms as demonstrated by the c. elegans clk 1 mutants would be expected to cause a reduction in ubisemiquinone levels a reduction in mitochondrial superoxide production and a subsequent deceleration of shortening and increase in life span[ 40 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257657 11050436 353040 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 oxygen is initially converted to superoxide o 2 _amp_#x2212; either by xanthine oxidase respiratory chain complexes i and iii or other cellular enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257658 11050436 353041 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the superoxide is converted to hydrogen peroxide h 2 o 2 by superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257659 11050436 353042 3544 1516 CAT catalase catalase 0 1.0 hydrogen peroxide is converted to water by either catalase or glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257660 11050436 353056 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 this then promptly reduces the b l haem of cytochrome b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257661 11050436 353057 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 the b h haem of cytochrome b then reduces ubiquinone q to produce another ubisemiquinone. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257663 11050436 353063 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 complex i nadh ubiquinone oxidoreductase complex iii ubiquinol cytochrome c oxidoreductase complex iv cytochrome c oxidase and complex v h + translocating atp synthetase are shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253643 11223912 347837 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 mitochondrial uptake of ca 2+ has recently been found to play an important role in glutamate induced neurotoxicity gnt as well as in the activation of ca 2+ dependent molecules such as calmodulin and neuronal nitric oxide synthase nnos in the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253645 11223912 347841 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mitochondrial uncouplers markedly blocked acute excitotoxicity and membrane permeable superoxide dismutase mimics attenuated acute excitotoxicity induced by glutamate and nmda but not by alpha amino 3 hydroxy 5 methylisoxazole 4 propionate ampa or kainate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253646 11223912 347847 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 phenylhydrazone|kainic acid|2 4 dinitrophenol|glutamic acid|calmidazolium|cyclosporine|n methylaspartate|calcium|dizocilpine maleate|alpha amino 3 hydroxy 5 methyl 4 isoxazolepropionic acid|dibucaine|nitric oxide synthase|nitric oxide synthase type i|nos1 protein rat|superoxide dismutase|calcium calmodulin dependent protein kinase type 2|calcium calmodulin dependent protein kinases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253647 11223912 347847 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 |nitric oxide synthase type i|nos1 protein rat|superoxide dismutase|calcium calmodulin dependent protein kinase type 2|calcium calmodulin dependent protein kinases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253681 11228742 347969 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 activation of nf kappa b by reactive oxygen intermediates in the nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253682 11228742 347970 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nuclear factor kappa b nf kappa b is a transcription factor crucially involved in glial and neuronal function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253683 11228742 347970 14352 7794 NFKB1 nuclear factor kappa-b nuclear factor kappa b 0 1.0 nuclear factor kappa b nf kappa b is a transcription factor crucially involved in glial and neuronal function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253684 11228742 347971 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nf kappa b is ubiquitously distributed within the nervous system and its inducible activity can be discerned from constitutive activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253685 11228742 347972 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 prototypic inducible nf kappa b in the nervous system is composed of the dna binding subunits p50 and p65 complexed with an inhibitory i kappa b alpha molecule. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253686 11228742 347973 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 a number of signals from the cell surface can lead to rapid activation of nk kappa b thus releasing the inhibition by i kappa b. this activates translocation of nf kappa b to the nucleus where it binds to kappa b motifs of target genes and activates transcription. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253687 11228742 347974 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 previous findings have identified reactive oxygen intermediates roi as a common denominator of nf kappa b activating signals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253688 11228742 347975 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 more specifically hydrogen peroxide h2o2 might be used as second messenger in the nf kappa b system despite its cytotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253689 11228742 347976 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 analysis of pathways leading to nf kappa b activation in the nervous system has identified a number of roi dependent pathways such as cytokine and neurotrophin mediated activation glutamatergic signal transduction and various diseases with crucial roi involvement e.g. alzheimer's disease parkinson's disease experimental autoimmune encephalomyelitis multiple 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253690 11228742 347976 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 analysis of pathways leading to nf kappa b activation in the nervous system has identified a number of roi dependent pathways such as cytokine and neurotrophin mediated activation glutamatergic signal transduction and various diseases with cr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253692 11228742 347977 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 a number of nf kappa b specific target genes contribute to the production of roi or are involved in detoxification of rois. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253693 11228742 347978 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 in this review possible mechanisms and regulatory pathways of roi mediated nf kappa b activation are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253694 11228742 347980 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nf kappa b|oxidants|reactive oxygen species| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 249610 11328670 340451 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 invited review: manganese superoxide dismutase in disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 249612 11328670 340452 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 manganese superoxide dismutase mnsod is essential for life as dramatically illustrated by the neonatal lethality of mice that are deficient in mnsod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242842 11513882 330566 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 approximately 10% of all familial cases of amyotrophic lateral sclerosis fals are linked to mutations in the sod1 gene which encodes the copper/zinc superoxide dismutase cuznsod . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242843 11513882 330573 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the sod1 gene which encodes the enzyme copper/zinc superoxide dismutase are associated with familial amyotrophic lateral sclerosis fals a fatal neurodegenerative disorder affecting spinal cord and brain motor neurons [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242844 11513882 330582 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in order to address our hypothesis that calcineurin is one of the targets we investigated the ability of four different copper/zinc superoxide dismutase cuznsod proteins three mutant forms and the wild type wt enzyme to protect calcineurin from oxidative inactivation in vitro. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242845 11513882 330616 17566 9577 PSPH phosphoserine phosphatase phosphoserine phosphatase 0 1.0 phosphoserine phosphatase assay was performed as described previously [ 5 and 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242846 11513882 330617 3430 1442 CALM1 calmodulin 1 calmodulin 1 0 1.0 in brief 40 _amp_#x3bc;l recombinant or partially purified calcineurin was mixed with test buffer 40 mm tris_amp_#x2013;hcl ph 8 0.1 m kcl 0.4 mg/ml bsa 0.67 mm dtt 0.67 _amp_#x3bc;m calmodulin 1 _amp_#x3bc;m fkbp and 0.5 _amp_#x3bc;m okadaic acid for inhibition of phophotase a1 and a2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242847 11513882 330637 17566 9577 PSPH phosphoserine phosphatase phosphoserine phosphatase 0 1.0 incubation of calcineurin for 20 min at 30_amp_#xb0;c under aerobic conditions in the presence of calcium led to a rapid loss of phosphoserine phosphatase activity to 5_amp_#x2013;8% of baseline activity fig 2a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242848 11513882 330662 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 therefore calcineurin would be an ideal candidate for a proposed influence of superoxide dismutase mutations on signal transduction pathways leading to a mutant steady state finally resulting in neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242849 11513882 330680 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 since the calcineurin inactivation is dependent on the presence of calcium motoneurons which are subject to glutamate receptor mediated ca 2+ influxes may be especially at risk for calcineurin inactivation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245377 11562447 333613 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 t. marmorata choline acetyltransferase chat was impaired to the same extent as bovine brain chat. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245379 11562447 333617 551 399 ALB serum albumin serum albumin 0 1.0 peroxynitrite dependent nitrations were impaired when synaptosomes were pretreated with thioreductants glutathione n acetyl cysteine dithiothreitol or antioxidants uric acid melatonin bovine serum albumin desferrioxamine . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245380 11562447 333625 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 no can then combine with o 2 which is formed at sites of free radical generation beckman et al. 1990 ; pryor and squadrito 1995 such as mitochondria or through enzyme activity e.g. monoamine oxidase xanthine oxidase to form peroxynitrite onoo . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245381 11562447 333628 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 clinical studies showed that tyrosine hydroxylase the first and rate limiting enzyme in catecholamine biosynthesis that is selectively affected in parkinson's disease is nitrated suggesting that the cause of the pathology may be an onoo overload ara 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245382 11562447 333634 207 15814 ACSS2 acetyl-coa synthetase acetyl coa synthetase 0 1.0 the first is acetate which is converted into acetyl coa by acetyl coa synthetase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245383 11562447 333636 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 synthesis of ach from choline and acetyl coa is performed by choline acetyltransferase chat a cytosolic enzyme wu and hersh 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245384 11562447 333639 21633 11506 SYP synaptophysin synaptophysin 0 1.0 onoo dependent changes in several presynaptic proteins chat synaptophysin vamp/synaptobrevin actin tubulin present in t. marmorata synaptosomes and synaptic vesicles were examined and showed examples of nitration of tyrosines and covalent oligomerization. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245385 11562447 333653 21633 11506 SYP synaptophysin synaptophysin 0 1.0 polyclonal antibody against t. marmorata synaptophysin and monoclonal antibodies against vamp/synaptobrevin and tubulin were developed and characterized in the laboratory by dr. nicolas morel laboratoire de neurobiologie cellulaire et moleculaire cnrs gi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245387 11562447 333690 551 399 ALB serum albumin serum albumin 0 1.0 the reaction was started by the addition of the substrates [1 c]acetyl coa 14 microm and choline 2.5 mm in the presence of 250 microm eserine 10 microm bovine serum albumin bsa and 75 mm nacl and stopped after 1 h by dilution with cold sodium phosphate buffer. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245388 11562447 333724 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 1 but neither was inhibited by h 2 o 2 up to 1 mm this study or by similar concentrations of the no donors s nitroso n acetylpenicillamine and sodium nitroprusside morot gaudry talarmain et al. 1997 alpha synuclein by souza et al 2000 or proteolysis may occur requiring further studies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245389 11562447 333726 3455 24190 CAMK2N1 calcium/calmodulin-dependent protein kinase ii calcium/calmodulin dependent protein kinase ii 0 1.0 olled proteolysis and subcellular localization cytosolic versus membrane bound isoforms and the presence of thiol agents can all modulate the activity of the enzyme posttranslationally oda 1999 alpha calcium/calmodulin dependent protein kinase ii bruce and hersh 1989 ; dobransky et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245390 11562447 333737 22692 12008 TPH1 tryptophan hydroxylase tryptophan hydroxylase 0 1.0 inactivation by onoo of the enzyme activity by sulfhydryl oxidation was recently shown to be essential for tryptophan hydroxylase another neurotransmitter synthesis enzyme kuhn and geddes 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245391 11562447 333747 21633 11506 SYP synaptophysin synaptophysin 0 1.0 moreover we were able to define affected residues by taking advantage of a specific antibody raised against a well conserved sequence gyqpnygq q of the t. marmorata synaptophysin cowan et al. 1990 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245392 11562447 333751 21633 11506 SYP synaptophysin synaptophysin 0 1.0 can affect numerous proteins at the presynaptic side of a neuromuscular junction in several subcellular compartments; these include choline transporter at the plasma membrane chat in the cytosol and synaptophysin tubulin or actin at the periphery of synaptic vesicles. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245393 11562447 333785 23858 12642 VAMP1 synaptobrevin 1 synaptobrevin 1 0 1.0 arrows show actin 1/200 c tubulin 1/1000 d synaptophysin 1/2500 e and vamp/synaptobrevin 1/25 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245394 11562447 333785 21633 11506 SYP synaptophysin synaptophysin 0 1.0 arrows show actin 1/200 c tubulin 1/1000 d synaptophysin 1/2500 e and vamp/synaptobrevin 1/25 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245395 11562447 333793 8885 20374 GSX1 gsh 1 gsh 1 0 1.0 concentration of the drugs were as follows: 5 mm gsh 1.25 mm nac 1 mm uric acid 1 mm bsa 1 mm dtt 200 microm desferrioxamine deferriox and 1 mm melatonin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245396 11562447 333799 8885 20374 GSX1 gsh 1 gsh 1 0 1.0 concentrations of protectors were for the high affinity choline uptake protection assay a : 5 mm gsh 1 mm nac 1 mm dtt 0.5 mm uric acid 1 mm bsa 200 microm desferrioxamine desfer. 1 mm melatonin melat. ; and for chat activity protection assay b : 5 mm gsh 5 mm nac 1 mm dtt 1 mm uric acid 1 mm bsa 200 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245397 11562447 333844 21633 11506 SYP synaptophysin synaptophysin 0 1.0 synaptophysin an integral vesicular 38 kda glycoprotein was detected in the controls fig 5 e as a doublet using an antibody directed against the c terminal epitope gyqpnygq q cowan et al. 1990 ; n morel personal c 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245398 11562447 333853 22692 12008 TPH1 tryptophan hydroxylase tryptophan hydroxylase 0 1.0 as shown for tryptophan hydroxylase kuhn and geddes 1999 protection against onoo induced tyrosine nitrations may prevent the loss of enzymatic activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245399 11562447 333855 8885 20374 GSX1 gsh 1 gsh 1 0 1.0 synaptosomes were pretreated with the following thioreductants: 5 mm glutathione gsh 1.25 mm n acetylcysteine nac and 1 mm dithiothreitol dtt ; and with the following antioxidants: 1 mm uric acid 1 mm melatonin 0.2 mm desferrioxamine and 1 mm bsa for 30 min before the addition of 1 mm 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245400 11562447 333868 21633 11506 SYP synaptophysin synaptophysin 0 1.0 dr. pierre potier in whose laboratories this work was performed for continuous support; dr. nicolas morel for help on immunological studies and the kind gift of antibodies against vamp/synaptobrevin synaptophysin and tubulin; dr. fran_amp_ccedil;ois marie meunier for sequence alignments; dr. seana o'regan for expertise in choline uptake mechanisms and critical reading; and dr. michael spedding and dr. esther 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245402 11562447 333874 551 399 ALB serum albumin serum albumin 0 1.0 trite; ach acetylcholine; sin 1 3 morpholinosydnonimine; coa coenzyme a; chat choline acetyltransferase; vamp/synaptobrevin vesicular associated membrane protein; tca trichloroacetic acid; bsa bovine serum albumin; page polyacrylamide gel electrophoresis; ecl enhanced chemiluminescence; gsh glutathione; nac n acetylcysteine; dtt dithiothreitol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245403 11562447 333874 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 onoo peroxynitrite; ach acetylcholine; sin 1 3 morpholinosydnonimine; coa coenzyme a; chat choline acetyltransferase; vamp/synaptobrevin vesicular associated membrane protein; tca trichloroacetic acid; bsa bovine serum albumin; page polyacrylamide gel electrophoresis; ecl enhanced chemiluminescence; gsh glutathione 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245404 11562447 333875 3520 16014 CASD1 o-acetyltransferase o acetyltransferase 0 1.0 acetates|antioxidants|carbon radioisotopes|nitrates|oxidants|reducing agents|molsidomine|peroxynitric acid|3 morpholino sydnonimine|3 nitrotyrosine|acetylcholine|tyrosine|choline|uric acid|choline o acetyltransferase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238968 11679167 325597 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 the importance of this protective mechanism is illustrated by tdh3p a glyceraldehyde 3 phosphate dehydrogenase isoform. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238969 11679167 325602 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 methionine sulfoxide reductase is able to repair mildly oxidised proteins by reducing methionine sulfoxide to methionine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238970 11679167 325607 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 it was recently shown that hydrogen peroxide induced protein carbonylation is specific and glyceraldehyde 3 phosphate dehydrogenase and mitochondrial enzymes are the major targets inactivated cabiscol et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238971 11679167 325608 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 the inactivation of glyceraldehyde 3 phosphate dehydrogenase may contribute to cellular protection as it increases the levels of glucose 6 phosphate to be used in the pentose phosphate pathway in order to increase the production of nadph see section 3.4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238972 11679167 325616 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 in s. cerevisiae several components of the ubiquitin 26s proteasome pathway and vacuolar proteases are induced by hydrogen peroxide godon et al. 1998 ; lee et al. 1999 which is consistent with the involvement of these proteolytic pathways in the degrad 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238973 11679167 325634 8885 20374 GSX1 gsh 1 gsh1 0 1.0 the disruption of gsh1 gene encoding the rate limiting enzyme of glutathione biosynthesis increases hydrogen peroxide sensitivity but also leads to a high frequency of petite respiration deficient cell generation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238974 11679167 325635 8885 20374 GSX1 gsh 1 gsh1 0 1.0 the function of glutathione in the protection of the mtdna is independent of its role in oxidative stress resistance as suppressors of the gsh1 mutation that decreased the rate of generation of petites did not increase hydrogen peroxide resistance of gsh 1_amp_#x394; cells lee et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238975 11679167 325636 43 34 ABCA4 atp binding cassette transporter atp binding cassette transporter 0 1.0 atm1p an atp binding cassette transporter that controls iron homeostasis within the yeast mitochondria is also important for mtdna integrity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238976 11679167 325644 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 the toxicity of lipid hydroperoxides has been associated to a decrease of coenzyme q and glutathione levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238977 11679167 325645 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 coenzyme q as well as vitamin e protect cells by reducing lipid peroxyl radicals and therefore by inhibiting the propagation of lipid peroxidation do et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238979 11679167 325647 21992 19737 TENC1 putative protein tyrosine phosphatase putative protein tyrosine phosphatase 0 1.0 it was recently shown that the inhibition of yeast growth by linoleic acid hydroperoxide requires a putative protein tyrosine phosphatase oca1p of unknown function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238980 11679167 325672 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the association of heat shock and oxidative stress is further supported by the data revealing that the superoxide dismutase genes are upregulated by heat shock costa et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238981 11679167 325673 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in agreement s. cerevisiae mutants deficient in antioxidant defences such as catalase superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238982 11679167 325673 3544 1516 CAT catalase catalase 0 1.0 in agreement s. cerevisiae mutants deficient in antioxidant defences such as catalase superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238983 11679167 325673 3544 1516 CAT catalase catalase 0 1.0 superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238984 11679167 325673 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in agreement s. cerevisiae mutants deficient in antioxidant defences such as catalase superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238985 11679167 325673 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238986 11679167 325674 8885 20374 GSX1 gsh 1 gsh1 0 1.0 the oxygen heat shock association is also correlated with glutathione levels as the expression of gsh1 and gsh2 genes coding for the two enzymes involved in glutathione synthesis is induced by a sublethal heat shock under aerobic but not anaerobic conditions sugiyama et al. 2000a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238987 11679167 325678 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the link between ethanol and oxidative stress was revealed by different experimental evidences such as the increase of the mitochondrial superoxide dismutase mnsod activity by ethanol the high ethanol sensitivity of s. cerevisiae cells deficient in mnsod costa and costa and the induction of ctt1 gene upon ethanol stress schuller et al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238988 11679167 325711 8413 4330 GLRX glutaredoxin glutaredoxin 0 1.0 owth is highlighted by a significant decrease in the growth rate of cells deficient in antioxidant defences namely superoxide dismutases sod 1_amp_#x394; sod 2_amp_#x394; glutathione gsh 1_amp_#x394; glutaredoxin grx 5_amp_#x394; ubiquinol coq 3_amp_#x394; or poliamines spe 2_amp_#x394; moradas ferreira and costa 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238989 11679167 325713 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 in glucose consuming cells the high activity of protein kinase a represses gene transcription mediated by these factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238990 11679167 325714 3544 1516 CAT catalase catalase 0 1.0 hap1p regulates the transcriptional activation of the antioxidant genes such as sod2 mitochondrial superoxide dismutase cta1 peroxisomal catalase ctt1 cytosolic catalase and ubi4 polyubiquitin . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238991 11679167 325714 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 hap1p regulates the transcriptional activation of the antioxidant genes such as sod2 mitochondrial superoxide dismutase cta1 peroxisomal catalase ctt1 cytosolic catalase and ubi4 polyubiquitin . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238992 11679167 325728 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 for example the increasing requirement of nadph is met by the increase of glucose 6 phosphate utilisation by the pentose phosphate pathway as the activity of glucose 6 phosphate dehydrogenase zwf1p is induced by hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238993 11679167 325729 23454 12435 TXN thioredoxin thioredoxin 0 1.0 indeed the nadph is essential for the glutathione and the thioredoxin antioxidant systems which play a key role in maintaining a reduced intracellular state in the cells challenged by an oxidative stress fig 5 kuge and jones 1994 ; izawa et al. 1995 ; morgan et al. 199 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238994 11679167 325732 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 i the glycolytic flux is inhibited: genes coding for glycolytic enzymes are downregulated and glyceraldehyde 3 phosphate dehydrogenase is oxidatively inactivated see section 2.1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238995 11679167 325735 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 the inhibition of the glycolytic pathway at the step catalysed by glyceraldehyde 3 phosphate dehydrogenase increases the pool of dihydroxyacetone phosphate available for the glycerol cycle godon et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238996 11679167 325736 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 iii the glutamate catabolic pathway is upregulated: the expression of succinate semi aldehyde dehydrogenase gene uga5 is induced and the loss/overexpression of glutamate decarboxylase gene gad1 decreases/increases hydrogen peroxide resistance coleman et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238997 11679167 325738 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 under non stress conditions these factors are negatively regulated by the ras/protein kinase a pathway which is activated by glucose and promotes cellular growth fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238998 11679167 325739 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 under stress conditions the ras/protein kinase a pathway is inhibited and the different transcription factors are activated by specific signal transduction pathways. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238999 11679167 325742 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 yap1p also upregulates the rpi1 gene which codes for protein that represses the ras/protein kinase a pathway dumond et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239001 11679167 325752 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 it was recently shown that the thioredoxin system consisting of thioredoxin thioredoxin reductase and thioredoxin peroxidase plays a key role in regulating the yap1p dependent stress response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239002 11679167 325753 23454 12435 TXN thioredoxin thioredoxin 0 1.0 indeed yap1p is constitutively active in thioredoxin deficient mutants trx 1_amp_#x394; trx 2_amp_#x394; izawa et al. 1999 and the whole genome analysis of gene expression showed that 70% of the yap1p targets are upregulated in mutants lacking thioredo 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239003 11679167 325753 23454 12435 TXN thioredoxin thioredoxin 0 1.0 deficient mutants trx 1_amp_#x394; trx 2_amp_#x394; izawa et al. 1999 and the whole genome analysis of gene expression showed that 70% of the yap1p targets are upregulated in mutants lacking thioredoxin reductase trr 1_amp_#x394; under non stress conditions carmel harel et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239005 11679167 325754 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 in addition the thioredoxin peroxidase tpx1p is essential for the transcriptional activation of trx2 and trr1 genes ross et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239006 11679167 325755 23454 12435 TXN thioredoxin thioredoxin 0 1.0 as yap1p/skn7p mediates the upregulation of thioredoxin system these results indicate that yap1p function is regulated by a feedback mechanism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239007 11679167 325756 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the reduction of yap1p disulphide bonds by the thioredoxin system exposes the nuclear export signals and crm1p exports yap1p back to the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239008 11679167 325760 23454 12435 TXN thioredoxin thioredoxin 0 1.0 these results suggest that the effects of hydrogen peroxide endogenously produced or added are stronger in cells lacking thioredoxin reductase probably due to a decreased capacity to eliminate the oxidant and/or to reduce yap1p disulphide bonds. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239009 11679167 325761 23454 12435 TXN thioredoxin thioredoxin 0 1.0 despite the increased levels of antioxidant defences and other stress proteins the trr 1_amp_#x394; mutants are hypersensitive to hydrogen peroxide indicating that the thioredoxin system plays a critical role in the detoxification of hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239010 11679167 325763 7683 3796 FOS ap 1 ap 1 0 1.0 interestingly the yeast ap 1 family yap1p of proteins are involved in the sensing of reactive oxygen species in the different yeasts toone et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239011 11679167 325771 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the activation of these factors requires a functional mitochondria and the activity of cytochrome c peroxidase ccp1p . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239013 11679167 325772 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 indeed the induction of tpx1 thioredoxin peroxidase gene is skn7p and yap1p dependent and is lower in respiration deficient mutants and ccp 1_amp_#x394; cells charizanis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239014 11679167 325798 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the accumulation of oxidised proteins carbonyls and mixed disulphides and the increased production of reactive oxygen species concomitant with a depletion of antioxidant defences glutathione and superoxide dismutase seem to be key factors in ageing and cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239015 11679167 325799 20997 11180 SOD2 mn superoxide dismutase mn superoxide dismutase 0 1.0 ted to respiratory growth conditions which display high levels of antioxidant defences maclean et al. 2001 and by the decreased life span observed in mutants deficient in cuzn superoxide dismutase or mn superoxide dismutase longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239018 11679167 325800 20997 11180 SOD2 mn superoxide dismutase mn superoxide dismutase 0 1.0 the deficiency in mn superoxide dismutase leads to the accumulation of superoxide radicals which destroy the 4fe_amp_#x2013;4s clusters of mitochondrial enzymes e.g. aconitase leading to an impaired respiratory activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239020 11679167 325807 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 1.0 in agreement mutations in adenylate cyclase extend life span by a msn2/4p dependent mechanism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239021 11679167 325810 10601 6081 INS insulin insulin 0 1.0 sch9p is an homologue of the mammalian protein kinase b/akt which is involved in insulin signalling apoptosis and cellular proliferation and functions in a pathway that regulates ageing and stress resistance paradis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239022 11679167 325810 543 391 AKT1 protein kinase b protein kinase b 0 1.0 sch9p is an homologue of the mammalian protein kinase b/akt which is involved in insulin signalling apoptosis and cellular proliferation and functions in a pathway that regulates ageing and stress resistance paradis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239023 11679167 325817 1576 990 BCL2 bcl 2 bcl 2 0 1.0 several proteins have been identified as being major regulators of apoptosis including the bcl 2 family and caspases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239024 11679167 325818 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the bcl 2 family of proteins consist of anti apoptotic proteins such as bcl 2 and bcl x l and pro apoptotic proteins such as bax and bak gross et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239025 11679167 325818 1578 992 BCL2L1 bcl x bcl x 0 1.0 the bcl 2 family of proteins consist of anti apoptotic proteins such as bcl 2 and bcl x l and pro apoptotic proteins such as bax and bak gross et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239026 11679167 325827 1389 30213 ATP13A2 putative atpase putative atpase 0 1.0 the mutation of the yeast cdc48 gene which codes for a putative atpase homologous to the mammalian anti apoptotic valosine containing protein vcp shirogane et al. 1999 also induces both apoptosis and the accumulation of reactive oxygen species madeo et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239027 11679167 325828 1576 990 BCL2 bcl 2 bcl 2 0 1.0 on dna strand breaks and plasma membrane inversion laun et al. 2001 ; v the life span of non dividing yeast cells lacking superoxide dismutase is extended by overexpressing the anti apoptotic protein bcl 2 longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239028 11679167 325828 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 cellular levels of glutathione decreases the mitochondrial membrane potential and affects the intracellular redox potential and these effects are reverted by expression of a plant antioxidant defence glutathione s transferase/peroxidase kampranis et al. 2000 ; iii bax lethality is higher under respiratory conditions and is suppressed in respiration deficient mutants and by inhibition of the f 0 f 1 atpase/h + pump with ol 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239029 11679167 325828 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 both oxidative stress see above and apoptosis including chromatin fragmentation dna strand breaks and plasma membrane inversion laun et al. 2001 ; v the life span of non dividing yeast cells lacking superoxide dismutase is extended by overexpressing the anti apoptotic protein bcl 2 longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239030 11679167 325832 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the regulatory role of the bcl 2 members e.g. depends on their ability to regulate the mitochondrial function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239031 11679167 325833 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in yeast bcl 2 proteins interact with the voltage dependent anion channel vdac and the adenine nucleotide translocator ant and these proteins are components of the mitochondrial permeability transition pore complex 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239032 11679167 325833 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 in yeast bcl 2 proteins interact with the voltage dependent anion channel vdac and the adenine nucleotide translocator ant and these proteins are components of the mitochondrial permeability transition pore complex that is required for bax lethality marzo et al. 1998 ; shimizu et al. 1999 ; vander heiden et al. 1999 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239033 11679167 325834 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 it has been suggested that the cytochrome c released into the cytosol as a consequence of pore opening has a pro apoptotic activity manon et al. 1997 ; minn et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239034 11679167 325835 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 however ant is not essential for bax induced cytochrome c release from the mitochondria and contradictory results have been described regarding the role of vdac priault and priault ; shimizu et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239035 11679167 325836 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 it should be noted that the importance of cytochrome c release in bax lethality was recently questioned as bax induces cell death in yeast cells expressing a functional cytochrome c_amp_#x2013;gfp fusion that is not relocalised into the cytosol roucou et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239036 11679167 325860 7975 3951 FXN frataxin frataxin 0 1.0 this disorder results from a deficiency in frataxin a nuclear encoded mitochondrial protein with no homology to proteins of known function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239037 11679167 325860 3248 1260 C21orf2 nuclear encoded mitochondrial protein nuclear encoded mitochondrial protein 0 1.0 this disorder results from a deficiency in frataxin a nuclear encoded mitochondrial protein with no homology to proteins of known function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239038 11679167 325861 7975 3951 FXN frataxin frataxin 0 1.0 studies on the yeast frataxin homologue yfh1p suggest that this protein is an iron binding protein that plays a key role in regulation of iron homeostasis and resistance to oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239039 11679167 325862 7975 3951 FXN frataxin frataxin 0 1.0 indeed yfh1p exhists as a monomer in the absence of iron but self aggregates in the presence of iron forming multimers able to sequester more than 16 iron atoms per frataxin molecule adamec et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239040 11679167 325863 7975 3951 FXN frataxin frataxin 0 1.0 both frataxin and yfh1p are processed in the mitochondria to a mature form that is essential for the control of mitochondrial iron homeostasis knight et al. 1998 ; branda et al. 1999 ; cavadini et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239041 11679167 325874 7975 3951 FXN frataxin frataxin 0 1.0 as the excess of iron is known to promote the formation of the highly reactive hydroxyl radicals the absence of an oxidative stress response may account for cellular dysfunction of frataxin deficient mutants. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239042 11679167 325887 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 a under physiological conditions cells growing on glucose contain high levels of camp which activates protein kinase a pka and inhibits the general stress response mediated by msn2/4p and specific stress responses mediated by skn7p and yap1p. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239043 11679167 325896 23454 12435 TXN thioredoxin thioredoxin 0 1.0 glutathione and thioredoxin antioxidant systems. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239044 11679167 325897 23454 12435 TXN thioredoxin thioredoxin 0 1.0 a glutathione gsh and thioredoxin trx sh2 are oxidised during reduction of hydroperoxides and disulphide bonds. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239045 11679167 325898 23454 12435 TXN thioredoxin thioredoxin 0 1.0 b nadph is essential for reduction of oxidised glutathione gssg and thioredoxin trx s 2 to gsh and trx sh 2 respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239046 11679167 325902 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 zwf1 glucose 6 phosphate dehydrogenase gpd1 glycerol phosphate dehydrogenase gpp2 glycerol phosphate phosphatase ybr149w glycerol dehydrogenase dak1 dihydroxyacetone kinase gad1 glutamate decarboxylase uga5 succinate semialdehyde dehydrog 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239047 11679167 325909 23454 12435 TXN thioredoxin thioredoxin 0 1.0 a under non stress conditions thioredoxin reduces the cysteine residues and exposes the nes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239736 11701756 326723 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative inactivation of calcineurin by cu zn superoxide dismutase g93a a mutant typical of familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239737 11701756 326726 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in a recent work we have observed that calcineurin activity is depressed in two models for familial amyotrophic lateral sclerosis fals associated with mutations of the antioxidant enzyme cu zn superoxide dismutase sod1 namely in neuroblastoma cells expressing either sod1 mutant g93a or mutant h46r and in brain areas from g93a transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 234251 11796206 317438 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we previously characterized the enhanced peroxidative activity of the human familial als fals mutants of copper zinc superoxide dismutase cuznsod a4v and g93a in vitro. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230689 11905995 311195 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mitochondrial dysfunction is an early event of motor neuron degeneration in transgenic mice overexpressing mutant superoxide dismutase sod 1 gene and mitochondrial abnormality is observed in human als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230690 11905995 311196 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ll culture system we demonstrated that infection of mouse nsc 34 motor neuron like cells with adenovirus containing mutant g93a sod1 gene increased cellular oxidative stress mitochondrial dysfunction cytochrome c release and motor neuron cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232222 11978481 313819 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the generation of nitric oxide no _amp_#x2022; from arginine by nitric oxide synthase is a process which is involved in neurotransmission regulation of vascular relaxation and in inflammatory processes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232223 11978481 313820 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 the generation of no _amp_#x2022; is catalyzed by three isoforms of nitric oxide synthase neuronal nitric oxide synthase nnos endothelial nitric oxide synthase enos and inducible nitric oxide synthase inos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232224 11978481 313820 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 the generation of no _amp_#x2022; is catalyzed by three isoforms of nitric oxide synthase neuronal nitric oxide synthase nnos endothelial nitric oxide synthase enos and inducible nitric oxide synthase inos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232226 11978481 313846 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 recent work showed that transgenic mice with a knockout of methionine sulfoxide reductase which repairs oxidized methione have a reduced life span and show increased protein carbonyls [ 17 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232227 11978481 313850 4423 1991 CKB creatine kinase creatine kinase 0 1.0 prior studies showed that glutamine synthetase and creatine kinase are particularly vulnerable to oxidative damage [ 12 and 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232228 11978481 313850 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 prior studies showed that glutamine synthetase and creatine kinase are particularly vulnerable to oxidative damage [ 12 and 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232229 11978481 313855 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 one protein was manganese superoxide dismutase which was previously shown to be selectively nitrated at tyr 34 and inactivated [ 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232231 11978481 313857 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 nitration of tyrosine residues in glutamine synthetase by peroxynitrite inhibits oxidation of methione residues and leads to inactivation of the enzyme [ 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232232 11978481 313861 4423 1991 CKB creatine kinase creatine kinase 0 1.0 creatine kinase is another key intracellular enzyme regulating energy metabolism that is nitrated and inactivated by peroxynitrite [ 25 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232233 11978481 313871 4423 1991 CKB creatine kinase creatine kinase 0 1.0 there were also significant decreases in glutamine synthetase and creatine kinase activity and alterations in spin labeled synaptosomes consistent with oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232234 11978481 313871 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 there were also significant decreases in glutamine synthetase and creatine kinase activity and alterations in spin labeled synaptosomes consistent with oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232236 11978481 313875 12369 6893 MAPT microtubule-associated protein tau microtubule associated protein tau 0 1.0 neurofibrillary tangles are protein aggregates which are largely made up of the microtubule associated protein tau. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232237 11978481 313885 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the source of the nitric oxide is possibly from upregulation of an inducible nitric oxide synthase in neurofibrillary tangle bearing neurons or from nitric oxide synthase in astrocytes and microglia adjacent to senile plaques [ 38 and 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232238 11978481 313887 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 a 6 fold increase in 3 nitrotyrosine concentrations was detected in ad cerebrospinal fluid as compared to age matched controls [ 41 ] and an increase in nitrated manganese superoxide dismutase was also reported [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232240 11978481 313900 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 we and others showed that inhibitors of neuronal nitric oxide synthase blocked mptp induced dopaminergic toxicity in mice and that mptp neurotoxicity was attenuated in mice deficient in neuronal nitric oxide synthase [ 45 and 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232242 11978481 313901 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 we subsequently showed that neuronal nitric oxide synthase inhibitors blocked mptp neurotoxicity in baboons and this was accompanied by an inhibition of 3 nitrotyrosine staining [ 47 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232244 11978481 313905 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 an increase in nitrated manganese superoxide dismutase was found in cerebrospinal fluid [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232246 11978481 313913 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 other evidence for oxidative damage to proteins in pd is increased expression of neural heme oxygenase 1 and increased immunostaining of glycosylated proteins [ 55 and 56 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232247 11978481 313925 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 other groups reported marked increases of both free 3 nitrotyrosine and nitrated manganese superoxide dismutase in the cerebrospinal fluid of sporadic als patients [ 42 and 62 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232250 11978481 313927 4423 1991 CKB creatine kinase creatine kinase 0 1.0 we found significant decreases in creatine kinase activity in the transgenic als mice that were mimicked by exposure of brain extracts of peroxynitrite [ 63 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232251 11978481 313929 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 an increase in neuronal nitric oxide synthase nnos was found in motor neurons in one study [ 65 66 and 67 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229374 12125078 309248 23454 12435 TXN thioredoxin thioredoxin 0 1.0 gga was found to induce the expression of heat shock protein 70 as well as thioredoxin which may partly contribute to the protective effect of gga. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229375 12125078 309248 9691 5232 HSPA1A heat shock protein 70 heat shock protein 70 0 1.0 gga was found to induce the expression of heat shock protein 70 as well as thioredoxin which may partly contribute to the protective effect of gga. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 224454 12218958 300505 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase applications and relevance to human diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 224455 12218958 300508 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase sod catalyzes the conversion of single electron reduced species of molecular oxygen to hydrogen peroxide and oxygen. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 224456 12218958 300510 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 among these cu zn superoxide dismutase sod1 is widely distributed and comprises 90% of the total sod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226064 12368231 302530 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 overexpression of sod1 protects vulnerable motor neurons after spinal cord injury by attenuating mitochondrial cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226065 12368231 302531 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 defective cu zn superoxide dismutase sod1 is responsible for some types of amyotrophic lateral sclerosis and ventral horn motor neurons vmn have been shown to die through a mitochondria dependent apoptotic pathway after chronic exposure 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226066 12368231 302534 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 superoxide production mitochondrial release of cytochrome c and activation of caspase 9 were examined and apoptotic dna injury was also characterized. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226067 12368231 302534 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 superoxide production mitochondrial release of cytochrome c and activation of caspase 9 were examined and apoptotic dna injury was also characterized. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226068 12368231 302535 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 in the wild type animals increased superoxide production mitochondrial release of cytochrome c and cleaved caspase 9 were observed exclusively in vmn after sci. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226069 12368231 302535 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the wild type animals increased superoxide production mitochondrial release of cytochrome c and cleaved caspase 9 were observed exclusively in vmn after sci. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226070 12368231 302537 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 transgenic animals showed less superoxide production mitochondrial cytochrome c release and caspase 9 activation resulting in death of only 45% of the vmn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226071 12368231 302537 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 transgenic animals showed less superoxide production mitochondrial cytochrome c release and caspase 9 activation resulting in death of only 45% of the vmn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226072 12368231 302541 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c group|superoxides|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226214 12373523 302680 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 1 a signal transduction role because nitration of tyrosine residues through tyro _amp_#8226; formation can modulate as well the phosphorylation tyrosine kinases activity and/or tyrosine hydroxylation tyrosine hydroxylase inactivation leading to consequent dopamine synthesis failure and increased degradation of target proteins respectively; 2 a role of _amp_#8220;blocker_amp_#8221; for radical radical reactions scaven 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218389 12392777 292016 20997 11180 SOD2 mn superoxide dismutase mn superoxide dismutase 0 1.0 the antioxidant enzymes in the brain include cu/zn superoxide dismutase sod 1 and mn superoxide dismutase sod 2 which catalyze the conversion of o 2 _amp_#x221a; _amp_#x2212; to h 2 o 2 [ 73 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218391 12392777 292017 3544 1516 CAT catalase catalase 0 1.0 h 2 o 2 is then converted to h 2 o by either catalase or glutathione peroxidase gsh px . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218392 12392777 292031 14352 7794 NFKB1 nuclear factor kappa-b nuclear factor kappa b 0 1.0 another index of oxidative stress is the activation of the transcriptional factor nuclear factor kappa b nf _amp_#x3ba;b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218393 12392777 292035 1576 990 BCL2 bcl 2 bcl 2 0 1.0 moreover nf _amp_#x3ba;b induces the expression of the so called inhibitor of apoptosis proteins iaps bcl 2 and calbindins [ 179 and 270 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 221146 12437573 295643 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we have recently observed that calcineurin activity is depressed in human neuroblastoma cells expressing cu zn superoxide dismutase sod1 mutant g93a and in brain areas from g93a transgenic mice and that mutant g93a sod1 oxidatively inactivates calcineurin in vitro. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 221147 12437573 295646 14354 7797 NFKBIA ikappabalpha ikappabalpha 0 1.0 alteration of the phosphorylation state of ikappabalpha the inhibitor of nf kappab translocation into the nucleus and induction of cyclooxygenase 2 are consistent with the up regulation of this transcription factor in this system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207579 12614931 278044 9462 5013 HMOX1 ho 1 ho 1 0 1.0 expression of heme oxygenase 1 ho 1 a marker of oxidative stress also increased. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207580 12614931 278044 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 expression of heme oxygenase 1 ho 1 a marker of oxidative stress also increased. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207581 12614931 278053 3544 1516 CAT catalase catalase 0 1.0 ecause of its high level of polyunsaturated fatty acids as substrates for lipid peroxidation high rate of oxygen consumption and low or moderate levels of the antioxidant enzymes superoxide dismutase catalase and gpx compared with kidney or liver [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207582 12614931 278053 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 to oxidative injury because of its high level of polyunsaturated fatty acids as substrates for lipid peroxidation high rate of oxygen consumption and low or moderate levels of the antioxidant enzymes superoxide dismutase catalase and gpx compared with kidney or liver [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207583 12614931 278109 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 mrna 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207584 12614931 278110 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the heme oxygenase 1 ho 1 mrna level was measured by northern blot analysis as previously described [ 21 ] using total cellular rna 5 _amp_#x3bc;g from control or ea treated nsc 34 cells about 2.5_amp_#xd7;10 6 cells . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207585 12614931 278110 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 the heme oxygenase 1 ho 1 mrna level was measured by northern blot analysis as previously described [ 21 ] using total cellular rna 5 _amp_#x3bc;g from control or ea treated nsc 34 cells about 2.5_amp_#xd7;10 6 cells . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207586 12614931 278150 9462 5013 HMOX1 ho 1 ho 1 0 1.0 as a marker of oxidative stress we also measured the induction of ho 1 mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207587 12614931 278151 9462 5013 HMOX1 ho 1 ho 1 0 1.0 exposure to 100 _amp_#x3bc;m ea promptly increased ho 1 mrna with a massive rise 3 h after treatment respectively 1.6 12 and 16 times the control level after 1 2 and 3 h of treatment; fig 5 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207588 12614931 278173 3544 1516 CAT catalase catalase 0 1.0 ease in dcfh da oxidation after treatment with ea indicates the presence of increased levels of h 2 o 2 and could be a direct consequence of gsh deficiency since in mitochondria_amp_#x2014;which lack catalase activity_amp_#x2014;h 2 o 2 is metabolized by gsh peroxidase using the reducing equivalents of gsh. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207589 12614931 278177 3544 1516 CAT catalase catalase 0 1.0 in addition levels of catalase are very low in the nervous system [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207590 12614931 278178 3544 1516 CAT catalase catalase 0 1.0 interestingly treatment with catalase was beneficial in a mouse model of als [ 28 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207591 12614931 278197 9462 5013 HMOX1 ho 1 ho 1 0 1.0 gsh depletion by ea induced expression of ho 1 which has been reported to be protective in different models of oxidative stress induced neuronal injury [ 43 and 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207592 12614931 278198 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 zymatic activity potentially act as antioxidants [ 45 ] and can thus exert anti apoptotic effects with co acting in a dominant manner as an anti apoptotic messenger possibly through activation of the p38 mitogen activated protein kinase mapk signal transduction pathway [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207593 12614931 278198 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the end products of ho 1 enzymatic activity potentially act as antioxidants [ 45 ] and can thus exert anti apoptotic effects with co acting in a dominant manner as an anti apoptotic messenger possibly through activation of t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207594 12614931 278199 9462 5013 HMOX1 ho 1 ho 1 0 1.0 however the role of ho 1 in our model requires further investigation since proapoptotic signals prevailed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207595 12614931 278200 9462 5013 HMOX1 ho 1 ho 1 0 1.0 interestingly increased immunoreactivity for ho 1 and p38mapk were detected in human and mouse als [ 47 48 and 49 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207596 12614931 278224 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 effect of ethacrynic acid on heme oxygenase 1 expression in nsc 34 cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207597 12614931 278226 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the heme oxygenase 1 ho 1 mrna signal is shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207598 12614931 278226 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 the heme oxygenase 1 ho 1 mrna signal is shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208066 12618129 278659 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 mitochondrial respiratory chain dysfunction was also found in transgenic mice expressing a mutant form of superoxide dismutase 1 associated with familial als [ 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208067 12618129 278684 4996 2422 CS citrate synthase citrate synthase 0 1.0 the activities of complex i+iii nadh_amp_#x2013;cytochrome c reductase ii+iii succinate_amp_#x2013;cytochrome c reductase iv cytochrome c oxidase cox and the mitochondrial matrix enzyme citrate synthase cs were measured as described elsewhere [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208069 12618129 278684 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 the activities of complex i+iii nadh_amp_#x2013;cytochrome c reductase ii+iii succinate_amp_#x2013;cytochrome c reductase iv cytochrome c oxidase cox and the mitochondrial matrix enzyme citrate synthase cs were measured as described elsewhere [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208070 12618129 278724 4996 2422 CS citrate synthase citrate synthase 0 1.0 enzymatic activities of the mitochondrial respiratory chain complexes i+iii ii+iii cox and of the nuclear encoded mitochondrial matrix enzyme citrate synthase were measured on cybrid clones and mass cultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208071 12618129 278790 4996 2422 CS citrate synthase citrate synthase 0 1.0 a respiratory chain activities in cybrid mass cultures als n = 13; controls n = 10 normalized by the activity of the mitochondrial matrix enzyme citrate synthase cs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208073 12618129 278794 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 i+iii nadh cytochrome c reductase; ii+iii succinate cytochrome c reductase; cox cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209890 12654515 280253 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 vascular endothelial growth factor vegf is neurotrophic and also protects from hypoxia induced neuronal injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209891 12654515 280266 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the landmark discovery that mutations of the copper_amp_#x2013;zinc superoxide dismutase sod1 gene cause a portion of human familial als and that transgenic animal models expressing mutant sod1 mimic human als have contributed significantly to our understanding of human als [ 5 18 37 41 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209892 12654515 280269 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 recently vascular endothelial growth factor vegf has been demonstrated to have neurotrophic effects by promoting neuronal cell survival in vitro and in vivo [ 23 26 43 and 45 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209893 12654515 280271 23910 12680 VEGFA vascular permeability factor vascular permeability factor 0 1.0 vegf also known as vascular permeability factor is a dimeric glycoprotein that binds to endothelial cell specific receptors fms like tyrosine kinase flt 1 and fetal liver kinase flk 1 [ 16 and 36 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209894 12654515 280272 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 acting through these receptors vegf is believed to initiate several intracellular signal transduction systems including phosphatidylinositol 3 kinase pi3 k and mitogen activated protein kinase mapk [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209897 12654515 280332 16616 8978 PIK3CG pi3-kinase pi3 kinase 0 1.0 pi3 kinase activity assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209898 12654515 280354 3544 1516 CAT catalase catalase 0 1.0 based on our previous study showing that the anti oxidants catalase n acetyl cysteine n ac and the spin trapping molecule 5_amp_#x2032; 5_amp_#x2032; dimethylpryrroline n oxide dmpo were all protective fig 1d and ref [ 32 ] we assume that oxidative stress is at least 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209899 12654515 280378 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 several lines of evidence prompted us to examine the effects of vegf on mutant sod1 mediated motor neuron like cell death: i vegf acts as a neurotrophic factor preventing hypoxia ischemia mediated neuronal cell death [ 23 ]; ii increased oxidative stress plays an important role in hypoxia mediated neuronal cell death [ 30 and 33 ]; iii disruption of the hyp 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209900 12654515 280397 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 horylated akt has been demonstrated to promote cell survival by inactivation of one or more apoptotic factors [ 1 14 15 and 22 ] glycogen synthase kinase 3 forkhead transcription factors [ 8 ] and/or caspase 9 [ 9 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209901 12654515 280448 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 e proteins|reactive oxygen species|tumor necrosis factor alpha|vascular endothelial growth factor a|vascular endothelial growth factors|hydrogen peroxide|superoxide dismutase 1|superoxide dismutase|1 phosphatidylinositol 3 kinase|protein serine threonine kinases|proto oncogene proteins c akt| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211476 12663085 281778 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 protein cross linkage results in aggregates which then form intracellular protease resistant and ubiquitin proteasome resistant deposits consequently inhibiting the intracellular transport of materials. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211477 12663085 281789 14282 7739 NEFL nf l nf l 0 1.0 neurofilaments have three isoforms which are referred to as light nf l medium nf m and heavy chains nf h . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211478 12663085 281789 14285 7734 NEFM nf m nf m 0 1.0 neurofilaments have three isoforms which are referred to as light nf l medium nf m and heavy chains nf h . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211480 12663085 281801 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 since mutations of the superoxide dismutase 1 sod 1 gene were first identified in 1993 it has been considered a possible cause of familial als fals [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211482 12663085 281812 11780 6563 LGALS3 galectin 3 galectin 3 0 1.0 e as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211483 12663085 281812 5546 2728 DDOST age r1 age r1 0 1.0 although many are as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211484 12663085 281812 17314 9411 PRKCSH 80k-h protein 80k h protein 0 1.0 although many are as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211485 12663085 281820 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 a_amp_#x3b2; induces the production of tumor necrosis factor _amp_#x3b1; by microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211486 12663085 281829 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 m_amp_#xfc;nch et al. reported that the accumulation of intracellular age was observed in up to 95% of pyramidal neurons in patients with presenilin 1 mutations [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211487 12663085 281830 9462 5013 HMOX1 ho 1 ho 1 0 1.0 age coexisted with hemeoxygenase 1 ho 1 on neurofibrillary tangles [ 119 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211488 12663085 281831 9462 5013 HMOX1 ho 1 ho 1 0 1.0 since ho 1 is induced under oxidative stress it was speculated that reactive oxygen species were produced by tau modified with age leading to the induction of ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211489 12663085 281904 551 399 ALB albumin albumin 0 1.0 an increased accumulation of amadori products was found in all major proteins of the csf of ad patients including albumin apoe and transthyretin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211490 12663085 281905 551 399 ALB albumin albumin 0 1.0 glycation in albumin normalized on protein quantity was nearly 1.5 times greater in ad patients than in controls total csf glycation of the samples was 8.9 and 3.1 arbitrary units/_amp_#x3bc;g of protein respectively . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211491 12663085 281906 551 399 ALB albumin albumin 0 1.0 this demonstrated that increased csf glycation in ad is not due to a specific protein modification because all major csf proteins of different origin are involved in the process albumin from plasma 90% of transthyretin synthesized by choroid plexus and apoe derived from astrocytes . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211492 12663085 281906 23358 12405 TTR transthyretin transthyretin 0 1.0 demonstrated that increased csf glycation in ad is not due to a specific protein modification because all major csf proteins of different origin are involved in the process albumin from plasma 90% of transthyretin synthesized by choroid plexus and apoe derived from astrocytes . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211493 12663085 281938 8403 4323 GLO1 glyoxalase i glyoxalase i 0 1.0 glyoxalase i catalyzes the conversion of mg to s lactoylglutathione which in turn is converted to lactate by glyoxalase ii [ 91 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211494 12663085 281938 9010 4805 HAGH glyoxalase ii glyoxalase ii 0 1.0 glyoxalase i catalyzes the conversion of mg to s lactoylglutathione which in turn is converted to lactate by glyoxalase ii [ 91 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211495 12663085 281950 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 2 3 dg induced toxicity in pc12 cells which was suppressed by the overexpression of aldehyde reductase [ 102 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211496 12663085 281953 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the cytotoxic effects were attenuated by antioxidants aminoguanidine and inhibitors of nitric oxide synthase nos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211497 12663085 281955 4691 2206 COL4A4 collagen iv collagen iv 0 1.0 4 neurite production and neuronal survival of cultured drg neurons were significantly reduced on glycated collagen iv and laminin [ 54 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211498 12663085 281982 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 1 enzyme systems such as aldehyde reductase and glyoxalase detoxify 3 dg and mg which are the building blocks of age. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211499 12663085 281987 523 381 AKR1B1 aldose reductase aldose reductase 0 1.0 aldehyde reductase has been identified as a detoxication enzyme of 3 dg and mg and has homology to aldose reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211500 12663085 281987 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 aldehyde reductase has been identified as a detoxication enzyme of 3 dg and mg and has homology to aldose reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211501 12663085 281988 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 in pc12 cells overexpressing aldehyde reductase 3 dg toxicity was suppressed as described above [ 102 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211502 12663085 281989 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 aldehyde reductase however can be glycated and its enzymatic activity attenuated [ 103 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211503 12663085 281992 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 in addition to its suppressive effect on glycation ag has antioxidant properties [ 81 ] and also inhibits inducible nitric oxide synthase inos [ 100 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211504 12663085 282019 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 neuronal hyaline inclusions nhis abnormal intracellular structures that appear in the soma and neurites of some of the surviving lower motor neurons and contain ubiquitin and phosphorylated neurofilament protein are the characteristic markers of fals with sod 1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211505 12663085 282091 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 among the three types of age receptors other than rage reported in the human brain age r1 oligosaccharyltransferase family and age r2 substrate of protein kinase c have been found in neurons while age r3 is restricted to glial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211506 12663085 282091 5546 2728 DDOST age r1 age r1 0 1.0 among the three types of age receptors other than rage reported in the human brain age r1 oligosaccharyltransferase family and age r2 substrate of protein kinase c have been found in neurons while age r3 is restricted to glial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211507 12663085 282092 5546 2728 DDOST age r1 age r1 0 1.0 al. investigated the distributions of these receptors in conglomerates of cortical motor neurons in eight als brains five sporadic als and three fals and three control brains with antibodies against age r1 and age r2 [ 13 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211508 12663085 282093 5546 2728 DDOST age r1 age r1 0 1.0 they found that age r1 immunoreactivity was co localized with those of age sod 1 and neurofilaments. 12.7. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211509 12663085 282101 3544 1516 CAT catalase catalase 0 1.0 sod and catalase activities were not changed suggesting that specific defects of the gsh system are more important in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212294 12684448 283316 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 observations of elevated csf glutamate in amyotrophic lateral sclerosis als together with findings that motor neurons are selectively vulnerable to glutamate receptor mediated "excitotoxic" injury support an excitotoxic contribution to the motor neuron loss in the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212296 12684448 283326 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 although a small percentage 1 2% of cases have been linked to mutations in the enzyme superoxide dismutase 1 sod1 rosen et al. 1993 the vast majority 90 95% are sporadic. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212297 12684448 283331 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 mns seem to possess large numbers of unusual ampa type glutamate receptor channels that are directly permeable to ca carriedo et al. 1995 1996 ; williams et al. 1997 ; vandenberghe et al. 2000 and activation of these channels with the selective agonists ampa or kainate ind 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212298 12684448 283351 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 control studies using the astrocyte specific marker glial fibrillary acidic protein gfap confirmed the identity of cells with these morphological characteristics see fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212299 12684448 283353 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 cultures were fixed in 4% paraformaldehyde blocked and exposed to primary antibody [smi 32 1:5000 and gfap 1:400 dako glostrup denmark ; glutamate transporter glt 1 also known as eaat2 0.17 microg/ml kindly supplied by jeff rothstein johns hopkins university baltimore md ; 3 nitrotyrosine 10 microg/ml upstate biotechnology waltham ma ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212300 12684448 283365 3544 1516 CAT catalase catalase 0 1.0 xposed for 15 min to sham wash or to kainate [100 micro m plus + 5 methyl 10 11 dihydro 5h dibenzo [a d] cyclohepten 5 10 imine maleate mk 801 ] alone or in the presence of antioxidants sod 100 u/ml; catalase 400 u/ml followed after another 10 min by incubation in [ h]glutamate 2 microci/ml in hss for 5 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212301 12684448 283390 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 behave similarly to those in situ with both seeming to possess large numbers of ca permeable ampa channels to show poor intracellular ca buffering and to be selectively vulnerable to injury caused by glutamate receptor activation o'brien and fischbach 1986 ; hugon et al. 1989 ; rothstein et al. 1993 ; carriedo et al. 1996 2000 ; williams et al. 1997 ; vandenberghe et al. 1998 ; palecek et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212302 12684448 283391 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 thus the relatively selective ros generation we observe in cultured mns in response to glutamate receptor activation and the ability of this ros to escape the cell and affect the surrounding microenvironment is likely to model events that can occur in vivo . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212303 12684448 283415 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in addition the suggestion that the ros can exit mns and affect surrounding astrocytes provides an explanation for previous reports of oxidative modifications of the glt 1 transporter in als pedersen et al. 1998 ; trotti et al. 1999 ; deitch et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212304 12684448 283424 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 c under confocal microscopy the close spatial relationship between the mn smi 32 red and glial glutamate transporters anti glt 1 green is apparent. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212305 12684448 283455 3544 1516 CAT catalase catalase 0 1.0 a spinal cultures were exposed to sham wash or to kainate ka ; 100 micro m plus 10 micro m mk 801 alone or with addition of the antioxidants sod 100 u/ml and catalase 400 u/ml to the bath ka+ao before [ h]glutamate uptake assays as described. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212306 12684448 283495 3544 1516 CAT catalase catalase 0 1.0 furthermore this local decrease in uptake was prevented by addition of cell impermeant antioxidant enzymes sod 100 u/ml; catalase 400 u/ml to the bath. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203910 12718737 273318 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative stress in neurodegenerative diseases: therapeutic implications for superoxide dismutase mimetics. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203911 12718737 273323 3544 1516 CAT catalase catalase 0 1.0 antioxidant enzymes such as superoxide dismutase sod catalase and glutathione peroxidase gpx have demonstrated therapeutic efficacy in models of neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203912 12718737 273323 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 antioxidant enzymes such as superoxide dismutase sod catalase and glutathione peroxidase gpx have demonstrated therapeutic efficacy in models of neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203913 12718737 273325 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 most recently sod mimetics small molecules which mimic the activity of endogenous superoxide dismutase have come to the forefront of antioxidant therapeutics. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205115 12753090 274886 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 proteasome activation and nnos down regulation in neuroblastoma cells expressing a cu zn superoxide dismutase mutant involved in familial als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205116 12753090 274888 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we demonstrated that expression of the fully active g93a cu zn superoxide dismutase mutant in neuroblastoma cells is associated with an increased level of oxidatively modified proteins in terms of carbonylated residues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205117 12753090 274891 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 nitrosative stress was not involved in the oxidative unbalance as a decrease in neuronal nitric oxide production and down regulation of neuronal nitric oxide synthase nnos level were detected. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205119 12753090 274893 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the altered rate of proteolysis observed in g93a cells was specific for nnos as cu zn superoxide dismutase cu zn sod degradation by proteasome was influenced neither by its mutation nor by increased proteasome activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201232 12893007 269238 12369 6893 MAPT tau protein tau protein 0 1.0 in contrast tau protein in phf is relatively resistant to postmortem dephosphorylation [ cooper et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201233 12893007 269240 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 another important observation is accumulation of abnormal ubiquitin conjugated proteins in affected neurons suggesting dysfunction of the proteasome proteolytic system in these cells [ shringarpure et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201234 12893007 269262 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 accumulation of abnormal ubiquitin conjugated proteins in affected neurons in ad suggests dysfunction of proteasome system while co existence of hne immunoreactivity in the same cells suggests the essential role of oxidative damage in 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201236 12893007 269263 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 hne immunopositivity seems to be associated with the inheritance of apolipoprotein e 4 apoe alleles. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201237 12893007 269266 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 hne is toxic for p19 cells causing cross linking of tau into high molecular weight substances that are conjugated with ubiquitin [ montine et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201238 12893007 269268 8877 4638 GSTP1 glutathione transferase glutathione transferase 0 1.0 significant decrease of glutathione transferase activity and of other antioxidative enzymes was described in amygdala hippocampus and inferior parietal lobule in patients with ad [ lovell and markesbery 1998 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201239 12893007 269288 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 about 20% of the fals cases which are dominantly inherited are linked with mutation in the gene encoding the superoxide dismutase sod 1 protein [ rosen et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201240 12893007 269290 3544 1516 CAT catalase catalase 0 1.0 nding ubiquitous antioxidative enzyme that catalyses the conversion of the toxic superoxide radical to hydrogen peroxide which in turn is converted to h 2 o by the action of glutathione peroxidase or catalase [ fridovich 1986 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201241 12893007 269297 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 neurofilament proteins and neurotrophic factor tyrosine kinase receptors are proteins particularly susceptible to nitrotyrosine damage [ beckman et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201242 12893007 269299 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 the same inclusions contain epitopes of ubiquitin and phosphorylated neurofilament protein [ shibata et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201243 12893007 269302 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 an in vitro study showed that hne impaires the glutamate and glucose transport and the choline acetyltransferase activity in cultured motor neurons [ pedersen et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201244 12893007 269334 20070 11049 SLC6A3 dopamine transporter dopamine transporter 0 1.0 these data suggest that hne is an important mediator of oxidative stress that alters dopamine uptake after binding to sh groups of the dopamine transporter and to na + /k + atpase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201719 12901835 269760 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we report that the expression of mutant g93a copper/zinc superoxide dismutase sod1 associated with familial amyotrophic lateral sclerosis specifically causes a decrease in mtt reduction rate and atp levels and an increase in both cytosolic and mitochondrial reactive oxygen spe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201720 12901835 269768 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in the early 1990s it has been demonstrated that about 20% of familial als fals patients possess point mutations in the gene coding for the antioxidant enzyme cu zn superoxide dismutase sod1 [ siddique et al 1991 deng et al 1993 and rosen et al 1993 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201722 12901835 269787 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 decreased activity of cytochrome c oxidase was demonstrated in spinal cord motor neurons [ borthwick et al 1999 ] and lymphocytes [ curti et al 1996 ] from sals patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201723 12901835 269788 14217 7688 NDUFA5 ubiquinone reductase ubiquinone reductase 0 1.0 nadh ubiquinone reductase defects have been shown both in postmortem brains from sod1 linked fals patients [ browne et al 1998 ] and in skeletal muscle from sals patients [ vielhaber et al 1999 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201724 12901835 269804 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activity apoalert caspase 3 colorimetric assay kit clontech palo alto usa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201725 12901835 269843 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 neither caspase 3 activation fig 1b nor the number of condensed nuclei fig 1c_amp_#x2013;e was found to be significantly increased in g93a mutant cells indicating that no significant spontaneous apoptotic tendency was 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201726 12901835 269894 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 this is in line with the recent report [ lee et al 2002 ] that aggregation of fals sod1 is not causative of death in nerve growth factor ngf differentiated pc12 cells transfected with mutant sod1s sodmt v148g or a4v . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202336 12909279 270753 3544 1516 CAT catalase catalase 0 1.0 these include enzymatic activities superoxide dismutase catalase peroxidase and peroxiredoxin low molecular weight antioxidant species vitamin e ascorbate glutathione plus more complex forms of protection such as systems for metal transport and buffering and induc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202337 12909279 270753 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 these include enzymatic activities superoxide dismutase catalase peroxidase and peroxiredoxin low molecular weight antioxidant species vitamin e ascorbate glutathione plus more complex forms of protection such as systems for metal transport and buffering 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202338 12909279 270757 3544 1516 CAT catalase catalase 0 1.0 the central nervous system cns is particularly sensitive to this kind of damage for a number of reasons including a low level of some antioxidant enzymes catalase and gsh peroxidase a high content of easily oxidised substrates e.g membrane polyunsaturated lipids and an inherently high flux of ros generated during neurochemical reactions such as dopamine oxidat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202339 12909279 270764 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 to the concept that oxidative stress plays a major role in als as in other neurodegenerative diseases is provided by the observation that mutations in the gene coding for the antioxidant enzyme cu zn superoxide dismutase sod1 have been reported in fals patients [ 21 and 80 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202340 12909279 270779 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 in fact it is known that neurons and astrocytes of sals patients contain cytoplasmic aggregates that show immunoreactivity for sod1 and ubiquitin; similar inclusion bodies were also observed in sod1 linked fals patients [ 12 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202342 12909279 270800 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 as a chain of consequent events modulating extracellular transport uptake intracellular delivery from chaperones e.g copper chaperone for sod1 ccs cox17 and atx1 to specific targets such as sod1 and cytochrome c oxidase and/or storage in copper scavenging systems such as gsh and metallothioneins [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202343 12909279 270818 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 one link between cu and fe metabolism is represented by the enzyme ceruloplasmin cp the copper protein of the plasma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202344 12909279 270819 4840 2295 CP ferroxidase ferroxidase 0 1.0 cp is an enzyme with very efficient ferroxidase activity [ 41 ] that is able to oxidise fe ii to fe iii conveying four electrons to oxygen in a single step: thus water is produced and iron can enter its transport and deposit pathway via incorporat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202345 12909279 270819 22023 11740 TF transferrin transferrin 0 1.0 [ 41 ] that is able to oxidise fe ii to fe iii conveying four electrons to oxygen in a single step: thus water is produced and iron can enter its transport and deposit pathway via incorporation into transferrin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202347 12909279 270835 22054 11763 TFRC transferrin receptor transferrin receptor 0 1.0 if the ire is located on the 3_amp_#x2032; untranslated region of the mrna the binding of irp usually causes an up regulation of the coded protein as for example for the transferrin receptor [ 28 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202348 12909279 270868 17610 9605 PTGS2 cox 2 cox2 0 1.0 nf _amp_#x3ba;b modulates the expression of several proteins such as nitric oxide synthase nos [ 93 ] and cox2 [ 70 ] that might be involved in mechanisms of inflammation mediated neurodegeneration and be crucial in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202349 12909279 270868 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 nf _amp_#x3ba;b modulates the expression of several proteins such as nitric oxide synthase nos [ 93 ] and cox2 [ 70 ] that might be involved in mechanisms of inflammation mediated neurodegeneration and be crucial in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202350 12909279 270869 17610 9605 PTGS2 cox 2 cox2 0 1.0 indeed cox2 and nos activity are dramatically increased in post mortem spinal cord samples from sporadic als patients and in astrocytes from fals mice [ 2 and 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202351 12909279 270870 17610 9605 PTGS2 cox 2 cox2 0 1.0 increased levels of cox2 and of the pro inflammatory prostaglandin pge2 were found in the cerebrospinal fluid from als patients [ 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202352 12909279 270871 17610 9605 PTGS2 cox 2 cox2 0 1.0 treatment with a selective cox2 inhibitor markedly inhibits production of pge2 in the spinal cord of als mice protecting motor neurones and significantly prolonging survival [ 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 192552 13678536 256990 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cross talk of nitric oxide oxygen radicals and superoxide dismutase regulates the energy metabolism and cell death and determines the fates of aerobic life. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 192553 13678536 256992 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 because mitochondria are the major site of free radical generation they are highly enriched with enzymes such as mn type superoxide dismutase in matrix and antioxidants including gsh on both sides of inner membranes thus minimizing oxidative stress in and around this organelle. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 192554 13678536 256994 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the present work shows that cu/zn type superoxide dismutase which has been postulated for a long time to be a cytosolic enzyme also localizes bound to inner membranes of mitochondria thereby minimizing oxidative stress in and around this organelle while mitoc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196463 14572730 262141 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 neurons but may also involve altered function of non neural cells. _amp_#x201c;non cell autonomous_amp_#x201d; death of neurons is induced by the pro oxidant activity of a mutant form of copper/zinc superoxide dismutase sod 1 in patients with familial als which supports a crucial role of glia in the pathogenesis of als. 6 7 and 8 several findings indicate that neuroinflammatory processes mediate als pathogenesis and 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 186281 14625013 249317 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 transgenic mice overexpressing the human mutated form g93a of cu zn superoxide dismutase msod1 develop motor neuron degeneration resembling amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 186282 14625013 249325 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the exact etiology of the disease is unknown but mutations in the gene encoding cu zn superoxide dismutase sod1 are found in approximately 2% of als patients [ 12 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187460 14648077 250304 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187462 14648077 250304 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 by prx2 and gpx1 that direct 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187463 14648077 250304 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 otect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 by prx2 and gpx1 that directly regulate the redox system 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187465 14648077 250304 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then co 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187466 14648077 250309 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin 2 0 1.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187467 14648077 250309 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase 1 0 1.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187469 14648077 250309 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187470 14648077 250313 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 for the first antioxidant enzyme group three isoforms of superoxide dismutase sod [ec 1.15.1.1] have been identified: sod1 sod2 and sod3 [ 9 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187471 14648077 250314 3544 1516 CAT catalase catalase 0 1.0 in the second enzyme group the peroxiredoxin prx and glutathione peroxidase gpx families as well as catalase localized within peroxisomes have been identified. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187472 14648077 250315 3544 1516 CAT catalase catalase 0 1.0 unlike sod and catalase enzymes of the prx and gpx families require secondary enzymes and cofactors to function at high efficiency. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187473 14648077 250319 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 peroxiredoxin2 prx2 is a novel organ specific antioxidative enzyme that is mainly expressed in mammalian brain [ 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187474 14648077 250321 23454 12435 TXN thioredoxin thioredoxin 0 1.0 prx2 requires thioredoxin reductase tr as a secondary enzyme as well as thioredoxin and nadph as cofactors to function at high efficiency; the activity of prx2 in the thioredoxin/tr/nadph system is over five times higher than that of prx2 by itself [ 5 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187476 14648077 250322 17266 9354 PRDX3 thioredoxin-dependent peroxide reductase thioredoxin dependent peroxide reductase 0 1.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187477 14648077 250322 17264 9353 PRDX2 thioredoxin-dependent peroxide reductase 1 thioredoxin dependent peroxide reductase 1 0 1.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187479 14648077 250322 17264 9353 PRDX2 thioredoxin peroxidase 1 thioredoxin peroxidase 1 0 1.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187480 14648077 250323 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in addition to controlling the intracellular content of h 2 o 2 prx2 directly regulates the redox signals of the thioredoxin/tr/nadph system because alone the secondary enzyme and cofactors i.e. thioredoxin/tr/nadph can not directly regulate the redox system and can not act on h 2 o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187481 14648077 250327 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 like prx2 gpx1 needs glutathione reductase gr as a secondary enzyme as well as glutathione and nadph as cofactors to work at high efficiency and this process is also one of the redox signals in living cells [ 21 24 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187483 14648077 250336 551 399 ALB serum albumin serum albumin 0 1.0 n of polyclonal antibody against prx2 a synthetic peptide corresponding to the c terminal region of prx2 amino acids 184_amp_#x2013;198: nh 2 kpnvddskeyfskhn cooh with or without conjugation to human serum albumin hsa at the carboxyl end was supplied by peptide institute osaka japan . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187484 14648077 250354 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 the anti prx2 antibody recognizes the hsa conjugated prx2 peptide but does not react with has prx2 peroxiredoxin2 elisa enzyme linked immunosorbent assay has human serum albumin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187485 14648077 250354 551 399 ALB serum albumin serum albumin 0 1.0 the anti prx2 antibody recognizes the hsa conjugated prx2 peptide but does not react with has prx2 peroxiredoxin2 elisa enzyme linked immunosorbent assay has human serum albumin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187486 14648077 250360 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 table 1 characteristics of five fals cases fals familial amyotrophic lateral sclerosis sod superoxide dismutase lbhi lewy body like hyaline inclusion 2 bp two base pair pci posterior column involvement type + detected nd not determined as asphyxia ih intraperitoneal hemorrhage rd respiratory distress pn pneumo 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187488 14648077 250372 551 399 ALB serum albumin serum albumin 0 1.0 the following primary antibodies were utilized: an affinity purified rabbit antibody against prx2 concentration: 1 _amp_micro;g/ml a polyclonal antibody to gpx1 [diluted 1:2 000 in 1% bovine serum albumin containing phosphate buffered saline bsa pbs ph 7.4] [ 2 ] and a polyclonal antibody to human sod1 diluted 1:10 000 in 1% bsa pbs ph 7.4 [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187489 14648077 250401 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187490 14648077 250401 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187491 14648077 250414 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 b _amp_#x2013; f no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187492 14648077 250414 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 b _amp_#x2013; f no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187493 14648077 250438 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 lization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187494 14648077 250438 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 r stainability and immunolocalization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187496 14648077 250438 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 similar stainability and immunolocalization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187497 14648077 250447 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 hese three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187498 14648077 250447 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 onal immunolocalizations of these three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187500 14648077 250447 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 the precise intra inclusional immunolocalizations of these three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187501 14648077 250450 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 round and sausage like lbhis in the neuropil are positive for both sod1 and prx2 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187502 14648077 250450 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase1 0 1.0 round and sausage like lbhis in the neuropil are positive for both sod1 and prx2 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187503 14648077 250453 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 round lbhis in the neuropil are positive for both sod1 and gpx1 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion gpx1 glutathione peroxidase1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187504 14648077 250453 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase1 0 1.0 round lbhis in the neuropil are positive for both sod1 and gpx1 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion gpx1 glutathione peroxidase1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187505 14648077 250469 21633 11506 SYP synaptophysin synaptophysin 0 1.0 or normal cytosolic constitutive proteins including tubulin and tau protein as well as neuron specific constitutive proteins containing phosphorylated neurofilament proteins nfp nonphosphorylated nfp synaptophysin and neuron specific enolase [ 13 17 18 ]; this results in partial impairment of the maintenance of cell metabolism [ 13 17 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187506 14648077 250469 12369 6893 MAPT tau protein tau protein 0 1.0 such sequestration into lbhis has also been observed for normal cytosolic constitutive proteins including tubulin and tau protein as well as neuron specific constitutive proteins containing phosphorylated neurofilament proteins nfp nonphosphorylated nfp synaptophysin and neuron specific enolase [ 13 17 18 ]; this results in par 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188363 14660707 251221 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 p experiments were performed on vulnerable hypoglossal motoneurones mns and mitochondrial function was disturbed by bath application of 1_amp_#x02013;2 m m sodium cyanide cn which inhibits complex iv cytochrome c oxidase of the electron transport chain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188365 14660707 251324 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 we investigated the impact of a disturbed respiratory chain on membrane currents and [ca 2+ ] i using cyanide cn a known inhibitor of cytochrome c oxidase complex iv . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188366 14660707 251379 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 this is based on the observation that impaired vascular endothelial growth factor vegf synthesis due to hypoxia selectively damages mns oosthuyse et al 2001 ; lambrechts et al 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189433 14690536 252558 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 expression of sod1 g93a or wild type sod1 in primary cultures of astrocytes down regulates the glutamate transporter glt 1: lack of involvement of oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189435 14690536 252562 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 using western blotting immunocytochemistry and rt pcr it was shown that expression of either hsod1 g93a or hsod1wt in astrocytes produced down regulation of the levels of a glutamate transporter glt 1 without alterations in its mrna level. hsod1 g93a or hsod1wt expression caused a decrease of the monomeric form of glt 1 without increasing oxidative multimers of glt 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189436 14690536 252562 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 without alterations in its mrna level. hsod1 g93a or hsod1wt expression caused a decrease of the monomeric form of glt 1 without increasing oxidative multimers of glt 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189437 14690536 252563 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the effects were selective to glt 1 since another glutamate transporter glast protein and mrna levels were not altered. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189438 14690536 252564 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 reflecting the decrease in glt 1 protein [3h]d aspartate uptake was reduced in cultures expressing hsod1 g93a or hsod1wt. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189439 14690536 252565 3544 1516 CAT catalase catalase 0 1.0 the hsod1 induced decline in glt 1 protein and [3h]d aspartate uptake was not blocked by the antioxidant trolox nor potentiated by antioxidant depletion using catalase and glutathione peroxidase inhibitors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189440 14690536 252565 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the hsod1 induced decline in glt 1 protein and [3h]d aspartate uptake was not blocked by the antioxidant trolox nor potentiated by antioxidant depletion using catalase and glutathione peroxidase inhibitors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189441 14690536 252567 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 this study suggests that levels of glt 1 protein in astrocytes are reduced rapidly by overexpression of hsod1 and is due to a property shared between the wild type and g93a mutant form but does not involve the production of intracellular ox 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189442 14690536 252569 20017 10940 SLC1A2 excitatory amino acid transporter 2 excitatory amino acid transporter 2 0 1.0 excitatory amino acid transporter 2|sod1 g93a protein|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189760 14698606 252862 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 most cases are sporadic although a subset 10% is familial with 20% of these being linked to mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189761 14698606 252906 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 specifically the astrocytic glutamate transporter glt 1 also known as the excitatory amino acid transporter eaat 2 appears to be particularly affected [ 34 and 35 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189762 14698606 252923 17610 9605 PTGS2 cox 2 cox 2 0 1.0 supporting a role for inflammation inhibitors of the enzyme cyclooxygenase 2 cox 2 have shown beneficial effects in sod1 mutant mouse models [ 49 and 50 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189763 14698606 252929 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 indeed the glt 1 transporter which is damaged in als is concentrated in astrocytic processes directly abutting motor neurons [ 55 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189764 14698606 252941 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 they are also compatible with possible apoptotic contributions to motor neuron loss in als [ 58 ] because mitochondria which contain cytochrome c and other apoptotic mediators are crucial regulators of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190875 14739060 254345 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 neuronal increases in calcium can activate a series of enzymes including protein kinase c proteases phosphatases phospholipases nnos and xanthine oxidase [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190876 14739060 254345 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 neuronal increases in calcium can activate a series of enzymes including protein kinase c proteases phosphatases phospholipases nnos and xanthine oxidase [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190877 14739060 254356 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 astrocytes take up glutamate convert it to glutamine through the action of glutamine synthetase an enzyme requiring atp and then release it for uptake by neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190878 14739060 254357 8420 4331 GLS glutaminase glutaminase 0 1.0 neurons then convert glutamine back to glutamate through the action of glutaminase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190879 14739060 254358 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 this cycle can be disrupted by inhibitors of glutamine synthetase an enzyme which can be easily damaged by oxidative stress [ 31 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190880 14739060 254360 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 finally excessive response to glutamate receptor mediated stimulation occur intra cellularly [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190881 14739060 254366 1576 990 BCL2 bcl 2 bcl2 0 1.0 three main signals cause the release of apoptogenic mitochondrial mediators: _amp_#x2022; pro apoptotic members of bcl2 family _amp_#x2022; elevated levels of intra cellular calcium such as that triggered by excitotoxicity _amp_#x2022; elevated levels of ros_amp_#x2013;rns 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190882 14739060 254368 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 hen it is released from the mitochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to inhibitors of activated caspases and causes further caspase activation _amp_#x2022; apoptosis inducing factor and endonuclease g mediate caspase independent cell death pathways 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190883 14739060 254368 6634 3346 ENDOG endonuclease g endonuclease g 0 1.0 tochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to inhibitors of activated caspases and causes further caspase activation _amp_#x2022; apoptosis inducing factor and endonuclease g mediate caspase independent cell death pathways 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190884 14739060 254368 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 _amp_#x2022; cytochrome c a member of the mitochondrial electron chain required for the generation of atp when it is released from the mitochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to in 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190885 14739060 254371 5696 2773 DFFB caspase-activated dnase caspase activated dnase 0 1.0 he collapse of trans membrane electrochemical gradient the loss of matrix solutes the swelling of mitochondria causing the release of cytochrome c procapases 2 3 and 9 apoptosis initiating factor and caspase activated dnase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190886 14739060 254371 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 this results in the collapse of trans membrane electrochemical gradient the loss of matrix solutes the swelling of mitochondria causing the release of cytochrome c procapases 2 3 and 9 apoptosis initiating factor and caspase activated dnase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190887 14739060 254372 5696 2773 DFFB caspase-activated dnase caspase activated dnase 0 1.0 cytochrome c and the cytosolic factor apaf1 activate the caspases while apoptosis initiating factor and caspase activated dnase move to the nucleus initiating apoptosis or programmed cell death [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190888 14739060 254372 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c and the cytosolic factor apaf1 activate the caspases while apoptosis initiating factor and caspase activated dnase move to the nucleus initiating apoptosis or programmed cell death [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190889 14739060 254382 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 g93a transgenic mouse [ 46 50 47 48 and 49 ]. _amp_#x2022; protein misfolding and aggregates: for example of a_amp_#x3b2; 42 for ad [ 43 ]. _amp_#x2022; proteasome dysfunction on ubiquinited material ubiquitin forms covalent bonds with other protein in order to mark them for degradation by an atp dependent non lysosomial proteolytic system i.e proteasome . _amp_#x2022; oxidative stress mitochondria dysfunc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190890 14739060 254392 17381 9461 PRPH peripherin peripherin 0 1.0 another intermediate filament peripherin is found in neuronal inclusions in patients with sporadic als and in transgenic mice with sod1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190891 14739060 254396 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the involvement of mitochondria and apoptosis in neuronal death is too revealed by a prolonged period of neuronal caspase activation especially caspase 1 [ 17 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190892 14739060 254397 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 ice [ 46 and 63 ] revealed an up regulation of gene related to an inflammatory process such as tnf_amp_#x3b1; gene resulting in glial activation together with change in apoptosis related gene such as caspase 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190893 14739060 254401 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 in familial forms missense mutation have been identified for gene encoding _amp_#x3b2; amyloid precursor protein as well as presenilin 1 psen1 and presenilin 2 psen2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190894 14739060 254401 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 in familial forms missense mutation have been identified for gene encoding _amp_#x3b2; amyloid precursor protein as well as presenilin 1 psen1 and presenilin 2 psen2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190895 14739060 254402 12369 6893 MAPT tau protein tau protein 0 1.0 the sporadic forms are thought to result from a complex interaction among multiple predisposing genes such as variant apoe the gene for _amp_#x3b1; 2 macrogobulin and perhaps the gene for tau protein and other factors including environmental contributions and occurrence by chance [ 45 and 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190896 14739060 254403 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 tion of proteins: microtubular tau protein for the former accumulation of several aggregated proteins _amp_#x3b2; amyloid especially its toxic form a_amp_#x3b2; 42 apoe [ 43 ] hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0;and 2 with an inflammatory reaction around the deposit of _amp_#x3b2; amyloid for the latter [ 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190897 14739060 254403 12369 6893 MAPT tau protein tau protein 0 1.0 the neuropathological hallmarks neurofibrillary tangles and senile plaques are both aggregation of proteins: microtubular tau protein for the former accumulation of several aggregated proteins _amp_#x3b2; amyloid especially its toxic form a_amp_#x3b2; 42 apoe [ 43 ] hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0;and 2 with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190899 14739060 254413 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 1.0 parkin is one member of the family of ubiquitin ligase responsible for ubiquination a process tagging proteins for degradation through proteosomal pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190900 14739060 254425 9766 4851 HTT huntingtin huntingtin 0 1.0 the increased number in gag repeats in the mutant gene are expressed as an elongated huntingtin protein [ 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190901 14739060 254426 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 as demonstrated in transgenic mouse this abnormal protein is cleaved to fragments conjugated with ubiquitin; which aggregate forming neuronal intra nuclear inclusions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190905 14739060 254456 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 primary coenzyme q deficiency cause a mitochondrial encephalomyopathy that is responsive to coenzyme q administration [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190906 14739060 254489 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 clinical trials are underway to test inhibitors of apoptosis such as minocycline [ 17 ] coenzyme q in pd [ 56 ] and many others using so called antioxidants despite disappointing results obtained [ 51 and 52 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190907 14739060 254491 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 then the antioxidant defenses: vitamins a e c selenium food rich in vegetables and fruits and perhaps by using mitochondrial cofactors such as l carnitine r _amp_#x3b1; lipoic acid [ 35 ] riboflavine coenzyme q etc. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183237 15031734 244221 211 132 ACTB beta actin beta actin 0 1.0 all four bases of dna are susceptible to oxidative damage involving hydroxylation 7 and significant protein carbonylation for example of creatine kinase and beta actin 2 and nitration is observed in ad brains whereas increased levels of 8 hydroxyguanine and 8 hydroxy 2 deoxyguanosine are observed in pd brains; the selective attack on guanine bases implies oh radica 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183238 15031734 244221 4423 1991 CKB creatine kinase creatine kinase 0 1.0 all four bases of dna are susceptible to oxidative damage involving hydroxylation 7 and significant protein carbonylation for example of creatine kinase and beta actin 2 and nitration is observed in ad brains whereas increased levels of 8 hydroxyguanine and 8 hydroxy 2 deoxyguanosine are observed in pd brains; the selective attack on guanine bases im 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183239 15031734 244223 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 in the ad brain the activity of the antioxidant proteins catalase superoxide dismutase sod glutathione peroxidase and glutathione reductase are increased in the hippocampus and amygdala 9 10 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183240 15031734 244223 3544 1516 CAT catalase catalase 0 1.0 in the ad brain the activity of the antioxidant proteins catalase superoxide dismutase sod glutathione peroxidase and glutathione reductase are increased in the hippocampus and amygdala 9 10 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183241 15031734 244223 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in the ad brain the activity of the antioxidant proteins catalase superoxide dismutase sod glutathione peroxidase and glutathione reductase are increased in the hippocampus and amygdala 9 10 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183242 15031734 244229 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 glutamate and glucose from cell culture 12 whereas hne modifies proteins resulting in a multitude of effects including inhibition of the neuronal glucose transporter type 3 the glutamate transporter glt 1 ref 13 as well as the na + +k + atpases 14 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183243 15031734 244229 20025 11007 SLC2A3 glucose transporter type 3 glucose transporter type 3 0 1.0 acrolein downregulates the uptake of glutamate and glucose from cell culture 12 whereas hne modifies proteins resulting in a multitude of effects including inhibition of the neuronal glucose transporter type 3 the glutamate transporter glt 1 ref 13 as well as the na + +k + atpases 14 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183244 15031734 244230 12337 6871 MAPK1 mitogen-activated protein kinase 1 mitogen activated protein kinase 1 0 1.0 hne activates c jun aminoterminal kinases and mitogen activated protein kinase 1 also known as p38 thereby stimulating an apoptotic cascade 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183245 15031734 244230 10824 6204 JUN c jun c jun 0 1.0 hne activates c jun aminoterminal kinases and mitogen activated protein kinase 1 also known as p38 thereby stimulating an apoptotic cascade 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183246 15031734 244231 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 modifications to proteins result in the impairment of enzymes for example glutamine synthase superoxide dismutase whereas ros interactions with dna lead to mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183247 15031734 244242 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 n redox active metals and oxygen species via reactions such as the fenton and haber weiss reactions or via indirect pathways involving the calcium activation of metallo enzymes such as phospholipases nitric oxide synthase and xanthine dehydrogenase also known as xanthine oxidase 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183248 15031734 244242 24288 12805 XDH xanthine dehydrogenase xanthine dehydrogenase 0 1.0 oxygen species via reactions such as the fenton and haber weiss reactions or via indirect pathways involving the calcium activation of metallo enzymes such as phospholipases nitric oxide synthase and xanthine dehydrogenase also known as xanthine oxidase 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183249 15031734 244242 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 the fenton and haber weiss reactions or via indirect pathways involving the calcium activation of metallo enzymes such as phospholipases nitric oxide synthase and xanthine dehydrogenase also known as xanthine oxidase 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183250 15031734 244251 7975 3951 FXN frataxin frataxin 0 1.0 we have proposed that the proteins implicated in several age dependent neurodegenerative disorders a beta in ad alpha synuclein in pd sod1 in als frataxin in friedreich's ataxia box 1 and alpha b crystallin in cataracts might abnormally present cu 2+ or fe 3+ ligands for inappropriate reaction with o 2 fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183251 15031734 244251 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 we have proposed that the proteins implicated in several age dependent neurodegenerative disorders a beta in ad alpha synuclein in pd sod1 in als frataxin in friedreich's ataxia box 1 and alpha b crystallin in cataracts might abnormally present cu 2+ or fe 3+ ligands for inappropriate reaction with o 2 fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183252 15031734 244263 20351 17128 SLC39A3 zinc transporter zinc transporter 0 1.0 results have highlighted the importance of zn 2+ in amyloid plaque formation; for example age and female sex related plaque formation in tg2576 transgenic mice was reduced by genetic ablation of the zinc transporter 3 protein which is required for zinc transport into synaptic vesicles 36 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183253 15031734 244277 3544 1516 CAT catalase catalase 0 1.0 synthetic a beta is toxic to cells in the presence of cu 2+ but this toxicity is inhibited by extracellular catalase which implicates h 2 o 2 in the toxic pathway 50 51 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183254 15031734 244301 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the principal protein component of these deposits is alpha synuclein 65 which is ubiquitously expressed in the brain; mutations of alpha synuclein a30p and a53t contribute to familial forms of the disease 66 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183255 15031734 244314 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 a diverse array of evidence is emerging that alpha synuclein has a role in modulating the activity of dopamine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183256 15031734 244316 17754 9752 QDPR dihydropteridine reductase dihydropteridine reductase 0 1.0 the mutations in alpha synuclein have been shown to alter the expression of dihydropteridine reductase which indirectly regulates the synthesis of dopamine 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183257 15031734 244316 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the mutations in alpha synuclein have been shown to alter the expression of dihydropteridine reductase which indirectly regulates the synthesis of dopamine 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183258 15031734 244317 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 synuclein forms stable complexes with the human dopamine transporter thereby inhibiting uptake of dopamine by its transporter 80 and that alpha synuclein can regulate dopamine synthesis by inhibiting tyrosine hydroxylase 81 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183259 15031734 244317 20070 11049 SLC6A3 dopamine transporter dopamine transporter 0 1.0 co immunoprecipitation experiments have shown that alpha synuclein forms stable complexes with the human dopamine transporter thereby inhibiting uptake of dopamine by its transporter 80 and that alpha synuclein can regulate dopamine synthesis by inhibiting tyrosine hydroxylase 81 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183260 15031734 244317 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 co immunoprecipitation experiments have shown that alpha synuclein forms stable complexes with the human dopamine transporter thereby inhibiting uptake of dopamine by its transporter 80 and that alpha synuclein can regulate dopamine synthesis by inhibiting tyrosine hydroxylase 81 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183261 15031734 244318 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the link between alpha synuclein and redox chemistry associated with iron bound dopamine/neuromelanin has been given further credence by a study showing that initiation of lewy body formation coincides with alpha synuclein depositio 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183262 15031734 244318 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 and redox chemistry associated with iron bound dopamine/neuromelanin has been given further credence by a study showing that initiation of lewy body formation coincides with alpha synuclein deposition exclusively within lipofuscin and neuromelanin deposits 82 ; in addition alpha synuclein crosslinked to neuromelanin has been reported 83 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183263 15031734 244318 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 deposition exclusively within lipofuscin and neuromelanin deposits 82 ; in addition alpha synuclein crosslinked to neuromelanin has been reported 83 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183264 15031734 244319 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the breakdown in alpha synuclein modulated dopamine homeostasis is consistent with the recent observation that the pathogenicity of mutant alpha synuclein is dopamine dependent 84 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183265 15031734 244320 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 in addition to the regulation of dopamine by alpha synuclein studies have shown a direct interaction of alpha synuclein with metal ions leading to protein aggregation 85 86 87 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183266 15031734 244321 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 methionine oxidation inhibits alpha synuclein aggregation; however in the presence of certain metal ions aggregation and fibrillization of alpha synuclein still occurs 88 which highlights a potential role of metals and oxidative stress in the deposition of alpha synuclein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183267 15031734 244321 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 still occurs 88 which highlights a potential role of metals and oxidative stress in the deposition of alpha synuclein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183268 15031734 244354 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 are continuing with regard to the design of small molecule stimulators of endogenous neurotrophins an alternative approach to increasing endogenous neurotrophins _amp_#8212; for example brain derived neurotrophic factor which is known to enhance learning and memory and also protect against oxidative stress _amp_#8212; is caloric restriction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183269 15031734 244354 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 hough efforts are continuing with regard to the design of small molecule stimulators of endogenous neurotrophins an alternative approach to increasing endogenous neurotrophins _amp_#8212; for example brain derived neurotrophic factor which is known to enhance learning and memory and also protect against oxidative stress _amp_#8212; is caloric restriction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183270 15031734 244392 12337 6871 MAPK1 mitogen-activated protein kinase 1 mitogen activated protein kinase 1 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183271 15031734 244392 7975 3951 FXN frataxin frataxin 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183272 15031734 244392 211 132 ACTB beta actin beta actin 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183273 15031734 244392 4423 1991 CKB creatine kinase creatine kinase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183274 15031734 244392 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183275 15031734 244392 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183276 15031734 244392 24288 12805 XDH xanthine dehydrogenase xanthine dehydrogenase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183277 15031734 244392 3544 1516 CAT catalase catalase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183278 15031734 244392 20025 11007 SLC2A3 glucose transporter type 3 glucose transporter type 3 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183279 15031734 244394 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 alzheimer's disease amyotrophic lateral sclerosis friedreich's ataxia huntington's disease nitric oxide synthase parkinson's disease stroke wilson's disease 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183280 15031734 244401 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 a beta amyloid beta; ros reactive oxygen species; sod superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183281 15031734 244415 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the equilibrium between vesicle bound dopamine and cytoplasmic dopamine is regulated by alpha synuclein; mutations in this protein shift the dopamine equilibrium in favour of the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183282 15031734 244416 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 in the presence of fe and under conditions of oxidative stress alpha synuclein will aggregate and form deposits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183283 15031734 244417 13411 7212 MPHOSPH1 mpp 1 mpp 1 0 1.0 mpp 1 methyl 4 phenyl pyridine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183284 15031734 244420 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the normal function of superoxide dismutase sod is to convert toxic superoxide radicals into h 2 o 2 that are subsequently inactivated by catalase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 184282 15038597 246226 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 in particular we recently demonstrated that in copper deficiency mitochondrial function is impaired due to decreased activity of cytochrome c oxidase leading to production of reactive oxygen species which in turn triggers mitochondria mediated apoptotic neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 177202 15105254 236595 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 in parkinson's disease pd mitochondrial toxins and perturbed ubiquitin dependent proteolysis may impair atp production and increase oxyradical production and maos. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 177203 15105254 236596 9766 4851 HTT huntingtin huntingtin 0 1.0 the inheritance of polyglutamine expanded huntingtin may promote neuronal degeneration in huntington's disease hd in part by increasing maos. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169744 15208263 227119 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the gene coding for the ubiquitous anti oxidant enzyme cu zn superoxide dismutase sod1 are associated with familial amyotrophic lateral sclerosis fals a fatal disease characterized by selective loss of motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169745 15208263 227122 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 we show that human glioblastoma cells expressing g93a sod1 induce activation of caspase 1 release of cytokines and activation of apoptotic pathways in cocultured human neuroblastoma cells also expressing g93a sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169746 15208263 227123 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 activation of caspase 1 and caspase 3 is observed also in neuroblastoma lines expressing other fals sod1s g37r g85r and i113t cocultured with glioblastoma lines expressing the corresponding mutant enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169747 15208263 227123 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 activation of caspase 1 and caspase 3 is observed also in neuroblastoma lines expressing other fals sod1s g37r g85r and i113t cocultured with glioblastoma lines expressing the corresponding mutant enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169748 15208263 227126 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 proinflammatory cytokines interferon gamma and nitric oxide are among the molecular signals exchanged between glial and neuronal cells that generate a functional interplay between the two cell types. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169749 15208263 227131 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 cytokines|enzyme inhibitors|lipopolysaccharides|noc 18|nitric oxide donors|nitroso compounds|reactive oxygen species|ng nitroarginine methyl ester|interferon type ii|catalase|nitric oxide synthase|sod1 g93a protein|superoxide dismutase 1|superoxide dismutase|caspase 1| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 172854 15266948 231018 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 melatonin has been shown to either stimulate gene expression for the antioxidant enzymes superoxide dismutase catalase glutathione peroxidase glutathione reductase or to increase their activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 172855 15266948 231018 3544 1516 CAT catalase catalase 0 1.0 melatonin has been shown to either stimulate gene expression for the antioxidant enzymes superoxide dismutase catalase glutathione peroxidase glutathione reductase or to increase their activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 172856 15266948 231018 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 melatonin has been shown to either stimulate gene expression for the antioxidant enzymes superoxide dismutase catalase glutathione peroxidase glutathione reductase or to increase their activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175554 15333927 234325 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 structure of the cytosolic cu zn superoxide dismutase from schistosoma mansoni. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175555 15333927 234326 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cu zn superoxide dismutase cu zn sod is an essential enzyme for protecting cells from the toxic effects of reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175556 15333927 234330 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 this is the first report of a crystal structure of a cu zn superoxide dismutase derived from a human parasite. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 166654 15480846 223890 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 iron has been shown to accumulates at site where neurons degenerate in neurodegenerative diseases of parkinson s disease alzheimer s disease huntington disease amyotrophic lateral sclerosis and friedreich ataxia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151511 15812313 199883 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the copper_amp_#47;zinc superoxide dismutase sod1 gene are known to be responsible for familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151512 15812313 199887 3542 1515 CAST calpain inhibitor calpain inhibitor 0 1.0 moreover this copper induced toxicity was attenuated by a free radical scavenger a caspase inhibitor or a calpain inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151513 15812313 199891 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the mutation in the copper_amp_#47;zinc superoxide dismutase sod1 gene is known to be associated with the familial als fals because of some undefined property of mutant sod1 protein _amp_#91; 1 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151514 15812313 199907 16325 8808 PDHB pyruvate dehydrogenase pyruvate dehydrogenase 0 1.0 copper overload induces lipid peroxidation marked by the formation of 4 hydroxy nonenal and it inhibits pyruvate dehydrogenase pdh by covalently modifying the lipoic acid moiety of the enzyme _amp_#91; 10 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151515 15812313 199917 3542 1515 CAST calpain inhibitor calpain inhibitor 0 1.0 of cells expressing mutant sod1 the cells were treated with various agents prior to exposing the cells to cu 2_amp_#43; namely enzyme inhibitors _amp_#91;z vad fmk a pan caspase inhibitor calpeptin a calpain inhibitor _amp_#93; intermediates of energy metabolism or cofactors of mitochondrial enzymes pyruvate thiamine lipoic acid alternate energy substrates lactate oxaloacetate [alpha] ketoglutarate free radical sc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151516 15812313 199948 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 copper is an essential trace metal and is required for the proper functioning of several enzymes including cytochrome c oxidase ceruloplasmin and sod1 _amp_#91; 13 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151518 15812313 199948 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 copper is an essential trace metal and is required for the proper functioning of several enzymes including cytochrome c oxidase ceruloplasmin and sod1 _amp_#91; 13 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151519 15812313 199957 16325 8808 PDHB pyruvate dehydrogenase pyruvate dehydrogenase 0 1.0 this cu 2_amp_#43; neurotoxicity was attenuated by the pyruvate dehydrogenase cofactors thiamine or dihydrolipoic acid. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 154000 15850589 203907 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 nitrocellulose membranes were probed with a polyclonal sheep anti human superoxide dismutase cu/zn antibody 1:1000; calbiochem emd biosciences inc la jolla ca usa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 154001 15850589 204017 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 failure to maintain this condition can result from several mechanisms including oxidative modifications of critical thiols in the inner mitochondrial membrane particularly in mptp components such as adenine nucleotide translocator ant . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 154002 15850589 204046 1576 990 BCL2 bcl 2 bcl2 0 1.0 treatment with inhibitors of mptp opening and overexpression of bcl2 which inhibits the opening of mptp under stressful conditions delayed the disease onset and prolonged survival in transgenic mice with mutant sod1 [42] [43] and [44] and rendered cells transfected wi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142775 15863242 187979 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 cu/zn superoxide dismutase 1 sod1 encoded on chromosome 21 is a key enzyme in metabolism of oxygen free radicals and oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142777 15863242 187987 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 the human cu/zn superoxide dismutase 1 gene hsod1 was the first chromosome 21 gene to be characterised groner et al. 1985 and it was even shown earlier to be overexpressed at the protein level in down syndrome ds; trisomy 21 patients sine 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142778 15863242 188041 21672 11517 TAC1 substance p substance p 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142779 15863242 188041 8831 4605 GRP bombesin bombesin 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142780 15863242 188041 452 333 AGT angiotensin i angiotensin i 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142781 15863242 188041 452 333 AGT angiotensin ii angiotensin ii 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142782 15863242 188092 3843 1618 CCT5 tcp 1 epsilon tcp 1 epsilon 0 1.0 eight t complex 1 proteins tcp 1 were studied in ds brain; the tcp 1 epsilon yoo et al. 2001a as well as alpha and beta subunits were significantly decreased in fetal second trimester ds brain yoo et al. 2001b and decrease of the gamma subunit was here observed in hippocampus 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142783 15863242 188092 21932 11655 TCP1 t-complex 1 t complex 1 0 1.0 eight t complex 1 proteins tcp 1 were studied in ds brain; the tcp 1 epsilon yoo et al. 2001a as well as alpha and beta subunits were significantly decreased in fetal second trimester ds brain yoo et al. 2001b and dec 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142784 15863242 188097 23397 12408 TUBA3C tubulin, alpha 2 tubulin alpha 2 0 1.0 while reduced neurofilament triplet m protein and neuronal tropomodulin markers for neuronal density may simply indicate neuronal loss in brain of transgenic animals tubulin alpha 2 and beta chains were overexpressed in this study ruling out that decrease of proteins in this study was simply due to neuronal loss. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142785 15863242 188099 6372 3189 EEF1A1 ef tu ef tu 0 1.0 species ros with subsequent oxidation and modification of transcription neurodegeneration per se or general impairment of translation reflected by reduced expression of translation elongation factor ef tu like protein p43 table 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142786 15863242 188105 6135 3013 DPYS dihydropyrimidinase dihydropyrimidinase 0 1.0 a most intriguing finding was misexpression of dihydropyrimidinase related proteins major neuronal migration guidance cues in tg hsod1 mice: pathfinding of growing axons to reach their target during brain development or modeling is a subtle process needed to build u 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142787 15863242 188106 6135 3013 DPYS dihydropyrimidinase dihydropyrimidinase 0 1.0 abnormal brain development in ds was described in a couple of morphological reports becker et al. 1991 epstein 1995 wisniewski and bobinski 1991 and wisniewski and kida 1994 and decrease of dihydropyrimidinase related protein 2 in ds was previously observed weitzdoerfer et al. 2001a and weitzdoerfer et al. 2001b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142788 15863242 188107 6135 3013 DPYS dihydropyrimidinase dihydropyrimidinase 0 1.0 expressional patterns of several dihydropyrimidinase related proteins including isoforms or posttranslational modifications thereof in tg hsod1 mice and in ds were similar and may represent or lead to neurodegenerative changes abnormal wiring and plast 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142790 15863242 188108 23546 17598 UBE2J1 ubiquitin-conjugating enzyme e2 ubiquitin conjugating enzyme e2 0 1.0 finally the manifold decrease of ubiquitin conjugating enzyme e2 level in tg hsod1 mice catalyzing covalent attachment of ubiquitin to other proteins may reflect sod1 mediated impaired protein handling in terms of ubiquitination. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142793 15863242 188110 23406 20778 TUBB tubulin beta polypeptide tubulin beta polypeptide 0 1.0 we have included fragments of two proteins table 1 similar to tubulin beta polypeptide and sex determining protein that were differentially expressed between groups but these were not included in the discussion as no definitive assignment can be made based upon an incomplete sequence. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144769 15896810 189884 7975 3951 FXN frataxin frataxin 0 1.0 recent evidence suggests that frataxin might detoxify ros via activation of glutathione peroxidase and elevation of thiols and in addition that decreased expression of frataxin protein is associated with frda. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144771 15896810 189891 9462 5013 HMOX1 ho 1 ho 1 0 1.0 among the various hsps hsp32 also known as heme oxygenase i ho 1 has received considerable attention as it has been recently demonstrated that ho 1 induction by generating the vasoactive molecule carbon monoxide and the potent antioxidant bilirubin could represent a protective system potentially active against brain oxidative injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144772 15896810 189901 5180 17937 CUZD1 erg 1 erg 1 0 1.0 there is evidence to support that oxidative stress alters the expression of antioxidant enzymes and enhances expression and/or dna binding of numerous transcription factors including ap 1 fos jun myc erg 1 sapk and nfkb [3] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144773 15896810 189901 7683 3796 FOS ap 1 ap 1 0 1.0 there is evidence to support that oxidative stress alters the expression of antioxidant enzymes and enhances expression and/or dna binding of numerous transcription factors including ap 1 fos jun myc erg 1 sapk and nfkb [3] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144774 15896810 189908 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however although activation of stress tolerance signaling leading to protective nuclear responses such as increased expression of heat shock proteins antioxidant enzymes and bcl 2 may be triggered to withstand all the above mentioned pathogenic changes a vicious cycle of increasing oxidative damage may insidiously develop over a period of years inducing progressive degenerativ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144775 15896810 189910 22023 11740 TF transferrin transferrin 0 1.0 evated content of iron in specific areas of the human brain such as globus pallidus and substantia nigra sn while cerebrospinal fluid has very little iron binding capacity owing to its low content of transferrin; e cns contains non replicating neuronal cells which once damaged may be permanently dysfunctional or committed to programmed cell death apoptosis . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144776 15896810 189910 3544 1516 CAT catalase catalase 0 1.0 ble substrates such as polyunsaturated fatty acids and catecholamines; b relatively low levels of antioxidants such as glutathione and vitamin e and antioxidant enzymes such as glutathione peroxidase catalase and superoxide dismutase ; c the endogenous generation of reactive oxygen free radicals via several specific reactions; d the elevated content of iron in specific areas of the human brain such as glo 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144777 15896810 189910 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 s such as polyunsaturated fatty acids and catecholamines; b relatively low levels of antioxidants such as glutathione and vitamin e and antioxidant enzymes such as glutathione peroxidase catalase and superoxide dismutase ; c the endogenous generation of reactive oxygen free radicals via several specific reactions; d the elevated content of iron in specific areas of the human brain such as globus pallidus and substant 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144778 15896810 189917 7975 3951 FXN frataxin frataxin 0 1.0 there is now evidence to suggest that frataxin might detoxify ros via activation of glutathione peroxidase and elevation of thiols [10] and in addition that decreased expression of frataxin protein is associated with frda [11] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144779 15896810 189922 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 clinical and genetic features of friedreich ataxia 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144780 15896810 189923 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 friedreich ataxia is the commonest form of inherited ataxia with a frequency of 1 in 50 000 live births. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144781 15896810 189933 7975 3951 FXN frataxin frataxin 0 1.0 mutations in the frda gene either gaa expansions or point mutations result in reduced expression of a protein called frataxin [16] which has been shown to be localized to mitochondria [16] [17] and [18] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144782 15896810 189935 7975 3951 FXN frataxin frataxin 0 1.0 the amount of residual frataxin in lymphoblastoid cell lines from frda patients correlates with the gaa expansion size in the smaller allele [16] and likely represents the molecular basis of the relationship between gaa expansion s 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144783 15896810 189938 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 there is significant evidence that the pathogenesis of several neurodegenerative diseases including parkinson's disease alzheimer's disease friedreich ataxia multiple sclerosis and amyotrophic lateral sclerosis may involve the generation of reactive oxygen species ros reactive nitrogen species rns and mitochondrial dysfunction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144785 15896810 189939 7975 3951 FXN frataxin frataxin 0 1.0 studies using the budding yeast saccharomyces cerevisiae have provided the first clues to understand the consequences of frataxin loss [17] [18] [19] [20] and [21] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144786 15896810 189940 7975 3951 FXN frataxin frataxin 0 1.0 it has been shown that deletion of the yeast frataxin homolog yfh1 results in a 10 fold increase in iron within the mitochondria along with increased ros production [17] and [20] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144787 15896810 189944 7975 3951 FXN frataxin frataxin 0 1.0 recent evidence suggests that frataxin might detoxify ros via activation of glutathione peroxidase and elevation of thiols [10] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144788 15896810 189945 7975 3951 FXN frataxin frataxin 0 1.0 transgenic overexpression of human frataxin increases cellular antioxidant defense via activation of glutathione peroxidase and elevation of reduced thiols thereby reducing the incidence of malignant transformation induced by ros as observed b 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144789 15896810 189946 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 up regulation of protein manganese superoxide dismutase mnsod fails to occur in frda fibroblasts exposed to iron [25] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144791 15896810 189949 7975 3951 FXN frataxin frataxin 0 1.0 there is evidence that frataxin acts as a chaperone for fe ii and a storage compartment for excess iron [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] and [38] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144792 15896810 189950 7975 3951 FXN frataxin frataxin 0 1.0 this is consistent with the roles played by frataxin in iron export fe_amp_#x2013;s cluster assembly heme biosynthesis and prevention of oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144793 15896810 189951 7975 3951 FXN frataxin frataxin 0 1.0 also frataxin plays a direct role in the mitochondrial energy activation and oxidative phosphorylation [11] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144794 15896810 189953 7975 3951 FXN frataxin frataxin 0 1.0 in mouse models deletion of the frataxin gene results in embryonic lethality [40] while its selective inactivation in neuronal and cardiac tissues leads to neurological symptoms and cardiomyopathy associated with mitochondrial iron_amp_#x20 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144795 15896810 189954 7975 3951 FXN frataxin frataxin 0 1.0 in contrast a model expressing 25_amp_#x2013;35% of wild type frataxin levels by virtue of a gaa 230 expansion inserted in the first intron of the mouse gene has no obvious phenotype [39] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144796 15896810 189959 4423 1991 CKB creatine kinase creatine kinase 0 1.0 free metabolically active [adp] the major regulator of the oxidative phosphorylation can be calculated from the mrs data using the creatine kinase equilibrium expression [42] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144797 15896810 189971 7975 3951 FXN frataxin frataxin 0 1.0 the length of the gaa expansion has been shown to determine the amount of frataxin expressed [16] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144798 15896810 189972 7975 3951 FXN frataxin frataxin 0 1.0 therefore the residual expression of frataxin probably determines the reduced skeletal muscle mitochondrial atp production rate we detected in vivo. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144800 15896810 190030 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 other data are also consistent with these findings as it has been shown both in a patient with cytochrome c oxidase deficiency and in an animal model of copper deficiency that more than a 50% deficit in complex iv activity did not affect the respiratory flux [56] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144802 15896810 190045 5893 2898 DLD diaphorase diaphorase 0 1.0 excessive formation of no_amp_#xb7; from glial origin has been evidenced in some study in which nadph diaphorase a cytochemical marker of nos activity positive glial cells have been identified in the substantia nigra of postmortem brains obtained from individuals with parkinson's disease [88] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144803 15896810 190054 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the enzyme responsible for no synthesis is the nitric oxide synthase nos family of enzymes which catalyse the conversion of arginine to citrulline and no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144804 15896810 190061 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 activation of inos requires gene transcription and the induction can be influenced by endotoxin and cytokines interleukin 1 interleukin 2 lipopolysaccharide interferon _amp_#x3b3; tumor necrosis factor . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144805 15896810 190061 10452 6001 IL2 interleukin 2 interleukin 2 0 1.0 activation of inos requires gene transcription and the induction can be influenced by endotoxin and cytokines interleukin 1 interleukin 2 lipopolysaccharide interferon _amp_#x3b3; tumor necrosis factor . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144806 15896810 190061 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 activation of inos requires gene transcription and the induction can be influenced by endotoxin and cytokines interleukin 1 interleukin 2 lipopolysaccharide interferon _amp_#x3b3; tumor necrosis factor . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144807 15896810 190062 10480 5962 IL10 interleukin 10 interleukin 10 0 1.0 this activation can be blocked by anti inflammatory drugs dexamethasone inhibitory cytokines interleukin 4 interleukin 10 prostaglandins pga 2 tissue growth factors or inhibitors of protein synthesis e.g. cycloheximide [94] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144808 15896810 190062 10458 6014 IL4 interleukin 4 interleukin 4 0 1.0 this activation can be blocked by anti inflammatory drugs dexamethasone inhibitory cytokines interleukin 4 interleukin 10 prostaglandins pga 2 tissue growth factors or inhibitors of protein synthesis e.g. cycloheximide [94] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144809 15896810 190066 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the rate of this reaction is three times faster than the rate of superoxide dismutase sod in catalyzing the dismutation of the superoxide anion to hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144811 15896810 190071 551 399 ALB serum albumin serum albumin 0 1.0 nitrosothiols with biological relevance have been isolated and characterized including s nitrosoglutathione and the nitrosothiols of serum albumin [101] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144812 15896810 190074 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 no has been demonstrated to stimulate the auto adp ribosylation of glyceraldehyde 3 phosphate dehydrogenase gapdh by reacting with a critical cysteine with resulting binding of nad to the catalytic cysteine inhibition of gapdh activity and depression of glycolysis [104] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144813 15896810 190078 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 other heme protein targets for no are catalase cytochrome c hemoglobin and peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144814 15896810 190078 3544 1516 CAT catalase catalase 0 1.0 other heme protein targets for no are catalase cytochrome c hemoglobin and peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144815 15896810 190081 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 through this mechanism no a irreversibly inactivates the enzyme ribonucleotide reductase thereby inhibiting dna synthesis b moves iron from iron storage proteins such as ferritin and c mobilizes cu+ from caeruloplasmin and metallothionein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144816 15896810 190097 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 the factors responsible for this include the inner mitochondrial membrane lipid composition and/or the oxidant/antioxidant balance particularly manganese superoxide dismutase and/or heat shock protein activity and expressions as well as the glutathione status. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144818 15896810 190121 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 this reaction can occur spontaneously but most often is catalyzed by glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144819 15896810 190128 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 the latter finding that could also be induced by addition of a_amp_#x3b2; to synaptosomes [127] coupled with the reported loss of glutamine synthetase activity in ad brain [127] suggests that glutamate stimulated excitotoxic mechanisms could be important in neurodegeneration in ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144820 15896810 190129 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 there are evidences of an impairment in vivo of glutathione homeostasis and antioxidant enzymes in patients with friedreich ataxia suggesting a relevant role of free radical cytotoxicity in the pathophysiology of the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144821 15896810 190130 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 in fact a reduction of free glutathione levels in the blood of patients with friedreich ataxia a total glutathione concentration comparable to the controls and a significant increase of glutathione bound to haemoglobin in erythrocytes have been demonstrated in frda patients [128] also associat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144822 15896810 190130 8877 4638 GSTP1 glutathione transferase glutathione transferase 0 1.0 in in erythrocytes have been demonstrated in frda patients [128] also associated with a significant elevation in the superoxide dismutase/glutathione peroxidase activity ratio and with an 83% rise of glutathione transferase activity in the blood [129] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144823 15896810 190130 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 arable to the controls and a significant increase of glutathione bound to haemoglobin in erythrocytes have been demonstrated in frda patients [128] also associated with a significant elevation in the superoxide dismutase/glutathione peroxidase activity ratio and with an 83% rise of glutathione transferase activity in the blood [129] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144824 15896810 190142 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144825 15896810 190142 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144826 15896810 190142 9462 5013 HMOX1 ho 1 ho 1 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144827 15896810 190144 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144828 15896810 190146 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144829 15896810 190146 8888 4646 GTF2A1 glucose regulated protein glucose regulated protein 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144830 15896810 190147 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after a variety of central nervous system cns insults hsp70 is synthesized at high levels and is present in the cytosol nucleus and endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144831 15896810 190151 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after heat shock for instance the synthesis of hsp70 increases to a point to where it becomes the most abundant single protein in a cell. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144832 15896810 190152 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 once synthesized hsp70 binds to denaturated proteins in an atp dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144833 15896810 190159 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 only recently however with the availability of transgenic animals and gene transfer has become possible to overexpress the gene encoding hsp70 to test directly the hypothesis that stress proteins protects cells from injury and it has been demonstrated that overproduction of hsp70 leads to protection in several different models of nervous sy 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144834 15896810 190159 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 to test directly the hypothesis that stress proteins protects cells from injury and it has been demonstrated that overproduction of hsp70 leads to protection in several different models of nervous system injury [136] and [137] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144835 15896810 190160 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 following focal cerebral ischemia mrna encoding hsp70 is synthesized in most ischemic cells except in areas of very low blood flow because of limited atp levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144836 15896810 190161 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 proteins is produced mainly in endothelial cells in the core of infarcts in the cells that are most resistant to ischemia in glial cells at the edges of infarcts and in neurons outside the areas of i 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144837 15896810 190162 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 it has been suggested that this neuronal expression of hsp70 outside an infarct can be used to define the ischemic penumbras which means the zone of protein denaturation in the ischemic areas [138] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144838 15896810 190165 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 transfection of cultured astrocytes with hsp70 protects them from ischemia or glucose deprivation [140] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144839 15896810 190166 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 has been demonstrated to inhibit caspase 3 activation caused by ceramide and also affect jun kinase and p38 kinase activation [141] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144840 15896810 190166 12354 6886 MAPK9 jun kinase jun kinase 0 1.0 hsp70 has been demonstrated to inhibit caspase 3 activation caused by ceramide and also affect jun kinase and p38 kinase activation [141] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144841 15896810 190166 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 hsp70 has been demonstrated to inhibit caspase 3 activation caused by ceramide and also affect jun kinase and p38 kinase activation [141] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144842 15896810 190167 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 in addition hsp70 binds to and modulates the function of bag 1 the bcl 2 binding protein [142] thus modulating some type of apoptosis related cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144843 15896810 190167 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in addition hsp70 binds to and modulates the function of bag 1 the bcl 2 binding protein [142] thus modulating some type of apoptosis related cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144844 15896810 190167 1497 939 BAG3 bcl-2-binding protein bcl 2 binding protein 0 1.0 in addition hsp70 binds to and modulates the function of bag 1 the bcl 2 binding protein [142] thus modulating some type of apoptosis related cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144845 15896810 190170 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 we have demonstrated in astroglial cell cultures that cytokine induced nitrosative stress is associated with an increased synthesis of hsp70 stress proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144846 15896810 190171 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increase in hsp70 protein expression was also found after treatment of cells with the no generating compound sodium nitroprusside snp thus suggesting a role for no in inducing hsp70 proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144847 15896810 190173 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ubiquitin is one of the smallest hsps and is expressed throughout brain in response to ischemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144848 15896810 190174 6708 3415 EPO erythropoietin erythropoietin 0 1.0 it is involved in targeting and chaperoning of proteins degraded in proteasomes which include nfkb cyclins hsfs hypoxia inducible factor some apoptosis related proteins tumor necrosis factor and erythropoietin receptors [146] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144849 15896810 190174 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 it is involved in targeting and chaperoning of proteins degraded in proteasomes which include nfkb cyclins hsfs hypoxia inducible factor some apoptosis related proteins tumor necrosis factor and erythropoietin receptors [146] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144850 15896810 190176 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 it chaperones cytoskeletal proteins such as intermediate filaments actin or glial fibrillary acidic protein following stress in astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144851 15896810 190177 7333 11920 FAS apo 1 apo 1 0 1.0 it also protects against fas apo 1 staurosporine tnf and etoposside induced apoptotic cell death as well as h 2 o 2 induced necrosis [147] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144852 15896810 190179 8888 4646 GTF2A1 glucose regulated protein glucose regulated protein 0 1.0 hsp60 glucose regulated protein 75 grp75 and hsp10 chaperone proteins within mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144853 15896810 190183 9462 5013 HMOX1 ho 1 ho 1 0 1.0 there are three isoforms of heme oxygenase: ho 1 or inducible isoform ho 2 or constitutive isoform and the recently discovered ho 3 [149] [150] [151] [152] [153] and [154] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144854 15896810 190183 9463 5014 HMOX2 ho 2 ho 2 0 1.0 there are three isoforms of heme oxygenase: ho 1 or inducible isoform ho 2 or constitutive isoform and the recently discovered ho 3 [149] [150] [151] [152] [153] and [154] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144855 15896810 190187 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the iron released by ho 1 is bound by ferritin perhaps via a ho 1 chaperone function [155] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144856 15896810 190189 9462 5013 HMOX1 ho 1 ho 1 0 1.0 increasing evidence suggests that the ho 1 gene is redox regulated and contains in its promoter region the antioxidant responsive element are similar to other antioxidant enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144857 15896810 190191 9462 5013 HMOX1 ho 1 ho 1 0 1.0 significant increases in the levels of ho 1 have been observed in ad brains in association with neurofibrillary tangles [157] and ho 1 mrna was found to be increased in ad neocortex and cerebral vessels [158] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144858 15896810 190192 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [153] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144859 15896810 190192 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [153] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144860 15896810 190193 9462 5013 HMOX1 ho 1 ho 1 0 1.0 it is conceivable that the dramatic increase in ho 1 in ad may be a direct response to increased free heme associated with neurodegeneration and an attempt to convert the highly damaging heme into the antioxidants biliverdin and bilirubin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144861 15896810 190194 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is rapidly upregulated by oxidative and nitrosative stresses as well as by glutathione depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144862 15896810 190204 9462 5013 HMOX1 ho 1 ho 1 0 1.0 remarkably recent evidence has demonstrated that curcumin is a potent inducer of ho 1 in vascular endothelial cells [7] and [167] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144863 15896810 190205 9462 5013 HMOX1 ho 1 ho 1 0 1.0 we have also recently demonstrated in astroglial cells the role of caffeic acid phenylethyl ester cape an active component of propolis as a novel ho 1 inducer [162] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144864 15896810 190222 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 the effect of another antioxidant treatment coenzyme q 10 400 mg/day plus vitamin e 2100 iu/day on in vivo cardiac and calf muscle energy metabolism left ventricle hypertrophy lvh and ataxia has been evaluated in ten frda patients [177] after 6 months of 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144865 15896810 190240 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 a deficiency of the micronutrient has also been reported in patients with friedreich ataxia and there are histological similarities between friedreich's cardiomyopathy and keshan disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144866 15896810 190243 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 as iron induced mitochondrial oxidative damage is central to the pathology of friedreich ataxia and in addition some studies suggest a link between frataxin expression glutathione peroxidase gpx activity and oxidative stress the administration of selenium supplements could normalize the antioxi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144867 15896810 190243 7975 3951 FXN frataxin frataxin 0 1.0 as iron induced mitochondrial oxidative damage is central to the pathology of friedreich ataxia and in addition some studies suggest a link between frataxin expression glutathione peroxidase gpx activity and oxidative stress the administration of selenium supplements could normalize the antioxidant activity of myocardial glutathione peroxidase and slow t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144868 15896810 190250 7975 3951 FXN frataxin frataxin 0 1.0 although the precise function of frataxin still remains to be defined frda has clearly been identified as a nuclear encoded mitochondrial disorder. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147202 15964487 194016 7334 11936 FASLG fas ligand fas ligand 0 1.0 in these processes mitochondria appear to be a key point of convergence of different pathways initiated by several apoptotic stimuli including receptor activation by fas ligand kavurma and khachigian 2003 or glutamate stout et al. 1998 or after exposure to neurotoxins such as veratridine jordan et al. 2002 or staurosporine tafani et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147203 15964487 194017 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 opening of a permeability transition pore ptp leads to mitochondrial swelling and the release of intramitochondrial proteins to the cytoplasm including cytochrome c apaf 1 and caspase family members which participate in apoptosis pathways van gurp et al 2003 joza et al 2003 and galindo et al 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147204 15964487 194023 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 also its administration in mice expressing a mutant superoxide dismutase sod1 g37r at late presymptomatic stage delayed the onset of motor neuron degeneration and muscle strength decline and increased the longevity of sod1 g37r mice kriz et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147206 15964487 194028 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the exact mechanisms by which minocycline plays these neuroprotective effects remain unknown although a reduced expression of cycloxygenase 2 caspase 1 and inducible nitric oxide synthase inos mrna have been described chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147207 15964487 194028 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the exact mechanisms by which minocycline plays these neuroprotective effects remain unknown although a reduced expression of cycloxygenase 2 caspase 1 and inducible nitric oxide synthase inos mrna have been described chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147209 15964487 194064 551 399 ALB serum albumin serum albumin 0 1.0 mitochondrial protein concentrations were quantified spectrophotometrically micro bca protein reagent kit pierce rockford il usa with bovine serum albumin used as standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147210 15964487 194086 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the activity of complex ii_amp_#x2013;iii succinate cytochrome c reductase was determined following the method of king 1967 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147212 15964487 194087 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 complex iv cytochrome c oxidase; e.c.1.9.3.1 activity was determined as described by wharton and tzagoloff 1967 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147214 15964487 194101 14257 7711 NDUFS4 mitochondrial respiratory chain complex i mitochondrial respiratory chain complex i 0 1.0 consistently the mitochondrial uncoupler carbonyl cyanide 4 trifluoromethoxyphenlhydrazone fccp 1_amp_#x3bc;m fccp depleted and rotenone a mitochondrial respiratory chain complex i inhibitor 10_amp_#x3bc;m rot increased the nucleotide signal fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147215 15964487 194151 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 indeed calcium induces the release of mitochondrial cytochrome c by different mechanisms selective for brain versus liver andreyev and fiskum 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147216 15964487 194161 23199 12716 TRPV1 vanilloid receptor subtype 1 vanilloid receptor subtype 1 0 1.0 al 2003b drugs able to depolarize mitochondria including the protonophores fccp and carbonyl cyanide m chlorophenylhydrazone provide protection against acute glutamate neurotoxicity reynolds 1999 and vanilloid receptor subtype 1 mediated death jambrina et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136181 16026864 180216 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 als is sporadic in 90% of cases; the remaining 10% are of genetic origin with a subset being induced by mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136182 16026864 180232 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 early evidence for involvement of ca 2+ was provided by the observation that ca 2+ binding proteins such as calbindin d28k and parvalbumin were absent in motoneuron populations lost early in als cortical spinal and lower cranial nerve motoneurons whereas motoneurons damaged late or infrequently in the disease those of onuf's nucleus and 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136183 16026864 180232 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 rons whereas motoneurons damaged late or infrequently in the disease those of onuf's nucleus and the oculomotor trochlear and abducens nerves expressed markedly higher levels of calbindin d28k and/or parvalbumin [13] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136184 16026864 180264 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 most interestingly recent work provided evidence that mutant sod1 might disrupt association of complex iv cytochrome c with the inner mitochondrial membrane and by this interfere with mitochondrial respiration [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136185 16026864 180270 7521 3665 FGF1 endothelial cell growth factor endothelial cell growth factor 0 1.0 in line with these observations als like symptoms and neuropathology can be produced in mice by a targeted deletion that eliminates the ability of vascular endothelial cell growth factor vegf to respond to tissue hypoxia [54] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136186 16026864 180289 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 it is interesting to note that experimentally measured buffering capacities correlated well with the expression profiles of ca 2+ binding proteins such as parvalbumin and calbindin d28k supporting the notion that they might represent the major structural components responsible for endogenous ca 2+ buffering. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136188 16026864 180337 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 als related disturbance of mitochondrial respiration by mutant superoxide dismutase 1 sod1 or hypoxia results in increased formation of reactive oxygen species ros 48 and 49 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136867 16043017 181169 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 familial als cases accounting for 10_amp_#x2013;15% of all als disease are caused by a gain of function mutation in cu zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136868 16043017 181176 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 these proteins are sod1 translationally controlled tumor protein tctp ubiquitin carboxyl terminal hydrolase l1 uch l1 and possibly b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136869 16043017 181176 23792 12609 USP11 ubiquitin carboxyl-terminal hydrolase ubiquitin carboxyl terminal hydrolase 0 1.0 these proteins are sod1 translationally controlled tumor protein tctp ubiquitin carboxyl terminal hydrolase l1 uch l1 and possibly b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136870 16043017 181176 23620 12513 UCHL1 uch l1 uch l1 0 1.0 these proteins are sod1 translationally controlled tumor protein tctp ubiquitin carboxyl terminal hydrolase l1 uch l1 and possibly b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136871 16043017 181177 23620 12513 UCHL1 uch l1 uch l1 0 1.0 because oxidative modification can lead to structural alteration and activity decline our current study suggests that oxidative modification of uch l1 tctp sod1 and possibly b crystallin may play an important role in the neurodegeneration of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136872 16043017 181181 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 inherited als accounts for 10_amp_#x2013;15% of cases and among all of the familial als fals patients 20_amp_#x2013;30% of them are caused by a gain of function mutation in cu zn superoxide dismutase sod1 [3] and [4] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136873 16043017 181190 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 the proteinaceous inclusions found in tissues from als patients [23] [24] and [25] and msod transgenic mice [22] and [26] reportedly are rich in msod ubiquitin and neurofilament proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136874 16043017 181198 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 also elevation of inflammation related genes e.g. induced nitric oxide synthase proinflammatory cytokines occurs at 11 weeks of age in the presymptomatic stage before motor neuron death in g93a sod1 transgenic mice suggesting that neuroinflammation mediated oxidative stress is a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136875 16043017 181251 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ubiquitin carboxyl terminal hydrolase l1 uch l1 assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136876 16043017 181251 23792 12609 USP11 ubiquitin carboxyl-terminal hydrolase ubiquitin carboxyl terminal hydrolase 0 1.0 ubiquitin carboxyl terminal hydrolase l1 uch l1 assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136877 16043017 181251 23620 12513 UCHL1 uch l1 uch l1 0 1.0 ubiquitin carboxyl terminal hydrolase l1 uch l1 assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136879 16043017 181252 23521 12468 UBC ubiquitin c ubiquitin c 0 1.0 the activities of uch l1 in the spinal cord were measured by determining the rate of conversion of ubiquitin c terminal 7 amido 4 methylcoumarin ub amc calbiochem to ubiquitin and free amc [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136880 16043017 181252 23620 12513 UCHL1 uch l1 uch l1 0 1.0 the activities of uch l1 in the spinal cord were measured by determining the rate of conversion of ubiquitin c terminal 7 amido 4 methylcoumarin ub amc calbiochem to ubiquitin and free amc [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136881 16043017 181255 23620 12513 UCHL1 uch l1 uch l1 0 1.0 uch l1 activities of each individual were assayed by the change of _amp_#x3bb; em 460 nm over time. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136882 16043017 181256 23620 12513 UCHL1 uch l1 uch l1 0 1.0 the average uch l1 activities of six transgenic animals were compared to those of six control animals using student's t test. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136883 16043017 181269 23620 12513 UCHL1 uch l1 uch l1 0 1.0 these proteins were identified as sod1 translationally controlled tumor protein tctp uch l1 and b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136884 16043017 181274 23620 12513 UCHL1 uch l1 uch l1 0 1.0 we report here that the specific carbonyl levels of human sod1 tctp uch l1 and possibly b crystallin are significantly increased in the spinal cord of g93a sod1 transgenic mice compared to that of nontransgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136885 16043017 181281 23620 12513 UCHL1 uch l1 uch l1 0 1.0 in order to confirm that oxidative modification inactivated protein activity we compared the activity of uch l1 in the g93a sod1 transgenic mice to that in the control mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136886 16043017 181282 23620 12513 UCHL1 uch l1 uch l1 0 1.0 consistent with our prior studies that demonstrate loss of activity of oxidatively modified proteins [49] [50] and [51] uch l1 activity was significantly decreased 29% in the g93a sod1 transgenic mice compared to that of nontransgenic control fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136887 16043017 181289 23620 12513 UCHL1 uch l1 uch l1 0 1.0 in the current study we identified the proteins that demonstrate increased carbonyl levels compared to those of the nontransgenic mice as sod1 tctp uch l1 and b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136888 16043017 181293 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 moreover free radical production in the g93a sod1 transgenic animals is induced by sod1 mutation [32] alteration of tumor necrosis factor tnf and tnf modulating cytokines [38] and [46] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136889 16043017 181303 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 uch l1 belongs to a family of ubiquitin carboxyl terminal hydrolases that play important roles in the ubiquitin_amp_#x2013;proteolytic pathway [71] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136890 16043017 181303 23620 12513 UCHL1 uch l1 uch l1 0 1.0 uch l1 belongs to a family of ubiquitin carboxyl terminal hydrolases that play important roles in the ubiquitin_amp_#x2013;proteolytic pathway [71] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136891 16043017 181306 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 uch ls then recycle ubiquitin from ubiquitinated protein complexes or polyubiquitin chains by cleaving the amide linkage next to the c terminal glycine of ubiquitin [72] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136892 16043017 181307 23620 12513 UCHL1 uch l1 uch l1 0 1.0 loss of uch l1 function causes neuroaxonal dystrophy [74] [75] and [76] significant protein oxidization [45] and accumulation of synuclein protein in gracile axonal dystrophy mice [77] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136893 16043017 181308 23620 12513 UCHL1 uch l1 uch l1 0 1.0 similarly decreased uch l1 activity by mutation also enhances protein aggregation in escherichia coli [78] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136894 16043017 181309 23620 12513 UCHL1 uch l1 uch l1 0 1.0 therefore based on the prior literature oxidative inactivation of uch l1 presented in the current study possibly contributes to both the protein aggregation and the oxidative stress observed in g93a sod1 transgenic mice and als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136895 16043017 181310 23620 12513 UCHL1 uch l1 uch l1 0 1.0 consistent with this notion and consistent with our finding fig 4 that uch l1 activity is decreased in g93a sod1 mouse spinal cord the inclusions of human als and msod1 including g93a mice are excessively ubiquitinated [79] [80] [81] and [82] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136896 16043017 181316 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 moreover crystallins were recruited to aggregates when cells were treated with proteasome inhibitor [88] and the degradation of b crystallin along with ubiquitin conjugation was decreased in bovine lens epithelial cells when b crystallin was oxidized [89] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136897 16043017 181319 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 consistent with this notion inclusions in als patients contain b crystallin metallothionein glutamine synthetase and tubulin immunoreactivities [90] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136898 16043017 181321 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ubiquitin protein epitopes and b crystallin are found in fibrillar neuronal inclusions in the cortex of sporadic als patients [79] [80] [81] and [91] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136899 16043017 181323 23620 12513 UCHL1 uch l1 uch l1 0 1.0 based on our current observations the increased oxidative modification of sod1 uch l1 and b crystallin plays a significant role in the protein aggregation in the spinal cords of g93a sod1 transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136900 16043017 181324 23620 12513 UCHL1 uch l1 uch l1 0 1.0 study provides insight into the mechanism of g93a sod1 neurotoxicity in vivo which involves oxidative modification of a ca 2+ regulating protein tctp and proteins involved in inclusion formation sod1 uch l1 and b crystallin suggesting a potential relationship between protein oxidation protein aggregation and ca 2+ regulation in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136901 16043017 181325 23620 12513 UCHL1 uch l1 uch l1 0 1.0 moreover one can speculate that the oxidative modification of these proteins impairs protein stability b crystallin ca 2+ binding tctp protein degradation uch l1 and antioxidant capacity sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136902 16043017 181340 23620 12513 UCHL1 uch l1 uch l1 0 1.0 fig. 4._amp_#xa0;activity of uch l1 in g93a sod1 transgenic mice as a percentage of the nontransgenic control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136903 16043017 181341 23620 12513 UCHL1 uch l1 uch l1 0 1.0 the activity of uch l1 is significantly decreased in the spinal cord of g93a sod1 transgenic mice compared to nontransgenic control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137282 16046141 181622 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 vation of the caspases cascade is also effective in preventing both the mitochondrial damage and the increase in the production of reactive oxygen species induced by fals sod1 even in the presence of cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137283 16046141 181628 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondria alterations membrane depolarization decreased activity of respiratory complexes cytochrome c release and oxidative stress increased ros flux oxidatively modified proteins seem likely candidates to explain many facets of als because of their early occurrence in experimental models and in pati 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137284 16046141 181629 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 als occurs both as a sporadic and as a familial dominantly inherited disease fals and about one fifth of fals patients have mutations in the gene coding for the enzyme cu zn superoxide dismutase sod1 rosen et al. 1993 . fals sod1 mutations cause the appearance of a pro oxidant pro apoptotic function in a typically anti oxidant anti apoptotic enzyme rabizadeh et al. 1995 wiedau pazos et al. 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137285 16046141 181634 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 t al. 1997 and prolongs life in a transgenic mouse model kostic et al. 1997 ; caspases 1 and 3 have consistently been shown to play an important role in the death of motor neurons in this disease and caspase 9 is activated in spinal motor neurons of human als subjects inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137286 16046141 181634 1576 990 BCL2 bcl 2 bcl2 0 1.0 members of the bcl gene family show altered expression in post mortem samples from sporadic and familial als patients and in experimental models as well mu et al. 1996 and vukosavic et al. 1999 and bcl2 prevents death of cells expressing fals sod1 ghadge et al. 1997 and prolongs life in a transgenic mouse model kostic et al. 1997 ; caspases 1 and 3 have consistently been shown to play an important r 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137287 16046141 181636 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 of apoptosis by oxidative stress is a feature observed in several experimental paradigms cai and jones 1998 and luetjens et al. 2000 and oxidative stress mediated mitochondrial dysfunction leading to cytochrome c release plays an important role in the initiation of motor neuron death by mutant sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137288 16046141 181637 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in spinal cord specimens of both als patients and in the mice model for fals evidence of prominent recruitment of the mitochondrial apoptotic pathway has been documented by the observation of cytochrome c release and by the observation that prevention of cytochrome c release prolongs the lifespan of transgenic sod1 g93a mice zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137289 16046141 181637 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 release and by the observation that prevention of cytochrome c release prolongs the lifespan of transgenic sod1 g93a mice zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137290 16046141 181639 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 upon release from mitochondria cytochrome c becomes part of the apoptosome a complex in which apaf1 serves as a scaffold protein also for the binding of pro caspase 9 the apoptosome recruits and processes caspase 9 to form a holoenzyme complex which in turn recruits and activates the effector caspases cecconi 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137291 16046141 181639 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 the apoptosome recruits and processes caspase 9 to form a holoenzyme complex which in turn recruits and activates the effector caspases cecconi 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137292 16046141 181639 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 upon release from mitochondria cytochrome c becomes part of the apoptosome a complex in which apaf1 serves as a scaffold protein also for the binding of pro caspase 9 the apoptosome recruits and processes caspase 9 to form a holoenzyme complex 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137293 16046141 181640 3526 1503 CASP2 caspase 2 caspase 2 0 1.0 therefore the apoptosome has a crucial role in the activation of several caspases such as caspase 2 3 6 7 8 and 10 adams and cory 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137294 16046141 181642 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 our data demonstrate that removal of apaf1 prevents cell death and mitochondrial damage by intercepting activation of the caspases cascade even in the presence of cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137295 16046141 181654 5902 2903 DLG4 psd 95 psd95 0 1.0 ed to differentiate both etna+/+ and _amp_#x2212;/_amp_#x2212; cells display neurite outgrowth and the upregulation of some neural markers neun class iii _amp_#x3b2; tubulin choline acetyltransferase psd95 and tau; cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137296 16046141 181654 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 nal precursors; when induced to differentiate both etna+/+ and _amp_#x2212;/_amp_#x2212; cells display neurite outgrowth and the upregulation of some neural markers neun class iii _amp_#x3b2; tubulin choline acetyltransferase psd95 and tau; cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137297 16046141 181658 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 the broad caspase inhibitor zvad fmk 100 _amp_#x3bc;m; calbiochem and the caspase 9 specific inhibitor zlehd fmk 100 _amp_#x3bc;m; calbiochem were added at this time. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137298 16046141 181661 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspase 1 and caspase 3 activities were determined by measuring the rates of 7 amido 4 methylcoumarin amc release from synthetic caspase substrates: ac yvad amc for caspase 1 and ac devd amc for caspase 3 calbiochem . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137299 16046141 181661 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 1 and caspase 3 activities were determined by measuring the rates of 7 amido 4 methylcoumarin amc release from synthetic caspase substrates: ac yvad amc for caspase 1 and ac devd amc for caspase 3 calbiochem . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137300 16046141 181665 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 specific activity was demonstrated by the use of the caspase 1 and caspase 3 inhibitors ac yvad cho and ac devd cho respectively that completely block the development of fluorescence due to the cleaved product. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137301 16046141 181665 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 specific activity was demonstrated by the use of the caspase 1 and caspase 3 inhibitors ac yvad cho and ac devd cho respectively that completely block the development of fluorescence due to the cleaved product. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137302 16046141 181674 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 for cytochrome c and aif release experiments etna cells were harvested in hypotonic buffer 2 mm mgcl 2 10 mm kcl 10 mm tris_amp_#x2013;hcl ph 7.6 supplemented with protease inhibitor cocktail sigma and incubated for 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137303 16046141 181682 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspase 1 was detected with a rabbit polyclonal antibody sigma aldrich recognizing the 45 kda pro enzyme and the 20 kda active subunit. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137304 16046141 181683 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activity was detected using a rabbit polyclonal antibody cell signaling specifically reacting with the cleaved 17/19 kda fragments of active caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137305 16046141 181684 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 caspase 9 activity was detected using a rabbit polyclonal antibody cell signaling specifically reacting with the cleaved fragments of active caspase 9. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137306 16046141 181685 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mouse monoclonal anti cytochrome c antibody was purchased from bd bioscience. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137307 16046141 181703 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 an anti cytochrome c monoclonal antibody clone 6h2.b4 pharmingen an anti cytochrome c polyclonal antibody santa cruz an anti aif monoclonal antibody clone e1 santa cruz and an anti endog polyclonal antibody prosci incorporated were used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137308 16046141 181716 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 ring that the percentage of transfected cells was estimated around 30% see materials and methods . 48 h after transfection expression of mutant sod1s induces activation of caspase 3 caspase 9 but not caspase 1 fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137309 16046141 181716 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 icularly conspicuous considering that the percentage of transfected cells was estimated around 30% see materials and methods . 48 h after transfection expression of mutant sod1s induces activation of caspase 3 caspase 9 but not caspase 1 fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137310 16046141 181716 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 onspicuous considering that the percentage of transfected cells was estimated around 30% see materials and methods . 48 h after transfection expression of mutant sod1s induces activation of caspase 3 caspase 9 but not caspase 1 fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137311 16046141 181718 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 cell death induced by mutant sod1 is prevented by treatment both with pan caspase inhibitor z vad and by caspase 9 inhibitor lehd fig 1 d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137312 16046141 181724 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 transient transfection of control sh cells or sh/apaf1 cells with wtsod1 or g93a sod1 mutant elicits high level comparable expression of the two proteins in both cell lines fig 2 a but activation of caspase 3 is dramatically increased only in g93a expressing sh/apaf1 cells as compared to g93a transfected sh cells fig 2 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137313 16046141 181729 17732 9717 PXMP3 paf 1 paf1 0 1.0 stable cell lines have been named etna e mbryonic t elencephalic n aive a paf1 ; etna+/+ and etna_amp_#x2212;/_amp_#x2212; cell lines have been preliminary characterized both in basal growth conditions and after further differentiation cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137314 16046141 181730 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 etna_amp_#x2212;/_amp_#x2212; cells do not express apaf1 and the absence of this adapter provides them with a complete resistance to caspase 3 activation elicited by a classic pro apoptotic agent such as staurosporine cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137315 16046141 181731 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we have observed that apaf1 deletion also provides these cells with a complete resistance to activation of caspase 3 induced by several fals sod1s and observed in control etna+/+ cells 24 h after transfection with the cdna coding for the mutant protein fig 3 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137316 16046141 181734 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c release induced by fals sod1 is independent of apaf1 expression 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137317 16046141 181735 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondrial damage and cytochrome c release are pro apoptotic features observed in several experimental paradigms for fals see introduction . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137318 16046141 181736 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 to compare cytochrome c release in cells expressing either fals sod1s or wild type sod1 etna cells were transfected with cdna coding for gfp sod1s fusion proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137319 16046141 181739 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 furthermore while no cytochrome c release is observed in cells expressing gfp or the wild type enzyme both etna_amp_#x2212;/_amp_#x2212; and etna+/+ cells expressing different fals sod1s display cytochrome c release independently from the apaf1 genotype figs 4 b_amp_#x2013;d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137320 16046141 181740 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondrial release of pro apoptotic factors induced by fals sod1 is specific for cytochrome c ; indeed we have observed that other mitochondrial factors involved in apoptotic pathways such as aif fig 4 and fig 5 and endog not shown are not affected by the expression of mutant sod1s in this sy 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137321 16046141 181752 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 it is widely believed that activation of the apoptosome followed by caspase 9 and caspase 3 activation plays a central role in cell death in the nervous system yuan and yankner 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137322 16046141 181752 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 it is widely believed that activation of the apoptosome followed by caspase 9 and caspase 3 activation plays a central role in cell death in the nervous system yuan and yankner 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137323 16046141 181757 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondrial membrane depolarization decreased activity of respiratory complexes and cytochrome c release occur at the asymptomatic stage in fals sod1 transgenic mice bendotti et al. 2001 and jung et al. 2002 and in cultured cells expressing the mutant protein carr_amp_#xec; et al. 1997 beal 2000 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137324 16046141 181763 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 leading to bioenergetic failure in the motor neurons bendotti et al. 2001 and jung et al. 2002 and to alteration in the mitochondrial permeability transition pore causing leakage of cytochrome c and apoptosis inducing factor aif friedlander 2003 were suggested to play a role in the mitochondrial dependent motor neuron death through the activation of a caspase mediated cascade leading to programmed cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137325 16046141 181763 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 respiratory chain leading to bioenergetic failure in the motor neurons bendotti et al. 2001 and jung et al. 2002 and to alteration in the mitochondrial permeability transition pore causing leakage of cytochrome c and apoptosis inducing factor aif friedlander 2003 were suggested to play a role in the mitochondrial dependent motor neuron death through the activation of a caspase mediated cascade leading to prog 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137326 16046141 181767 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we have observed that indeed apaf1 is a key factor in the noxious function of fals sod1: while overexpression of apaf1 exacerbates the induction of apoptosis fig 2 its removal prevents activation of caspase 3 even in the presence of cytochrome c release fig 3 and fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137327 16046141 181767 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 1 is a key factor in the noxious function of fals sod1: while overexpression of apaf1 exacerbates the induction of apoptosis fig 2 its removal prevents activation of caspase 3 even in the presence of cytochrome c release fig 3 and fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137328 16046141 181772 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 either exert some aberrant chemistry specifically inside or on the surface of mitochondria or interfere with cytoplasmic functions modulating mitochondria functionality: both could lead to release of cytochrome c activation of the caspase cascade and impairment in the respiratory chain atp depletion and changes in the membrane permeability. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137329 16046141 181780 1576 990 BCL2 bcl 2 bcl 2 0 1.0 pasinelli et al. have reported that both wt and mutsod1 bind to bcl 2 an anti apoptotic protein located on the cytoplasmic face of outer mitochondria membranes and have suggested that entrapment of bcl 2 by large mutsod1 aggregates may deplete motor neurons of this anti apoptotic protein pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137330 16046141 181781 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in a recent paper kirkinezos et al. have reported that cytochrome c association with the inner mitochondrial membrane is impaired in the cns of g93a sod1 mice kirkinezos et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137331 16046141 181790 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 c left panel: sh sy5y cells were transfected as in panel a. after 48 h equal amounts 30 _amp_#x3bc;g of clear cell lysates were incubated with 20 _amp_#x3bc;m ac yvad amc for caspase 1 and ac devd amc for caspase 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137332 16046141 181790 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 t panel: sh sy5y cells were transfected as in panel a. after 48 h equal amounts 30 _amp_#x3bc;g of clear cell lysates were incubated with 20 _amp_#x3bc;m ac yvad amc for caspase 1 and ac devd amc for caspase 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137333 16046141 181793 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 right panel: caspase 1 caspase 3 and caspase 9 activity were also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137334 16046141 181793 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 right panel: caspase 1 caspase 3 and caspase 9 activity were also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137335 16046141 181793 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 right panel: caspase 1 caspase 3 and caspase 9 activity were also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137336 16046141 181795 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 ication of apoptotic nuclei of sh sy5y transfected with wtsod1 or g37r g85r and i113t sod1 for the indicated periods of time in the absence or in the presence of 100 _amp_#x3bc;m zlehd fmk a specific caspase 9 inhibitor or zvad fmk a pan caspase inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137337 16046141 181800 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 b cells were treated as in panel a and analyzed for caspase 3 activation 24 h after transfection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137338 16046141 181805 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 a left panel: caspase 3 activity was assayed in cells 24 h after transient transfection with either wtsod1 or g93a g37r g85r and i113t sod1 mutants. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137339 16046141 181806 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activity is expressed as arbitrary fluorescence units afu n _amp_#xa0;=_amp_#xa0;3 . 100 _amp_#x3bc;m zvad fmk a pan caspase inhibitor was used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137340 16046141 181807 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 right panel: caspase 3 activity was also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137341 16046141 181815 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 gfp green cytochrome c red and merged patterns of the same representative fields are shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137342 16046141 181817 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 c the proportion of gfp positive cells releasing cytochrome c was scored n _amp_#xa0;=_amp_#xa0;3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137343 16046141 181818 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 d cytosolic fractions of etna cells transfected for 24 h with wtsod1 or g93a g37r g85r and i113t sod1 mutants were assessed for the presence of cytochrome c and aif by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137344 16046141 181819 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 extracts from the mitochondrial fraction of untransfected etna cells were used as a positive control for aif and cytochrome c expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137345 16046141 181822 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 double labeling confocal immunofluorescence microscopy staining of cytochrome c green and aif red in etna cells 48 h after transfection with wtsod1 gfp g93a sod1 gfp g85r sod1 gfp and a4v sod1 gfp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137346 16046141 181823 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 white arrowheads point to cells with released cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137915 16050975 182086 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 however remarkable mitochondrial abnormalities have also been identified in transgenic mouse models of familial als expressing mutant cu zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137916 16050975 182109 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ons are bunina bodies round eosinophilic inclusions containing a homogeneous granular matrix surrounded by vesicular and tubular structures tomonaga et al. 1978 and skein like inclusions that contain ubiquitin and are comprised of bundles of 15_amp_#x2013;20 nm thick neurofilaments migheli et al. 1990 and sasaki and maruyama 1992 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137918 16050975 182119 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 approximately 20% of fals cases are due to mutations in the gene encoding superoxide dismutase 1 sod1; cu zn dismutase; mim147450 rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137919 16050975 182145 14257 7711 NDUFS4 mitochondrial respiratory chain complex i mitochondrial respiratory chain complex i 0 1.0 deficits in the activities of mitochondrial respiratory chain complex i wiedemann et al. 1998 and complex iv vielhaber et al. 2000 have been identified in the skeletal muscle and in the spinal cord of sals patients borthwick et al. 1999 and wiedemann et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137920 16050975 182187 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 for example caspase 1 and 3 are activated sequentially in differentiated neuroblastoma cells expressing mutant sod1 in response to oxidative stress pasinelli et al. 1998 and pasinelli et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137921 16050975 182189 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 in spinal motor neurons of g93a transgenic mice cytochrome c is released from mitochondria leading to caspase 9 activation guegan et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137922 16050975 182189 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in spinal motor neurons of g93a transgenic mice cytochrome c is released from mitochondria leading to caspase 9 activation guegan et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137923 16050975 182190 1576 990 BCL2 bcl 2 bcl 2 0 1.0 both inhibition of caspase activation li et al. 2000 and the overexpression of the mitochondrial anti apoptotic protein bcl 2 kostic et al. 1997 slow motor neuron degeneration and extend the survival of sod1 mutant mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137924 16050975 182195 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 one may envision a scenario where mitochondrial dysfunction results in quantal releases of pro apoptotic factors such as cytochrome c apoptosis inducing factor aif and endog from individual mitochondria perhaps in response to local calcium mediated toxicity for example under excitatory synapses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137925 16050975 182195 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 one may envision a scenario where mitochondrial dysfunction results in quantal releases of pro apoptotic factors such as cytochrome c apoptosis inducing factor aif and endog from individual mitochondria perhaps in response to local calcium mediated toxicity for example under excitatory synapses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137926 16050975 182215 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 higgins and colleagues have observed that sod1 and cytochrome c a resident protein of the intermembrane space colocalize at the early stages of mitochondrial vacuolization in mutant sod1 transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137927 16050975 182218 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the expanded outer membrane could become porous and allow for leakage of cytochrome c and other pro apoptotic molecules into the cytosol potentially triggering the apoptotic cascade higgins et al. 2003 and xu et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137928 16050975 182228 1576 990 BCL2 bcl 2 bcl 2 0 1.0 an example of such potentially harmful protein protein interactions is the binding of mutant sod1 with bcl 2 pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137929 16050975 182256 1576 990 BCL2 bcl 2 bcl 2 0 1.0 within mitochondria mutant sod1 may interfere with the anti apoptotic function of bcl 2 pasinelli et al. 2004 affect mitochondrial import by interfering with the translocation machinery tom/tim liu et al. 2004 generate toxic free radicals ros via aberrant superoxide chemistry estevez et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137931 16050975 182258 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131951 16188953 173803 166 118 ACO2 aconitase 2 aconitase 2 0 1.0 detoxification of reactive oxygen species ros by pramipexole is shown in vitro and in vivo by evaluating mitochondrial ros release and aconitase 2 activity respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131953 16188953 173806 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 finally both compounds were tested in superoxide dismutase 1 g93a mice a model of familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131955 16188953 173829 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 twenty percent of familial als cases are caused by mutations in superoxide dismutase 1 sod1 which expressed in mice result in a phenotype resembling the pathology in patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131956 16188953 173896 3544 1516 CAT catalase catalase 0 1.0 in further conditions ppx 300 microm malonate malo 10 mm the sod catalase mimic euk 134 melov et al. 2001 euk 30 microm or atp 1 mm was added. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131957 16188953 173900 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 in a further set of experiments hydrogen peroxide ~80% and to a smaller extent superoxide ~20% were generated by xanthine oxidase 0.3 mu/ml and hypoxanthine 0.1 mm fridovich 1970 in a solution containing ppx snd or euk 134 at the indicated concentrations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131958 16188953 173961 9851 5385 IDH3B isocitrate dehydrogenase isocitrate dehydrogenase 0 1.0 twenty microliters of lysate was added to a well of a 96 well microtiter plate followed by the addition of a prewarmed solution 37degreec containing 0.4 mm nadp 1.2 mm mncl 2 and 2 u/ml isocitrate dehydrogenase in buffer [10 mm tris/hcl 0.6 mm mncl 2 20 microm d l fluorocitrate and 1% v/v triton x 100]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131960 16188953 173965 166 118 ACO2 aconitase 2, mitochondrial aconitase 2 mitochondrial 0 1.0 additionally a monoclonal antibody raised against the 23 c terminal amino acids of aconitase 2 mitochondrial aconitase from rat nanotools; antik_amp_ouml;rpertechnik teningen germany was used to study the expression of the protein in mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131961 16188953 173968 166 118 ACO2 aconitase 2 aconitase 2 0 1.0 afterward aconitase 2 expression was analyzed by a standard western blot protocol by probing the used nitrocellulose membranes with the anti aconitase 2 antibody 2 microg/ml using an enhanced chemiluminescence detection system applied biosystems . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131962 16188953 173998 3544 1516 CAT catalase catalase 0 1.0 therefore we reevaluated the antioxidative properties of ppx and snd targeted toward different reactive species and compartments; obtained efficacies were compared with euk 134 a potent sod catalase mimetic jung et al. 2001 ; melov et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131963 16188953 173999 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 we show that ppx and the equipotent snd are weak h 2 o 2 scavengers if generation and detoxification are measured in the same compartment in absence of a detection system xanthine oxidase . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131964 16188953 174058 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 a ros were generated by xanthine oxidase in a solution containing euk 134 black bars ppx light gray bars or snd dark gray bars at the indicated concentrations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131965 16188953 174110 3544 1516 CAT catalase catalase 0 1.0 after demonstrating entry of ppx into brain cells and mitochondria we reevaluated the antioxidative properties of ppx and snd and compared the obtained efficacy with euk 134 a potent sod catalase mimetic melov et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131966 16188953 174111 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 first h 2 o 2 and superoxide were generated by xanthine oxidase fridovich 1970 in a cell free assay where detoxifying enzymes and membranes are absent. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131967 16188953 174114 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 as expected euk 134 was the most potent compound which at a concentration of 300 microm was able to detoxify >95% ros generated by xanthine oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131968 16188953 174117 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 additionally both enantiomers showed equipotent efficacy in detoxification of xanthine oxidase generated ros fig 3a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132329 16194581 174728 3544 1516 CAT catalase catalase 0 1.0 moreover the brain is not particularly endowed with antioxidant defenses: it has a very low level of catalase activity and only moderate amounts of the endogenous antioxidant enzymes superoxide dismutase and glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132330 16194581 174728 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 moreover the brain is not particularly endowed with antioxidant defenses: it has a very low level of catalase activity and only moderate amounts of the endogenous antioxidant enzymes superoxide dismutase and glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132331 16194581 174740 14352 7794 NFKB1 nuclear factor kappa-b nuclear factor kappa b 0 1.0 ced signal transduction leading to the activation genes such as the inducible nitric oxide synthase inos interleukin 1_amp_#x3b2; il 1_amp_#x3b2; tumor necrosis factor _amp_#x3b1; tnf _amp_#x3b1; and nuclear factor kappa b nf _amp_#x3ba;b [1] [49] [60] [65] [69] [72] [81] and [86] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132332 16194581 174740 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 neuroinflammation has been connected to enhanced signal transduction leading to the activation genes such as the inducible nitric oxide synthase inos interleukin 1_amp_#x3b2; il 1_amp_#x3b2; tumor necrosis factor _amp_#x3b1; tnf _amp_#x3b1; and nuclear factor kappa b nf _amp_#x3ba;b [1] [49] [60] [65] [69] [72] [81] and [86] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132333 16194581 174740 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 neuroinflammation has been connected to enhanced signal transduction leading to the activation genes such as the inducible nitric oxide synthase inos interleukin 1_amp_#x3b2; il 1_amp_#x3b2; tumor necrosis factor _amp_#x3b1; tnf _amp_#x3b1; and nuclear factor kappa b nf _amp_#x3ba;b [1] [49] [60] [65] [69] [72] [81] and [86] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132334 16194581 174759 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 amyloid precursor protein/presenilin 1 app/psl transgenic mice have been used as a murine model for ad since these mutations facilitate the production of beta amyloid and consequently alzheimer like plaques in several regions of the brain 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132335 16194581 174767 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 the levels of extracellular signal regulated kinase erk and protein kinase c pkc were elevated in the bb supplemented app/psl mice as compared to those found in the non supplemented mice [41] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132336 16194581 174767 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 the levels of extracellular signal regulated kinase erk and protein kinase c pkc were elevated in the bb supplemented app/psl mice as compared to those found in the non supplemented mice [41] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132339 16194581 174781 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 the localized expression of erk and insulin like growth factor 1 igf 1 and its receptor igf 1r was also assayed by immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132340 16194581 174786 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 the data indicated that bb supplementation increased hippocampal plasticity and cognitive performance via concerted mechanisms involving neurogenesis neurotrophic factor igf 1 and its receptor and map kinase signal transduction cascades. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133282 16227974 175711 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 approximately 10% of cases are inherited and roughly a quarter of these inherited forms result from mutations in the cytosolic form of the antioxidant protein superoxide dismutase sod1 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133284 16227974 175716 23521 12468 UBC ubiquitin c ubiquitin c 0 1.0 at least five separate genes that are associated with parkinson's disease have been identified including those encoding alpha synuclein parkin ubiquitin c terminal hydrolase 1 dj1 and pten induced kinase 1 pink1 refs 2 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133285 16227974 175716 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 at least five separate genes that are associated with parkinson's disease have been identified including those encoding alpha synuclein parkin ubiquitin c terminal hydrolase 1 dj1 and pten induced kinase 1 pink1 refs 2 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133286 16227974 175719 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 for instance in the brains of patients with parkinson's disease alpha synuclein is modified by oxidative and nitrative stress 2 3 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133287 16227974 175720 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 inhibiting mitochondrial function leads to increased alpha synuclein aggregation which can in turn lead to impaired mitochondrial function 5 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133288 16227974 175729 522 380 AKR1A1 alcohol dehydrogenase alcohol dehydrogenase 0 1.0 hypotheses exist regarding how a beta induces injury but one possibility is that this peptide can directly induce oxidative stress 12 potentially through an interaction with the mitochondrial protein alcohol dehydrogenase 13 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133289 16227974 175738 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 the levels of carbonylated proteins increase dramatically with age 15 and mutants of d. melanogaster that lack carbonyl reductase activity suffer from neurodegenerative symptoms 16 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133290 16227974 175755 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 a number of groups have proposed that a plasma membrane superoxide generating enzyme system known as the nadph oxidase is involved 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133291 16227974 175757 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 subsequent analysis showed that components of the nadph oxidase system are expressed in other cell types and that a large family of tissue specific oxidases exist 23 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133292 16227974 175758 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consistent with its potential role in vascular disease knockout mice that are deficient in nadph oxidase have reduced vascular oxidant production and in some settings reduced atherosclerosis 24 25 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133294 16227974 175760 20997 11180 SOD2 superoxide dismutase 2 superoxide dismutase 2 0 1.0 superoxide dismutase 2 +/ sod2 +/ mice which lack one copy of this mitochondrial antioxidant protein show an increased rate of atherosclerotic plaque formation 26 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133295 16227974 175776 1271 795 ATM ataxia telangiectasia mutated ataxia telangiectasia mutated 0 1.0 for example there is evidence that p53 myc ataxia telangiectasia mutated atm and ras can all alter intracellular ros levels 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133296 16227974 175784 5811 2859 DHCR24 seladin 1 seladin 1 0 1.0 another group noted that inhibiting seladin 1 could also block ras or oxidant induced senescence 42 seladin 1 had been previously discovered in the context of alzheimer's disease in which it seems to be selectively downregulated 43 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133297 16227974 175785 5811 2859 DHCR24 seladin 1 seladin 1 0 1.0 notably following hydrogen peroxide treatment seladin 1 translocates to the nucleus where it seems to bind to and stabilize p53. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133298 16227974 175845 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 alpha synuclein app atm jund parkin peroxiredoxin i pink1 ras seladin 1 sirt1 sirt3 sod1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133299 16227974 175845 5811 2859 DHCR24 seladin 1 seladin 1 0 1.0 alpha synuclein app atm jund parkin peroxiredoxin i pink1 ras seladin 1 sirt1 sirt3 sod1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134204 16242643 176945 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 furthermore malonate did not induce the expression of the inos caspase 3 8 and 9 genes which have been shown to be up regulated in several models where minocycline resulted cytoprotective. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134205 16242643 176946 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in addition malonate induced down regulation of the antiapoptotic gene bcl 2 was not prevented by minocycline controversially the mechanism previously proposed to explain minocycline protective action. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134207 16242643 176951 10437 5992 IL1B interleukin 1, beta interleukin 1 beta 0 1.0 in this sense tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134208 16242643 176951 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134209 16242643 176951 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 in this sense tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134210 16242643 176953 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 this blockade in turn inhibits the release of the proapoptotic factors cytochrome c smac diablo and apoptosis inducing factor from the mitochondria wang et al. 2003 and zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134211 16242643 176953 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 this blockade in turn inhibits the release of the proapoptotic factors cytochrome c smac diablo and apoptosis inducing factor from the mitochondria wang et al. 2003 and zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134212 16242643 176965 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 moreover although no modifications in the expression of the mrna's encoding for inos caspase 3 8 and 9 after malonate additions were found we observed a significant reduction of blc 2 mrna expression which was not reverted by minocycline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134214 16242643 176972 551 399 ALB serum albumin serum albumin 0 1.0 tissues were incubated with trypsin for 20 min at 37_amp_#xb0;c and dissociated by trituration in a medium containing dnase bovine serum albumin and trypsin inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134215 16242643 177078 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 inos caspase 3 8 and 9 mrna expression levels are not modulated by malonate 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134216 16242643 177080 1576 990 BCL2 bcl 2 bcl 2 0 1.0 among them the down regulation of caspases and inos and the up regulation of bcl 2 have been documented recently wang et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134217 16242643 177081 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in order to check whether these pathways were involved in malonate induced granular cell death we first analyzed the pattern of expression of inos caspase 3 8 and 9 and the antiapoptotic gene bcl 2 in malonate treated cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134218 16242643 177081 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in order to check whether these pathways were involved in malonate induced granular cell death we first analyzed the pattern of expression of inos caspase 3 8 and 9 and the antiapoptotic gene bcl 2 in malonate treated cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134219 16242643 177082 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the results shown in fig. 6 a revealed that malonate at the concentration which causes a significant decrease in cell viability does not modify the expression of the inos caspase 3 8 and 9 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134220 16242643 177083 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however 50 mm malonate caused a significant down regulation of the antiapoptotic gene bcl 2 fig 6 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134221 16242643 177085 1576 990 BCL2 bcl 2 bcl 2 0 1.0 therefore we studied whether minocycline would prevent the down regulation of bcl 2 gene expression induced by malonate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134222 16242643 177086 1576 990 BCL2 bcl 2 bcl 2 0 1.0 as depicted in fig. 6 b minocycline consistently with its lack of protective effect failed to block the down regulation of bcl 2 caused by malonate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134223 16242643 177091 1576 990 BCL2 bcl 2 bcl 2 0 1.0 additionally although malonate treatment fails to induce the mrna expression of caspase 3 8 and 9 as well as inos it decreases the mrna of the antiapoptotic protein bcl 2 an effect that was not abrogated by minocycline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134224 16242643 177091 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 additionally although malonate treatment fails to induce the mrna expression of caspase 3 8 and 9 as well as inos it decreases the mrna of the antiapoptotic protein bcl 2 an effect that was not abrogated by minocycline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134225 16242643 177101 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cardiolipin is a phospholipid located in the inner mitochondrial membrane whose oxidation can be the consequence of the release of cytochrome c from the mitochondria to the cytoplasm tuominen et al. 2002 a release that we have previously observed to be increased in sh sy5y cells challenged with malonate fern_amp_#xe1;ndez g_amp_#xf3;mez et a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134226 16242643 177103 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 as a consequence of permeability transition pore formation cytochrome c is released to the cytoplasm turning on the apoptotic machinery. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134227 16242643 177115 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we found no changes in the expression of the genes coding for inos caspase 3 8 and 9. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134228 16242643 177116 1576 990 BCL2 bcl 2 bcl 2 0 1.0 conversely we did find a significant down regulation of bcl 2 expression after a 24 h malonate exposure. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134229 16242643 177117 1576 990 BCL2 bcl 2 bcl 2 0 1.0 it should be noted that the up regulation of bcl 2 gene expression has been recently proposed as a mechanism mediating minocycline induced cytoprotection wang et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134230 16242643 177118 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however abounding on the lack of protective effect by minocycline in the present work this drug failed to reverse the down regulation of bcl 2 induced by malonate treatment nor induced bcl 2 expression by itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134231 16242643 177149 1576 990 BCL2 bcl 2 bcl 2 0 1.0 fig. 6._amp_#xa0;malonate does not affect inos caspase 3 8 and 9 but significantly reduces bcl 2 mrna expression levels. mrna expression in malonate treated cerebellar granular cells was quantitatively measured by real time pcr using gadph mrna levels as control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134232 16242643 177149 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 fig. 6._amp_#xa0;malonate does not affect inos caspase 3 8 and 9 but significantly reduces bcl 2 mrna expression levels. mrna expression in malonate treated cerebellar granular cells was quantitatively measured by real time pcr using gadph mrna levels as c 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134233 16242643 177150 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 a lack of effects of malonate on the inos caspase 3 8 and 9 mrna expression levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134234 16242643 177151 1576 990 BCL2 bcl 2 bcl 2 0 1.0 b effect of malonate on bcl 2 mrna expression levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134235 16242643 177152 1576 990 BCL2 bcl 2 bcl 2 0 1.0 minocycline pre treatment fails to avoid the bcl 2 down regulation induced by malonate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134236 16242643 177158 1576 990 BCL2 bcl 2 bcl 2 0 1.0 cardiolipins|enzyme inhibitors|malonates|neuroprotective agents|neurotoxins|proto oncogene proteins c bcl 2|reactive oxygen species|minocycline|malonic acid|glutathione|succinate dehydrogenase|caspases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129646 16406002 170378 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 combining findings on neurodegeneration and oxidative stress in drosophila with studies on the metabolic characteristics of the human enzyme carbonyl reductase cr it is clear now that cr has a potential physiological role for neuroprotection in humans. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129647 16406002 170415 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in various cell lines reactive aldehyde induced apoptosis was accompanied by c jun n terminal kinase and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129648 16406002 170415 10824 6204 JUN c jun c jun 0 1.0 in various cell lines reactive aldehyde induced apoptosis was accompanied by c jun n terminal kinase and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129649 16406002 170424 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 in general routes of metabolism for these carbonylic lipids include spontaneous and enzyme catalyzed glutathione gsh conjugation and either oxidation by aldehyde dehydrogenase or carbonyl reduction catalyzed by enzymes from two different protein superfamilies the aldo keto reductases akr [12] and the short chain dehydrogenases sdr [13] to which sniffer belongs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129650 16406002 170426 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 sniffer is a carbonyl reductase and belongs to the superfamily of short chain dehydrogenases/reductases 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129651 16406002 170427 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 it turned out as a surprise that according to its primary structure sniffer shows similarity with human carbonyl reductase cr; secondary alcohol: nadp + oxidoreductase; ec 1.1.1.184 [14] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129652 16406002 170433 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 sniffer is so far the only known functional carbonyl reductase in drosophila melanogaster which emphasizes the importance of this enzyme as a neuroprotective agent [5] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129653 16406002 170434 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 carbonyl reductase plays a unique role in the detoxification of reactive aldehydes derived from lipid peroxidation 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129654 16406002 170443 523 381 AKR1B1 aldose reductase aldose reductase 0 1.0 at a first glance compared to cr the enzyme akr1b1 previously named aldose reductase from the akr superfamily exhibits a higher k cat / k m due to a lower k m for one and gs one reduction [18] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129655 16406002 170458 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 acid; hne = 4 hydroxynon 2 enal; hno = 1 hydroxynon 2 en 4 one; ona = 4 oxononanal; one = 4 oxonon 2 enal; gsh = reduced glutathione ar = aldose reductase akr1b1 ; aldh = aldehyde dehydrogenase; cr = carbonyl reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129656 16406002 170458 523 381 AKR1B1 aldose reductase aldose reductase 0 1.0 abbreviations: dhn = 4 dihydroxynonene; hna = 4 hydroxynonan acid; hne = 4 hydroxynon 2 enal; hno = 1 hydroxynon 2 en 4 one; ona = 4 oxononanal; one = 4 oxonon 2 enal; gsh = reduced glutathione ar = aldose reductase akr1b1 ; aldh = aldehyde dehydrogenase; cr = carbonyl reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129657 16406002 170458 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 nonene; hna = 4 hydroxynonan acid; hne = 4 hydroxynon 2 enal; hno = 1 hydroxynon 2 en 4 one; ona = 4 oxononanal; one = 4 oxonon 2 enal; gsh = reduced glutathione ar = aldose reductase akr1b1 ; aldh = aldehyde dehydrogenase; cr = carbonyl reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113439 16624679 147583 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 _#x201d; generating adenosine triphosphate atp through oxidative phosphorylation which relies on the activity of the four respiratory enzyme complexes of the mitochondrial etc the f0f1 atpase and the adenine nucleotide translocator ant fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113441 16624679 147724 1576 990 BCL2 bcl 2 bcl 2 0 1.0 interestingly bcl 2 which has protective activity against oxidative stress [24] and prevents cell death induced by rotenone by blocking the loss of mitochondrial membrane potential [45] and [49] was trapped by sod1 aggr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113442 16624679 147733 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 atp is then released into the cytosol via the adenine nucleotide translocator ant and the _amp_#x201c;voltage dependent_amp_#x201d; anion channel vdac which are the core components of the mitochondrial membrane permeability pore. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113443 16624679 147734 1576 990 BCL2 bcl 2 bcl 2 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113444 16624679 147734 17080 9257 PPID cyclophilin d cyclophilin d 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113445 16624679 147734 17080 9257 PPID cyp d cyp d 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 17082 9259 PPIF 0 113446 16624679 147734 4423 1991 CKB creatine kinase creatine kinase 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113447 16624679 147734 23264 1158 TSPO peripheral benzodiazepine receptor peripheral benzodiazepine receptor 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 103420 16681429 132323 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 methods: we determined activity of the following ades: copper zinc superoxide dismutase cuzn sod catalase cat glutathione peroxidase gsh px and glutathione reductase gr in erythrocytes from sporadic als patients [sals /+ ] familial als patients with the leu144phe mutation in the sod1 gene [fals +/+ ] asymptomatic carriers with the leu144phe mutation in the sod1 g 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 103421 16681429 132323 3544 1516 CAT catalase catalase 0 1.0 methods: we determined activity of the following ades: copper zinc superoxide dismutase cuzn sod catalase cat glutathione peroxidase gsh px and glutathione reductase gr in erythrocytes from sporadic als patients [sals /+ ] familial als patients with the leu144phe mutation in the sod1 gene [fals +/+ ] asy 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 103422 16681429 132323 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 methods: we determined activity of the following ades: copper zinc superoxide dismutase cuzn sod catalase cat glutathione peroxidase gsh px and glutathione reductase gr in erythrocytes from sporadic als patients [sals /+ ] familial als patients with the leu144phe mutation in the sod1 ge 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106297 16764863 137649 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 to further examine the mechanisms of bmaa induced injury to mns cultures were exposed to bmaa 100_amp_#xa0;_amp_#x3bc;m in the presence of the selective glutamate receptor antagonists mk 801 10_amp_#xa0;_amp_#x3bc;m and/or nbqx 10_amp_#xa0;_amp_#x3bc;m fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106298 16764863 137652 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 fluorescence imaging techniques were used to address mechanisms of mn injury downstream from glutamate receptor activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106299 16764863 137658 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 previous studies have demonstrated that glutamate receptor mediated ca 2+ entry triggers the generation of ros lafon cazal et al. 1993 dugan et al. 1995 reynolds and hastings 1995 carriedo et al. 1998 and carriedo et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106300 16764863 137677 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 enotypic development eagleson et al. 1985 schaffner et al. 1987 and martinou et al. 1989 and results in mns far more closely resembling mns in vivo in terms of such factors as axodendritic growth and glutamate receptor expression than occurs in pure mn cultures vandenberghe et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106301 16764863 137687 5893 2898 DLD diaphorase diaphorase 0 1.0 in a previous study we identified a subpopulation of cortical neurons nadph diaphorase neurons which was far more susceptible to bmaa injury than the overall cortical neuronal population weiss et al. 1989a and weiss et al. 1989b providing precedent for the idea that vulnerability to bm 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106302 16764863 137698 5893 2898 DLD diaphorase diaphorase 0 1.0 however in our prior studies we found that the preferential injury to the nadph diaphorase neurons induced by lower bmaa exposures was predominantly mediated by ampa/kainate receptors weiss et al. 1989a weiss et al. 1989b and smith and meldrum 1990 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100381 16877542 128958 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 herein we show that nadph oxidase the main reactive oxygen species producing enzyme during inflammation is activated in spinal cords of als patients and in spinal cords in a genetic animal model of this disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100382 16877542 128959 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we demonstrate that inactivation of nadph oxidase in als mice delays neurodegeneration and extends survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100385 16877542 128960 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100386 16877542 128960 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100387 16877542 128966 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 transgenic sod1 g93a mice [c57bl/6j tgn sod1 g93a 1gur dl ] were crossed with gp91 phox deficient mice b6.129s6 cybb tm1din . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100388 16877542 128972 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 primer sequences for gp91 phox glial fibrillary acidic protein macrophage antigen complex 1 and gapdh and pcr conditions are presented in supporting text . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100389 16877542 128972 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 primer sequences for gp91 phox glial fibrillary acidic protein macrophage antigen complex 1 and gapdh and pcr conditions are presented in supporting text . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100390 16877542 129014 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is up regulated in inflamed spinal cords of als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100391 16877542 129015 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 to determine the role of nadph oxidase in motor neuron degeneration we first evaluated its expression at different stages of the disease in transgenic mice expressing mutant human sod1 with a substitution of glycine to alanine in position 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100392 16877542 129016 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 expression of nadph oxidase in the spinal cord which carries the brunt of the pathology in this als model was determined by analyzing its catalytic subunit gp91 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100393 16877542 129016 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 expression of nadph oxidase in the spinal cord which carries the brunt of the pathology in this als model was determined by analyzing its catalytic subunit gp91 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100394 16877542 129017 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 both gp91 phox message and protein contents in whole tissue extracts of spinal cord rose over time in transgenic sod1 g93a mice fig 1 a b d and e in concert with the development of a glial response fig 6 which is p 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100395 16877542 129018 14170 7661 NCF2 p67 phox p67 phox 0 1.0 the levels of the p67 phox subunit that contains the nadph binding site of the nadph oxidase complex 10 were increased in membrane fractions of spinal cord extracts from symptomatic transgenic sod1 g93a mice fig 1 c indicating 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100396 16877542 129018 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 the levels of the p67 phox subunit that contains the nadph binding site of the nadph oxidase complex 10 were increased in membrane fractions of spinal cord extracts from symptomatic transgenic sod1 g93a mice fig 1 c indicating that this cytosolic subunit did translocate to the plasma membran 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100397 16877542 129019 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 conversely none of these nadph oxidase alterations were seen in age matched nontransgenic littermates fig 1 a _amp_#x02013; e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100398 16877542 129020 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 histological evaluation of the spinal cord of symptomatic transgenic sod1 g93a mice showed numerous gp91 phox positive cells primarily in the gray matter of the anterior horn fig 1 g whereas sparse staining was observed in the spinal cord of age matched nontransgenic controls fig 1 f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100399 16877542 129021 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 consistent with nadph oxidase expression by professional phagocytes confocal microscopy demonstrated the colocalization of the gp91 phox subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013; j ; no gp91 phox colocalization was detected with the motor neuron marker nonphosphorylated neurofilament 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100400 16877542 129021 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013; j ; no gp91 phox colocalization was detected with the motor neuron marker nonphosphorylated neurofilament heavy chain or with the astrocyte marker glial fibrillary acid protein data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100401 16877542 129021 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consistent with nadph oxidase expression by professional phagocytes confocal microscopy demonstrated the colocalization of the gp91 phox subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100402 16877542 129023 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase causes protein oxidation in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100403 16877542 129024 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we further characterized the status of spinal cord nadph oxidase in transgenic sod1 g93a mice by probing for formation of ros and evidence of protein oxidation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100404 16877542 129026 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 in contrast in symptomatic transgenic sod1 g93a mice carrying the wild type gp91 phox allele sod g93a /gp91 phox+ spinal cord ethidium fluorescence was intense fig 1 l and coincided anatomically with the areas of gp91 phox expression fig 1 g and microglial activation fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100405 16877542 129026 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 + spinal cord ethidium fluorescence was intense fig 1 l and coincided anatomically with the areas of gp91 phox expression fig 1 g and microglial activation fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100406 16877542 129029 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 symptomatic transgenic sod1 g93a /gp91 phox+ mice but not age matched sod1 g93a /gp91 phox_amp_#x02212; mice had increased levels of spinal cord protein carbonyl adducts compared with nontransgenic controls expressing either wild type or null 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100407 16877542 129029 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 but not age matched sod1 g93a /gp91 phox_amp_#x02212; mice had increased levels of spinal cord protein carbonyl adducts compared with nontransgenic controls expressing either wild type or null mutant gp91 phox fig 1 n . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100408 16877542 129030 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 immunohistochemically the most robust labeling for protein carbonyl adducts occurred in spinal cord sections from sod1 g93a /gp91 phox+ mice at the level of cells with mixed morphology including large motor neurons fig 1 o _amp_#x02013; q . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100409 16877542 129031 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase induction and neuronal protein carbonylation in sporadic als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100410 16877542 129032 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we then sought to determine whether the nadph oxidase alterations identified in transgenic sod1 g93a mice were also present in human sporadic als the most common form of the disease 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100411 16877542 129033 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 consistent with the mouse data gp91 phox content was low fig 2 a and b and its immunoreactivity was faint in control postmortem spinal cords fig 2 d whereas gp91 phox content was _amp_#x02248;3 fold higher and its immunoreactivity robust in sporadic als spinal cords fig 2 e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100412 16877542 129034 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 in the latter gp91 phox positive cells colocalized with the microglial associated antigen cd68 fig 2 f and were identified in all of the typical als loci of neurodegeneration including the anterior horn and the lateral cort 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100413 16877542 129038 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox mitigates the disease phenotype in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100414 16877542 129039 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 next we explored the contribution of nadph oxidase activation on the disease phenotype in the sod1 g93a mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100415 16877542 129040 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 transgenic sod1 g93a /gp91 phox_amp_#x02212; mice reached end stage paralysis defined as a loss of the righting reflex later than their transgenic sod1 g93a /gp91 phox+ counterparts fig 3 a which resulted in a longer lifespan of transgenic sod1 g93a /gp91 phox_amp_#x02212; mice log rank test = 15.3; p _amp_#x0003c; 0.001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100416 16877542 129041 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in addition to the prolonged survival inactivation of nadph oxidase did mitigate neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100417 16877542 129042 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 compared with end stage transgenic sod1 g93a /gp91 phox+ mice age matched transgenic sod1 g93a /gp91 phox_amp_#x02212; mice had _amp_#x02248;50% more anterior horn motor neurons in the spinal cord fig 3 b _amp_#x02013; e and myelinated axons in the fifth 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100418 16877542 129043 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 spinal cord microgliosis evidenced by macrophage antigen complex 1 immunostaining and levels of the glial cytokine il 1_amp_#x003b2; did not differ between age matched transgenic sod1 g93a /gp91 phox+ mice and sod1 g93a /gp91 phox_amp_#x02212; mice fig 7 which is published as supporting information on the pnas web site . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100419 16877542 129044 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 also not affected by the deficit of gp91 phox were the levels of human sod1 in transgenic sod1 g93a mice fig 7 or the size of muscle fibers in the fibularis and peroneus longus muscles in nontransgenic mice fig 3 t . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100420 16877542 129045 13949 7577 MYH7 myosin heavy chain myosin heavy chain 0 1.0 the selected muscles are mainly composed of fast twitch fibers and by immunostaining for myosin heavy chain we did not observe any obvious alteration in the makeup of muscle fiber types among the different mouse groups fig 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100423 16877542 129047 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100424 16877542 129047 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100425 16877542 129048 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we then explored whether nadph oxidase mediated protein modifications might promote neurodegeneration in als by damaging essential surviving pathways for motor neurons such as igf1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100426 16877542 129051 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however protein carbonyl adducts were evident in the _amp_#x003b1; chain of the igf1 tyrosine kinase cognate receptor in the spinal cord of symptomatic transgenic sod1 g93a /gp91 phox+ mice fig 4 a and b ; similar results were obtained for the _amp_#x003b2; chain of igf1 receptor data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100427 16877542 129058 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however there were fewer phospho igf1 receptor immunoreactive cells in spinal cord sections from symptomatic transgenic sod1 g93a /gp91 phox+ mice than from age matched sod1 g93a /gp91 phox_amp_#x02212; mice fig 4 c _amp_#x02013; e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100428 16877542 129059 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 as fewer cells that were immunoreactive for a downstream target of akt phospho bad fig 4 h _amp_#x02013; j and smaller phospho bad:total bad ratios fig 4 k and l in symptomatic transgenic sod1 g93a /gp91 phox+ mice compared with their age matched sod1 g93a /gp91 phox_amp_#x02212; counterparts. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100429 16877542 129060 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 these data further support the idea that oxidative modification of igf1 receptor in symptomatic transgenic sod1 g93a /gp91 phox+ mice is associated with a range of molecular perturbations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100430 16877542 129062 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 to test the idea that nadph oxidase derived ros could impair igf1 pathway function an in vitro cell system using the neuron like cell lines sh sy5y and imr32 was used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100431 16877542 129065 3544 1516 CAT catalase catalase 0 1.0 to conditioned medium containing 0.1 milliunits/ml glucose oxidase generating an average stable concentration of 75 _amp_#x003bc;m h 2 o 2 fig 5 e ; this effect was abolished by adding 1 000 units/ml catalase to the medium data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100432 16877542 129069 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 however both the alteration of igf1 mediated akt phosphorylation and the loss of cell viability mediated by lps activated microglia were counteracted by the specific nadph oxidase inhibitor apocynin fig 5 c d and f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100433 16877542 129073 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 germane to the molecular basis of this deleterious effect on motor neurons is our finding that virtually all spinal cord microglial cells express the gp91 phox subunit of the oxidant producing enzyme nadph oxidase fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100434 16877542 129073 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 germane to the molecular basis of this deleterious effect on motor neurons is our finding that virtually all spinal cord microglial cells express the gp91 phox subunit of the oxidant producing enzyme nadph oxidase fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100435 16877542 129074 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 agreeing with the fact that in nonactivated phagocytes nadph oxidase is quiescent 7 gp91 phox positive cells in spinal cords from 1 to 4 month old nontransgenic mice had a morphology of resting microglia and did not seem to produce ros figs 1 and 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100436 16877542 129074 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 agreeing with the fact that in nonactivated phagocytes nadph oxidase is quiescent 7 gp91 phox positive cells in spinal cords from 1 to 4 month old nontransgenic mice had a morphology of resting microglia and did not seem to produce ros figs 1 and 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100437 16877542 129075 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 conversely in transgenic sod1 g93a mice paralleling the worsening of the als phenotype there was an intensification of spinal cord microgliosis accompanied by an up regulation and activation of nadph oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100438 16877542 129077 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 corroborating this view are the levels of protein carbonyls which were markedly elevated in spinal cord extracts of symptomatic transgenic sod1 g93a mice for the most part in a nadph oxidase dependent manner fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100439 16877542 129078 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 evidence of microgliosis nadph oxidase up regulation and protein carbonylation was also found in postmortem spinal cords from human sporadic als cases fig 2 supporting the conclusion that the occurrence of inflammation mediated oxidative 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100440 16877542 129079 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 our results also show that abrogation of the gp91 phox subunit of nadph oxidase in transgenic sod1 g93a mice eliminates the production of microglial derived ros fig 1 m and importantly prolongs survival and retards neurodegeneration in this als model fig 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100441 16877542 129079 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our results also show that abrogation of the gp91 phox subunit of nadph oxidase in transgenic sod1 g93a mice eliminates the production of microglial derived ros fig 1 m and importantly prolongs survival and retards neurodegeneration in this als model fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100442 16877542 129080 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox in transgenic sod1 g93a mice did not alter the spinal cord microglial response or the expression of human sod1 in transgenic sod1 g93a mice fig 7 which is a known determinant of disease severity in t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100443 16877542 129081 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consequently the attenuated phenotype seen in transgenic sod1 g93a /gp91 phox_amp_#x02212; mice is attributable to the lack of nadph oxidase activity and not to either an impaired microglial response or expression of the human sod1 g93a transgene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100444 16877542 129082 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 these data provide compelling evidence that nadph oxidase contributes to the degeneration of motor neurons in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100445 16877542 129084 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however the magnitude of benefit afforded by gp91 phox deletion in transgenic sod1 g93a mice argues that targeting neuroinflammation by inhibiting just one of its mediators such as nadph oxidase may not be sufficient to produce robust and lasting neuropr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100446 16877542 129084 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 however the magnitude of benefit afforded by gp91 phox deletion in transgenic sod1 g93a mice argues that targeting neuroinflammation by inhibiting just one of its mediators such as nadph oxidase may not be sufficient to produce robust and lasting neuroprotection in als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100447 16877542 129085 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 all cells not motor neurons only which are located in the vicinity of activated microglia may indiscriminately have their plasma membrane proteins and lipids damaged by nadph oxidase derived ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100448 16877542 129091 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in this study we indeed found that receptors for igf1 were primarily expressed on motor neurons in mouse spinal cords fig 8 and that the igf1 signaling pathway was impaired by a nadph oxidase dependent mechanism in symptomatic transgenic sod1 g93a mice fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100449 16877542 129092 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 although igf1 per se did not seem to be damaged by inflammation nadph oxidase did stimulate the oxidative modification of igf1 receptors fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100450 16877542 129095 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 ggregate show that several molecular events that are normally elicited by ligation of the igf1 receptor including autophosphorylation and akt phosphorylation were indeed abated by ros in a microglial nadph oxidase dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100451 16877542 129096 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our data also show that microglial nadph oxidase by impairing the igf1 signaling pathway renders sh sy5y cells in our in vitro system more prone to die upon exposure to a hostile environment such as that emulated by lps activated microglial conditi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100452 16877542 129099 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in our study however we did not find any evidence that the rescue of the igf1 pathway by abrogating nadph oxidase was associated with muscle hypertrophy fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100453 16877542 129100 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 nevertheless whether transgenic sod1 g93a mice carrying the gp91 phox null mutation reach end stage paralysis later and exhibit an attenuated neurodegenerative process because of some effects at the skeletal muscle level is an interesting possibility that cannot be exc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100454 16877542 129114 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 microglial nadph oxidase stimulates carbonylation of spinal cord motor neurons in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100455 16877542 129115 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a _amp_#x02013; e spinal cord gp91 phox mrna a and d and protein b and e in 1 month old asymptomatic to 4 month old end stage transgenic sod1 more ... 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100456 16877542 129117 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is up regulated and associated with motor neuron carbonylation in the spinal cord of sporadic als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100457 16877542 129118 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a and b immunoblots and bar graph for gp91 phox using spinal cord extracts from six normal controls and six age matched als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100458 16877542 129121 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox increases lifespan and lessens neurodegeneration in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100459 16877542 129122 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a survival comparison of transgenic sod1 g93a /gp91 phox+ mice red 122.0 _amp_#x000b1; 1.7 days; n = 19 and transgenic sod1 g93a /gp91 phox_amp_#x02212; littermates more ... 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100460 16877542 129124 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 modulation of the igf1/akt pathway by nadph oxidase derived ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100463 16877542 129130 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100465 16877542 129130 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100467 16877542 129133 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 insights into its neurodegenerative mechanisms followed the discovery that dominant mutations in the gene for superoxide dismutase 1 sod1 cause familial als 2 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100468 16877542 129138 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 among the microglia derived mediators that could promote neurodegeneration are reactive oxygen species ros produced by the enzyme nadph oxidase complex 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100470 16877542 129141 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in light of these facts we undertook the study of nadph oxidase in both human als and one of its genetic models. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100471 16877542 129142 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our results for both human and mouse postmortem tissues indicate that spinal cord microgliosis in als is accompanied with an up regulation of nadph oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100472 16877542 129143 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 furthermore by using mutant deficient mice in functional nadph oxidase as well as in neuron like cell culture systems we provide compelling evidence that supports the concept that this microglial ros generating enzymatic complex promotes spinal cord motor neuron degener 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87992 17099894 113908 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 motor neuron degeneration in amyotrophic lateral sclerosis mutant superoxide dismutase 1 transgenic mice: mechanisms of mitochondriopathy and cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87994 17099894 113909 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 the mechanisms of human mutant superoxide dismutase 1 msod1 toxicity to motor neurons mns are unresolved. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87995 17099894 113912 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 the mn death is independent of activation of caspases 1 3 and 8 or apoptosis inducing factor within mns with a blockade of apoptosis possibly mediated by aven up regulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87996 17099894 113914 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87999 17099894 113914 13731 7419 MT-CO1 cytochrome c oxidase subunit i cytochrome c oxidase subunit i 0 1.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88000 17099894 113915 5893 2898 DLD diaphorase diaphorase 0 1.0 mitochondria in msod1 mouse mns accumulate nadph diaphorase and inducible nitric oxide synthase inos like immunoreactivity and inos gene deletion extends significantly the life span of g93a msod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88001 17099894 113915 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 mitochondria in msod1 mouse mns accumulate nadph diaphorase and inducible nitric oxide synthase inos like immunoreactivity and inos gene deletion extends significantly the life span of g93a msod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88002 17099894 113917 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 olving blockade of apoptosis accumulation of mn mitochondria with enhanced toxic potential from distal terminals nos localization in mn mitochondria and peroxynitrite damage and early degeneration of alpha synuclein + interneurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88214 17105868 114229 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the proapoptotic proteins fas fas associated death domain caspase 8 and caspase 3 were also elevated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88215 17105868 114229 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 the proapoptotic proteins fas fas associated death domain caspase 8 and caspase 3 were also elevated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88216 17105868 114240 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the ratio of apoptotic cell death genes bax to bcl 2 is increased at both the mrna and protein level in spinal motor neurons from patients with als and from sod1 g93a mice mu et al. 1996 ; vukosavic et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88217 17105868 114241 1576 990 BCL2 bcl 2 bcl 2 0 1.0 mutant sod1 g93a has been observed to aggregate in spinal cord mitochondria but not liver mitochondria and binds to bcl 2 pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88218 17105868 114242 1576 990 BCL2 bcl 2 bcl 2 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 200 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88219 17105868 114242 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 2001 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88220 17105868 114242 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 2001 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88221 17105868 114242 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 2001 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88222 17105868 114243 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in support of this idea overexpression of bcl 2 or the caspase inhibitory protein xiap prolongs survival and improves motor performance in als mice expressing the sod1 g93a mutation kostic et al. 1997 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88225 17105868 114247 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 surprisingly insulin like growth factor 1 prevents neuronal cell apoptosis and protects spinal motor neurons in als mice ryu et al. 1999 ; kaspar et al. 2003 but markedly potentiates neuronal cell necrosis induced by hydroxyl radical or glut 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88226 17105868 114284 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 ctions were then reacted overnight at 4degreec with the primary antibodies: mouse anti fas bd biosciences san jose ca anti nitrotyrosine 4 microg/ml; upstate biotechnology lake placid ny anti cleaved caspase 3 cell signaling technology danvers ma and anti neun. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88227 17105868 114294 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the following primary antibodies were used: fas fadd bd bioscience franklin lakes nj cleaved caspase 3 and cleaved caspase 8 1 microg/ml; cell signaling technology . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88228 17105868 114294 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 the following primary antibodies were used: fas fadd bd bioscience franklin lakes nj cleaved caspase 3 and cleaved caspase 8 1 microg/ml; cell signaling technology . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88229 17105868 114332 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative stress in als seems to be attributable to multiple factors including mitochondrial dysfunction reduced glutathione peroxidase activity and point mutations in the cu zn superoxide dismutase sod1 gene the last of which are present in approximately 20% of familial als cases rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88230 17105868 114335 4772 26515 COQ10A coenzyme q10 homolog a coenzyme q10 a 0 1.0 second in transgenic mice expressing the sod1 g93a mutation transgenic als mice administration of antioxidants such as coenzyme q10 a component of the mitochondrial respiratory chain and creatine an inhibitor of the mitochondrial transition pore reduces free radical formation and increases life span and motor performance matthews e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88231 17105868 114342 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the latter effect may be attributable to interaction of mutant sod1 and bcl 2 causing mitochondrial dysfunction and subsequently increased sensitivity to oxidative stress pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88232 17105868 114348 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we found that expression of fas and fadd were increased selectively in the ventral motor neurons of g93a transgenic mice and that this led to activation of caspase 8 and caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88233 17105868 114348 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 we found that expression of fas and fadd were increased selectively in the ventral motor neurons of g93a transgenic mice and that this led to activation of caspase 8 and caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88234 17105868 114351 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in support of this li blocked activation of the fas pathway during serum deprivation induced apoptosis and attenuated motor neuron degeneration as well as activation of fas caspase 8 and caspase 3 in the spinal cords of als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88235 17105868 114351 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 in support of this li blocked activation of the fas pathway during serum deprivation induced apoptosis and attenuated motor neuron degeneration as well as activation of fas caspase 8 and caspase 3 in the spinal cords of als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88236 17105868 114354 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 0 blocks free radical neurotoxicity in cortical cell cultures at a dose as low as 0.3 microm and completely blocks free radical production after focal cerebral gwag et al. 2006 beta and activation of phosphatidylinositol 3 kinase that result in activation of the serine/threonine kinase akt 1 and phospholipase c gamma chalecka franaszek and chuang 1999 ~0.425 _amp_#177; 0.05 meq/l in blood below the therapeutic range 0.6 1.5 m 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88237 17105868 114354 16737 15917 PLCB1 phospholipase c phospholipase c 0 1.0 completely blocks free radical production after focal cerebral gwag et al. 2006 beta and activation of phosphatidylinositol 3 kinase that result in activation of the serine/threonine kinase akt 1 and phospholipase c gamma chalecka franaszek and chuang 1999 ~0.425 _amp_#177; 0.05 meq/l in blood below the therapeutic range 0.6 1.5 meq/l in blood for treatment of manic episodes and depression in humans ross and fra 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88238 17105868 114356 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 long term treatment with li increases expression of brain derived neurotrophic factor in the hippocampus and neocortex which mediates the antiapoptotic action of li fukumoto et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88239 17105868 114356 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 long term treatment with li increases expression of brain derived neurotrophic factor in the hippocampus and neocortex which mediates the antiapoptotic action of li fukumoto et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88240 17105868 114357 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88242 17105868 114357 14727 8023 NTF3 neurotrophin 3 neurotrophin 3 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; won 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88243 17105868 114357 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88244 17105868 114357 14728 8024 NTF4 nt 4/5 nt 4/5 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; won et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88245 17105868 114357 14728 8024 NTF4 nt 4/5 nt 4/5 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; won et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88246 17105868 114357 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88247 17105868 114358 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 neurotrophins can induce oxidative stress through up regulation of nadph oxidase leading to neuronal cell necrosis kim et al. 2002 kim et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88248 17105868 114383 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 c western blot analysis showing expression of cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control or g93a mice at ages indicated a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88249 17105868 114383 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 c western blot analysis showing expression of cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control or g93a mice at ages indicated a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88250 17105868 114384 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 levels of cleaved caspase 8 b and caspase 3 c were measured and scaled to actin mean _amp_#177; s.e.m. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88251 17105868 114384 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 levels of cleaved caspase 8 b and caspase 3 c were measured and scaled to actin mean _amp_#177; s.e.m. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88252 17105868 114386 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 d fluorescence photomicrographs of lumbar ventral sections from control a and g93a mice b at 12 weeks of age immunolabeled with an antibody for cleaved caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88253 17105868 114387 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 note activation of caspase 3 in the motor neurons arrows from g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88254 17105868 114395 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 c western blot analysis of fadd after immunoprecipitation ip with fas antibody cleaved caspase 8 cleaved caspase 3 and actin in neuron rich cortical cell cultures deprived of serum for 12 h alone or in the presence of 1 microm neu2000 or 5 mm li . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88255 17105868 114395 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 c western blot analysis of fadd after immunoprecipitation ip with fas antibody cleaved caspase 8 cleaved caspase 3 and actin in neuron rich cortical cell cultures deprived of serum for 12 h alone or in the presence of 1 microm neu2000 or 5 mm li . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88256 17105868 114403 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 f western blot analysis of fas fadd cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control and g93a transgenic mice treated with saline neu2000 30 mg/kg/days or li 200 mg/kg/days for 4 weeks starting from 8 weeks of age a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88257 17105868 114403 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 f western blot analysis of fas fadd cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control and g93a transgenic mice treated with saline neu2000 30 mg/kg/days or li 200 mg/kg/days for 4 weeks starting from 8 weeks of age a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88258 17105868 114423 7334 11936 FASLG fas ligand fas ligand 0 1.0 fas and fas ligand mediated apoptosis plays a role in neuronal loss in animal models of stroke martin et al. 2001 beta amyloid neurotoxicity in cultured cortical neurons su et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88259 17105868 114425 22151 21354 TICAM2 cytoplasmic adaptor cytoplasmic adaptor 0 1.0 expression of fas and its cytoplasmic adaptor protein fadd and fas fadd interaction were also increased in the lumbar spinal cord of g93a transgenic mice at 12 weeks of age compared with control mice fig 2a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88260 17105868 114427 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 increased expression of the apoptosis inducing signaling complex was followed by activation of caspase 8 and caspase 3 in the lumbar spinal cord fig 2c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88261 17105868 114427 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 increased expression of the apoptosis inducing signaling complex was followed by activation of caspase 8 and caspase 3 in the lumbar spinal cord fig 2c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88262 17105868 114428 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the active form of caspase 3 was observed in spinal motor neurons from g93a mice fig 2d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88263 17105868 114429 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 these findings suggest that fas fadd caspase 8 and caspase 3 are activated in spinal motor neurons and mediate subsequent neuronal apoptosis in als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88264 17105868 114429 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 these findings suggest that fas fadd caspase 8 and caspase 3 are activated in spinal motor neurons and mediate subsequent neuronal apoptosis in als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88265 17105868 114441 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 interaction of fadd with fas cleaved caspase 8 and cleaved caspase 3 were all increased in neuron rich cortical cell cultures deprived of serum for 8 h and these changes were blocked by the addition of li but not neu2000 fig 3c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88266 17105868 114441 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 interaction of fadd with fas cleaved caspase 8 and cleaved caspase 3 were all increased in neuron rich cortical cell cultures deprived of serum for 8 h and these changes were blocked by the addition of li but not neu2000 fig 3c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88267 17105868 114445 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 daily administration of neu2000 in the diet slightly but statistically insignificantly attenuated the increase in fas fadd and cleaved caspase 8 and caspase 3 in the lumbar spinal cords of g93a transgenic mice at 12 weeks of age fig 3f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88268 17105868 114445 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 daily administration of neu2000 in the diet slightly but statistically insignificantly attenuated the increase in fas fadd and cleaved caspase 8 and caspase 3 in the lumbar spinal cords of g93a transgenic mice at 12 weeks of age fig 3f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88269 17105868 114469 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 abbreviations: als amyotrophic lateral sclerosis; page paw grip endurance; mfr mitochondrial free radicals; div days in vitro; bso dl buthionine [ s r ] sulfoximine; sod superoxide dismutase; ldh lactate dehydrogenase; fadd fas associated death domain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72569 17150307 92627 7683 3796 FOS ap 1 ap 1 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72570 17150307 92627 7683 3796 FOS c fos c fos 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72571 17150307 92627 10824 6204 JUN c jun c jun 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72572 17150307 92627 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72573 17150307 92628 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72574 17150307 92628 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72575 17150307 92628 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72576 17150307 92629 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in an als like transgenic mouse model overexpressing mutant g93a sod1 gene we showed that the reduction of gsh in the spinal cord and motor neuron cells is correlated with aif translocation caspase 3 activation and motor neuron degeneration during als like disease onset and progression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72577 17150307 92634 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations of cu zn superoxide dismutase sod1 gene cause motor neuron degeneration and have linked to 2_amp_#x02013;5% of als cases rosen et al. 1994 ; rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72578 17150307 92646 8857 4624 GSS gsh synthetase gsh synthetase 0 1.0 gsh is synthesized in two sequential enzymatic reactions catalyzed by _amp_#x003b3; glutamylcysteine synthetase _amp_#x003b3; gcs and gsh synthetase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72579 17150307 92699 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the forward and reverse real time pcr primers for amplification of ho 1 transcripts were 5_amp_#x02019; ctcactggcaggaaatcatccc 3_amp_#x02019; and 5_amp_#x02019; gagaggtcacccaggtagcg respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72580 17150307 92710 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after protein concentration measurement western blotting was performed to analyze cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72581 17150307 92712 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 western analysis was performed to analyze cytochrome c release and aif translocation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72582 17150307 92714 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 after permeabilization with 0.2% triton x 100 in pbs and blocking with 10% goat serum cells were incubated with specific antibodies overnight at 4 _amp_#x000b0;c aif cytochrome c and active caspase 3 antibodies were all at 1:300 dilution; chemicon inc. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72583 17150307 92714 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after permeabilization with 0.2% triton x 100 in pbs and blocking with 10% goat serum cells were incubated with specific antibodies overnight at 4 _amp_#x000b0;c aif cytochrome c and active caspase 3 antibodies were all at 1:300 dilution; chemicon inc. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72584 17150307 92746 7683 3796 FOS ap 1 ap 1 0 1.0 ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72585 17150307 92746 7683 3796 FOS c fos c fos 0 1.0 ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72586 17150307 92746 10824 6204 JUN c jun c jun 0 1.0 ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72587 17150307 92747 9462 5013 HMOX1 ho 1 ho 1 0 1.0 similarly gsh depletion also increased ho 1 expression as detected by quantitative real time pcr reaction and western blotting analyses respectively figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72588 17150307 92755 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 results gsh depletion promoted aif redistribution cytochrome c release caspase 3 activation and apoptotic cell death a biochemical assay and an immunohistochemical analysis were used to identify the molecular pathways of cell apoptosis by gsh depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72589 17150307 92755 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 results gsh depletion promoted aif redistribution cytochrome c release caspase 3 activation and apoptotic cell death a biochemical assay and an immunohistochemical analysis were used to identify the molecular pathways of cell apoptosis by gsh depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72590 17150307 92759 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 similarly mitochondrial and cytosolic fractionation coupled with western blotting analysis and immunohistochemistry showed that cytochrome c release was involved in nsc34 cell apoptosis caused by gsh depletion figure 6c 6d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72591 17150307 92761 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 gsh depletion increased caspases 3 activation revealed by immunohistochemical staining with anti active caspase 3 antibody figure 7a_amp_#x02013;7c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72592 17150307 92769 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 decreased gsh was associated with aif nuclear translocation caspase 3 activation and motor neuron cell death figure 9 in als like transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72593 17150307 92779 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 cytochrome c mediated caspase 3 activation elicited by gsh reduction also contributed to motor neuron cell death apoptosis . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72594 17150307 92779 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c mediated caspase 3 activation elicited by gsh reduction also contributed to motor neuron cell death apoptosis . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72595 17150307 92793 8857 4624 GSS glutathione synthetase glutathione synthetase 0 1.0 gsh is biosynthesized from l glutamate catalyzed by _amp_#x003b3; gcs and glutathione synthetase gs in the cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72596 17150307 92798 7683 3796 FOS ap 1 ap 1 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72597 17150307 92798 7683 3796 FOS c fos c fos 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72598 17150307 92798 10824 6204 JUN c jun c jun 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72599 17150307 92798 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72600 17150307 92809 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the dramatic increase in cytochrome c release to cytosol detected by the fractionation assay and immunohistochemical analysis figure 6b and 6d most likely reflects the increased activation of caspase 3 and consequently contributes to the markedly increased of apoptosis elicited through the reduction of gsh in nsc34 cells figure 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72601 17150307 92809 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the dramatic increase in cytochrome c release to cytosol detected by the fractionation assay and immunohistochemical analysis figure 6b and 6d most likely reflects the increased activation of caspase 3 and consequently contributes to the 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72602 17150307 92810 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c mediated caspase activation has also been shown to lead motor neuron degeneration in als like mouse and human als patients guegan et al. 2001 ; li et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72603 17150307 92811 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 discussion decreased gsh is associated with motor neuron degeneration and als like disease onset and progression in the g93a sod1 transgenic mouse model more recently alterations of glutathione s transferase pi activity have been reported in als patients kuzma et al. 2006 ; usarek et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72604 17150307 92811 8877 4638 GSTP1 glutathione s-transferase pi glutathione s transferase pi 0 1.0 discussion decreased gsh is associated with motor neuron degeneration and als like disease onset and progression in the g93a sod1 transgenic mouse model more recently alterations of glutathione s transferase pi activity have been reported in als patients kuzma et al. 2006 ; usarek et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72605 17150307 92817 3544 1516 CAT catalase catalase 0 1.0 more significantly treatment of als like transgenic mice with antioxidants such as sod and catalase mimetics jung et al. 2001 dmpo liu et al. 2002 iron porphyrin wu et al. 2003 or manganese porphyrin crow et al. 2005 delays disease onset and extends survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72606 17150307 92844 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 figure 9 redistribution of aif and active caspase 3 in motor neuron cells of als like mice 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72607 17150307 92846 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 aif apoptosis inducing factor als amyotrophic lateral sclerosis bso l buthionine sulfoximine dcf dichlorofluorescin dmem dulbecco_amp_#x02019;s modified eagle_amp_#x02019;s medium ea ethacrynic acid fbs fetal bovine serum _amp_#x 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72608 17150307 92846 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 etal bovine serum _amp_#x003b3; gcs _amp_#x003b3; glutamylcysteine synthetase gsh glutathione gssg oxidized glutathione mbm monobromobimane pfa paraformaldehyde ros reactive oxygen species sod1 cu zn superoxide dismutase tunel terminal deoxynucleotidyl transferase mediated nick end labeling 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72609 17150307 92847 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 apoptosis inducing factor|biological markers|enzyme inhibitors|reactive oxygen species|buthionine sulfoximine|ethacrynic acid|glutathione|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74577 17174478 95135 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in a superoxide dismutase which removes oxygen free radicals may cause the neurodegenerative disease amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74578 17174478 95136 24250 12791 WRN werner syndrome werner syndrome 0 1.0 additionally dna repair disorders that affect the brain to varying extents include ataxia telangiectasia like disorder cockayne syndrome or werner syndrome. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74579 17174478 95140 24250 12791 WRN werner syndrome werner syndrome 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74580 17174478 95140 24316 12814 XPA xeroderma pigmentosum xeroderma pigmentosum 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74581 17174478 95140 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74582 17174478 95140 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74583 17174478 95156 24250 12791 WRN werner syndrome werner syndrome 0 1.0 severe neurodegeneration is clearly apparent in some disorders such as cockayne syndrome lehmann 2003 while more aging related phenotypes are present in others including werner syndrome goto 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74584 17174478 95194 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 tion repair hrdc helicase rnase d conserved domain mmr mismatch repair mrn mre11/rad50/nbs1 mtdna mitochondrial dna ner nucleotide excision repair no nitric oxide e i or nnos endothelial inducible or neuronal nitric oxide synthase nosox nos catalytic oxygenase module nosred nos reductase module nhej nonhomologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription cou 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74585 17174478 95194 24250 12791 WRN werner syndrome werner syndrome 0 1.0 omologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription coupled nucleotide excision repair thm thumb domain ttd trichothiodystropy ws werner syndrome xp xeroderma pigmentosum 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74586 17174478 95194 24316 12814 XPA xeroderma pigmentosum xeroderma pigmentosum 0 1.0 ng ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription coupled nucleotide excision repair thm thumb domain ttd trichothiodystropy ws werner syndrome xp xeroderma pigmentosum 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74588 17174478 95194 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 ide e i or nnos endothelial inducible or neuronal nitric oxide synthase nosox nos catalytic oxygenase module nosred nos reductase module nhej nonhomologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription coupled nucleotide excision repair thm thumb domain ttd trichothiodystropy ws werner syndrome xp xeroderma pigmentosum 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74589 17174478 95195 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74591 17174478 95198 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 most of these free radicals are rapidly scavenged in the cell by the superoxide dismutase sod enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74592 17174478 95216 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74594 17174478 95227 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 ros and copper zinc superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74595 17174478 95232 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase1 0 1.0 however mutations in the superoxide dismutase1 sod1 gene give rise to approximately 20% of fals cases deng et al. 1993 rosen et al. 1993 rakhit et al. 2002 while mutations in several other genes including als2 setx or vapb cause much rarer forms 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74596 17174478 95233 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 sod1 encodes a cytosolic copper zinc superoxide dismutase cu zn sod which similar to the mitochondrial mnsod is responsible for the disproportionation of harmful superoxide radicals to hydrogen peroxide and oxygen fridovich 1986 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74597 17174478 95244 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 cu zn sod with essential cellular components bruijn et al. 1998 johnston et al. 2000 cleveland and rothstein 2001 and this has been demonstrated with the copper chaperone for sod ccs kato et al. 2001 nitric oxide synthase nos and phosphorylated neurofilaments chou et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74598 17174478 95256 3544 1516 CAT catalase catalase 0 1.0 the catalase protein completes the process of eliminating ros by converting hydrogen peroxide into water and oxygen. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74599 17174478 95257 3544 1516 CAT catalase catalase 0 1.0 in addition to this defense against oxidative damage human catalase has roles in ethanol metabolism zimatkin et al. 1998 inflammation halliwell and gutteridge 1984 apoptosis yabuki et al. 1999 aging and cancer miyamoto et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74600 17174478 95260 3544 1516 CAT catalase catalase 0 1.0 several catalase crystal structures have been determined aiding our understanding of reactive oxygen control by defining the reaction and inhibition mechanisms goth 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74601 17174478 95261 3544 1516 CAT catalase catalase 0 1.0 these studies include the definition of the chemistry of the human catalase through structures of the resting state enzyme and complexes of a catalase bound to cyanide and 3at inhibitors putnam et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74602 17174478 95262 3544 1516 CAT catalase catalase 0 1.0 human catalase forms a tetrameric assembly and this may be important to ensure that the active site is sequestered and that the enzyme is competent to complete the reaction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74603 17174478 95263 3544 1516 CAT catalase catalase 0 1.0 interestingly an unstable catalase isolated from patients homozygous for a swiss type acatalasemia a hereditary catalase deficiency disorder rapidly disassociates into inactive dimers with reduced heme content. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74604 17174478 95264 3544 1516 CAT catalase catalase 0 1.0 this suggests that catalase assembly variants may play roles in disease susceptibility aebi et al. 1974 in addition to nonsense and splicing mutations hirono et al. 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74605 17174478 95265 3544 1516 CAT catalase catalase 0 1.0 from the structural data a mechanism for the recognition and removal of peroxide by catalase has been proposed putnam et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74606 17174478 95268 3544 1516 CAT catalase catalase 0 1.0 catalase uses these two asymmetric interactions with the substrate to prime the otherwise symmetric peroxide bond for heterolytic bond cleavage; good geometry for both iron coordination and hydrogen bond form 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74607 17174478 95271 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ros and nitric oxide synthase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74608 17174478 95277 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 no is a small easily diffusible and transient free radical whose availability is controlled at the synthesis level by the nitric oxide synthase nos enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74609 17174478 95288 16990 9208 POR nadph-dependent cytochrome p450 reductase nadph dependent cytochrome p450 reductase 0 1.0 nosred belongs to a large protein family including nadph dependent cytochrome p450 reductase and sulfite reductase flavoprotein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74611 17174478 95288 16990 9208 POR cytochrome p450 reductase cytochrome p450 reductase 0 1.0 nosred belongs to a large protein family including nadph dependent cytochrome p450 reductase and sulfite reductase flavoprotein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74612 17174478 95293 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ros and nitric oxide synthase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74613 17174478 95309 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 this model is consistent with the proposed role of the same region in the structurally related cytochrome p450 bm3 sevrioukova et al. 1999 and reminiscent of those found in multiple redox centers containing proteins zhang et al. 1998 lennon et al. 2000 leys et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74614 17174478 95313 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ros and nitric oxide synthase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74615 17174478 95396 24250 12791 WRN werner syndrome werner syndrome 0 1.0 hereditary mutations in wrn are associated with werner syndrome ws a rare autosomal recessive disorder that gives rise to multiple progeroid pathologies including osteoporosis atherosclerosis and a greatly increased cancer incidence goto 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74616 17174478 95405 1675 1058 BLM bloom syndrome bloom syndrome 0 1.0 mutations in blm and recq4l cause bloom syndrome and rothmund thomson syndrome respectively harrigan et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74617 17174478 95416 22185 23696 TIPARP parp 1 parp 1 0 1.0 rigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74618 17174478 95416 7490 3650 FEN1 fen 1 fen 1 0 1.0 inks to ber include physical and functional interaction with pol_amp_#x003b2; harrigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74619 17174478 95416 16068 270 PARP1 poly (adp-ribose) polymerase poly adp ribose polymerase 0 1.0 ion with pol_amp_#x003b2; harrigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74620 17174478 95416 16068 270 PARP1 poly adp-ribose polymerase 1 poly adp ribose polymerase 1 0 1.0 ion with pol_amp_#x003b2; harrigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74621 17174478 95420 22185 23696 TIPARP parp 1 parp 1 0 1.0 furthermore wrn has been observed in an endogenous complex with the ku70/80 subunit and poly adp ribose polymerase 1 parp 1 li et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74622 17174478 95420 16068 270 PARP1 poly (adp-ribose) polymerase poly adp ribose polymerase 0 1.0 furthermore wrn has been observed in an endogenous complex with the ku70/80 subunit and poly adp ribose polymerase 1 parp 1 li et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74623 17174478 95420 16068 270 PARP1 poly adp-ribose polymerase 1 poly adp ribose polymerase 1 0 1.0 furthermore wrn has been observed in an endogenous complex with the ku70/80 subunit and poly adp ribose polymerase 1 parp 1 li et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74624 17174478 95421 22185 23696 TIPARP parp 1 parp 1 0 1.0 notably parp 1 binds sites of ssbs and dsbs and is also implicated in the control of genomic integrity and mammalian life span burkle et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74625 17174478 95429 24250 12791 WRN werner syndrome werner syndrome 0 1.0 additionally wrn exonuclease activity is required to fully compliment a werner syndrome dna end joining phenotype in an in vivo plasmid based assay perry et al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74626 17174478 95431 24250 12791 WRN werner syndrome werner syndrome 0 1.0 however werner syndrome cells have mild radiation sensitivity which rules out wrn as an essential dsb repair protein but wrn exonuclease may nevertheless be used for resolution of a limited class of dsbs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74627 17174478 95444 14656 7983 NR5A1 sf 1 sf 1 0 1.0 the two n terminal domains are helicase lobes that share structural similar to superfamily sf 1 and 2 helicases but have some features unique to the recq family. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74628 17174478 95456 1675 1058 BLM bloom syndrome bloom syndrome 0 1.0 the cysteine side chains are conserved in the recq family and mutations in these residues disrupt recq helicase function and are sufficient to cause bloom syndrome when mutated in blm ellis et al. 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74629 17174478 95466 22185 23696 TIPARP parp 1 parp 1 0 1.0 onuclease domain activity is regulated through the interaction of its c terminus with p53 blander et al. 1999 ku70/80 cooper et al. 2000 li and comai 2000 brosh et al. 2001a karmakar et al. 2002b and parp 1 von kobbe et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74630 17174478 95467 22185 23696 TIPARP parp 1 parp 1 0 1.0 while wrn helicase activity is regulated by c terminal interactions that include trf2 opresko et al. 2002 rad52 baynton et al. 2003 and parp 1 von kobbe et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74631 17174478 95468 7490 3650 FEN1 fen 1 fen 1 0 1.0 an example of wrn stimulation of partner proteins includes the fen 1 partner protein whose structures with dna and pcna have been defined hosfield et al. 1998 chapados et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74632 17174478 95469 7490 3650 FEN1 fen 1 fen 1 0 1.0 wrn interaction that was mapped to the winged helix domain stimulates fen 1 nucleolytic activity by more than 80 fold brosh et al. 2001b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74634 17174478 95478 24316 12814 XPA xeroderma pigmentosum xeroderma pigmentosum 0 1.0 this includes patients with the rare genetic disorders xeroderma pigmentosum xp trichothiodystrophy ttd and cockayne syndrome cs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74635 17174478 95491 16854 9122 PMS2 dna mismatch repair dna mismatch repair 0 1.0 a small n terminal domain is attached to helicase domain hd1 fig 7 which shares structural similarity to the mismatch recognition domain of the dna mismatch repair protein muts obmolova et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75166 17191135 96090 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 an inducible and redox regulated enzyme has having an important role in cellular antioxidant defense. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75167 17191135 96102 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mccord and fridovich first described superoxide dismutase implying a potential physiological role of superoxide [ 2 ] subsequently confirmed in numerous studies [ 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75168 17191135 96104 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in defense against this the cell has developed a number of antioxidant defense systems including superoxide dismutase the peroxidases the glutathione redox cycle with its associated constitutive enzymes as well as glutathione itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75169 17191135 96113 9462 5013 HMOX1 ho 1 ho 1 0 1.0 heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75170 17191135 96113 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75171 17191135 96116 9462 5013 HMOX1 ho 1 ho 1 0 1.0 fig. 1 a cellular stress response and the interplay between ho 1 and trxr. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75172 17191135 96120 9462 5013 HMOX1 ho 1 ho 1 0 1.0 acetylcarnitine through activation via acetylation of the redox sensitive transcription factor nrf2 and its consequent binding to the antioxidant responsive element are in the ho gene up regulates ho 1 and trxr thus counteracting nitrosative stress and no mediated neurotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75173 17191135 96122 23454 12435 TXN thioredoxin thioredoxin 0 1.0 oxs oxidative stress; ho 1 heme oxygenase; trxr thioredoxin reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75174 17191135 96122 9462 5013 HMOX1 ho 1 ho 1 0 1.0 oxs oxidative stress; ho 1 heme oxygenase; trxr thioredoxin reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75175 17191135 96123 23454 12435 TXN thioredoxin thioredoxin 0 1.0 trx thioredoxin sh reduced form s s oxidized form. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75176 17191135 96124 9462 5013 HMOX1 ho 1 ho 1 0 1.0 b regulation of ho 1 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75177 17191135 96125 12211 6782 MAFK nuclear factor erythroid-2 nuclear factor erythroid 2 0 1.0 nuclear factor erythroid 2 related factor 2 nrf2 is a transcription factor responsible for the induction of several genes related to the cellular stress response including ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75178 17191135 96125 9462 5013 HMOX1 ho 1 ho 1 0 1.0 nuclear factor erythroid 2 related factor 2 nrf2 is a transcription factor responsible for the induction of several genes related to the cellular stress response including ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75179 17191135 96126 11267 25888 KLHL22 kelch-like kelch like 0 1.0 under normal conditions nrf2 is sequestered in the cytoplasm by an actin binding protein kelch like ech associating protein 1 keap1 but upon exposure of cells to oxidative stress nrf2 dissociates from keap1 translocates to the nucleus binds to antioxidant responsive elements ares and activates ho 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75180 17191135 96126 9462 5013 HMOX1 ho 1 ho 1 0 1.0 like ech associating protein 1 keap1 but upon exposure of cells to oxidative stress nrf2 dissociates from keap1 translocates to the nucleus binds to antioxidant responsive elements ares and activates ho 1 gene this review will emphasize the role of free radicals in the pathogenesis of neurodegenerative disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75181 17191135 96127 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in addition the key role played by members of the vitagene system such as ho 1 and thioredoxin fig 1 a in modulating the onset and progression of major neurodegenerative diseases such as ad and pd are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75182 17191135 96127 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition the key role played by members of the vitagene system such as ho 1 and thioredoxin fig 1 a in modulating the onset and progression of major neurodegenerative diseases such as ad and pd are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75183 17191135 96139 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75184 17191135 96139 20997 11180 SOD2 mn sod mn sod 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75185 17191135 96139 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75186 17191135 96140 9462 5013 HMOX1 ho 1 ho 1 0 1.0 hat the antioxidant protein heme oxygenase could _amp_#8220;sense_amp_#8221; no and thus protect against ros and rns insults is supported by the following findings: a no and no related species induce ho 1 expression and increase heme oxygenase activity in human glioblastoma cells hepatocytes and aortic vascular cells; b cells pre treated with various no releasing molecules acquire increased resistance 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75187 17191135 96141 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 the conception that no and rns can be directly involved in the modulation of ho 1 expression in eukaryotes is based on the evidence that different no releasing agents can markedly increase ho 1 and hsp70 in a variety of tissues including brain cells [ 19 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75188 17191135 96141 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the conception that no and rns can be directly involved in the modulation of ho 1 expression in eukaryotes is based on the evidence that different no releasing agents can markedly increase ho 1 and hsp70 in a variety of tissues including brain cells [ 19 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75189 17191135 96142 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 in rat glial cells treatment with lipopolysaccaride lps and interferon g ifn g promotes a rapid increase in both inos expression and nitrite levels followed by enhancement of hsp70 [ 3 20 ] whereas the modulation of ho 1 mrna expression by inos derived no following stimulation with lps has also been reported in different brain regions particularly in the hippocampus and substan 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75190 17191135 96142 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ls treatment with lipopolysaccaride lps and interferon g ifn g promotes a rapid increase in both inos expression and nitrite levels followed by enhancement of hsp70 [ 3 20 ] whereas the modulation of ho 1 mrna expression by inos derived no following stimulation with lps has also been reported in different brain regions particularly in the hippocampus and substantia nigra in an in vivo rat model of sep 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75191 17191135 96143 9462 5013 HMOX1 ho 1 ho 1 0 1.0 moreover the early increase in inos protein levels observed in endothelial cells exposed to low oxygen tension seems to precede the stimulation of ho 1 expression and activity an effect that appears to be finely regulated by redox reactions involving glutathione [ 18 21 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75192 17191135 96144 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 taken together these findings point to a possible role of the no as a signaling molecule which by triggering expression of cytoprotective genes such as ho 1 and hsp70 may lead to adaptation and resistance of brain cells to subsequent more severe nitrosative and oxidative stress [ 21 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75193 17191135 96144 9462 5013 HMOX1 ho 1 ho 1 0 1.0 taken together these findings point to a possible role of the no as a signaling molecule which by triggering expression of cytoprotective genes such as ho 1 and hsp70 may lead to adaptation and resistance of brain cells to subsequent more severe nitrosative and oxidative stress [ 21 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75194 17191135 96145 7683 3796 FOS activator protein 1 activator protein 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or nitrosant species might be crucial for deter 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75195 17191135 96145 7683 3796 FOS ap 1 ap 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or nitrosant species might be crucial for determinin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75196 17191135 96145 9462 5013 HMOX1 ho 1 ho 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or ni 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75197 17191135 96147 14424 19374 NKRF transcription factor nrf transcription factor nrf 0 1.0 eatment of astrocytes exposed to cytokine induced nitrosative stress restores gsh/gssg ratio and complex iv inhibition an effect associated with up regulation of ho 1 and nuclear translocation of the transcription factor nrf 2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75198 17191135 96147 9462 5013 HMOX1 ho 1 ho 1 0 1.0 acetylcarnitine treatment of astrocytes exposed to cytokine induced nitrosative stress restores gsh/gssg ratio and complex iv inhibition an effect associated with up regulation of ho 1 and nuclear translocation of the transcription factor nrf 2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75199 17191135 96156 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75200 17191135 96156 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75201 17191135 96156 9462 5013 HMOX1 ho 1 ho 1 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75202 17191135 96159 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75203 17191135 96159 8888 4646 GTF2A1 glucose regulated protein glucose regulated protein 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75204 17191135 96160 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after a variety of central nervous system cns insults hsp70 is synthesized at high levels and is present in cytosol nucleus and endoplasmic reticulum [ 24 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75205 17191135 96164 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after heat shock synthesis of hsp70 may increase to become the most abundant protein in the cell. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75206 17191135 96165 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 once synthesized hsp70 binds to denaturated proteins in an atp dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75207 17191135 96169 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increase in hsp70 protein expression was also found after treatment of cells with the no generating compound sodium nitroprusside snp thus suggesting a role for no in inducing hsp70 proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75208 17191135 96172 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in these conditions exogenous antioxidant treatment with ferulic acid ethyl ester faee afforded protection of cortical neurons from b amyloid toxicity by acting at three different levels: i inducing ho 1 and hsp72 proteins ii decreasing the neuronal 3 nitrotyrosine levels and therefore inducible nos activity; and iii by the well known direct free radical quenching activity [ 38 ] fig 1 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75209 17191135 96175 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 during translocation this proteins interact with hsp70 atp dependent binding and the release of hsp70 provide the major driving force for complete transport of polypeptides into the matrix. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75210 17191135 96176 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 although most imported polypeptides are released from soluble hsp70 however a subset of aggregation sensitive polypeptides must be transferred from hsp70 to hsp60 for folding [ 40 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75211 17191135 96177 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 owing to the close functional interaction between this chaperonin system and the hsp70 system it is likely that up regulation of hsp60 may be a fundamental site targeted by lac action with consequent restoration of complex iv function under conditions of nitrosative stress dependent pe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75212 17191135 96177 9718 5261 HSPD1 chaperonin chaperonin 0 1.0 owing to the close functional interaction between this chaperonin system and the hsp70 system it is likely that up regulation of hsp60 may be a fundamental site targeted by lac action with consequent restoration of complex iv function under conditions of nitrosativ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75213 17191135 96178 9462 5013 HMOX1 ho 1 ho 1 0 1.0 heme oxygenase system until 1997 two heme oxygenase ho isoforms were described: an inducible isoform ho 1 and a constitutive isoform ho 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75214 17191135 96178 9463 5014 HMOX2 ho 2 ho 2 0 1.0 heme oxygenase system until 1997 two heme oxygenase ho isoforms were described: an inducible isoform ho 1 and a constitutive isoform ho 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75215 17191135 96183 9462 5013 HMOX1 ho 1 ho 1 0 1.0 apart from the identity between the active centers of the enzyme ho 1 and ho 2 broadly differ in cell and tissue regulation and distribution. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75216 17191135 96183 9463 5014 HMOX2 ho 2 ho 2 0 1.0 apart from the identity between the active centers of the enzyme ho 1 and ho 2 broadly differ in cell and tissue regulation and distribution. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75217 17191135 96184 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is induced by various stimuli including ros rns ischemia heat shock lps hemin and the neuroprotective agent neotrofin [ 41 44 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75218 17191135 96185 9462 5013 HMOX1 ho 1 ho 1 0 1.0 furthermore in cultured human cells ho 1 expression can be repressed by hypoxia or by the treatment with interferon g or desferrioxamine [ 47 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75219 17191135 96186 9463 5014 HMOX2 ho 2 ho 2 0 1.0 on the contrary ho 2 the constitutive form is responsive to developmental factors adrenal glucocorticoids [ 41 45 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75220 17191135 96187 9462 5013 HMOX1 ho 1 ho 1 0 1.0 although ho 1 and ho 2 catalyze the same reaction they play different roles in protecting tissues against injuries. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75221 17191135 96187 9463 5014 HMOX2 ho 2 ho 2 0 1.0 although ho 1 and ho 2 catalyze the same reaction they play different roles in protecting tissues against injuries. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75222 17191135 96188 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the current hypothesis suggests that ho 1 induction is one of the earlier cellular responses to tissue damage and is responsible for the rapid transformation of the pro oxidant heme into carbon monoxide co and bilirubin br two molecules with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75223 17191135 96189 9463 5014 HMOX2 ho 2 ho 2 0 1.0 on the contrary ho 2 constitutively expressed is primarily involved in maintaining cell heme homeostasis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75224 17191135 96191 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the induction of ho 1 is regulated principally by two upstream enhancers e1 and e2 [ 52 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75225 17191135 96193 14345 7782 NFE2L2 nf e2 nf e2 0 1.0 there is now evidence to suggest that heterodimers of nf e2 related factors 2 nrf2 and one or another of the small maf proteins i.e mafk maff and mafg are directly involved in induction of ho 1 gene through these mares [ 53 ]. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 14343 7780 NFE2 0 75226 17191135 96193 9462 5013 HMOX1 ho 1 ho 1 0 1.0 there is now evidence to suggest that heterodimers of nf e2 related factors 2 nrf2 and one or another of the small maf proteins i.e mafk maff and mafg are directly involved in induction of ho 1 gene through these mares [ 53 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75227 17191135 96195 9462 5013 HMOX1 ho 1 ho 1 0 1.0 hence regulation of ho 1 gene expression by bach1 and heme occurs through antagonism between transcription activators and the repressor bach1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75228 17191135 96196 14345 7782 NFE2L2 nf e2 nf e2 0 1.0 mal physiological conditions expression of ho 1 is repressed by bach1/maf complex while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with the transcriptional promotion of ho 1 [ 33 ]. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 14343 7780 NFE2 0 75229 17191135 96196 9462 5013 HMOX1 ho 1 ho 1 0 1.0 under normal physiological conditions expression of ho 1 is repressed by bach1/maf complex while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75230 17191135 96196 9462 5013 HMOX1 ho 1 ho 1 0 1.0 x while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with the transcriptional promotion of ho 1 [ 33 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75231 17191135 96200 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in the rat brain bvr is co expressed in cells that display ho 1 and/or ho 2 under normal conditions as well as in regions and cell types that have the potential to express heat shock inducible ho 1 protein [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75232 17191135 96200 9463 5014 HMOX2 ho 2 ho 2 0 1.0 in the rat brain bvr is co expressed in cells that display ho 1 and/or ho 2 under normal conditions as well as in regions and cell types that have the potential to express heat shock inducible ho 1 protein [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75233 17191135 96203 9463 5014 HMOX2 ho 2 ho 2 0 1.0 heme oxygenase 1 is ubiquitary and particularly abundant in reticuloendothelial organs such as liver and spleen whereas ho 2 is localized in specific organs such as brain kidney and testis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75234 17191135 96203 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is ubiquitary and particularly abundant in reticuloendothelial organs such as liver and spleen whereas ho 2 is localized in specific organs such as brain kidney and testis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75235 17191135 96204 9463 5014 HMOX2 ho 2 ho 2 0 1.0 the cns is endowed with very high ho activity under basal conditions mostly accounted for by ho 2 the latter being expressed in neuronal populations in forebrain hippocampus hypothalamus midbrain basal ganglia thalamus cerebellum and brainstem. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75236 17191135 96206 9462 5013 HMOX1 ho 1 ho 1 0 1.0 this finding indicates that the activation of ho 1 and the following formation of co can be induced by many noxious stimuli within the nuclei that are primarily involved in the central regulation of the stress response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75237 17191135 96208 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is also found within cells of glial lineage where its gene expression can be induced by oxidative stress [ 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75238 17191135 96213 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the thioredoxin system the thioredoxin trx system trx and trx reductase has received a considerable attention in the last years as a stress responsive gene [ 60 ] fig 1 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75239 17191135 96215 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 originally identified in escherichia coli in 1964 as a hydrogen donor for ribonucleotide reductase required for dna synthesis trx plays an essential role in cell function by limiting oxidative stress directly via antioxidant effects and indirectly by protein protein interactions [ 61 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75240 17191135 96217 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 in fact trx and gsh systems are involved in a variety of redox dependent pathways such as supplying reducing equivalents for ribonucleotide reductase the first step in dna biosynthesis and peptide methionine sulfoxide reductase an enzyme involved in antioxidant defenses and regulation of the cellular redox state [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75241 17191135 96217 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 in fact trx and gsh systems are involved in a variety of redox dependent pathways such as supplying reducing equivalents for ribonucleotide reductase the first step in dna biosynthesis and peptide methionine sulfoxide reductase an enzyme involved in antioxidant defenses and regulation of the cellular redox state [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75242 17191135 96221 23454 12435 TXN thioredoxin thioredoxin 0 1.0 thioredoxin itself is kept in a reduced form by trxr and nadph collectively known as the trx system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75243 17191135 96236 23454 12435 TXN thioredoxin thioredoxin 0 1.0 trx 1 and trxr the most extensively studied eukaryotic thioredoxin proteins were first localized immunohistochemically in the rat sciatic nerve. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75244 17191135 96239 22027 11742 TFAP2A ap 2 ap 2 0 1.0 ene contains a series of stress responsive elements various transcription factor binding sites such as sp1 gcf and wt zfp conferring constitutive expression inducible expression elements such as ap 1 ap 2 nf kb oct 1 pea 3 myb and the antioxidant responsive element are [ 71 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75245 17191135 96239 7683 3796 FOS ap 1 ap 1 0 1.0 trx gene contains a series of stress responsive elements various transcription factor binding sites such as sp1 gcf and wt zfp conferring constitutive expression inducible expression elements such as ap 1 ap 2 nf kb oct 1 pea 3 myb and the antioxidant responsive element are [ 71 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75246 17191135 96243 7683 3796 FOS ap 1 ap 1 0 1.0 in has been reported to cause the translocation of trx from the cytoplasm to the nucleus where it regulates the redox activation and dna binding activity of critical transcription factors such as the ap 1 family members nf kb jun fos p53 creb pebp2/cbf myb all involved in fundamental processes such as gene expression cell growth and apoptosis [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75247 17191135 96248 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 ngf a neurotrophic factor regulating development maintenance and function of the cns has been shown to activate trx 1 expression via cyclic amp camp response elements cres present in the trx 1 gene promoter and also to induce 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75248 17191135 96249 9462 5013 HMOX1 ho 1 ho 1 0 1.0 that beyond its ability to regulate the function of proteins through thiol disulfide exchange reactions trx may also have beneficial effects during oxidative stress by transcriptionally upregulating ho 1 with important cytoprotective pleiotropic effects deriving from heme degradation biliverdin and bilirubin formation as well as carbon monoxide generation [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75249 17191135 96254 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the prxs also called thioredoxin peroxidases are a relatively newly discovered family of antioxidant enzymes most of which use the reducing activity of trx or other electron donors to catalyze the reduction of peroxides including h 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75250 17191135 96269 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 onal changes of the protein and ubiquitination clearing misfolded proteins to the proteasome and segregation of tau aggregates from the cellular machinery and recruitment of chaperone pairs including hsp70 and hsp27 endowed with anti apoptotic properties [ 85 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75251 17191135 96270 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 binding of phosphorylated tau to hsp70 implies that the complex may be a substrate for the e3 ligase carboxyl terminus of heat shock cognate hsc 70 interacting protein chip [ 86 88 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75252 17191135 96271 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 chip_amp_#8217;s is a ubiquitin e3 ligase that can collaborate with molecular chaperones to facilitate protein folding and prevent protein aggregation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75253 17191135 96272 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 together with hsp70 chip can regulate tau ubiquitination and degradation in a cell culture system [ 87 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75254 17191135 96273 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increased levels of chip and hsp70 has ben detected in ad compared with normal controls [ 86 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75255 17191135 96279 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 mass spectrometry analysis of proteins that specifically coimmunoprecipitate with ab has identified chaperone proteins such as hsp70 and alpha b crystallin related small hsp hsp16 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75256 17191135 96281 9462 5013 HMOX1 ho 1 ho 1 0 1.0 recently the involvement of ho 1 in the antidegenerative mechanisms operating in ad has received considerable attention as it has been demonstrated that the amyloid precursor protein app decreases ho activity thus reducing the intra 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75257 17191135 96282 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 induction which occurs together with the induction of other stress proteins during various physiopathological conditions represents a strong protective system potentially active against brain oxidati 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75258 17191135 96283 9462 5013 HMOX1 ho 1 ho 1 0 1.0 significant increases in the levels of ho 1 have been observed in ad brains in association with neurofibrillary tangles and also ho 1 mrna was found increased in ad neocortex and cerebral vessels [ 92 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75259 17191135 96284 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [ 94 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75260 17191135 96284 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [ 94 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75261 17191135 96285 12369 6893 MAPT tau protein tau protein 0 1.0 in addition takeda et al. explored the relationship between ho 1 and tau protein this latter being the major component of intraneuronal neurofibrillary tangles in ad [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75262 17191135 96285 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition takeda et al. explored the relationship between ho 1 and tau protein this latter being the major component of intraneuronal neurofibrillary tangles in ad [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75263 17191135 96286 12369 6893 MAPT tau protein tau protein 0 1.0 in transfected neuroblastoma cells overexpressing ho 1 the activity of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense ho 1 or vector transfected cells [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75264 17191135 96286 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in transfected neuroblastoma cells overexpressing ho 1 the activity of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense ho 1 or vector transfected cells [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75265 17191135 96287 12369 6893 MAPT tau protein tau protein 0 1.0 the suppression of tau protein expression was almost completely counteracted by zinc deuteroporphyrin a specific inhibitor of ho activity [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75266 17191135 96288 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the activated forms of erks extracellular signal regulated kinases were also decreased in cells overexpressing ho 1 although no changes in the expression of total erks were observed [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75267 17191135 96291 9462 5013 HMOX1 ho 1 ho 1 0 1.0 consistently recent data from our laboratory has provided clear evidence in the inferior parietal brain of ad patients of a significant increase in the expression of ho 1 and trxr whereas this latter was not increased in the cerebellum of ad brains compared to controls [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75268 17191135 96294 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 in addition ad lymphocytes showed an increased expression of inducible nitric oxide synthase ho 1 hsp72 hsp60 and trxr [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75269 17191135 96294 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition ad lymphocytes showed an increased expression of inducible nitric oxide synthase ho 1 hsp72 hsp60 and trxr [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75270 17191135 96301 23454 12435 TXN thioredoxin thioredoxin 0 1.0 these observations strongly support a role for nitrosative stress in the pathogenesis of ad and indicate that the stress responsive genes such as heme oxygenase and thioredoxin reductase may represent important targets for novel cytoprotective strategies [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75271 17191135 96302 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the protective role played by ho 1 in ad in fact raises new possibilities regarding the use of natural substances which are able to increase ho 1 levels as potential drugs for the treatment of ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75272 17191135 96306 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition curcumin has been shown to significantly increase ho 1 in astrocytes and vascular endothelial cells [ 100 101 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75273 17191135 96307 9462 5013 HMOX1 ho 1 ho 1 0 1.0 this latter effect on ho 1 can explain at least in part the strong antioxidant properties of curcumin in particular keeping in mind that ho 1 derived br has the ability to efficiently scavenge both ros and rns [ 8 11 13 99 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75274 17191135 96322 1316 841 ATP5G1 atp synthase lipid-binding protein atp synthase lipid binding protein 0 1.0 bundant ones it has reported that lac modulates specific genes in the rat cns such as the hsp72 gene the gene for the isoform of 14 3 3 protein and that encoding for the precursor mitochondrial p3 of atp synthase lipid binding protein [ 107 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75275 17191135 96324 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 these results have shown for the first time that acetylcarnitine induces heme oxygenase 1 and hsp60 heat shock proteins with a mechanism involving activation and nuclear translocation of the transcription factor nrf2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75276 17191135 96326 20997 11180 SOD2 mn sod mn sod 0 1.0 e alone in unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75277 17191135 96326 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75278 17191135 96326 9462 5013 HMOX1 ho 1 ho 1 0 1.0 is conceivable that acetylcarnitine alone in unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75279 17191135 96354 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the evidence that phenolic compounds such as curcumin and ferulic acid can induce ho 1 and trxr and thus reduce ad strongly indicates the therapeutic potential of nutritional compounds against nd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75286 17192933 96373 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 correction of humoral derangements from mutant superoxide dismutase 1 spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75287 17192933 96379 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 mt spinal cord organotypic slices secreted higher levels of nitric oxide interleukin il 1beta il 6 and il 12p70 and lower levels of vascular endothelial growth factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75288 17192933 96379 10463 6018 IL6 il 6 il 6 0 1.0 mt spinal cord organotypic slices secreted higher levels of nitric oxide interleukin il 1beta il 6 and il 12p70 and lower levels of vascular endothelial growth factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75289 17192933 96380 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 the toxicity of mt spinal cord organotypic cultures was reduced and axonal lengths were restored to near normal by coculturing in the presence of reactive oxygen species scavenger vascular endothelial growth factor and neutralizing antibodies to il 1beta il 6 and il 12. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75290 17192933 96380 10463 6018 IL6 il 6 il 6 0 1.0 reduced and axonal lengths were restored to near normal by coculturing in the presence of reactive oxygen species scavenger vascular endothelial growth factor and neutralizing antibodies to il 1beta il 6 and il 12. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67824 17317654 85964 78 61 ABCD1 adrenoleukodystrophy adrenoleukodystrophy 0 1.0 the x linked adrenoleukodystrophy x ald and oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67825 17317654 85970 78 61 ABCD1 adrenoleukodystrophy adrenoleukodystrophy 0 1.0 the aim of the present study was to review the literature concerning the advances in the treatment of x adrenoleukodystrophy x ald omim # 300100 in the last two decades and to shed more light on the link between oxidative stress and x ald. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70643 17368952 89802 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 effort to study the role of reactive species in amyotrophic lateral sclerosis als the goal of this work is to explore the correlation between nitration and oxidation of proteins and mutation of cu zn superoxide dismutase sod1 in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70644 17368952 89803 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 transgenic mice overexpressing the mutant cu zn superoxide dismutase msod1 gene from humans with familial als wild type mice overexpressing the normal human sod1 gene and normal mice without gene overexpression were used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70645 17368952 89816 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the discovery of mutation of the cu zn superoxide dismutase sod1 gene in familial als patients deng et al 1993 and rosen et al 1993 was the first breakthrough in identifying causes of familial als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70646 17368952 89817 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 to explore how mutant cu zn superoxide dismutase msod1 causes als a transgenic mouse model was established by introducing a human mutant gly 93_amp_#x2192;ala g93a of the sod1 gene into the mouse gurney et al. 1994 ; these transgenic mice developed 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70647 17368952 89820 3544 1516 CAT catalase catalase 0 1.0 superoxide dismutase sod is a major antioxidative defense enzyme converting superoxide anion o 2 _amp_#xb7; _amp_#x2212; to hydrogen peroxide h 2 o 2 which is reduced to h 2 o by catalase and selenium dependent glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70648 17368952 89820 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase sod is a major antioxidative defense enzyme converting superoxide anion o 2 _amp_#xb7; _amp_#x2212; to hydrogen peroxide h 2 o 2 which is reduced to h 2 o by catalase and selenium dependent glutathio 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70649 17368952 89833 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 expression of inducible _amp_#xb7; nitric oxide synthase nos increases during the development of als in the g93a transgenic mice compared with normal sod1 mice and nc mice almer et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54605 17496232 67630 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 on the contrary lack of no disrupts pathways like s nitrosylation or h 2 o 2 production and likewise is a gateway to disease in amyotrophic lateral sclerosis with superoxide dismutase 1 mutations or to cancer proliferation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54606 17496232 67631 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 peroxynitrite; hydrogen peroxide; mitochondrial nitric oxide synthase; mitogen activated protein kinase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54607 17496232 67638 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 transcriptional increase of neuronal nitric oxide synthase nnos determines extensive binding to complex i and iv and contributes to hypothyroid phenotype. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54609 17496232 67641 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 mw molecular weight; mnsod manganese superoxide dismutase; 2d two dimensional. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54612 17496232 67648 864 576 APAF1 apoptotic protease activating factor 1 apoptotic protease activating factor 1 0 1.0 no and h 2 o 2 release and activation of intrinsic programmed cell death via apoptotic protease activating factor 1 and activation of p53. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54613 17496232 67649 1576 990 BCL2 bcl 2 bcl 2 0 1.0 increased no and onoo result in dna damage p53 accumulation increased bax/bcl 2 cytochrome c cyt c release and caspase activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54614 17496232 67649 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 increased no and onoo result in dna damage p53 accumulation increased bax/bcl 2 cytochrome c cyt c release and caspase activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54615 17496232 67662 5902 2903 DLG4 psd 95 psd95 0 1.0 these enzymes are bound to anchoring proteins in cell membrane caveolin and in synaptic vesicles psd95 in skeletal and cardiac muscles dystrophin and to heat shock protein hsp 90 or 70 chaperones 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54616 17496232 67662 5927 2928 DMD dystrophin dystrophin 0 1.0 these enzymes are bound to anchoring proteins in cell membrane caveolin and in synaptic vesicles psd95 in skeletal and cardiac muscles dystrophin and to heat shock protein hsp 90 or 70 chaperones 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54617 17496232 67663 5927 2928 DMD dystrophin dystrophin 0 1.0 the interaction with these proteins may involve different effects: 1 increased hsp90 nos or decreased caveolin nos enzyme activity 2 modified subcellular traffic dystrophin impedes nos i traffic to mitochondria 76 and 3 participation in ubiquitination and degradation 54 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54618 17496232 67666 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in contrast nos ii is not constitutive and does not depend on ca concentration; nos ii gene expression is modulated by inflammatory mediators like cytokines tnf alpha ifn gamma and lps that activate transcription factors like nf kappab or ap 1 59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54619 17496232 67666 7683 3796 FOS ap 1 ap 1 0 1.0 and does not depend on ca concentration; nos ii gene expression is modulated by inflammatory mediators like cytokines tnf alpha ifn gamma and lps that activate transcription factors like nf kappab or ap 1 59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54620 17496232 67670 12416 6915 MB myoglobin myoglobin 0 1.0 most no binds to cytosolic compounds like myoglobin 35 111 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54621 17496232 67705 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 in the presence of mitochondrial manganese superoxide dismutase mnsod most of o 2 is dismutated to h 2 o 2 which is freely diffusible to cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54623 17496232 67709 14631 2874 NQO1 nadh dehydrogenase nadh dehydrogenase 0 1.0 cordingly at 0.3 0.5 microm no inhibits electron transfer between cytochromes b and c 1 in the respiratory chain 108 111 whereas relatively prolonged 0.5 1 microm no exposure selectively inhibits the nadh dehydrogenase activity at mitochondrial complex i in intact cells 50 and isolated mitochondria 120 a hallmark of neurodegenerative experimental or clinical entities like parkinson disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54624 17496232 67715 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in agreement supplementation of submitochondrial particles with complex i or complex ii substrates increases by 10 to 20 fold no utilization; in contrast addition of superoxide dismutase sod decreases no utilization and prolongs its mean life and increases h 2 o 2 110 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54625 17496232 67726 3544 1516 CAT catalase catalase 0 1.0 because peroxisomes contain the highest concentration of catabolizing catalase mitochondria with very low levels of degrading enzymes are accepted as the main source of o 2 species 17 33 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54627 17496232 67729 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 otherwise enzymes that catabolize h 2 o 2 catalase gluthatione peroxidase gpx; reactions 6 and 7 and thioredoxin peroxidase trx; reaction 8 are preferentially distributed in cytosol and peroxisomes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54628 17496232 67729 3544 1516 CAT catalase catalase 0 1.0 otherwise enzymes that catabolize h 2 o 2 catalase gluthatione peroxidase gpx; reactions 6 and 7 and thioredoxin peroxidase trx; reaction 8 are preferentially distributed in cytosol and peroxisomes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54629 17496232 67737 3544 1516 CAT catalase catalase 0 1.0 considering the reduction to h 2 o by liver cytosolic gpx and catalase at the respective concentrations of 2.7 x 10 m and 1.2 x 10 m and the rate constants for reactions 7 and 8 the no dependent [h 2 o 2 ] ss could be calculated as follows 17 : 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54630 17496232 67740 3544 1516 CAT catalase catalase 0 1.0 lation of [h 2 o 2 ] ss implies an effective regulation of the different pathways participating in the process including the concentration and activities of mtnos cytosolic classic nos isoforms mnsod catalase and peroxidases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54631 17496232 67751 3544 1516 CAT catalase catalase 0 1.0 in this study cells were reverted to a normal phenotype by cotransfection with catalase and the authors concluded that a major role of h 2 o 2 is to activate genes related to the proliferating cascade. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54632 17496232 67757 7683 3796 FOS ap 1 ap 1 0 1.0 erks stimulate cell proliferation and induction of active cyclin d 1 by different mechanisms including the enhancement of ap 1 activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54633 17496232 67769 19050 10436 RPS6KB1 p70 s6k p70 s6k 0 1.0 another mechanism is the activation of specific phosphorylation cascades that participate in the progression of the cell cycle; for instance h 2 o 2 acts as a messenger in growth factor induced p70 s6k signaling pathway in mouse epidermal cells which plays an important role in the transition from g 0 /g 1 to s phase of the cell cycle 9 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54634 17496232 67773 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 activation of a myeloid leukemia cell line tf 1a by granulocyte/macrophage colony stimulating factor induced only a transient activation of mek and erk1/2 and 50% increase in cell proliferation whereas prolonged stimulation with 10 to 10 m pma underwent 91 98% cell differentiation without proliferat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54635 17496232 67776 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the proapoptotic effects depend on translocation of bax to mitochondria and generation of ros and ultimately on the release of cytochrome c but in a caspase independent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54636 17496232 67793 1576 990 BCL2 bcl 2 bcl 2 0 1.0 some antiapoptotic effects include s nitrosylation and inhibition of caspases increase of hsps and bcl 2 and activation of akt/pkb which induces cytoprotective gene expression through nf kappab activation 85 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54637 17496232 67796 1576 990 BCL2 bcl 2 bcl 2 0 1.0 on the other hand proapoptotic effects of no include inhibition of nf kappab decreased bcl 2 expression 87 89 118 and increased p53 expression both by no mediated inhibition of proteasome degradation and by direct dna damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54638 17496232 67807 14631 2874 NQO1 nadh dehydrogenase nadh dehydrogenase 0 1.0 similar to the nadh dehydrogenase site of electron leak forming complex i being directed into the matrix side of the inner mitochondrial membrane in mitochondria o 2 can be detoxified by matrix antioxidant defense systems. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54639 17496232 67840 3544 1516 CAT catalase catalase 0 1.0 isolated neonatal hepatocytes supplemented with h 2 o 2 catalase inhibitor 3 amino 1 2 4 triazole or l arginine invariably determined a dose dependent negative modulation of cell proliferation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54640 17496232 67851 1576 990 BCL2 bcl 2 bcl 2 0 1.0 caspases are cysteine proteases that cleave specific aspartate residues in other regulatory proteins like bcl 2 bax and mekk for review see ref 83 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54641 17496232 67852 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in the extrinsic pathway binding of membrane ligands like tnf alpha and fas to membrane receptors triggers the activation of caspases and the induction of apoptosis 6 106 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54643 17496232 67853 864 576 APAF1 apoptotic protease activating factor 1 apoptotic protease activating factor 1 0 1.0 in the intrinsic program mitochondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54644 17496232 67853 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 elease of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54645 17496232 67853 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 hondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54646 17496232 67853 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the intrinsic program mitochondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54647 17496232 67861 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 no can directly induce cytochrome c release through mitochondrial membrane potential loss 46 or by tyrosine nitration of cytochrome c 67 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54648 17496232 67862 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 no donors or endogenous no induces apoptotic cell death with the activation of jnk/sapk and p38 mapk and caspase 3 or inactivation of nf kappab. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54649 17496232 67868 1576 990 BCL2 bcl 2 bcl 2 0 1.0 disruption of the nf kappab gene is associated with embryo lethality; many antiapoptotic pathways like bcl 2 are induced by nf kappab. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54650 17496232 67872 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 no mediated p53 accumulation induces cell cycle arrest by p21 upregulation or apoptosis by increase in bax/bcl xl cytochrome c release and caspase activation 100 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54651 17496232 67872 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 no mediated p53 accumulation induces cell cycle arrest by p21 upregulation or apoptosis by increase in bax/bcl xl cytochrome c release and caspase activation 100 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54652 17496232 67874 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 on the other hand no has antiapoptotic effects that can be associated with cgmp production which suppresses mitochondrial cytochrome c release ceramide generation and caspase activation 46 77 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54653 17496232 67875 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 other antiapoptotic no pathways include s nitrosylation and inactivation of caspases thiols and upregulation of antiapoptotic genes like that of heme oxygenase 127 and hsp70 which protects hepatocytes from apoptosis induced by oxidative and nitrative stress 46 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59793 17584954 75221 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mitochondria; reactive oxygen species; amyotrophic lateral sclerosis; copper zinc superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59795 17584954 75259 551 399 ALB serum albumin serum albumin 0 1.0 the resulting pellet was washed once in modified chappell perry buffer with 0.5% bovine serum albumin and once in modified chappell perry buffer without bovine serum albumin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59797 17584954 75313 4996 2422 CS citrate synthase citrate synthase 0 1.0 mple genes encoding the mitochondrial respiratory chain and the tca cycle are significantly downregulated following denervation 48 60 66 and the levels of cytochrome c oxidase succinate dehydrogenase citrate synthase and cardiolipin are significantly lowered 8 14 days after denervation 18 82 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59799 17584954 75313 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 for example genes encoding the mitochondrial respiratory chain and the tca cycle are significantly downregulated following denervation 48 60 66 and the levels of cytochrome c oxidase succinate dehydrogenase citrate synthase and cardiolipin are significantly lowered 8 14 days after denervation 18 82 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59800 17584954 75322 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 in fact increased ros production following denervation is mirrored by decreases in surface hydrophobicity and enzymatic activity of glyceraldehyde 3 phosphate dehydrogenase and creatine kinase 64 possibly due to increased oxidative damage 63 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59801 17584954 75322 4423 1991 CKB creatine kinase creatine kinase 0 1.0 in fact increased ros production following denervation is mirrored by decreases in surface hydrophobicity and enzymatic activity of glyceraldehyde 3 phosphate dehydrogenase and creatine kinase 64 possibly due to increased oxidative damage 63 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59803 17584954 75327 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 1.0 mitochondrial ros has also been shown to lead to upregulation of the expression of ubiquitin ligase atrogin 1/mafbx 53 and could therefore contribute to atrophy through increased degradation of proteins by the 26s proteasome system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59804 17584954 75327 7405 16731 FBXO32 atrogin 1 atrogin 1 0 1.0 mitochondrial ros has also been shown to lead to upregulation of the expression of ubiquitin ligase atrogin 1/mafbx 53 and could therefore contribute to atrophy through increased degradation of proteins by the 26s proteasome system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49405 17634371 61544 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 nerve growth factor ngf can induce apoptosis by signaling through the p75 neurotrophin receptor p75 in several nerve cell populations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49406 17634371 61544 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 nerve growth factor ngf can induce apoptosis by signaling through the p75 neurotrophin receptor p75 in several nerve cell populations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49407 17634371 61546 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the present study we show that p75 mediated apoptosis in motor neurons involved neutral sphingomyelinase activation increased mitochondrial superoxide production and cytochrome c release to the cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49409 17634371 61548 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 in motor neurons overexpressing the amyotrophic lateral sclerosis als linked superoxide dismutase 1 sod1 mutation ngf induced apoptosis even in the absence of an external source of no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49410 17634371 61549 12211 6782 MAFK nuclear factor erythroid-2 nuclear factor erythroid 2 0 1.0 the increased susceptibility of sod1 motor neurons to ngf was associated to decreased nuclear factor erythroid 2 related factor 2 nrf2 expression and downregulation of the enzymes involved in glutathione biosynthesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49411 17634371 61554 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 key words: amyotrophic lateral sclerosis; mitochondria; motor neurons; nerve growth factor; nrf2; p75 ; superoxide 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49412 17634371 61555 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 nerve growth factor ngf has a key role on the development and function of the nervous system snider 1994 ; chao 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49413 17634371 61557 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49414 17634371 61557 14738 8031 NTRK1 tyrosine kinase receptor tyrosine kinase receptor 0 1.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49417 17634371 61557 3889 11919 CD40 tumor necrosis factor receptor superfamily tumor necrosis factor receptor superfamily 0 1.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49418 17634371 61560 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 induction of p75 renders motor neurons vulnerable to ngf induced apoptosis. p75 has been implicated in motor neuron death occurring in transgenic mice overexpressing mutant cu zn superoxide dismutase sod1 lowry et al. 2001b ; copray et al. 2003 ; kust et al. 2003 ; turner et al. 2003a b or after axotomy ferri et al. 1998 ; wiese et al. 1999 ; lowry et al. 2001a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49419 17634371 61563 12211 6782 MAFK nuclear factor erythroid-2 nuclear factor erythroid 2 0 1.0 astrocytes can protect motor neurons against p75 induced apoptosis by the activation of the transcription factor nuclear factor erythroid 2 related factor 2 nrf2 which increases antioxidant defenses vargas et al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49420 17634371 61565 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the death pathway is not completely elucidated but is associated with activation of c jun n terminal kinase jnk release of cytochrome c from mitochondria and subsequent activation of caspases 9 6 and 3 casaccia bonnefil et al. 1996 ; yoon et al. 1998 ; wang et al. 2001 ; bhakar et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49421 17634371 61565 10824 6204 JUN c jun c jun 0 1.0 the death pathway is not completely elucidated but is associated with activation of c jun n terminal kinase jnk release of cytochrome c from mitochondria and subsequent activation of caspases 9 6 and 3 casaccia bonnefil et al. 1996 ; yoon et al. 1998 ; wang et al. 2001 ; bhakar et al. 200 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49422 17634371 61568 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ceramide could be a mediator of apoptosis by acting directly or indirectly on mitochondria where it can dissipate the membrane potential promote cytochrome c release and induce reactive oxygen species ros production garcia ruiz et al. 1997 ; gudz et al. 1997 ; quillet mary et al. 1997 ; mansat de mas et al. 1999 ; birbes et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49423 17634371 61576 14727 8023 NTF3 ngf 2 ngf 2 0 1.0 mouse ngf 2.5s was obtained from harlan madison wi recombinant human soluble fas ligand and tert butylhydroquinone tbhq from alexis san diego ca and primers from integrated dna technologies coralville ia . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49424 17634371 61576 7334 11936 FASLG fas ligand fas ligand 0 1.0 mouse ngf 2.5s was obtained from harlan madison wi recombinant human soluble fas ligand and tert butylhydroquinone tbhq from alexis san diego ca and primers from integrated dna technologies coralville ia . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49426 17634371 61587 8240 4232 GDNF glial cell line derived neurotrophic factor glial cell line derived neurotrophic factor 0 1.0 motor neuron survival was maintained by the addition of glial cell line derived neurotrophic factor gdnf 1 ng/ml; sigma to the culture media. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49427 17634371 61597 7334 11936 FASLG fas ligand fas ligand 0 1.0 soluble fas ligand was added in the presence of enhancer antibody 1 microg/ml 16 h after motor neuron plating. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49428 17634371 61609 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaagatcctgaccgagcgtg 3' and 5' tctgctggaaggtggacagtgagg 3' 497 bp . p75 primers were from promega madison wi . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49430 17634371 61609 8204 4311 GCLC glutamate-cysteine ligase glutamate cysteine ligase 0 1.0 pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49431 17634371 61609 8204 4311 GCLC glutamate-cysteine ligase glutamate cysteine ligase 0 1.0 modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49432 17634371 61609 8204 4311 GCLC glutamate-cysteine ligase, catalytic subunit glutamate cysteine ligase catalytic subunit 0 1.0 f2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaag 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49433 17634371 61609 8205 4312 GCLM glutamate-cysteine ligase modifier subunit glutamate cysteine ligase modifier subunit 0 1.0 pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49434 17634371 61632 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after 12 h cultures were fixed as described above and processed for cytochrome c immunolabeling using alexa fluor 488 cytochrome c apoptosis detection kit from invitrogen. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49435 17634371 61652 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the present study we found that the p75 apoptotic pathway in motor neurons involved increased ceramide production and cytochrome c release into the cytosol as observed in other cell types casaccia bonnefil et al. 1996 ; kuner and hertel 1998 ; brann et al. 2002 ; bhakar et al. 2003 . p75 induced ceramide generation in motor neur 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49436 17634371 61660 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 it is noteworthy that the increased superoxide production by mitochondria does not require nitric oxide whereas cytochrome c release does require the presence of an external source of nitric oxide such as the addition of deta nonoate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49437 17634371 61661 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 these results suggest that peroxynitrite a strong oxidant formed from the reaction of superoxide and nitric oxide disrupts mitochondrial function to promote cytochrome c release beckman and koppenol 1996 ; radi et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49438 17634371 61679 8857 4624 GSS glutathione synthetase glutathione synthetase 0 1.0 gsh is synthesized by the consecutive action of the enzymes gcl and glutathione synthetase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49439 17634371 61687 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ngf induced apoptosis in motor neurons involves nsmase activation and triggers cytochrome c release from mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49440 17634371 61693 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 b fluorescence microphotographs showing cytochrome c immunoreactivity in motor neurons maintained with gdnf control or exposed to ngf plus deta nonoate ngf+no . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49441 17634371 61694 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the absence of ngf motor neurons showed a punctuate mitochondrial labeling of cytochrome c whereas 12 h after treatment with ngf+no motor neurons showed a diffuse cytoplasmic labeling. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49442 17634371 61695 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 c gw4869 100 n m ; gw prevented cytochrome c release induced by ngf+no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49443 17634371 61698 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 gw alone did not affect cytochrome c labeling data not shown . * p _lt_ 0.05 significantly different from control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49444 17634371 61718 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 c fluorescence microphotographs showing cytochrome c immunoreactivity in sod1 motor neurons maintained with gdnf and exposed to vehicle control or ngf 100 ng/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49445 17634371 61719 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the absence of ngf motor neurons showed a punctuate labeling of cytochrome c and 12 h after treatment with ngf a diffuse labeling was observed in affected motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49446 17634371 61751 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 immunofluorescence studies revealed that nsmase activation was followed by cytochrome c release from mitochondria fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49447 17634371 61752 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the absence of ngf motor neurons showed a punctate pattern of cytochrome c immunoreactivity indicative of mitochondrial localization. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49448 17634371 61753 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ngf 100 ng/ml or deta nonoate 10 micro m treatment alone did not affect cytochrome c localization fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49449 17634371 61754 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in contrast after 12 h of ngf treatment in the presence of deta nonoate ~27% of motor neurons displayed a diffuse pattern of cytochrome c immunoreactivity indicating release into the cytoplasm fig 1 b c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49450 17634371 61755 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c release induced by ngf in the presence of nitric oxide was prevented by the addition of the nsmase inhibitor gw4869 fig 1 c indicating that cytochrome c release required ceramide production. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49451 17634371 61770 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 moreover p75 mediated apoptosis in sod1 motor neurons was prevented by nsmase inhibitors fig 3 b and involved mitochondrial production and cytochrome c release fig 3 c d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49452 17634371 61772 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 although an exogenous source of nitric oxide is not required for ngf to induce sod1 motor neuron death n nitro l arginine methyl ester name 1 m m a general nitric oxide synthase nos inhibitor and 1 2 trifluoromethylphenyl imidazole trim 10 micro m a specific inhibitor of the neuronal isoform of nos prevented ngf induced apoptosis in sod1 motor neurons fig 3 e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49453 17634371 61777 8204 4311 GCLC glutamate-cysteine ligase glutamate cysteine ligase 0 1.0 the decrease in nrf2 expression correlated with a decrease in the expression of nrf2 regulated genes including both subunits of glutamate cysteine ligase gcl gclc and gclm the rate limiting enzyme in reduced glutathione gsh biosynthesis fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49454 17634371 61784 7334 11936 FASLG fas ligand fas ligand 0 1.0 to determine whether augmented antioxidant defenses also protect neurons from apoptosis triggered by other death receptors we analyzed the effect of tbhq on apoptosis induced by fas ligand in sod1 expressing motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49455 17634371 61787 7334 11936 FASLG fas ligand fas ligand 0 1.0 the soluble extracellular domain of fas ligand sfasl in the presence of an enhancer antibody significantly reduced the survival of motor neurons in a dose response manner whereas the enhancer antibody alone did not affect neuronal survival data n 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49456 17634371 61798 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 enzyme inhibitors|nf e2 related factor 2|nfe2l2 protein rat|nitric oxide donors|nitroso compounds|oligodeoxyribonucleotides antisense|reactive oxygen species|receptor nerve growth factor|2 2'|cytochromes c|nerve growth factor|sod1 g93a protein|superoxide dismutase|sphingomyelin phosphodiesterase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49457 17634371 61798 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 |2 2'|cytochromes c|nerve growth factor|sod1 g93a protein|superoxide dismutase|sphingomyelin phosphodiesterase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51663 17678953 64378 15951 8548 P4HB protein disulfide isomerase protein disulfide isomerase 0 1.0 one such molecule affected is protein disulfide isomerase pdi an enzyme responsible for normal protein folding in the endoplasmic greticulum er . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51667 17678953 64382 16060 8607 PARK2 e3 ubiquitin ligase e3 ubiquitin ligase 0 1.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40761 17719032 50702 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in wild type animals immunoreactivity for the astrocytic glutamate transporter glt 1 was particularly strong around ventral horn mns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40762 17719032 50703 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 however a marked loss of ventral horn glt 1 was observed along with substantial mn damage prior to onset of symptoms 90_amp_#x2013;100_amp_#xa0;days in the g93a rats. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40763 17719032 50705 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 compared to sham treated g93a animals 30 day nas infusions starting at 67 _amp_#xb1; 2_amp_#xa0;days of age markedly diminished the loss of both mns and of astrocytic glt 1 labeling. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40764 17719032 50709 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 although the cause of most cases is unknown observations of deficiencies in glutamate uptake resulting from a selective loss of the astrocytic glutamate transporter glt 1 suggested an excitotoxic contribution [rothstein et al. 1992] and [rothstein et al. 1995] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40765 17719032 50712 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 likely contributing to this vulnerability mns possess substantial numbers of unusual ca 2+ permeable ampa type glutamate receptor channels ca ampa channels [carriedo et al. 1995] [carriedo et al. 1996] [van den bosch et al. 2000] and [vandenberghe et al. 2000] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40766 17719032 50713 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 currently the best animal models of als are provided by rodents harboring mutant forms of the enzyme cu zn superoxide dismutase sod1 which are associated with familial als in humans. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40767 17719032 50724 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 we find that this treatment slows not only mn loss in these animals but also slows the loss of glt 1 glutamate transporter in ventral horn regions near mns consistent with the idea that ca ampa channel activation on mns contributes to the loss of astrocytic glutamate transport. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40768 17719032 50743 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 stains were carried out on floating sections blocked 10% fbs 1_amp_#xa0;h and exposed to primary antibody in 10% fbs 0.3% triton x 100 smi 32 1:8000 ip 1:2000 if sternberger monoclonals berkeley ca; glt 1 1:1000 chemicon temecula ca; 3 nitrotyrosine 10_amp_#xa0;_amp_#x3bc;g/ml upstate biotechnology waltham ma . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40769 17719032 50748 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 for examination of nt and glt 1 labeling staining in the neuropil surrounding ventral horn mns care was taken to ensure that all slices from each experiment were labeled using identical primary and secondary antibody exposures and 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40770 17719032 50751 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 for glt 1 fluorescence was measured in 5 _amp_#x3bc;m zones surrounding the mns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40771 17719032 50752 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 for this measure non specific background fluorescence from the center of a neuron a region lacking specific glt 1 labeling was subtracted prior to normalization of values to wt as above. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40772 17719032 50755 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 antibodies were from the following sources: smi 32 sternberger monoclonals berkeley ca; glt 1 chemicon temecula ca; 3 nitrotyrosine upstate biotechnology waltham ma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40773 17719032 50777 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 itrotyrosine labeling and loss of astrocytic glutamate transport in sod1 mutant rodent models of als [alexander et al. 2000] [ferrante et al. 1997] and [tu et al. 1996] and a specific decrease of the glt 1 glutamate transporter has been reported in ventral horn of the g93a rats that are the subject of this study howland et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40774 17719032 50787 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 finally there was a marked and consistent decrease in glt 1 staining most prominent in ventral horn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40775 17719032 50788 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 notably in wild type animals glt 1 labeling often showed a rim of particularly strong labeling immediately surrounding mn somata whereas even in the presymptomatic animals this rim was often conspicuously absent fig 2 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40776 17719032 50790 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 quantification of glt 1 labeling in the neuropil surrounding mns revealed a sharp decrease in glt 1 labeling surrounding mns in sham treated transgenic animals tg s . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40777 17719032 50791 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 however in contrast to the paucity of effect of nas on nt labeling nas completely prevented the loss of glt 1 labeling fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40778 17719032 50794 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in agreement with prior studies of these animals howland et al. 2002 we observe substantial loss of the glt 1 glutamate transporter most evident in the ventral horn in close proximity to mns in late presymptomatic animals 97_amp_#xa0;days shortly before an acceleration in the rate of mn death with developmen 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40779 17719032 50796 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the primary new findings of present studies are that animals treated with the ca ampa channel blocker nas demonstrate a marked preservation not only of ventral horn mns but also of glt 1 labeling near ventral horn mns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40780 17719032 50797 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 s generators in response to ca ampa channel activation taken together with present observations of strong oxidative damage in the vicinity of mns and protection by nas of mns themselves as well as of glt 1 levels in the adjacent astrocytes is most consistent with the primary relevant effect of nas being mn ca ampa channel blockade. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40781 17719032 50800 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 indeed observations that substantial loss of glt 1 preceded much of the mn loss howland et al. 2002 and that increasing the level of this transporter slows disease onset guo et al. 2003 whereas decreasing its levels accelerates disease in g93a transg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40782 17719032 50830 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 lumbar spinal cord sections were obtained from 97 _amp_#xb1; 2 day old wild type and g93a transgenic rats and stained for glial fibrillary acidic protein gfap green and smi 32 red a 3 nitrotyrosine b or the astrocytic glutamate transporter glt 1 green along with smi 32 red c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40783 17719032 50830 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 d from 97 _amp_#xb1; 2 day old wild type and g93a transgenic rats and stained for glial fibrillary acidic protein gfap green and smi 32 red a 3 nitrotyrosine b or the astrocytic glutamate transporter glt 1 green along with smi 32 red c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40784 17719032 50833 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 finally note the rim of strong glt 1 labeling surrounding mns in wild type animals and the distinct loss of labeling surrounding mns in the transgenics. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40785 17719032 50835 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 a photomicrographs show the ventral horn region of lumbar spinal cord sections derived from 97 _amp_#xb1; 2 day old rats upon termination of the 30 day intrathecal infusions stained for glial fibrillary acidic protein gfap; 400_amp_#xd7; or for 3 nitrotyrosine nt; 400_amp_#xd7; inserts 40_amp_#xd7; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40786 17719032 50843 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 fig. 4._amp_#xa0;loss of glt 1 in ventral horn astrocytes of g93a rats and preservation by nas. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40787 17719032 50844 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 a glt 1 immunofluorescence: photomicrographs show the ventral horn region of lumbar spinal cord sections derived from 97 _amp_#xb1; 2 day old rats upon termination of the 30 day intrathecal infusions stained 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40788 17719032 50844 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 nofluorescence: photomicrographs show the ventral horn region of lumbar spinal cord sections derived from 97 _amp_#xb1; 2 day old rats upon termination of the 30 day intrathecal infusions stained for glt 1 40 400_amp_#xd7; and for smi 32 right 400_amp_#xd7; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40789 17719032 50845 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 note the strong glt 1 labeling surrounding mns and throughout ventral horn mn clusters in wild type wt animals in contrast to the preferential loss of ventral horn labeling with preservation of dorsal horn labeling in tra 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40790 17719032 50847 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 arrows show clusters of ventral horn motor neurons with strong astrocytic glt 1 labeling; arrowhead shows persistent strong glt 1 labeling in dorsal horn of untreated transgenic animals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40791 17719032 50849 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 b quantification of labeling: graph shown quantification of glt 1 labeling in 5 _amp_#x3bc;m zones surrounding each mn compiled from 4 independent experiments _amp_#x3e; 100 surround regions for wt tg s and tg nas conditions; 3 animals _amp_#x3e; 60 regions for tg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40792 17719032 50852 20017 10940 SLC1A2 excitatory amino acid transporter 2 excitatory amino acid transporter 2 0 1.0 excitatory amino acid antagonists|excitatory amino acid transporter 2|glial fibrillary acidic protein|1 naphthylacetylspermine|spermine|sod1 g93a protein|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36249 17937892 44757 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 [sirt1/pgc 1: a neuroprotective axis?] 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36250 17937892 44760 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 since it has been recently demonstrated that activation of the sirt1/pgc 1 pathway in a metabolic context promotes mitochondrial function we performed a detailed literature review on the implication of this pathway in neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36251 17937892 44761 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 interestingly transgenic mice with impaired pgc 1 expression have neurodegenerative lesions and show behavioural abnormalities. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36252 17937892 44764 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 taken together these results strongly suggest that the modulation of the sirt1/pgc 1 pathway which has not been well documented in the central nervous system could become the cornerstone for new therapeutical approaches to combat neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36253 17937892 44766 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein|neuroprotective agents|reactive oxygen species|stilbenes|transcription factors|peroxisome proliferator activated receptor gamma coactivator 1|resveratrol|sirt1 protein human|sirt1 protein mouse|sirtu 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37378 17956327 46615 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 new synthesis and release of bdnf brain derived neurotrophic factor is necessary and sufficient for pltf in vivo [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37379 17956327 46615 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 new synthesis and release of bdnf brain derived neurotrophic factor is necessary and sufficient for pltf in vivo [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37382 17956327 46620 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 pkc protein kinase c activation] stimulating new protein synthesis including bdnf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37383 17956327 46621 543 391 AKT1 protein kinase b protein kinase b 0 1.0 igh affinity receptor trkb tropomyosin receptor kinase b resulting in the phosphorylation of erk extracellular signal regulated kinase mapks mitogen activated protein kinases and akt [also called pkb protein kinase b ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37384 17956327 46621 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 released bdnf then activates its high affinity receptor trkb tropomyosin receptor kinase b resulting in the phosphorylation of erk extracellular signal regulated kinase mapks mitogen activated protein kinases and akt [also called pkb protein kinase b ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37385 17956327 46622 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 we postulate that these activated kinases phosphorylate glutamate receptors inducing glutamate receptor trafficking inserting more receptors in the post synaptic membrane and strengthening synapses between glutamatergic brainstem respiratory neurons and phrenic motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37387 17956327 46636 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 for example pka protein kinase a and pkc both modulate basal respiratory drive currents in medullary respiratory neurons including expiratory neurons in the caudal medulla [ 31 32 ] inspiratory neurons in the pre b_amp_#246;tzinger 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37389 17956327 46651 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 ros are continuously generated in cells through enzymatic e.g nadph oxidase and xanthine oxidase and non enzymatic e.g mitochondrial electron transport chain and receptor activation processes [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37390 17956327 46651 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 ros are continuously generated in cells through enzymatic e.g nadph oxidase and xanthine oxidase and non enzymatic e.g mitochondrial electron transport chain and receptor activation processes [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37391 17956327 46654 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 sod superoxide dismutase ] prevent excessive ros accumulation [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37392 17956327 46660 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase may generate the ros necessary for pltf since apocynin an nadph oxidase and superoxide anion inhibitor blocks pltf [ 24 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37393 17956327 46662 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 indeed putative phrenic motor neurons and nearby astrocytes express subunits of the nadph oxidase complex i satriotomo p.m macfarlane d.j harrigan and g.s mitchell unpublished work . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37394 17956327 46666 17177 9308 PPP2R4 protein phosphatase 2a protein phosphatase 2a 0 1.0 indeed in vitro application of h 2 o 2 to cervical spinal cord homogenates significantly inhibits the activity of the okadaic acid sensitive serine/threonine phosphatase protein phosphatase 2a j.e.r wilkerson and g.s mitchell unpublished work . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37395 17956327 46685 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 key words: brain derived neurotrophic factor bdnf 5 hydroxytryptamine 5 ht long term facilitation pattern sensitivity phosphorylation plasticity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37397 17956327 46685 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 key words: brain derived neurotrophic factor bdnf 5 hydroxytryptamine 5 ht long term facilitation pattern sensitivity phosphorylation plasticity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37398 17956327 46686 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxyg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37399 17956327 46686 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 ns used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37400 17956327 46686 543 391 AKT1 protein kinase b protein kinase b 0 1.0 ermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37401 17956327 46686 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 f brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37402 17956327 46686 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37404 17956327 46686 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxyg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37405 17956327 46686 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 lar signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 39552 17987632 49317 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 optimizing separation efficiency of 2 de procedures for visualization of different superoxide dismutase forms in a cellular model of amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 39553 17987632 49319 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in ad and pd patients superoxide dismutase sod1 was also indicated as a major target of oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22670 18210200 26911 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 another study also suggested that cnts functionalized with growth factors such as nerve growth factor or brain derived neurotrophic factor can stimulate growth of neurons on the nanotube scaffold matsumoto et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22671 18210200 26911 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 another study also suggested that cnts functionalized with growth factors such as nerve growth factor or brain derived neurotrophic factor can stimulate growth of neurons on the nanotube scaffold matsumoto et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22672 18210200 26911 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 another study also suggested that cnts functionalized with growth factors such as nerve growth factor or brain derived neurotrophic factor can stimulate growth of neurons on the nanotube scaffold matsumoto et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22673 18210200 26919 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 for example a recent study reported a nanotube produced by a layer based assembly of cytochrome c poly sodium styrene sulfonate and poly ethylenimine pei . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22674 18210200 26997 10601 6081 INS insulin insulin 0 1.0 omes to the brain they can be additionally modified vectorized with monoclonal antibodies to glial fibrillary acidic proteins pardridge 1999 ; chekhonin et al 2005 transferrin receptors ox26 or human insulin receptors 83 14 mab; pardridge 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22675 18210200 26997 22023 11740 TF transferrin transferrin 0 1.0 to target pegylated liposomes to the brain they can be additionally modified vectorized with monoclonal antibodies to glial fibrillary acidic proteins pardridge 1999 ; chekhonin et al 2005 transferrin receptors ox26 or human insulin receptors 83 14 mab; pardridge 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22676 18210200 27013 10601 6081 INS insulin insulin 0 1.0 one study has shown that polymeric micelles of pluronic block copolymers after conjugation with an antibody against a 2 glycoprotein or insulin showed increased delivery of a drug haloperidol or a fluorescent probe to the brain in vivo kabanov et al 1989 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22677 18210200 27040 10601 6081 INS insulin insulin 0 1.0 the permeability of oligonucleotides with nanogels was enhanced when the nanogel surface was modified with polypeptides transferrin or insulin that bind receptors at the luminal side of the brain microvessel endothelial cells and transport to their abluminal side. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22678 18210200 27040 22023 11740 TF transferrin transferrin 0 1.0 the permeability of oligonucleotides with nanogels was enhanced when the nanogel surface was modified with polypeptides transferrin or insulin that bind receptors at the luminal side of the brain microvessel endothelial cells and transport to their abluminal side. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22679 18210200 27061 22023 11740 TF transferrin transferrin 0 1.0 gene transfer into brain capillary cells have been also shown using a transferrin conjugated peg modified pamam dendrimer huang et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22680 18210200 27065 551 399 ALB albumin albumin 0 1.0 notably several nanoscale drugs _amp_#8220;nanomedicines_amp_#8221; such as liposomal doxorubicin doxil gabizon et al 2006 or albumin bound paclitaxel abraxane gradishar 2006 have been used in clinic already for treatment of cancer and other diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22681 18210200 27081 3544 1516 CAT catalase catalase 0 1.0 based on this our laboratories developed cell mediated delivery of catalase nanozyme to the brain to mitigate production of ros and induce neuroprotection batrakova et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22682 18210200 27082 3544 1516 CAT catalase catalase 0 1.0 to preclude bmm mediated enzyme degradation catalase was packaged into a block ionomer complex with a cationic block copolymer pei peg. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22683 18210200 27083 3544 1516 CAT catalase catalase 0 1.0 the self assembled catalase/pei peg complexes were ca. 60 to 100 nm in size stable in ph and ionic strength and retained antioxidant activities. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22685 18210200 27089 8240 4232 GDNF glial derived neurotrophic factor glial derived neurotrophic factor 0 1.0 these diseases would collectively benefit from immunomodulation neurotrophic factors such as glial derived neurotrophic factor or brain derived neurotrophic factor and in the case of hiv 1 disease anti retroviral therapy kabanov and gendelman 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22686 18210200 27089 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 these diseases would collectively benefit from immunomodulation neurotrophic factors such as glial derived neurotrophic factor or brain derived neurotrophic factor and in the case of hiv 1 disease anti retroviral therapy kabanov and gendelman 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23829 18219386 28332 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in this issue of the jci harraz and colleagues demonstrate that sod1 mutants expressed in human cell lines directly stimulate nadph oxidase nox by binding to rac1 resulting in overproduction of damaging ros see the related article beginning on page 659 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23830 18219386 28334 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 footnotes nonstandard abbreviations used: als amyotrophic lateral sclerosis; nox nadph oxidase; o 2 _amp_#x02022;_amp_#x02013; superoxide; sod1 superoxide dismutase_amp_#x02013;1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23831 18219386 28361 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 the nox prototype nox2 is the phagocytic nox also known as gp91 phox that generates o 2 _amp_#x02022;_amp_#x02013; not as a byproduct but as a primary function of the enzyme 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23832 18219386 28363 5279 2577 CYBA p22-phox p22 phox 0 1.0 nox2 is constitutively associated with the transmembrane nox stabilizing protein p22 phox and recruitment of the activating cytosolic components p47 phox p67 phox and p40 phox are needed for function figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23833 18219386 28363 14170 7661 NCF2 p67 phox p67 phox 0 1.0 nox2 is constitutively associated with the transmembrane nox stabilizing protein p22 phox and recruitment of the activating cytosolic components p47 phox p67 phox and p40 phox are needed for function figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23834 18219386 28364 5279 2577 CYBA p22-phox p22 phox 0 1.0 upon cell activation p47 phox is phosphorylated thereby initiating translocation of the p47 phox /p67 phox /p40 phox complex to the membrane where phosphorylated p47 phox binds to p22 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23835 18219386 28364 14170 7661 NCF2 p67 phox p67 phox 0 1.0 upon cell activation p47 phox is phosphorylated thereby initiating translocation of the p47 phox /p67 phox /p40 phox complex to the membrane where phosphorylated p47 phox binds to p22 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23836 18219386 28367 14170 7661 NCF2 p67 phox p67 phox 0 1.0 rac acts to coordinate the translocation of the p47 phox /p67 phox /p40 phox complex and is active only when bound to gtp not when bound to gdp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23838 18219386 28404 14170 7661 NCF2 p67 phox p67 phox 0 1.0 apocynin is believed to block the translocation of p47 phox /p67 phox to nox 23 and would therefore inhibit only the nox proteins requiring these cytosolic activators which include nox1 and nox2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23839 18219386 28415 14170 7661 NCF2 chronic granulomatous disease chronic granulomatous disease 0 1.0 mutations altering the activity of nox2 or other subunits of nox are known to cause chronic granulomatous disease cgd 15 which is characterized by severe and chronic infections that are hard to treat due to the incapacity of immune cells to produce o 2 _amp_#x02022;_amp_#x02013; and therefore to fight pathogens. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 26562 18270519 31491 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the nitroxide radical by itself is also an antioxidant and can be used as a superoxide dismutase mimic krishna et al 1996a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15784 18308427 18543 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced endogenously or exogenously. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15785 18308427 18543 3544 1516 CAT catalase catalase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced endogenously or 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15786 18308427 18543 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced en 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15787 18308427 18543 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced endogenously or exogenously. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15788 18308427 18546 3544 1516 CAT catalase catalase 0 1.0 on the other hand catalase activity was found to be significantly lower p _amp_#x3c; 0.001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15789 18308427 18547 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 the activities of glucose 6 phosphate dehydrogenase glutathione reductase and glutathione levels were also found to be significantly reduced in als patients compared to healthy subjects p _amp_#x3c; 0.001 p _amp_#x3c; 0.01 and p _amp_#x3c; 0.01 respectively . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15790 18308427 18547 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 the activities of glucose 6 phosphate dehydrogenase glutathione reductase and glutathione levels were also found to be significantly reduced in als patients compared to healthy subjects p _amp_#x3c; 0.001 p _amp_#x3c; 0.01 and p _amp_#x3c; 0.01 respec 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15791 18308427 18548 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 it was further observed that lipid peroxidation started to increase and catalase glutathione reductase glucose 6 phosphate dehydrogenase enzyme activities and glutathione levels started to decrease as amyotrophic lateral sclerosis progressed from 6 to 24 months suggesting a correlation between these p 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15792 18308427 18548 3544 1516 CAT catalase catalase 0 1.0 it was further observed that lipid peroxidation started to increase and catalase glutathione reductase glucose 6 phosphate dehydrogenase enzyme activities and glutathione levels started to decrease as amyotrophic lateral sclerosis progressed from 6 to 24 months suggesting a corre 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15793 18308427 18548 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 it was further observed that lipid peroxidation started to increase and catalase glutathione reductase glucose 6 phosphate dehydrogenase enzyme activities and glutathione levels started to decrease as amyotrophic lateral sclerosis progressed from 6 to 24 months suggesting a correlation between these parameters and duration of amyotrop 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15794 18308427 18561 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 these enzymes include superoxide dismutase sod e.c no 1.15.1.1 that remove o 2_amp_#x2212; by catalyzing its dismutation one o 2_amp_#x2212; being reduced to h 2 o 2 and another oxidized to o 2 [fridovich 1989] [halliwell 2001] and [liochev a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15795 18308427 18562 3544 1516 CAT catalase catalase 0 1.0 catalase cat e.c no 1.11.1.6 catalyzes the conversion of hydrogen peroxide h 2 o 2 to water and molecular oxygen thereby protecting cells from the toxic effects of hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15796 18308427 18566 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 gsh recycling is catalyzed by glutathione reductase gr e.c no 1.8.1.10 which uses reducing equivalents from nadph to reconvert gssg to 2gsh. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15797 18308427 18568 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 low erythrocyte gsh is also manifest in hereditary nonspherocytic lymphocytic leukemia and glucose 6 phosphate dehydrogenase g 6 pdh e.c no 1.1.1.49 deficiency. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15798 18308427 18609 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15799 18308427 18626 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 the 1 ml reaction mixture contained tris_amp_#x2013;hcl buffer 25 mm ph 7.6; nadph 0.12 mm; glutathione reductase 1 u/ml; reduced glutathione 1 mm; cumin hydroperoxide 0.1 mm and suitable amount of enzyme. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15801 18308427 18634 551 399 ALB serum albumin serum albumin 0 1.0 y using the method of brehe and burch 1976 with minor modifications. 200 _amp_#x3bc;l of 0.01n hcl was mixed with dtnb containing buffer 110 mm na 2 hpo 4 40 mm nah 2 po 4 15 mm edta 0.04% w/v bovine serum albumin bsa and 0.3 mm dtnb. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15802 18308427 18637 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 glutathione reductase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15803 18308427 18643 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 glucose 6 phosphate dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15804 18308427 18659 3544 1516 CAT catalase catalase 0 1.0 the rate of lpo in the erythrocytes of als patients was significantly increased with respect to control subjects p _amp_#x3c; 0.001 fig 1 whereas catalase activity in the rbc of als patients was significantly lower than the controls p _amp_#x3c; 0.01 fig 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15805 18308427 18701 3544 1516 CAT catalase catalase 0 1.0 fig. 7._amp_#xa0;second degree polynomial regression plot showing the activity of catalase in the erythrocytes of als vs. duration of illness n = 10 at 6 months 5 at 12 months and 5 at 24 months . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15806 18308427 18705 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 fig. 9._amp_#xa0;second degree polynomial regression plot showing the activity of glutathione reductase vs. duration of illness in the erythrocytes of patients with als n = 10 at 6 months 5 at 12 months and 5 at 24 months . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15807 18308427 18707 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 fig. 10._amp_#xa0;second degree polynomial regression plot showing the activity of glucose 6 phosphate dehydrogenase vs. duration of illness in the erythrocytes of als patients n = 10 at 6 months 5 at 12 months and 5 at 24 months . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 18496 18349520 21380 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 methods: reactive oxygen species production protein carbonylation and nitration susceptibility to hydrogen peroxide exposure p38 mitogen activated protein kinase activation and adenosine triphosphate intracellular content were evaluated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9662 18414597 11013 10437 5992 IL1B il 1 il 1 0 1.0 pro inflammatory cytokines tnf alpha and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9663 18414597 11013 22551 11892 TNF tnf alpha tnf alpha 0 1.0 pro inflammatory cytokines tnf alpha and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9664 18414597 11015 10437 5992 IL1B il 1 il 1 0 1.0 tnf alpha and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9665 18414597 11015 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9667 18414597 11018 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9668 18414597 11020 14569 7897 NPC1 niemann-pick disease niemann pick disease 0 1.0 niemann pick diseases a and b are due to acidic sphingomyelinase deficiency resulting in sphingomyelin accumulation while niemann pick disease c is due to mutations in either the npc1 or npc2 genes resulting in defective cholesterol transport and cholesterol accumulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9762 18422522 11246 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 endothelial nitric oxide synthase overexpression by neuronal cells in neurodegeneration: a link between inflammation and neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9764 18422522 11247 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 the roles of neuronal and inducible nitric oxide synthases in neurones have been extensively investigated; by contrast the biological significance of endothelial nitric oxide synthase enos overexpression that occurs in several pathological conditions has not yet been studied. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9766 18422522 11249 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found that enos which is endogenously expressed by these cells was activated by tumour necrosis factor alpha tnf alpha a proinflammatory cytokine that plays important roles in als2 and several neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9767 18422522 11250 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the tnf alpha dependent enos activation occurred through generation by sphingosine kinase 1 of sphingosine 1 phosphate stimulation of its membrane receptors and activation of akt as determined using small interfer 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9768 18422522 11250 22551 11892 TNF tnf alpha tnf alpha 0 1.0 hate stimulation of its membrane receptors and activation of akt as determined using small interference rna and dominant negative constructs specific for the enzymes and receptors. enos activation by tnf alpha conferred cytoprotection from excitotoxicity and neurotoxic cues such as reactive oxygen species endoplasmic reticulum stress dna damage and mutated alsin itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9769 18422522 11250 21157 11240 SPHK1 sphingosine kinase 1 sphingosine kinase 1 0 1.0 the tnf alpha dependent enos activation occurred through generation by sphingosine kinase 1 of sphingosine 1 phosphate stimulation of its membrane receptors and activation of akt as determined using small interference rna and dominant negative constructs specific for the enzymes and recepto 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 7740 18588875 8938 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 this review will outline the potential role of mitochondrial function and redox balance in age related eye diseases and detail how the methionine sulfoxide reductase msr protein repair system and other redox systems play key roles in the function and maintenance of the aging eye. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2048 18751914 3073 10437 5992 IL1B il 1 il 1 0 1.0 pro inflammatory cytokines tnf _amp_#945; and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2049 18751914 3071 10437 5992 IL1B il 1 il 1 0 1.0 tnf _amp_#945; and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2051 18751914 3068 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2052 18751914 3066 14569 7897 NPC1 niemann-pick disease niemann pick disease 0 1.0 niemann pick diseases a and b are due to acidic sphingomyelinase deficiency resulting in sphingomyelin accumulation while niemann pick disease c is due to mutations in either the npc1 or npc2 genes resulting in defective cholesterol transport and cholesterol accumulation. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0