#sen2geneID pmid senID geneID hgncID approvedSymbol matchString actualString startPos score flankingText matchCodeID tag SciMinerVersion SciMinerMethod inExClude inExCludeCond phenotypeOnly conflictCode hgncIDbyNR NRText editTag editUser oldGeneID oldHgncID oldApprovedSymbol oldInExClude oldInExCludeCond 297138 8841988 424205 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 decreased cytochrome c oxidase activity but unchanged superoxide dismutase and glutathione peroxidase activities in the spinal cords of patients with amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297141 8841988 424208 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 we measured the antioxidant actions of superoxide dismutase sod glutathione peroxidase gsh px and cytochrome c oxidase co of the human spinal cord in patients with als in comparison with those in control patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297269 8899665 424391 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 evidence against increased oxidative stress in fibroblasts from patients with non superoxide dismutase 1 mutant familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297271 8899665 424393 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in parallel fibroblasts were examined for signs of abnormal oxidative stress by study of reactive oxygen species metabolism and concurrently leukocyte dna from the same patients was examined for superoxide dismutase 1 sod1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295173 8922414 420725 20478 11117 SMN1 spinal muscular atrophy spinal muscular atrophy 0 1.0 in humans elevated ros levels also have been linked to neuropathies such as parkinson's disease huntington's chorea alzheimer's disease infantile spinal muscular atrophy and amyotrophic lateral sclerosis als; olanow and arendash 1994 ; beal 1995 ; eisen 1995 ; mattson and goodman 1995 . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 295531 8997453 421543 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 the major neurodegenerative disorders include alzheimer's disease amyotrophic lateral sclerosis parkinson's disease and multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 294712 9172131 419815 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 d familial 5 10_amp_#37; cases forms which are clinically and pathologically indistinguishable. 2 the discovery of a missense mutation in the gene encoding the major cellular antioxidant enzyme cu/zn superoxide dismutase sod1 in familial als subjects 3 has initiated an intense investigation into the role of oxidative stress in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293755 9350962 417497 551 399 ALB albumin albumin 0 0.0 ribes an immunocytochemical method for localization of central nervous system cns lipid peroxidation lp that employs a rabbit derived antibody raised against malondialdehyde mda modified rabbit serum albumin rsa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293757 9350962 417521 551 399 ALB albumin albumin 0 0.0 five milliliters of the solution was mixed with 5 ml of rabbit serum albumin rsa; 10 mg/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293759 9350962 417531 551 399 ALB albumin albumin 0 0.0 malondialdehyde rabbit serum albumin elisa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293761 9350962 417533 551 399 ALB albumin albumin 0 0.0 the mda rsa solution was poured out and the plates blocked with 200 _amp_#x3bc; l of a solution of 1% bovine serum albumin bsa in phosphate buffered saline pbs for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293763 9350962 417541 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 transgenic familial als mice g1h/+ strain which highly express a mutant human cu/zn superoxide dismutase gene 93 gly_amp_#x2192;ala and develop motor neuron disease gurney et al. 1996 were bred and raised at pharmacia and upjohn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293764 9350962 417588 551 399 ALB albumin albumin 0 0.0 specificity of anti malondialdehyde rabbit serum albumin antibody 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291078 9462746 412763 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 a novel neurological phenotype in mice lacking mitochondrial manganese superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280473 10077670 394958 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 abstract it has been reported that expression of familial amyotrophic lateral sclerosis fals associated mutant cu/zn superoxide dismutase 1 sod induces apoptosis of neuronal cells in culture associated with an increase in reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280480 10077670 394991 17303 9391 PRKAR2A protein kinase a protein kinase a 0 0.0 in brief r ii peptide dldvpipgrfdrrvsvaae; 0.25 _amp_#x003bc;m containing the phosphorylation site of type ii camp dependent protein kinase lc services woburn ma was phosphorylated by bovine brain protein kinase a catalytic subunit 30 _amp_#x003bc;g/ml plus _amp_#x0005b;_amp_#x003b3; 32 p_amp_#x0005d;atp 0.5 mm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280520 10077670 395143 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 als amyotrophic lateral sclerosis sod cu/zn superoxide dismutase 1 fals familial als cyp cyclophilin wt wild type ngf nerve growth factor adv adenovirus csa cyclosporin a nmda n methyl d aspartate mptp mitochondrial permeability transition pore 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280522 10077670 395146 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in 1993 mutations in cu/zn superoxide dismutase 1 sod were found to be associated with 20_amp_#x00025; of cases of familial als fals 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 277453 10385054 390311 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 one of the strongest suggestions for this link has come from the association between the familial autosomal dominant form of amyotrophic lateral sclerosis fals and defects in the cu/zn superoxide dismutase sod 1 gene [ 2 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267933 10643818 372664 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267939 10643818 372671 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e apoe protects neurons from hydrogen peroxide toxicity and binds specific metal ions including iron which could otherwise catalyze the generation of hydroxyl radicals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267941 10643818 372672 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 the gene product of apolipoprotein e allele epsilon 4 has decreased anti oxidant activity compared to alleles epsilon 2 and 3 [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267943 10643818 372673 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e may also protect from _amp_#x3b2; amyloid peptide toxicity by binding to amyloid _amp_#x3b2; and under certain circumstances acting as kinetic inhibitor of amyloid formation [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268284 10671549 373497 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 furthermore g93a cells showed a significant decrease of bcl 2 expression and as target of no derived radicals showed lower cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268311 10671549 373603 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 cytochrome c oxidase activity cells attached and detached were washed and collected by centrifugation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268313 10671549 373605 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 lysates were used for cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268325 10671549 373664 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 a specific marker of no toxicity was the decrease of cytochrome c oxidase activity which paralleled the extent of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268340 10671549 373733 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 b activity of cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268342 10671549 373734 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 spectrophotometric determination of cytochrome c oxidase activity was performed as described under "experimental procedures." 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268357 10671549 373777 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 among the above mentioned molecular target of no toxicity the hemoprotein cytochrome c oxidase appears to be the only one strongly affected by gsno insult and protected by native cu zn sod fig 7 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264088 10742195 364641 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 it is especially intriguing how the powerful catalytic redox activity of antioxidant cu/zn superoxide dismutase can convert into a pro oxidant activity a theme echoed in the recent proposal that a_amp_#x3b2; and prp the proteins respectively involved in alzheimer_amp_#x2019;s disease and prion diseases possess 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264096 10742195 364701 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh _amp_#x2022; [ 10 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264100 10742195 364742 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 we have also reported [ 25 ] that apolipoprotein e apoe modulates the precipitation of a_amp_#x3b2; by cu 2+ and zn 2+ which is important because apoe isoforms segregate with the genetic risk for ad; inheritance of the apoe4 isoform carries the gre 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257646 11050436 352951 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 the q cycle mechanism proposed for the operation of the ubiquinol cytochrome c reductase operates as follows. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257662 11050436 353063 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 complex i nadh ubiquinone oxidoreductase complex iii ubiquinol cytochrome c oxidoreductase complex iv cytochrome c oxidase and complex v h + translocating atp synthetase are shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253644 11223912 347837 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 rial uptake of ca 2+ has recently been found to play an important role in glutamate induced neurotoxicity gnt as well as in the activation of ca 2+ dependent molecules such as calmodulin and neuronal nitric oxide synthase nnos in the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253691 11228742 347976 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 otrophin mediated activation glutamatergic signal transduction and various diseases with crucial roi involvement e.g. alzheimer's disease parkinson's disease experimental autoimmune encephalomyelitis multiple sclerosis amyotrophic lateral sclerosis and injury . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 249611 11328670 340451 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 invited review: manganese superoxide dismutase in disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 249613 11328670 340452 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 manganese superoxide dismutase mnsod is essential for life as dramatically illustrated by the neonatal lethality of mice that are deficient in mnsod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245378 11562447 333617 551 399 ALB albumin albumin 0 0.0 peroxynitrite dependent nitrations were impaired when synaptosomes were pretreated with thioreductants glutathione n acetyl cysteine dithiothreitol or antioxidants uric acid melatonin bovine serum albumin desferrioxamine . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245386 11562447 333690 551 399 ALB albumin albumin 0 0.0 the reaction was started by the addition of the substrates [1 c]acetyl coa 14 microm and choline 2.5 mm in the presence of 250 microm eserine 10 microm bovine serum albumin bsa and 75 mm nacl and stopped after 1 h by dilution with cold sodium phosphate buffer. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245401 11562447 333874 551 399 ALB albumin albumin 0 0.0 ach acetylcholine; sin 1 3 morpholinosydnonimine; coa coenzyme a; chat choline acetyltransferase; vamp/synaptobrevin vesicular associated membrane protein; tca trichloroacetic acid; bsa bovine serum albumin; page polyacrylamide gel electrophoresis; ecl enhanced chemiluminescence; gsh glutathione; nac n acetylcysteine; dtt dithiothreitol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238978 11679167 325647 17649 9655 PTPN3 tyrosine phosphatase tyrosine phosphatase 0 0.0 it was recently shown that the inhibition of yeast growth by linoleic acid hydroperoxide requires a putative protein tyrosine phosphatase oca1p of unknown function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239000 11679167 325752 23454 12435 TXN thioredoxin thioredoxin 0 0.0 it was recently shown that the thioredoxin system consisting of thioredoxin thioredoxin reductase and thioredoxin peroxidase plays a key role in regulating the yap1p dependent stress response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239004 11679167 325754 23454 12435 TXN thioredoxin thioredoxin 0 0.0 in addition the thioredoxin peroxidase tpx1p is essential for the transcriptional activation of trx2 and trr1 genes ross et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239012 11679167 325772 23454 12435 TXN thioredoxin thioredoxin 0 0.0 indeed the induction of tpx1 thioredoxin peroxidase gene is skn7p and yap1p dependent and is lower in respiration deficient mutants and ccp 1_amp_#x394; cells charizanis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239016 11679167 325799 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 life span of cells adapted to respiratory growth conditions which display high levels of antioxidant defences maclean et al. 2001 and by the decreased life span observed in mutants deficient in cuzn superoxide dismutase or mn superoxide dismutase longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239017 11679167 325799 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 or mn superoxide dismutase longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239019 11679167 325800 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the deficiency in mn superoxide dismutase leads to the accumulation of superoxide radicals which destroy the 4fe_amp_#x2013;4s clusters of mitochondrial enzymes e.g. aconitase leading to an impaired respiratory activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232225 11978481 313820 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 the generation of no _amp_#x2022; is catalyzed by three isoforms of nitric oxide synthase neuronal nitric oxide synthase nnos endothelial nitric oxide synthase enos and inducible nitric oxide synthase inos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232230 11978481 313855 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 one protein was manganese superoxide dismutase which was previously shown to be selectively nitrated at tyr 34 and inactivated [ 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232235 11978481 313875 24393 12854 YWHAQ protein tau protein tau 0 1.0 neurofibrillary tangles are protein aggregates which are largely made up of the microtubule associated protein tau. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 232239 11978481 313887 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 a 6 fold increase in 3 nitrotyrosine concentrations was detected in ad cerebrospinal fluid as compared to age matched controls [ 41 ] and an increase in nitrated manganese superoxide dismutase was also reported [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232241 11978481 313900 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 we and others showed that inhibitors of neuronal nitric oxide synthase blocked mptp induced dopaminergic toxicity in mice and that mptp neurotoxicity was attenuated in mice deficient in neuronal nitric oxide synthase [ 45 and 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232243 11978481 313901 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 we subsequently showed that neuronal nitric oxide synthase inhibitors blocked mptp neurotoxicity in baboons and this was accompanied by an inhibition of 3 nitrotyrosine staining [ 47 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232245 11978481 313905 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 an increase in nitrated manganese superoxide dismutase was found in cerebrospinal fluid [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232248 11978481 313925 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 other groups reported marked increases of both free 3 nitrotyrosine and nitrated manganese superoxide dismutase in the cerebrospinal fluid of sporadic als patients [ 42 and 62 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232249 11978481 313926 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in transgenic mouse models of als protein carbonyls are significantly increased in the spinal cord and one of the most heavily oxidized proteins in cu/zn superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232252 11978481 313929 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 an increase in neuronal nitric oxide synthase nnos was found in motor neurons in one study [ 65 66 and 67 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218390 12392777 292016 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the antioxidant enzymes in the brain include cu/zn superoxide dismutase sod 1 and mn superoxide dismutase sod 2 which catalyze the conversion of o 2 _amp_#x221a; _amp_#x2212; to h 2 o 2 [ 73 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208065 12618129 278659 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mitochondrial respiratory chain dysfunction was also found in transgenic mice expressing a mutant form of superoxide dismutase 1 associated with familial als [ 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208068 12618129 278684 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 the activities of complex i+iii nadh_amp_#x2013;cytochrome c reductase ii+iii succinate_amp_#x2013;cytochrome c reductase iv cytochrome c oxidase cox and the mitochondrial matrix enzyme citrate synthase cs were measured as described elsewhere [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208072 12618129 278794 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 i+iii nadh cytochrome c reductase; ii+iii succinate cytochrome c reductase; cox cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209895 12654515 280327 12355 6872 MAPK10 map kinase map kinase 0 1.0 map kinase activation assay 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 209896 12654515 280328 12355 6872 MAPK10 map kinase map kinase 0 1.0 map kinase activation was measured by the phosphorylation of erk1/2 using anti phospho erk1/2 antibody cell signaling . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 211479 12663085 281801 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 since mutations of the superoxide dismutase 1 sod 1 gene were first identified in 1993 it has been considered a possible cause of familial als fals [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211481 12663085 281812 11778 6561 LGALS1 galectin galectin 0 0.0 e as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212295 12684448 283326 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 although a small percentage 1 2% of cases have been linked to mutations in the enzyme superoxide dismutase 1 sod1 rosen et al. 1993 the vast majority 90 95% are sporadic. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205118 12753090 274891 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 nitrosative stress was not involved in the oxidative unbalance as a decrease in neuronal nitric oxide production and down regulation of neuronal nitric oxide synthase nnos level were detected. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201231 12893007 269200 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in some familiar cases of als mutation in the gene for cu/zn superoxide dismutase sod1 can be identified. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201235 12893007 269263 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 hne immunopositivity seems to be associated with the inheritance of apolipoprotein e 4 apoe alleles. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201721 12901835 269787 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 decreased activity of cytochrome c oxidase was demonstrated in spinal cord motor neurons [ borthwick et al 1999 ] and lymphocytes [ curti et al 1996 ] from sals patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202341 12909279 270800 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 as a chain of consequent events modulating extracellular transport uptake intracellular delivery from chaperones e.g copper chaperone for sod1 ccs cox17 and atx1 to specific targets such as sod1 and cytochrome c oxidase and/or storage in copper scavenging systems such as gsh and metallothioneins [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202346 12909279 270835 22023 11740 TF transferrin transferrin 0 0.0 if the ire is located on the 3_amp_#x2032; untranslated region of the mrna the binding of irp usually causes an up regulation of the coded protein as for example for the transferrin receptor [ 28 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187461 14648077 250304 23454 12435 TXN thioredoxin thioredoxin 0 0.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 by prx2 and gpx1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187464 14648077 250304 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187468 14648077 250309 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187475 14648077 250322 23454 12435 TXN thioredoxin thioredoxin 0 0.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187478 14648077 250322 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 0.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187482 14648077 250336 551 399 ALB albumin albumin 0 0.0 olyclonal antibody against prx2 a synthetic peptide corresponding to the c terminal region of prx2 amino acids 184_amp_#x2013;198: nh 2 kpnvddskeyfskhn cooh with or without conjugation to human serum albumin hsa at the carboxyl end was supplied by peptide institute osaka japan . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187487 14648077 250372 551 399 ALB albumin albumin 0 0.0 the following primary antibodies were utilized: an affinity purified rabbit antibody against prx2 concentration: 1 _amp_micro;g/ml a polyclonal antibody to gpx1 [diluted 1:2 000 in 1% bovine serum albumin containing phosphate buffered saline bsa pbs ph 7.4] [ 2 ] and a polyclonal antibody to human sod1 diluted 1:10 000 in 1% bsa pbs ph 7.4 [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187495 14648077 250438 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 similar stainability and immunolocalization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187499 14648077 250447 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the precise intra inclusional immunolocalizations of these three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188362 14660707 251221 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 p experiments were performed on vulnerable hypoglossal motoneurones mns and mitochondrial function was disturbed by bath application of 1_amp_#x02013;2 m m sodium cyanide cn which inhibits complex iv cytochrome c oxidase of the electron transport chain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188364 14660707 251324 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 we investigated the impact of a disturbed respiratory chain on membrane currents and [ca 2+ ] i using cyanide cn a known inhibitor of cytochrome c oxidase complex iv . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189434 14690536 252560 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 it is possible that mutations of cu/zn superoxide dismutase sod1 responsible for about 20% of familial als down regulates glutamate transporters via oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189443 14690536 252569 20339 13448 SLC38A2 amino acid transporter 2 amino acid transporter 2 0 0.0 excitatory amino acid transporter 2|sod1 g93a protein|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189759 14698606 252862 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 most cases are sporadic although a subset 10% is familial with 20% of these being linked to mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190874 14739060 254321 12355 6872 MAPK10 map kinase map kinase 0 1.0 it is now recognized that redox regulation involving ros is key to the modulation of critical cellular functions notably for neurons astrocytes and microglia such as mitogene activated protein map kinase cascade activation ion transport calcium mobilization and apoptosis program activation. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 190898 14739060 254413 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 parkin is one member of the family of ubiquitin ligase responsible for ubiquination a process tagging proteins for degradation through proteosomal pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190902 14739060 254448 12580 7008 MELAS mitochondrial encephalomyopathy mitochondrial encephalomyopathy 0 0.0 the classic phenotypes of mitochondrial encephalomyopathy has been described as mitochondrial encephalomyopathy lactic acidosis and stroke like episodes syndrome melas . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190903 14739060 254448 12580 7008 MELAS mitochondrial encephalomyopathy, lactic acidosis, mitochondrial encephalomyopathy lactic acidosis an 0 1.0 the classic phenotypes of mitochondrial encephalomyopathy has been described as mitochondrial encephalomyopathy lactic acidosis and stroke like episodes syndrome melas . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190904 14739060 254456 12580 7008 MELAS mitochondrial encephalomyopathy mitochondrial encephalomyopathy 0 1.0 primary coenzyme q deficiency cause a mitochondrial encephalomyopathy that is responsive to coenzyme q administration [ 44 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 184281 15038597 246226 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 in particular we recently demonstrated that in copper deficiency mitochondrial function is impaired due to decreased activity of cytochrome c oxidase leading to production of reactive oxygen species which in turn triggers mitochondria mediated apoptotic neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 177204 15105254 236597 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 increased maos occurs in amyotrophic lateral sclerosis als as the result of genetic abnormalities e.g. cu/zn superoxide dismutase mutations or exposure to environmental toxins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 173000 15289674 231348 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 detection method of the adjacent motor neuronal death in an in vitro co culture model of familial als associated cu/zn superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 173001 15289674 231349 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mutations in cu/zn superoxide dismutase sod1 gene have been identified in familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151517 15812313 199948 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 copper is an essential trace metal and is required for the proper functioning of several enzymes including cytochrome c oxidase ceruloplasmin and sod1 _amp_#91; 13 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 153998 15850589 203859 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mutations of cu/zn superoxide dismutase sod1 are found in patients with familial amyotrophic lateral sclerosis fals . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 153999 15850589 203876 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 about one fifth of fals patients have mutations in the gene encoding for cu/zn superoxide dismutase sod1 and over 100 missense mutations have been described. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142774 15863242 187979 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 cu/zn superoxide dismutase 1 sod1 encoded on chromosome 21 is a key enzyme in metabolism of oxygen free radicals and oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142776 15863242 187987 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the human cu/zn superoxide dismutase 1 gene hsod1 was the first chromosome 21 gene to be characterised groner et al. 1985 and it was even shown earlier to be overexpressed at the protein level in down syndrome ds; trisomy 21 patients si 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142789 15863242 188108 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 finally the manifold decrease of ubiquitin conjugating enzyme e2 level in tg hsod1 mice catalyzing covalent attachment of ubiquitin to other proteins may reflect sod1 mediated impaired protein handling in terms of ubiquitination. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142791 15863242 188110 1345 853 ATP6V1B1 beta polypeptide beta polypeptide 0 0.0 we have included fragments of two proteins table 1 similar to tubulin beta polypeptide and sex determining protein that were differentially expressed between groups but these were not included in the discussion as no definitive assignment can be made based upon an incomplete sequence. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142792 15863242 188110 23406 20778 TUBB tubulin, beta tubulin beta 0 0.0 we have included fragments of two proteins table 1 similar to tubulin beta polypeptide and sex determining protein that were differentially expressed between groups but these were not included in the discussion as no definitive assignment can be made based upon an incomplet 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144768 15896810 189879 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 there is significant evidence that the pathogenesis of several neurodegenerative diseases including parkinson's disease alzheimer's disease friedreich's ataxia frda multiple sclerosis and amyotrophic lateral sclerosis may involve the generation of reactive oxygen species ros and/or reactive nitrogen species rns associated with mitochondrial dysfunction. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144770 15896810 189890 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 the major neurodegenerative diseases alzheimer's disease ad parkinson's disease pd amyotrophic lateral sclerosis als multiple sclerosis ms huntington's disease hd and frda are all associated with the presence of abnormal proteins. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144784 15896810 189938 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 there is significant evidence that the pathogenesis of several neurodegenerative diseases including parkinson's disease alzheimer's disease friedreich ataxia multiple sclerosis and amyotrophic lateral sclerosis may involve the generation of reactive oxygen species ros reactive nitrogen species rns and mitochondrial dysfunction. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144790 15896810 189946 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 up regulation of protein manganese superoxide dismutase mnsod fails to occur in frda fibroblasts exposed to iron [25] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144799 15896810 190030 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 other data are also consistent with these findings as it has been shown both in a patient with cytochrome c oxidase deficiency and in an animal model of copper deficiency that more than a 50% deficit in complex iv activity did not affect the respiratory flux [56] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144801 15896810 190043 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 cytokines inf _amp_#x3b3; which are present in normal brain are elevated in numerous pathological states including parkinson's disease [83] alzheimer's disease [84] multiple sclerosis ischemia encephalitis and central viral infections [85] . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144810 15896810 190071 551 399 ALB albumin albumin 0 0.0 nitrosothiols with biological relevance have been isolated and characterized including s nitrosoglutathione and the nitrosothiols of serum albumin [101] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144817 15896810 190097 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the factors responsible for this include the inner mitochondrial membrane lipid composition and/or the oxidant/antioxidant balance particularly manganese superoxide dismutase and/or heat shock protein activity and expressions as well as the glutathione status. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147205 15964487 194024 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 treatment of patients with minocycline has therefore been proposed as a possible therapy for some neurodegenerative diseases including multiple sclerosis popovic et al. 2002 ischemia arvin et al. 2002 pd and huntington_amp_#x2019;s disease thomas et al 2003 and thomas et al 2004 because minocycline crosses the blood brain barrier regardless of the dos 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 147208 15964487 194064 551 399 ALB albumin albumin 0 0.0 mitochondrial protein concentrations were quantified spectrophotometrically micro bca protein reagent kit pierce rockford il usa with bovine serum albumin used as standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147211 15964487 194087 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 complex iv cytochrome c oxidase; e.c.1.9.3.1 activity was determined as described by wharton and tzagoloff 1967 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147213 15964487 194091 20411 11086 SLIT2 slit 2 slit 2 0 1.0 fluorescence was continuously monitored using a perkin elmer ls 50b fluorescence spectrometer with the excitation at 506nm and the emission at 531nm slit 2.5nm . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 136180 16026864 180216 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 als is sporadic in 90% of cases; the remaining 10% are of genetic origin with a subset being induced by mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136187 16026864 180337 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 als related disturbance of mitochondrial respiration by mutant superoxide dismutase 1 sod1 or hypoxia results in increased formation of reactive oxygen species ros 48 and 49 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136878 16043017 181252 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 the activities of uch l1 in the spinal cord were measured by determining the rate of conversion of ubiquitin c terminal 7 amido 4 methylcoumarin ub amc calbiochem to ubiquitin and free amc [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137917 16050975 182119 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 approximately 20% of fals cases are due to mutations in the gene encoding superoxide dismutase 1 sod1; cu zn dismutase; mim147450 rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137930 16050975 182258 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131952 16188953 173806 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 finally both compounds were tested in superoxide dismutase 1 g93a mice a model of familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131954 16188953 173829 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 twenty percent of familial als cases are caused by mutations in superoxide dismutase 1 sod1 which expressed in mice result in a phenotype resembling the pathology in patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131959 16188953 173965 166 118 ACO2 aconitase 2 aconitase 2 0 0.0 additionally a monoclonal antibody raised against the 23 c terminal amino acids of aconitase 2 mitochondrial aconitase from rat nanotools; antik_amp_ouml;rpertechnik teningen germany was used to study the expression of the protein in mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132337 16194581 174781 10601 6081 INS insulin insulin 0 0.0 the localized expression of erk and insulin like growth factor 1 igf 1 and its receptor igf 1r was also assayed by immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132338 16194581 174781 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 the localized expression of erk and insulin like growth factor 1 igf 1 and its receptor igf 1r was also assayed by immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132341 16194581 174786 12355 6872 MAPK10 map kinase map kinase 0 1.0 the data indicated that bb supplementation increased hippocampal plasticity and cognitive performance via concerted mechanisms involving neurogenesis neurotrophic factor igf 1 and its receptor and map kinase signal transduction cascades. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 133283 16227974 175716 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 at least five separate genes that are associated with parkinson's disease have been identified including those encoding alpha synuclein parkin ubiquitin c terminal hydrolase 1 dj1 and pten induced kinase 1 pink1 refs 2 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133293 16227974 175760 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 2 +/ sod2 +/ mice which lack one copy of this mitochondrial antioxidant protein show an increased rate of atherosclerotic plaque formation 26 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134206 16242643 176951 10436 5991 IL1A interleukin 1 interleukin 1 0 0.0 in this sense tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134213 16242643 176972 551 399 ALB albumin albumin 0 0.0 tissues were incubated with trypsin for 20 min at 37_amp_#xb0;c and dissociated by trituration in a medium containing dnase bovine serum albumin and trypsin inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113437 16624679 147569 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 g93a cu/zn superoxide dismutase sod1 a human mutant sod1 associated with familial amyotrophic lateral sclerosis increased the toxicity of the mitochondrial toxin rotenone in the nsc 34 motoneuronal cell line. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113438 16624679 147574 11868 30922 LINS1 lines homolog 1 lines 1 0 1.0 in all the cell lines 1 h after rotenone exposure mitochondrial hyperpolarization was accompanied by the formation of a comparable amount of reactive oxygen species. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 113440 16624679 147589 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 some fals patients 20% have mutant forms of cu/zn superoxide dismutase sod1 a free radical scavenging enzyme that converts the superoxide anion radical generated during normal cell metabolism to o 2 and hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100383 16877542 128960 10601 6081 INS insulin insulin 0 0.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100384 16877542 128960 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100421 16877542 129047 10601 6081 INS insulin insulin 0 0.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100422 16877542 129047 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100461 16877542 129130 10601 6081 INS insulin insulin 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100462 16877542 129130 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100464 16877542 129130 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100466 16877542 129133 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 insights into its neurodegenerative mechanisms followed the discovery that dominant mutations in the gene for superoxide dismutase 1 sod1 cause familial als 2 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100469 16877542 129140 4848 30998 CPAT1 cerebral palsy cerebral palsy 0 1.0 such bystander cytotoxicity is thought to lead to the death of developing oligodendrocytes in periventricular leukomalacia 9 one of the most important causes of cerebral palsy. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 101478 16895581 130040 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ss 31 protected against cell death induced by hydrogen peroxide in vitro in neuronal cells stably transfected with either wild type or mutant cu/zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87991 17099894 113908 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 motor neuron degeneration in amyotrophic lateral sclerosis mutant superoxide dismutase 1 transgenic mice: mechanisms of mitochondriopathy and cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87993 17099894 113909 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the mechanisms of human mutant superoxide dismutase 1 msod1 toxicity to motor neurons mns are unresolved. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87997 17099894 113914 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87998 17099894 113914 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 0.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88223 17105868 114247 10601 6081 INS insulin insulin 0 0.0 surprisingly insulin like growth factor 1 prevents neuronal cell apoptosis and protects spinal motor neurons in als mice ryu et al. 1999 ; kaspar et al. 2003 but markedly potentiates neuronal cell necrosis induced by hyd 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88224 17105868 114247 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 surprisingly insulin like growth factor 1 prevents neuronal cell apoptosis and protects spinal motor neurons in als mice ryu et al. 1999 ; kaspar et al. 2003 but markedly potentiates neuronal cell necrosis induced by hydroxyl radical or gl 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88241 17105868 114357 1624 1033 BDNF neurotrophin neurotrophin 0 0.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; w 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74587 17174478 95194 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 ir hrdc helicase rnase d conserved domain mmr mismatch repair mrn mre11/rad50/nbs1 mtdna mitochondrial dna ner nucleotide excision repair no nitric oxide e i or nnos endothelial inducible or neuronal nitric oxide synthase nosox nos catalytic oxygenase module nosred nos reductase module nhej nonhomologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription cou 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74590 17174478 95195 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74593 17174478 95216 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74610 17174478 95288 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 0.0 nosred belongs to a large protein family including nadph dependent cytochrome p450 reductase and sulfite reductase flavoprotein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74633 17174478 95478 8901 21157 GTF2H5 trichothiodystrophy trichothiodystrophy 0 1.0 this includes patients with the rare genetic disorders xeroderma pigmentosum xp trichothiodystrophy ttd and cockayne syndrome cs . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 75285 17192933 96373 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 correction of humoral derangements from mutant superoxide dismutase 1 spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54604 17496232 67630 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 on the contrary lack of no disrupts pathways like s nitrosylation or h 2 o 2 production and likewise is a gateway to disease in amyotrophic lateral sclerosis with superoxide dismutase 1 mutations or to cancer proliferation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54608 17496232 67638 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 transcriptional increase of neuronal nitric oxide synthase nnos determines extensive binding to complex i and iv and contributes to hypothyroid phenotype. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54610 17496232 67641 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mw molecular weight; mnsod manganese superoxide dismutase; 2d two dimensional. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54611 17496232 67648 864 576 APAF1 apoptotic protease activating factor apoptotic protease activating factor 0 0.0 no and h 2 o 2 release and activation of intrinsic programmed cell death via apoptotic protease activating factor 1 and activation of p53. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54622 17496232 67705 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in the presence of mitochondrial manganese superoxide dismutase mnsod most of o 2 is dismutated to h 2 o 2 which is freely diffusible to cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54626 17496232 67729 23454 12435 TXN thioredoxin thioredoxin 0 0.0 otherwise enzymes that catabolize h 2 o 2 catalase gluthatione peroxidase gpx; reactions 6 and 7 and thioredoxin peroxidase trx; reaction 8 are preferentially distributed in cytosol and peroxisomes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54642 17496232 67853 864 576 APAF1 apoptotic protease activating factor apoptotic protease activating factor 0 0.0 in the intrinsic program mitochondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58551 17571960 73867 20478 11117 SMN1 spinal muscular atrophy spinal muscular atrophy 0 1.0 pathogenesis of neurodegeneration a multifaceted process that leads to various chronic disease states such as alzheimer's ad parkinson's pd huntington's hd diseases amyotrophic lateral sclerosis als spinal muscular atrophy sma and diabetic encephalopathy. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 59794 17584954 75259 551 399 ALB albumin albumin 0 0.0 the resulting pellet was washed once in modified chappell perry buffer with 0.5% bovine serum albumin and once in modified chappell perry buffer without bovine serum albumin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59796 17584954 75306 20478 11117 SMN1 spinal muscular atrophy spinal muscular atrophy 0 1.0 loss of motor neurons breakdown of neuromuscular junctions or inhibition of neural signaling occurs in many neuromuscular diseases including als or spinal cord injury 75 spinal muscular atrophy 56 diabetic neuropathy 72 and aging 6 41 48 and each of these situations is associated with muscle atrophy. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 59798 17584954 75313 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 for example genes encoding the mitochondrial respiratory chain and the tca cycle are significantly downregulated following denervation 48 60 66 and the levels of cytochrome c oxidase succinate dehydrogenase citrate synthase and cardiolipin are significantly lowered 8 14 days after denervation 18 82 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59802 17584954 75327 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 mitochondrial ros has also been shown to lead to upregulation of the expression of ubiquitin ligase atrogin 1/mafbx 53 and could therefore contribute to atrophy through increased degradation of proteins by the 26s proteasome system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49408 17634371 61548 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in motor neurons overexpressing the amyotrophic lateral sclerosis als linked superoxide dismutase 1 sod1 mutation ngf induced apoptosis even in the absence of an external source of no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49415 17634371 61557 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49416 17634371 61557 3889 11919 CD40 tumor necrosis factor receptor tumor necrosis factor receptor 0 0.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49425 17634371 61587 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 motor neuron survival was maintained by the addition of glial cell line derived neurotrophic factor gdnf 1 ng/ml; sigma to the culture media. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49429 17634371 61609 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 atcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaagatcctgaccgagcgtg 3' and 5' tctgctggaaggtggacagtgagg 3' 497 bp . p75 primers were from promega madison wi . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51662 17678953 64374 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 d in a final common pathway contributing to neuronal injury and death in a wide range of acute and chronic neurological disorders ranging from parkinson's disease pd amyotrophic lateral sclerosis als multiple sclerosis and alzheimer's disease ad to stroke and trauma. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 51664 17678953 64378 23469 20652 TXNDC15 disulfide isomerase disulfide isomerase 0 0.0 one such molecule affected is protein disulfide isomerase pdi an enzyme responsible for normal protein folding in the endoplasmic greticulum er . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51665 17678953 64382 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51666 17678953 64382 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 0.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40793 17719032 50852 20339 13448 SLC38A2 amino acid transporter 2 amino acid transporter 2 0 0.0 excitatory amino acid antagonists|excitatory amino acid transporter 2|glial fibrillary acidic protein|1 naphthylacetylspermine|spermine|sod1 g93a protein|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37371 17956327 46603 9749 5294 HTR2B 5 ht 5 ht 0 1.0 other notable models of synaptic plasticity exhibit similar pattern sensitivity including hippocampal long term potentiation and 5 ht 5 hydroxytryptamine dependent intermediate term facilitation or ltf in aplysia [ 12 13 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37372 17956327 46610 9749 5294 HTR2B 5 ht 5 ht 0 1.0 our understanding of the cellular/synaptic mechanisms of ltf has increased dramatically in recent years particularly for ltf in phrenic motor output pltf . pltf requires 5 ht [ 6 15 ] as well as adrenergic receptor activation [ 16 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37373 17956327 46611 9749 5294 HTR2B 5 ht 5 ht 0 1.0 specifically 5 ht 2a receptor activation is necessary during but not following aih suggesting that 5 ht receptor activation is necessary for its induction but not maintenance [ 15 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37374 17956327 46612 9749 5294 HTR2B 5 ht 5 ht 0 1.0 localized cervical c4 injections of 5 ht receptor antagonists attenuate pltf without any effect on hypoglossal ltf suggesting that the relevant 5 ht receptors for pltf are located in or near the phrenic motor nucleus [ 17 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37375 17956327 46613 9749 5294 HTR2B 5 ht 5 ht 0 1.0 since 5 ht 2a receptors in this region are predominantly expressed on phrenic motor neurons [ 18 19 ] these results suggest that the relevant 5 ht receptors are located post synaptically on phrenic motor neurons. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37376 17956327 46614 9749 5294 HTR2B 5 ht 5 ht 0 1.0 similar localized mechanisms may give rise to hypoglossal ltf since 5 ht 2a receptors are localized to hypoglossal motor neurons [ 20 ] 5 ht 2a receptor activation is necessary for hypoglossal ltf [ 15 ] and episodic 5 ht 2 receptor activation elicits hypoglossal ltf in in vitro brainstem slice preparations via post synaptic mechanisms [ 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37377 17956327 46614 9749 5294 HTR2B 5 ht 5 ht 0 1.0 2a receptor activation is necessary for hypoglossal ltf [ 15 ] and episodic 5 ht 2 receptor activation elicits hypoglossal ltf in in vitro brainstem slice preparations via post synaptic mechanisms [ 11 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37380 17956327 46617 9749 5294 HTR2B 5 ht 5 ht 0 1.0 the 5 ht dependent increase in bdnf synthesis following aih is necessary for pltf expression since translational inhibition of bdnf mrna with sirnas small interfering rnas blocks both increased bdnf protein l 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37381 17956327 46619 9749 5294 HTR2B 5 ht 5 ht 0 1.0 in our current working cellular/synaptic model of pltf aih triggers episodic 5 ht release near phrenic motor neurons initiating pltf by activating dendritic 5 ht 2a receptors. 5 ht receptor activation initiates signalling cascades [e.g. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37386 17956327 46634 9749 5294 HTR2B 5 ht 5 ht 0 1.0 for example 5 ht induced intermediate term facilitation and ltf in aplysia which are normally elicited only by three to five episodic 5 ht exposures are elicited by a single 5 ht exposure with protein phosphatase 2b inhibition [ 30 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37388 17956327 46645 9749 5294 HTR2B 5 ht 5 ht 0 1.0 bition of okadaic acid sensitive protein phosphatases is not sufficient to facilitate phrenic motor output [ 22 ]. pltf following sustained hypoxia with spinal protein phosphatase inhibition requires 5 ht receptor activation suggesting that aih and sustained hypoxia with phosphatase inhibition represent the same mechanism [ 44 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37396 17956327 46685 9749 5294 HTR2B 5 ht 5 ht 0 1.0 key words: brain derived neurotrophic factor bdnf 5 hydroxytryptamine 5 ht long term facilitation pattern sensitivity phosphorylation plasticity. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37403 17956327 46686 9749 5294 HTR2B 5 ht 5 ht 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropom 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 22669 18210200 26873 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 in neurodegenerative diseases such as alzheimer_amp_#8217;s diseases ad parkinson_amp_#8217;s diseases pd and multiple sclerosis patients experience symptoms related to movement memory and dementia due to the gradual loss of neurons. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 22684 18210200 27089 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 these diseases would collectively benefit from immunomodulation neurotrophic factors such as glial derived neurotrophic factor or brain derived neurotrophic factor and in the case of hiv 1 disease anti retroviral therapy kabanov and gendelman 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23837 18219386 28381 19504 10604 SCO2 yeast homolog 2 yeast 2 0 1.0 it is puzzling why multiple earlier screens for sod1 interacting proteins including yeast 2 hybrid approaches did not identify rac1. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 15800 18308427 18634 551 399 ALB albumin albumin 0 0.0 g the method of brehe and burch 1976 with minor modifications. 200 _amp_#x3bc;l of 0.01n hcl was mixed with dtnb containing buffer 110 mm na 2 hpo 4 40 mm nah 2 po 4 15 mm edta 0.04% w/v bovine serum albumin bsa and 0.3 mm dtnb. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9666 18414597 11018 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9669 18414597 11021 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is an autoimmune inflammatory demyelinating condition of the cns. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 9763 18422522 11246 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 endothelial nitric oxide synthase overexpression by neuronal cells in neurodegeneration: a link between inflammation and neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9765 18422522 11247 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 the roles of neuronal and inducible nitric oxide synthases in neurones have been extensively investigated; by contrast the biological significance of endothelial nitric oxide synthase enos overexpression that occurs in several pathological conditions has not yet been studied. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2050 18751914 3068 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2053 18751914 3064 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is an autoimmune inflammatory demyelinating condition of the cns. 7 SciMiner_v2.2 2 0 1 0 0 0 0 0 0 0