#sen2geneID pmid senID geneID hgncID approvedSymbol matchString actualString startPos score flankingText matchCodeID tag SciMinerVersion SciMinerMethod inExClude inExCludeCond phenotypeOnly conflictCode hgncIDbyNR NRText editTag editUser oldGeneID oldHgncID oldApprovedSymbol oldInExClude oldInExCludeCond 297132 8841988 424208 20996 11179 SOD1 SOD SOD 8 1.4 We measured the antioxidant actions of superoxide dismutase (SOD), SOD glutathione peroxidase (GSH-Px), GSH-Px and cytochrome c oxidase (CO) CO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 297134 8841988 424209 20996 11179 SOD1 SOD SOD 1 1.4 Total SOD activity in spinal cord transections from patients with sporadic ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 297266 8899665 424393 20996 11179 SOD1 SOD1 SOD1 32 1.2 the same patients was examined for superoxide dismutase 1 (SOD1) SOD1 mutations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 297267 8899665 424397 20996 11179 SOD1 SOD1 SOD1 3 1.2 The search for SOD1 mutations by linkage study and cycle sequencing proved negative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 297268 8899665 424398 20996 11179 SOD1 SOD1 SOD1 6 1.2 We did not find evidence for SOD1 mutations by either method of study 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 296646 8910880 423319 926 620 APP amyloid amyloid 29 1.3 damage aberrant calcium homeostasis metabolic compromise and under certain circumstances amyloid precursor protein mismetabolism 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 295073 8922414 420715 14452 14374 NLRP1 NAC NAC 22 0.3 the effects of agents such as N -acetyl-L -cysteine (NAC), NAC which reduce free radical damage 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295075 8922414 420716 14452 14374 NLRP1 NAC NAC 13 0.3 mice were given a 1% solution of the glutathione precursor NAC in their drinking water for a period of 9 weeks 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295076 8922414 420717 14452 14374 NLRP1 NAC NAC 13 0.3 examination of these animals revealed that wobbler mice treated with NAC exhibited (1) 1 a significant reduction in motor neuron loss 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295077 8922414 420718 14452 14374 NLRP1 NAC NAC 25 0.3 neurons in wobbler mice and demonstrate that oral administration of NAC effectively reduces the degree of motor degeneration in wobbler mice 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295083 8922414 420726 14452 14374 NLRP1 NAC NAC 6 0.3 The compound N -acetyl-L -cysteine (NAC) NAC has been shown to inhibit ROS thus increasing the viability 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295085 8922414 420727 14452 14374 NLRP1 NAC NAC 3 0.3 In vivo NAC also has been shown to reduce the toxicity of compounds 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295086 8922414 420728 14452 14374 NLRP1 NAC NAC 6 0.3 In humans extensive clinical experience with NAC suggests that it is a compound of low toxicity most 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295087 8922414 420729 14452 14374 NLRP1 NAC NAC 0 0.3 NAC seems to exert these effects by acting directly as an 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295089 8922414 420737 14452 14374 NLRP1 NAC NAC 5 0.3 To examine the effects of NAC on motor neuron degeneration in vivo we treated wobbler mice 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295090 8922414 420737 14452 14374 NLRP1 NAC NAC 20 0.3 degeneration in vivo we treated wobbler mice per os with NAC over a period of 9 weeks 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295091 8922414 420738 14452 14374 NLRP1 NAC NAC 4 0.3 The results demonstrate that NAC treatment reduces the decline in several important morphological and functional 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295093 8922414 420793 14452 14374 NLRP1 NAC NAC-treated 13 0.3 solutions were adjusted to the same pH and molarity as NAC-treated animals (61.2 61.2 m M and served as control agents 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295094 8922414 420796 14452 14374 NLRP1 NAC NAC-treated 1 0.3 Four-week-old NAC-treated mice drank an average of 3.4 _amp_#177 0.6 ml per 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295095 8922414 420797 14452 14374 NLRP1 NAC NAC 4 0.3 The mean quantity of NAC ingested was ~2.3 mg/gm mg gm body weight 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295096 8922414 420799 14452 14374 NLRP1 NAC NAC 4 0.3 The mean quantity of NAC received was 2.1 mg/gm mg gm body weight 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295097 8922414 420802 14452 14374 NLRP1 NAC NAC-treated 3 0.3 Even within the NAC-treated group the distinction between wr/wr wr wr and NW mice 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295098 8922414 420816 14452 14374 NLRP1 NAC NAC-treated 18 0.3 of the facial nerve for wr/wr wr wr NW and NAC-treated wr/wr wr wr and NW mice is shown in Figure 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295099 8922414 420818 14452 14374 NLRP1 NAC NAC-treated 1 0.3 In NAC-treated wr/wr wr wr mice [wr/wr(N)] wr wr N this reduction 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295100 8922414 420820 14452 14374 NLRP1 NAC NAC 35 0.3 nerve as compared with NW controls wobbler animals treated with NAC do not show this loss of motor axons instead giving 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295101 8922414 420832 14452 14374 NLRP1 NAC NAC-treated 12 0.3 the distribution of axon areas in wr/wr wr wr and NAC-treated wr/wr wr wr mice respectively 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295102 8922414 420835 14452 14374 NLRP1 NAC NAC-treated 2 0.3 In contrast NAC-treated wobbler mice do not show a marked reduction in axon 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295103 8922414 420837 14452 14374 NLRP1 NAC NAC 13 0.3 the wobbler controls are significantly different from both the wr NAC treatment and NW groups pair-wise comparisons wr/wr wr wr vs 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295104 8922414 420839 14452 14374 NLRP1 NAC NAC 12 0.3 given above demonstrate that oral treatment of wobbler mice with NAC can reduce significantly the degree of axonal atrophy and loss 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295105 8922414 420842 14452 14374 NLRP1 NAC NAC 5 0.3 To examine the effects of NAC on neuromuscular aspects of the forelimb we took 10 micro 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295106 8922414 420845 14452 14374 NLRP1 NAC NAC 28 0.3 neurons by 9 weeks of age wobbler mice treated with NAC exhibited significantly greater numbers of ChAT-positive neurons than wr/wr wr 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295107 8922414 420846 14452 14374 NLRP1 NAC NAC-wobbler 1 0.3 However NAC-wobbler mice still exhibited a substantial loss of ChAT-positive neurons as 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295108 8922414 420848 14452 14374 NLRP1 NAC NAC 5 0.3 To determine the effects of NAC treatment on the innervation targets of these spinal motor neurons 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295109 8922414 420849 14452 14374 NLRP1 NAC NAC 10 0.3 As shown in Figure 4 A B animals treated with NAC show a significant increase in the overall mass of the 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295110 8922414 420850 14452 14374 NLRP1 NAC NAC 3 0.3 Thus treatment with NAC reduces the degree of overt muscular atrophy that is induced 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295111 8922414 420851 14452 14374 NLRP1 NAC NAC 7 0.3 To delineate more clearly the effects of NAC on muscle morphology within the distal forelimb we determined cross-sectional 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295112 8922414 420852 14452 14374 NLRP1 NAC NAC 13 0.3 shown in Figure 4 C indicate that animals treated with NAC show a marked increase in mean fiber area (~603 ~603 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295113 8922414 420854 14452 14374 NLRP1 NAC NAC 7 0.3 These data demonstrate that oral administration of NAC can reduce significantly motor neuron loss and axonal atrophy in 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295114 8922414 420858 14452 14374 NLRP1 NAC NAC 8 0.3 These results demonstrate that although wobbler mice receiving NAC do exhibit a significant reduction in forelimb function they perform 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295115 8922414 420859 14452 14374 NLRP1 NAC NAC 6 0.3 These data suggest that treatment with NAC does result in some reduction in the functional losses that 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295116 8922414 420861 14452 14374 NLRP1 NAC NAC 5 0.3 Previous work has suggested that NAC acts in part by increasing intracellular supplies of cysteine the 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295117 8922414 420864 14452 14374 NLRP1 NAC NAC 5 0.3 To determine the ability of NAC to enhance the free-radical scavenging ability of the GPx system 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295118 8922414 420866 14452 14374 NLRP1 NAC NAC 9 0.3 As shown in Figure 6 animals that received NAC in their drinking water exhibited a substantial increase in GPx 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295119 8922414 420867 14452 14374 NLRP1 NAC NAC 16 0.3 similar to that of NW mice that did not receive NAC supplementation 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295120 8922414 420868 14452 14374 NLRP1 NAC NAC 6 0.3 To further assess the ability of NAC to effect GPx activity levels in non-wobbler mice we injected 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295121 8922414 420868 14452 14374 NLRP1 NAC NAC 28 0.3 (glucose glucose treatment group daily with 1 mg/gm mg gm NAC for 3 d before the analysis 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295122 8922414 420870 14452 14374 NLRP1 NAC NAC 6 0.3 These results demonstrate the ability of NAC to enhance antioxidant activity in tissues affected by the wobbler 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295123 8922414 420873 14452 14374 NLRP1 NAC NAC 8 0.3 The results demonstrate that daily oral administration of NAC significantly reduces the degeneration of lower motor neurons in wobbler 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295124 8922414 420874 14452 14374 NLRP1 NAC NAC 9 0.3 For motor axons of the facial nerve application of NAC resulted in a generalized increase in axon number and caliber 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295125 8922414 420875 14452 14374 NLRP1 NAC NAC 5 0.3 Within the cervical spinal cord NAC reduced losses of choline acetyltransferase-positive neurons 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295129 8922414 420881 14452 14374 NLRP1 NAC NAC 0 0.3 NAC has been shown previously in several of these paradigms to 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295130 8922414 420882 14452 14374 NLRP1 NAC NAC 3 0.3 The ability of NAC to reduce the loss of these lower motor neurons in 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295131 8922414 420882 14452 14374 NLRP1 NAC NAC 39 0.3 in the cervical spinal cord suggests a means by which NAC may act to reduce local ROS levels 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295133 8922414 420883 14452 14374 NLRP1 NAC NAC 5 0.3 Previous work also demonstrates that NAC directly supports glutathione synthesis in neural cells thus reducing intracellular 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295135 8922414 420884 14452 14374 NLRP1 NAC NAC 4 0.3 These data suggest that NAC may exert survival-promoting effects in a manner independent of its 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295136 8922414 420885 14452 14374 NLRP1 NAC NAC 0 0.3 NAC has been used previously in a limited trial over a 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295137 8922414 420886 14452 14374 NLRP1 NAC NAC 11 0.3 no net clinical improvement was observed in patients treated with NAC segregation of ALS cases into bulbar and limb onset groups 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295140 8922414 420887 14452 14374 NLRP1 NAC NAC 6 0.3 In ALS cases of bulbar onset NAC did not improve survival 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295141 8922414 420888 14452 14374 NLRP1 NAC NAC 8 0.3 However in patients with the limb onset form NAC does seem to improve survival (NAC NAC 74% 28/38; 28 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295142 8922414 420888 14452 14374 NLRP1 NAC NAC 14 0.3 limb onset form NAC does seem to improve survival (NAC NAC 74% 28/38; 28 38 vehicle 51% 22/43) 22 43 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295143 8922414 420890 14452 14374 NLRP1 NAC NAC 10 0.3 It is interesting to speculate that the differential availability of NAC to these two neural populations may underlie the differences in 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295147 8922414 420893 4649 2169 CNTF CNTF CNTF 14 0.3 wobbler mice has been treated previously with a combination of CNTF (1 1 mg/kg) mg kg and BDNF (5 5 mg/kg) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295148 8922414 420893 1624 1033 BDNF BDNF BDNF 18 0.3 a combination of CNTF (1 1 mg/kg) mg kg and BDNF (5 5 mg/kg) mg kg by subcutaneous injection three times 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295149 8922414 420895 14452 14374 NLRP1 NAC NAC 34 0.3 function over a similar time frame than those treated with NAC 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295150 8922414 420897 14452 14374 NLRP1 NAC NAC 8 0.3 For example to be accessible to motor neurons NAC must be taken up via contact with somatic tissue through 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295151 8922414 420898 14452 14374 NLRP1 NAC NAC 3 0.3 Oral administration of NAC does result in enhanced GPx activity in the cervical spinal 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295152 8922414 420899 14452 14374 NLRP1 NAC NAC 26 0.3 axonal transport may be impaired in their ability to accumulate NAC and its metabolites thus limiting its potential therapeutic effects 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295153 8922414 420902 14452 14374 NLRP1 NAC NAC 8 0.3 In addition it is important to realize that NAC may be affecting only a portion of the pathways involved 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295154 8922414 420904 14452 14374 NLRP1 NAC NAC 8 0.3 Despite this the use of agents such as NAC would seem to be a practical approach to enhancing cell 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295155 8922414 420905 14452 14374 NLRP1 NAC NAC 20 0.3 intrathecal implantation of proteins which are quite labile in vivo NAC can be given per os over dispersed intervals 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295156 8922414 420906 14452 14374 NLRP1 NAC NAC 0 0.3 NAC is also an inexpensive drug possessing few side effects and 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295157 8922414 420907 14452 14374 NLRP1 NAC NAC 19 0.3 to that of several human neurodegenerative disorders the application of NAC may prove useful in treating other mammalian neurodegenerative diseases 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295158 8922414 420916 14452 14374 NLRP1 NAC NAC 0 0.3 NAC reduces axonal loss in wobbler facial nerve 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295159 8922414 420920 14452 14374 NLRP1 NAC NAC-treated 6 0.3 Control-treated wr/wr wr wr mice n = 17 NAC-treated wr/wr wr wr mice n = 11 NW mice n 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295161 8922414 420924 14452 14374 NLRP1 NAC NAC 0 0.3 NAC prevents losses in axon caliber in wobbler mice 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295162 8922414 420928 14452 14374 NLRP1 NAC NAC-treated 5 0.3 C Axon distribution of NAC-treated wr/wr wr wr mice n = 6 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295164 8922414 420933 14452 14374 NLRP1 NAC NAC 0 0.3 NAC reduces the loss of ChAT-positive neurons in the cervical spinal 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295166 8922414 420938 14452 14374 NLRP1 NAC NAC 0 0.3 NAC reduces the atrophy of forelimb muscles in wobbler mice 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295168 8922414 420951 14452 14374 NLRP1 NAC NAC 0 0.3 NAC reduces functional losses in the forelimb of wobbler mice 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 295170 8922414 420959 14452 14374 NLRP1 NAC NAC 0 0.3 NAC treatment augments glutathione peroxidase (GPx) GPx levels in the cervical 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 297782 9044305 425433 20996 11179 SOD1 SOD SOD 10 0.9 supports the concept that decreases in Cu Zn-superoxide dismutase (SOD) SOD activity causes apoptotic cell death in neuronal cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294099 9092140 418549 20996 11179 SOD1 SOD SOD 0 1.4 SOD research is an important step for a better understanding of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294637 9172131 419812 878 587 APEX1 APE APE 12 3.9 of the pivotal BER protein apurinic/apyrimidinic apurinic apyrimidinic endonuclease (APE) APE were determined in 11 patients with sporadic ALS and six 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294639 9172131 419813 878 587 APEX1 APE APE 0 3.9 APE levels ( p _amp_#60 0.003 and activity ( p _amp_#60 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294644 9172131 419815 20996 11179 SOD1 SOD1 SOD1 65 2.9 major cellular antioxidant enzyme Cu/Zn Cu Zn superoxide dismutase (SOD1) SOD1 in familial ALS subjects 3 has initiated an intense investigation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294650 9172131 419817 20996 11179 SOD1 SOD1 SOD1 44 2.9 fewer than 20_amp_#37 of familial ALS cases map to the SOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294655 9172131 419821 878 587 APEX1 APE APE 43 3.9 abasic site is repaired by apurinic/apyrimidinic apurinic apyrimidinic endonuclease (APE) APE 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294656 9172131 419822 878 587 APEX1 APE APE 0 3.9 APE the pivotal step in BER is found in both the 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294657 9172131 419822 878 587 APEX1 APE APE 26 3.9 mitochondria (~65 ~65 kDa 10 A reduction or loss of APE would be extremely detrimental to a neuron and could conceivably 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294659 9172131 419823 878 587 APEX1 APE APE 0 3.9 APE is a bifunctional protein with separate domains for DNA repair 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294660 9172131 419824 878 587 APEX1 APE APE 1 3.9 Therefore APE possesses multiple cellular functions and its deficiency could have profound 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294661 9172131 419825 878 587 APEX1 APE APE 5 3.9 In fact lack of the APE gene is lethal to embryonic mutant mice (gestational gestational day 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294662 9172131 419826 878 587 APEX1 APE APE 10 3.9 The present study aimed to determine whether the BER protein APE is deficient in the brains of ALS subjects 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294666 9172131 419832 878 587 APEX1 APE APE 0 3.9 APE levels were determined in human brain tissue extracts and compared 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294667 9172131 419832 878 587 APEX1 APE APE 24 3.9 of HeLa cells (positive positive control and with recombinant human APE (a a hist_amp_#237 dine-tagged full-length human protein provided by Dr 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294669 9172131 419840 878 587 APEX1 APE APE 0 3.9 APE activity was determined in human brain tissue extracts by measuring 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294671 9172131 419844 878 587 APEX1 APE APE 0 3.9 APE levels and activity (ability ability to repair apurinic sites in 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294673 9172131 419845 878 587 APEX1 APE APE 10 3.9 There was no significant correlation between post mortem interval and APE levels in control ( r _amp_#61 _amp_#45 0.5 or ALS 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294675 9172131 419846 878 587 APEX1 APE APE 1 3.9 Cortical APE levels were reduced by 3-4_amp_#215 3 ( p _amp_#60 0.003 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294678 9172131 419847 13410 7211 MPG MPG MPG 38 1.1 to the human BER protein N -methylpurine DNA glycosylase (MPG) MPG and purified human MPG (positive positive control (both both provided 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294679 9172131 419847 13410 7211 MPG MPG MPG 42 1.1 protein N -methylpurine DNA glycosylase (MPG) MPG and purified human MPG (positive positive control (both both provided by Dr Sankar Mitra 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294680 9172131 419848 878 587 APEX1 APE APE 3 3.9 In contrast to APE levels cortical MPG levels in ALS subjects were not significantly 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294681 9172131 419848 13410 7211 MPG MPG MPG 6 1.1 In contrast to APE levels cortical MPG levels in ALS subjects were not significantly different ( p 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294683 9172131 419850 878 587 APEX1 APE APE 1 3.9 Like APE levels APE activity was significantly lower ( p _amp_#60 0.000007 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294684 9172131 419850 878 587 APEX1 APE APE 3 3.9 Like APE levels APE activity was significantly lower ( p _amp_#60 0.000007 in ALS 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294689 9172131 419852 13410 7211 MPG MPG MPG 41 1.1 removed by a DNA glycosylase (e.g e.g formamidopyrimidine DNA glycosylase MPG 20 21 and the resulting apurinic site repaired by APE 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294690 9172131 419852 878 587 APEX1 APE APE 50 3.9 MPG 20 21 and the resulting apurinic site repaired by APE 8-Oxodeoxyguanosine levels are elevated in ALS spinal cord tissue 6 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294693 9172131 419853 878 587 APEX1 APE APE 11 3.9 from the present studies indicate that the pivotal BER protein APE is severely deficient in ALS brain tissue 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294695 9172131 419854 13410 7211 MPG MPG MPG 10 1.1 The lack of a similar reduction in the BER protein MPG in ALS brain tissue suggests a selective abnormality in APE 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294697 9172131 419854 878 587 APEX1 APE APE 20 3.9 MPG in ALS brain tissue suggests a selective abnormality in APE 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294698 9172131 419855 878 587 APEX1 APE APE 1 3.9 Interestingly APE activity has also been examined in lymphocytes from patients with 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294700 9172131 419855 878 587 APEX1 APE APE 35 3.9 a double-stranded oligonucleotide probe containing a single AP site 22 APE activity was shown to be similarly reduced in lymphocytes of 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294702 9172131 419856 878 587 APEX1 APE APE 4 3.9 A similar reduction of APE in both ALS brain and lymphocyte tissue 22 suggests that 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294704 9172131 419856 878 587 APEX1 APE APE 28 3.9 deficit is systemic and possibly due to an abnormality in APE regulation or a gene mutation 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 294705 9172131 419857 878 587 APEX1 APE APE 4 3.9 Detection of several missense APE gene mutations 22 in lymphocyte DNA from patients with sporadic 1 JUMiner_v2.2 1 0 0 2 587 TotalCon:2<>587|APEX1|328|Complete__25523|CCDC88A|55704|Complete__<>AvaiableGeneRif=2<>BEST:587|APEX1|0.00120378405049938<>ScoreDetail__25523|CCDC88A|0.000799200799200799__587|APEX1|0.00120378405049938__ 0 0 0 0 0 293238 9337068 416912 926 620 APP amyloid amyloid 20 1.3 disease has not been reached yet the involvement of the amyloid precursor protein (APP) APP and betaA4 (A A beta in 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 293239 9337068 416912 926 620 APP APP APP 23 0.6 reached yet the involvement of the amyloid precursor protein (APP) APP and betaA4 (A A beta in the pathologic changes advances 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293240 9337068 416914 926 620 APP APP APP 34 0.6 oxidation and that free oxygen radicals may be involved in APP metabolism 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293241 9337068 416917 926 620 APP APP APP 9 0.6 reduction of Cu(II) Cu II to Cu(I) Cu I by APP involves an electron-transfer reaction and could also lead to a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 291075 9462746 412767 20996 11179 SOD1 SOD SOD 8 0.9 We report that treatment with the superoxide dismutase (SOD) SOD mimetic Manganese 5 10 15 20-tetrakis (4-benzoic 4-benzoic acid porphyrin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 289757 9620775 410130 20996 11179 SOD1 SOD1 SOD1 8 2.0 Extension of Drosophila lifespan by overexpression of human SOD1 in motorneurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 289758 9620775 410133 20996 11179 SOD1 SOD1 SOD1 16 2.0 encoding the oxygen radical metabolizing enzyme CuZn superoxide dismutase (SOD1) SOD1 and loss of motorneurons in the brain and spinal cord 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 289759 9620775 410134 20996 11179 SOD1 SOD1 SOD1 11 2.0 test this hypothesis we generated transgenic Drosophila which express human SOD1 specifically in adult motorneurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 289760 9620775 410135 20996 11179 SOD1 SOD1 SOD1 8 2.0 We show that overexpression of a single gene SOD1 in a single cell type the motorneuron extends normal lifespan 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 289761 9620775 410137 20996 11179 SOD1 SOD SOD 4 1.7 These results show that SOD activity in motorneurons is an important factor in ageing and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290126 9633809 410560 20996 11179 SOD1 ALS ALS 17 2.2 disease onset and progression in a transgenic model of familial ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124993433595886<>ScoreDetail__5468|IGFALS|0.000593615337261455__11179|SOD1|0.00124993433595886__ 0 0 0 0 0 290127 9633809 410561 20996 11179 SOD1 SOD1 SOD1 11 2.2 that highly over-express a mutated human CuZn superoxide dismutase (SOD1) SOD1 gene gly93-->ala TgN(SOD1-G93A)G1H TgN SOD1-G93A G1H line found in some 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290129 9633809 410561 20996 11179 SOD1 ALS ALS 22 2.2 TgN SOD1-G93A G1H line found in some patients with familial ALS (FALS) FALS have been shown to develop motor neuron disease 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124993433595886<>ScoreDetail__5468|IGFALS|0.000593615337261455__11179|SOD1|0.00124993433595886__ 0 0 0 0 0 290130 9633809 410562 20996 11179 SOD1 SOD SOD 3 2.2 The mutant Cu Zn SOD exhibits essentially normal SOD activity but also generates toxic oxygen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290131 9633809 410562 20996 11179 SOD1 SOD SOD 7 2.2 The mutant Cu Zn SOD exhibits essentially normal SOD activity but also generates toxic oxygen radicals as a result 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 285031 9675268 403182 12261 6817 MAL MAL MAL-6-linked 12 0.6 in our laboratory of the W / S ratio of MAL-6-linked synaptosomal membrane following 4-HNE treatment have shown that this toxic 11 JUMiner_v2.2 1 0 0 2 6817 TotalCon:3<>6817|MAL|4118|Complete__14334|MKL1|57591|Complete__1706|CD8A|925|Complete__<>AvaiableGeneRif=3<>BEST:6817|MAL|0.000487439070116235<>ScoreDetail__1706|CD8A|0.000319447248581107__6817|MAL|0.000487439070116235__14334|MKL1|0.000361682019572943__ 0 0 0 0 0 285032 9675268 403182 12261 6817 MAL MAL MAL-6-spin 44 0.6 as monitored by a reduced W / S ratio of MAL-6-spin labeled synaptosomal membranes 36 11 JUMiner_v2.2 1 0 0 2 6817 TotalCon:3<>6817|MAL|4118|Complete__14334|MKL1|57591|Complete__1706|CD8A|925|Complete__<>AvaiableGeneRif=3<>BEST:6817|MAL|0.000487439070116235<>ScoreDetail__1706|CD8A|0.000319447248581107__6817|MAL|0.000487439070116235__14334|MKL1|0.000361682019572943__ 0 0 0 0 0 285035 9675268 403189 12261 6817 MAL MAL MAL-6-labeled 24 0.6 generation 21 in which the W / S ratio of MAL-6-labeled neocortical or erythrocyte membranes was reduced 21 30 31 32 11 JUMiner_v2.2 1 0 0 2 6817 TotalCon:3<>6817|MAL|4118|Complete__14334|MKL1|57591|Complete__1706|CD8A|925|Complete__<>AvaiableGeneRif=3<>BEST:6817|MAL|0.000487439070116235<>ScoreDetail__1706|CD8A|0.000319447248581107__6817|MAL|0.000487439070116235__14334|MKL1|0.000361682019572943__ 0 0 0 0 0 285039 9675268 403196 926 620 APP amyloid amyloid 29 1.0 and peptides (e.g e.g nitric oxide synthase xanthine oxidase _amp_#x3b2 -amyloid etc. present in the brain 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 286907 9745361 405674 20017 10940 SLC1A2 GLT1 GLT1 19 2.3 in the structures of at least three transporter subtypes (GLT1, GLT1 GLAST and EAAC1 and shown to regulate transport rate via 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286908 9745361 405674 20018 10941 SLC1A3 GLAST GLAST 20 2.5 the structures of at least three transporter subtypes (GLT1, GLT1 GLAST and EAAC1 and shown to regulate transport rate via thiol-disulphide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286909 9745361 405674 20016 10939 SLC1A1 EAAC1 EAAC1 22 3.0 of at least three transporter subtypes (GLT1, GLT1 GLAST and EAAC1 and shown to regulate transport rate via thiol-disulphide redox interconversion 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286910 9745361 405679 20018 10941 SLC1A3 GLAST GLAST 15 2.5 (or or excitatory amino acid carriers have now been identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286911 9745361 405679 20018 10941 SLC1A3 EAAT1 EAAT1 16 2.5 excitatory amino acid carriers have now been identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286912 9745361 405679 20017 10940 SLC1A2 GLT1 GLT1 17 2.3 amino acid carriers have now been identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs Refs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286913 9745361 405679 20017 10940 SLC1A2 EAAT2 EAAT2 18 1.5 carriers have now been identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs Refs 1 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286914 9745361 405679 20016 10939 SLC1A1 EAAC1 EAAC1 19 3.0 have now been identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs Refs 1 2 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286915 9745361 405679 20016 10939 SLC1A1 EAAT3 EAAT3 20 2.5 been identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs Refs 1 2 3 4 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286916 9745361 405679 20021 10944 SLC1A6 EAAT4 EAAT4 21 1.0 identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs Refs 1 2 3 4 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286917 9745361 405679 20022 10945 SLC1A7 EAAT5 EAAT5 21 1.0 identified GLAST (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs Refs 1 2 3 4 5 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286918 9745361 405679 20022 10945 SLC1A7 EAAT5 EAAT5 23 1.0 (EAAT1), EAAT1 GLT1 (EAAT2), EAAT2 EAAC1 (EAAT3), EAAT3 EAAT4 and EAAT5 (Refs Refs 1 2 3 4 5 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286919 9745361 405686 20021 10944 SLC1A6 EAAT4 EAAT4 0 1.0 EAAT4 and EAAT5 have the highest Cl _amp_#x2212 conductances 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286920 9745361 405686 20022 10945 SLC1A7 EAAT5 EAAT5 0 1.0 EAAT4 and EAAT5 have the highest Cl _amp_#x2212 conductances 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286921 9745361 405686 20022 10945 SLC1A7 EAAT5 EAAT5 2 1.0 EAAT4 and EAAT5 have the highest Cl _amp_#x2212 conductances 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286922 9745361 405687 20017 10940 SLC1A2 GLT1 GLT1 6 2.3 In studies to localize the isoforms GLT1 and GLAST appear to be restricted to brain astrocytes 11 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286923 9745361 405687 20018 10941 SLC1A3 GLAST GLAST 8 2.5 In studies to localize the isoforms GLT1 and GLAST appear to be restricted to brain astrocytes 11 12 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286924 9745361 405688 20017 10940 SLC1A2 GLT1 GLT1 0 2.3 GLT1 is the most abundant glutamate transporter and represents about 1% 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286925 9745361 405689 20018 10941 SLC1A3 GLAST GLAST 4 2.5 The highest concentration of GLAST is found in the Bergmann glia of the cerebellar molecular 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286926 9745361 405690 20017 10940 SLC1A2 GLT1 GLT1 3 2.3 In astrocytic membranes GLT1 and GLAST localize preferentially to the parts of the plasma 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286927 9745361 405690 20018 10941 SLC1A3 GLAST GLAST 5 2.5 In astrocytic membranes GLT1 and GLAST localize preferentially to the parts of the plasma membrane that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286928 9745361 405691 20017 10940 SLC1A2 GLT1 GLT1 4 2.3 Moreover the expression of GLT1 and GLAST is under the control of neuronal soluble factors 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286929 9745361 405691 20018 10941 SLC1A3 GLAST GLAST 6 2.5 Moreover the expression of GLT1 and GLAST is under the control of neuronal soluble factors including glutamate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286930 9745361 405692 20016 10939 SLC1A1 EAAC1 EAAC1 4 3.0 In the brain the EAAC1 protein and mRNA are found in neurones 15 16 where 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286931 9745361 405693 20016 10939 SLC1A1 EAAC1 EAAC1 0 3.0 EAAC1 is not restricted to glutamatergic neurones and has now also 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286932 9745361 405694 20021 10944 SLC1A6 EAAT4 EAAT4 3 1.0 The fourth subtype EAAT4 is concentrated in the spines of Purkinje cells predominantly extrasynaptically 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286933 9745361 405695 20022 10945 SLC1A7 EAAT5 EAAT5 0 1.0 EAAT5 appears to be a retinal protein 5 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286934 9745361 405710 20017 10940 SLC1A2 GLT1 GLT1 19 2.3 tissue damage resulted from loss of the glial transporters particularly GLT1 (Ref Ref 25 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286935 9745361 405711 20017 10940 SLC1A2 GLT1 GLT1 4 2.3 Indeed knockout mice lacking GLT1 undergo lethal spontaneous seizures increased susceptibility to acute brain injury 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286936 9745361 405712 20016 10939 SLC1A1 EAAC1 EAAC1-knockout 2 2.5 In contrast EAAC1-knockout mice develop dicarboxylic aminoaciduria and no sign of neurodegeneration during 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286937 9745361 405727 20017 10940 SLC1A2 GLT1 GLT1 5 2.3 Indeed the transport activities of GLT1 EAAC1 and GLAST are equally inhibited by oxidants via a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286938 9745361 405727 20016 10939 SLC1A1 EAAC1 EAAC1 6 3.0 Indeed the transport activities of GLT1 EAAC1 and GLAST are equally inhibited by oxidants via a direct 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286939 9745361 405727 20018 10941 SLC1A3 GLAST GLAST 8 2.5 Indeed the transport activities of GLT1 EAAC1 and GLAST are equally inhibited by oxidants via a direct action on 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286940 9745361 405742 20016 10939 SLC1A1 EAAC1 EAAC1 0 3.0 EAAC1 GLT1 and GLAST exhibit redox-sensing properties 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286941 9745361 405742 20017 10940 SLC1A2 GLT1 GLT1 1 2.3 EAAC1 GLT1 and GLAST exhibit redox-sensing properties 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286942 9745361 405742 20018 10941 SLC1A3 GLAST GLAST 3 2.5 EAAC1 GLT1 and GLAST exhibit redox-sensing properties 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286943 9745361 405743 20021 10944 SLC1A6 EAAT4 EAAT4 7 1.0 At present no information is available for EAAT4 and EAAT5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286944 9745361 405743 20022 10945 SLC1A7 EAAT5 EAAT5 7 1.0 At present no information is available for EAAT4 and EAAT5 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286945 9745361 405743 20022 10945 SLC1A7 EAAT5 EAAT5 9 1.0 At present no information is available for EAAT4 and EAAT5 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286946 9745361 405745 20016 10939 SLC1A1 EAAC1 EAAC1 0 3.0 EAAC1 GLAST GLT1 EAAT4 and EAAT5 carry different cysteine residues in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286947 9745361 405745 20018 10941 SLC1A3 GLAST GLAST 1 2.5 EAAC1 GLAST GLT1 EAAT4 and EAAT5 carry different cysteine residues in their 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286948 9745361 405745 20017 10940 SLC1A2 GLT1 GLT1 2 2.3 EAAC1 GLAST GLT1 EAAT4 and EAAT5 carry different cysteine residues in their sequences 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286949 9745361 405745 20021 10944 SLC1A6 EAAT4 EAAT4 3 1.0 EAAC1 GLAST GLT1 EAAT4 and EAAT5 carry different cysteine residues in their sequences ranging 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286950 9745361 405745 20022 10945 SLC1A7 EAAT5 EAAT5 3 1.0 EAAC1 GLAST GLT1 EAAT4 and EAAT5 carry different cysteine residues in their sequences ranging 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286951 9745361 405745 20022 10945 SLC1A7 EAAT5 EAAT5 5 1.0 EAAC1 GLAST GLT1 EAAT4 and EAAT5 carry different cysteine residues in their sequences ranging from a 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286952 9745361 405745 20021 10944 SLC1A6 EAAT4 EAAT4 20 1.0 in their sequences ranging from a minimum of two for EAAT4 to a maximum of 11 for EAAT5 (Ref Ref 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286953 9745361 405745 20022 10945 SLC1A7 EAAT5 EAAT5 27 1.0 of two for EAAT4 to a maximum of 11 for EAAT5 (Ref Ref 5 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286954 9745361 405746 20022 10945 SLC1A7 EAAT5 EAAT5 12 1.0 residues two are conserved among all the transporter subtypes except EAAT5 which has only one conserved cysteine 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286958 9745361 405768 20016 10939 SLC1A1 EAAC1 EAAC1 8 3.0 Glutamate transporters located in the postsynaptic compartment (e.g e.g EAAC1 or EAAT4 have an increased chance of exposure to noxious 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286959 9745361 405768 20021 10944 SLC1A6 EAAT4 EAAT4 10 1.0 transporters located in the postsynaptic compartment (e.g e.g EAAC1 or EAAT4 have an increased chance of exposure to noxious amounts of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286962 9745361 405781 20017 10940 SLC1A2 GLT1 GLT1 42 2.3 glutamate uptake activity apparently owing to a selective loss of GLT1 in the spinal cord and motor cortex of patients with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286963 9745361 405782 20017 10940 SLC1A2 GLT1 GLT1 6 2.3 The mechanism(s) mechanism s leading to loss of GLT1 are not fully understood 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286964 9745361 405783 20017 10940 SLC1A2 GLT1 GLT1 4 2.3 The steady-state level of GLT1 mRNA was apparently unchanged leading investigators initially to suspect a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286965 9745361 405783 20017 10940 SLC1A2 GLT1 GLT1 26 2.3 or the internalization and/or and or degradation of post-translationally damaged GLT1 (Ref Ref 51 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286966 9745361 405784 20017 10940 SLC1A2 GLT1 GLT1 33 2.3 and/or and or producing a dominant negative effect on normal GLT1 (Ref Ref 52 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286968 9745361 405785 20996 11179 SOD1 SOD1 SOD1 37 1.4 gene encoding Cu 2 /Zn Zn 2 superoxide dismutase ( SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286969 9745361 405786 20996 11179 SOD1 SOD1 SOD1 5 1.4 Mice made transgenic for mutant SOD1 developed selective motoneurone pathology strongly resembling human ALS (Ref Ref 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286971 9745361 405787 20996 11179 SOD1 SOD1 SOD1-dependent 25 1.4 aetiology of sporadic forms may involve mechanisms similar to the SOD1-dependent defects of fALS (Ref Ref 55 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286972 9745361 405788 20996 11179 SOD1 SOD1 SOD1 2 1.4 Mutations in SOD1 not only reduce the capacity to detoxify superoxide but actually 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286973 9745361 405790 20996 11179 SOD1 SOD1 SOD1 2 1.4 Abnormalities of SOD1 may result in defective glutamate transport since transgenic mice expressing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286975 9745361 405790 20996 11179 SOD1 SOD1 SOD1 15 1.4 in defective glutamate transport since transgenic mice expressing an ALS-linked SOD1 mutation show increased tyrosine nitration of glutamate transporters 43 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286976 9745361 405790 20017 10940 SLC1A2 GLT1 GLT1 30 2.3 tyrosine nitration of glutamate transporters 43 and marked loss of GLT1 in the spinal cord 58 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286977 9745361 405794 926 620 APP amyloid amyloid 3 1.0 A fragment of _amp_#x3b2 -amyloid (A_amp_#x3b2;), A_amp_#x3b2 the central constituent of neuritic plaques in Alzheimer's 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 286978 9745361 405807 20017 10940 SLC1A2 GLT1 GLT1 33 2.3 shown to form adducts with a number of proteins including GLT1 by reaction at sulphydryls or other vulnerable groups 66 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286979 9745361 405816 20017 10940 SLC1A2 GLT1 GLT1 4 2.3 As the glutamate transporters GLT1 in particular are crucial in maintaining glutamate homeostasis 6 32 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286982 9745361 405830 20996 11179 SOD1 SOD1 SOD1 25 1.4 a result of altered function of mutant superoxide dismutase (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284183 9856861 401492 20996 11179 SOD1 SOD1 SOD1 20 0.8 enzyme catalase and partially prevented with the antioxidant vitamin E SOD1 the enzyme that removes superoxide did not protect against iron(III)/ascorbate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280270 10077670 394958 20996 11179 SOD1 SOD SOD 17 3.2 (FALS)-associated FALS -associated mutant Cu/Zn Cu Zn superoxide dismutase-1 (SOD) SOD induces apoptosis of neuronal cells in culture associated with an 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280271 10077670 394959 20996 11179 SOD1 SOD SOD 0 3.2 SOD recently has been shown to prevent calcineurin inactivation initiating the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280272 10077670 394959 20996 11179 SOD1 SOD SOD-induced 20 2.4 the present investigations examining the role of calcineurin in mutant SOD-induced cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280273 10077670 394960 20996 11179 SOD1 SOD SOD 3 3.2 Wild-type or mutant SOD was expressed in neuronal cells by infection with replication-deficient adenoviruses 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280274 10077670 394961 20996 11179 SOD1 SOD SOD 5 3.2 PC12 cells overexpressing human wild-type SOD exhibited higher calcineurin activity than cells expressing FALS-related mutant SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280275 10077670 394961 20996 11179 SOD1 SOD SOD 15 3.2 SOD exhibited higher calcineurin activity than cells expressing FALS-related mutant SOD (SODV148G); SODV148G however cells expressing SODV148G had calcineurin activity equal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280276 10077670 394961 20996 11179 SOD1 SOD SOD 35 3.2 to mock-infected cells suggesting that cell death induced by mutant SOD was not related to a decrease in calcineurin activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280278 10077670 394964 20996 11179 SOD1 SOD SOD-mediated 7 2.4 The importance of rotamase activity in mutant SOD-mediated apoptosis was supported by experiments showing that overexpressed wild-type cyclophilin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280279 10077670 394964 17055 9253 PPIA CYPA CyPA 19 1.3 supported by experiments showing that overexpressed wild-type cyclophilin A (CyPA), CyPA but not CyPA with a rotamase active site point mutation 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280280 10077670 394964 17055 9253 PPIA CYPA CyPA 22 1.3 showing that overexpressed wild-type cyclophilin A (CyPA), CyPA but not CyPA with a rotamase active site point mutation protected cells from 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280281 10077670 394965 20996 11179 SOD1 SOD SOD 5 3.2 These data suggest that mutant SOD produces a greater need for rotamase and also highlights possible 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280282 10077670 394968 20996 11179 SOD1 SOD SOD 26 3.2 preparation of adenoviruses (AdVs) AdVs expressing wild type or mutant SOD have been described previously ( 12 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280283 10077670 394972 20996 11179 SOD1 SOD SOD 2 3.2 Expression of SOD and calcineurin A was analyzed by Western blot analysis as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280284 10077670 394974 20996 11179 SOD1 SOD SOD 10 3.2 A previously described method was followed for immunohistochemical detection of SOD ( 12 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280285 10077670 394975 17055 9253 PPIA CYPA CyPA 0 1.3 CyPA (histidine-tagged) histidine-tagged ( 17 expression was detected by immunostaining with 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280286 10077670 394977 20996 11179 SOD1 SOD SOD 8 3.2 The effect of wild-type (WT) WT or FALS-linked mutant SOD gene expression on viability of cells was determined as reported 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280287 10077670 394982 17055 9253 PPIA CYPA CyPA 4 1.3 For some experiments involving CyPA we used a wild-type CyPA (CyPAWT) CyPAWT cDNA or isomerase-deficient 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280288 10077670 394982 17055 9253 PPIA CYPA CyPA 9 1.3 For some experiments involving CyPA we used a wild-type CyPA (CyPAWT) CyPAWT cDNA or isomerase-deficient mutant CyPA(R55A) CyPA R55A cDNA 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280289 10077670 394982 17055 9253 PPIA CYPA CyPA 15 1.3 a wild-type CyPA (CyPAWT) CyPAWT cDNA or isomerase-deficient mutant CyPA(R55A) CyPA R55A cDNA isolated from rat brain and cloned into pcDNA1/AMP 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280290 10077670 394983 17055 9253 PPIA CYPA CyPA 13 1.3 PC12 cells were transfected with either CyPAWT cDNA or CyPA(R55A) CyPA R55A cDNA by using polyethylenimine as described ( 18 19 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280291 10077670 394984 3870 1706 CD8A CD8 CD8 11 0.0 a control for these experiments some cells were transfected with CD8 cDNA (a a gift from Jeff Bluestone University of Chicago 1 JUMiner_v2.2 1 1 cd8; 0 0 0 0 0 0 0 0 280295 10077670 394997 14373 7808 NGF NGF NGF 11 1.2 phosphatase activity in cells expressing SODV148G or SODWT or after NGF withdrawal was normalized to activity of mock-infected cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280297 10077670 395002 20996 11179 SOD1 SOD SOD 0 3.2 SOD Activity Assay 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280299 10077670 395004 20996 11179 SOD1 SOD SOD 0 3.2 SOD activity was determined in triplicate by using a colorimetric assay 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280300 10077670 395006 20996 11179 SOD1 SOD SOD 6 3.2 Overexpression of WT- and FALS-Associated Mutant SOD with Replication-Deficient Adenoviruses 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280301 10077670 395007 20996 11179 SOD1 SOD SOD 0 3.2 SOD expression in PC12 cells was determined by Western blot analysis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280302 10077670 395008 20996 11179 SOD1 SOD SOD 2 3.2 Endogenous rodent SOD was present in both the mock-infected (Fig Fig 1 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280303 10077670 395009 20996 11179 SOD1 SOD SOD 14 3.2 of slower electrophoretic mobility consistent with that expected for human SOD was present in extracts from cells infected with AdSODWT AdSODV148G 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280304 10077670 395010 20996 11179 SOD1 SOD SOD 2 3.2 The human SOD level in cells expressing SODWT SODV148G and SODA4V was similar 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280305 10077670 395010 20996 11179 SOD1 SOD SOD 15 3.2 cells expressing SODWT SODV148G and SODA4V was similar to endogenous SOD seen in mock cells (Fig Fig 1 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280306 10077670 395014 20996 11179 SOD1 SOD SOD 5 3.2 Effect of Overexpression of Mutant SOD on Neural Cell Viability 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280307 10077670 395015 20996 11179 SOD1 SOD SOD 10 3.2 We determined the effect of expression of WT and mutant SOD on differentiated PC12 cells a model system for postmitotic neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280308 10077670 395020 20996 11179 SOD1 SOD SOD 14 3.2 that the cells that died were the ones expressing mutant SOD and that these cells died by apoptosis ( 12 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280309 10077670 395021 20996 11179 SOD1 SOD SOD 5 3.2 Effect of Overexpression of Mutant SOD on Calcineurin Activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280310 10077670 395022 20996 11179 SOD1 SOD SOD 8 3.2 We examined the effects of WT and mutant SOD overexpression on calcineurin activity in differentiated PC12 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280311 10077670 395025 14373 7808 NGF NGF NGF-removal 12 1.2 was no decline in calcineurin activity of PC12 cells after NGF-removal a procedure that also leads to apoptotic cell death (Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280313 10077670 395028 20996 11179 SOD1 SOD SOD 7 3.2 We next tested whether the effects of SOD overexpression on calcineurin activity were related to a change in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280314 10077670 395029 14373 7808 NGF NGF NGF 30 1.2 after mock infection (Fig Fig 2 C lane 1 after NGF removal (Fig Fig 2 C lane 2 or 72 hr 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280315 10077670 395031 20996 11179 SOD1 SOD SOD 12 3.2 CsA and CsA Analogs on Cell Death Induced by Mutant SOD Expression or NGF Withdrawal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280316 10077670 395031 14373 7808 NGF NGF NGF 15 1.2 Analogs on Cell Death Induced by Mutant SOD Expression or NGF Withdrawal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280319 10077670 395032 20996 11179 SOD1 SOD SOD 5 3.2 To assess the relationship between SOD expression calcineurin activity and cell death cells were treated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280325 10077670 395039 20996 11179 SOD1 SOD SOD-induced 8 2.4 As previously noted these results indicate that mutant SOD-induced cell death is not related to calcineurin inhibition 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280329 10077670 395045 14373 7808 NGF NGF NGF 25 1.2 811 and PSC 833 protected PC12 cells from death after NGF withdrawal (Fig Fig 3 B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280331 10077670 395046 14373 7808 NGF NGF NGF 14 1.2 dansylated CsA had relatively little effect on cell death after NGF withdrawal (Fig Fig 3 B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280333 10077670 395049 20996 11179 SOD1 SOD SOD-induced 9 2.4 Both CsA and PKF 211_amp_#x02013 811 significantly enhanced the mutant SOD-induced death of hippocampal neurons (Fig Fig 4 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280337 10077670 395053 20996 11179 SOD1 SOD SOD 12 3.2 studies suggested that CsA and its immunosuppressive analogs might enhance SOD mutant-induced cell death through its interference with rotamase activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280346 10077670 395059 20996 11179 SOD1 SOD SOD 6 3.2 Table 1 shows that the baseline SOD activity was similar in mock SODWT- and SODV148G-expressing cells CsA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280347 10077670 395059 20996 11179 SOD1 SOD SOD 21 3.2 mock SODWT- and SODV148G-expressing cells CsA caused a decrease in SOD activity that was significantly (albeit albeit slightly more in SODWT-expressing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280349 10077670 395059 20996 11179 SOD1 SOD SOD 48 3.2 the mutant SOD-expressing cells had a slightly greater decrease in SOD activity than SODWT-expressing cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280351 10077670 395060 20996 11179 SOD1 SOD SOD 8 3.2 Our interpretation of these studies is that human SOD/rodent SOD rodent SOD heterodimers that are formed in the transiently expressing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280352 10077670 395060 20996 11179 SOD1 SOD SOD 9 3.2 interpretation of these studies is that human SOD/rodent SOD rodent SOD heterodimers that are formed in the transiently expressing cells may 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280353 10077670 395061 20996 11179 SOD1 SOD SOD 5 3.2 In addition the mutant human SOD/rodent SOD rodent SOD heterodimers may be more sensitive to changes in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280354 10077670 395061 20996 11179 SOD1 SOD SOD 6 3.2 In addition the mutant human SOD/rodent SOD rodent SOD heterodimers may be more sensitive to changes in conformation than 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280355 10077670 395061 20996 11179 SOD1 SOD SOD 20 3.2 sensitive to changes in conformation than the WT human SOD/rodent SOD rodent SOD heterodimers 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280356 10077670 395061 20996 11179 SOD1 SOD SOD 21 3.2 changes in conformation than the WT human SOD/rodent SOD rodent SOD heterodimers 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280357 10077670 395062 20996 11179 SOD1 SOD SOD 7 3.2 Effect of Overexpression of Cyclophilin A in SOD Mutant-Induced Cell Death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280358 10077670 395063 20996 11179 SOD1 SOD SOD-induced 11 2.4 further examine the role of cyclophilin rotamase activity on mutant SOD-induced cell death we transfected NGF-differentiated PC12 cells with wild-type CyPA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280359 10077670 395063 14373 7808 NGF NGF NGF-differentiated 16 1.2 cyclophilin rotamase activity on mutant SOD-induced cell death we transfected NGF-differentiated PC12 cells with wild-type CyPA (CyPAWT) CyPAWT cDNA or CyPA(R55A) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280360 10077670 395063 17055 9253 PPIA CYPA CyPA 21 1.3 SOD-induced cell death we transfected NGF-differentiated PC12 cells with wild-type CyPA (CyPAWT) CyPAWT cDNA or CyPA(R55A) CyPA R55A cDNA that contains 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280361 10077670 395063 17055 9253 PPIA CYPA CyPA 25 1.3 PC12 cells with wild-type CyPA (CyPAWT) CyPAWT cDNA or CyPA(R55A) CyPA R55A cDNA that contains a point mutation in the putative 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280362 10077670 395064 17055 9253 PPIA CYPA CyPA 0 1.3 CyPA immunohistochemical staining showed transfection efficiencies of 68 _amp_#x000b1 2_amp_#x00025 ( 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280363 10077670 395065 17055 9253 PPIA CYPA CyPA 10 1.3 cells that overexpressed CyPAWT but not PC12 cells overexpressing CyPA(R55A), CyPA R55A exhibited reduced cell death after SODV148G expression (Fig Fig 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280364 10077670 395066 20996 11179 SOD1 SOD SOD-expression 15 2.4 CyPAWT produced _amp_#x0003e 50_amp_#x00025 protection from cell death after mutant SOD-expression compared with that seen with transfection of a control cDNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280365 10077670 395066 17055 9253 PPIA CYPA CyPA 29 1.3 transfection of a control cDNA (CD8); CD8 transfection of CyPA(R55A) CyPA R55A was not protective 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280366 10077670 395066 3870 1706 CD8A CD8 CD8 26 0.0 with that seen with transfection of a control cDNA (CD8); CD8 transfection of CyPA(R55A) CyPA R55A was not protective 1 JUMiner_v2.2 1 1 cd8; 0 0 0 0 0 0 0 0 280367 10077670 395067 17055 9253 PPIA CYPA CyPA 8 1.3 These results suggest that the rotamase function of CyPA protects cells from death induced by SODV148G 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280368 10077670 395068 17055 9253 PPIA CYPA CyPA 6 1.3 In contrast overexpression of CyPAWT or CyPA(R55A) CyPA R55A in cells infected with AdSODWT or in mock-infected cells 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280369 10077670 395069 17055 9253 PPIA CYPA CyPA 6 1.3 Furthermore overexpression of either CyPAWT or CyPA(R55A) CyPA R55A did not significantly protect cells from death induced by 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280370 10077670 395069 14373 7808 NGF NGF NGF 16 1.2 R55A did not significantly protect cells from death induced by NGF withdrawal (Fig Fig 5 B indicating that the apoptotic pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280371 10077670 395069 20996 11179 SOD1 SOD SOD 30 3.2 5 B indicating that the apoptotic pathway induced by mutant SOD differs from that after growth factor removal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280372 10077670 395071 17055 9253 PPIA CYPA CyPA 8 1.3 To further investigate these issues we tested whether CyPA rescue of mutant SOD-induced cell death would be decreased with 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280373 10077670 395071 20996 11179 SOD1 SOD SOD-induced 12 2.4 investigate these issues we tested whether CyPA rescue of mutant SOD-induced cell death would be decreased with CsA treatment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280375 10077670 395072 17055 9253 PPIA CYPA CyPA 6 1.3 Table 2 shows that overexpression of CyPA (but but not CD8 _amp_#x0201c control_amp_#x0201d overexpression significantly reduced SODV148G-induced 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280376 10077670 395072 17055 9253 PPIA CYPA CyPA 24 1.3 cell death (from from 49.1 to 21.9_amp_#x00025 and that the CyPA rescue was decreased by CsA (changing changing cell death from 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280377 10077670 395072 3870 1706 CD8A CD8 CD8 9 0.0 Table 2 shows that overexpression of CyPA (but but not CD8 _amp_#x0201c control_amp_#x0201d overexpression significantly reduced SODV148G-induced cell death (from from 1 JUMiner_v2.2 1 1 cd8; 0 0 0 0 0 0 0 0 280380 10077670 395076 20996 11179 SOD1 SOD SOD 2 3.2 FALS-associated mutant SOD is believed to kill neurons through a gain of adverse 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280381 10077670 395077 20996 11179 SOD1 SOD SOD 7 3.2 We recently demonstrated that overexpression of mutant SOD leads to altered superoxide content and induces the death of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280382 10077670 395079 20996 11179 SOD1 SOD SOD 5 3.2 ( 16 that WT SOD prevents calcineurin from inactivation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280383 10077670 395080 20996 11179 SOD1 SOD SOD 7 3.2 This finding suggested to us that mutant SOD might induce cell death because it fails to protect calcineurin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280384 10077670 395081 14373 7808 NGF NGF NGF-differentiated 13 1.2 adenovirus as a vector to express SODWT or SODV148G in NGF-differentiated PC12 cells and hippocampal neurons to test whether calcineurin was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280385 10077670 395081 20996 11179 SOD1 SOD SOD-induced 35 2.4 in this death and to elucidate the mechanism underlying mutant SOD-induced cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280386 10077670 395083 20996 11179 SOD1 SOD SOD-induced 5 2.4 For the latter reason mutant SOD-induced cell death appeared unrelated to an effect on calcineurin activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280387 10077670 395084 20996 11179 SOD1 SOD SOD-induced 10 2.4 To further investigate a role for calcineurin inactivation in mutant SOD-induced cell death we tested the effect of CsA a calcineurin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280391 10077670 395086 20996 11179 SOD1 SOD SOD-induced 13 2.4 demonstrate a lack of correlation between calcineurin activity and mutant SOD-induced cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280393 10077670 395089 14373 7808 NGF NGF NGF-withdrawal 1 1.2 Both NGF-withdrawal and expression of SOD mutations have been associated with the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280394 10077670 395089 20996 11179 SOD1 SOD SOD 5 3.2 Both NGF-withdrawal and expression of SOD mutations have been associated with the generation of O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280395 10077670 395090 14373 7808 NGF NGF NGF 1 1.2 For NGF withdrawal and NMDA toxicity the ability of CsA and its 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280397 10077670 395091 20996 11179 SOD1 SOD SOD 13 3.2 hand CsA and its analogs enhanced death induced by mutant SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280402 10077670 395097 20996 11179 SOD1 SOD SOD 11 3.2 found that both drug classes enhanced apoptosis induced by mutant SOD indicating that the action of CsA may be related to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280404 10077670 395098 20996 11179 SOD1 SOD SOD 6 3.2 A role for rotamase in mutant SOD toxicity was supported by experiments comparing mutant SOD-induced cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280405 10077670 395098 20996 11179 SOD1 SOD SOD-induced 14 2.4 in mutant SOD toxicity was supported by experiments comparing mutant SOD-induced cell death after expression of CyPAWT vs an isomerase activity-deficient 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280406 10077670 395098 17055 9253 PPIA CYPA CyPA 26 1.3 after expression of CyPAWT vs an isomerase activity-deficient mutant CyPA(R55A) CyPA R55A 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280407 10077670 395099 17055 9253 PPIA CYPA CyPA 6 1.3 The WT but not the mutant CyPA protected cells from death induced by mutant SOD expression 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280408 10077670 395099 20996 11179 SOD1 SOD SOD 14 3.2 the mutant CyPA protected cells from death induced by mutant SOD expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280409 10077670 395100 17055 9253 PPIA CYPA CyPA 6 1.3 Although a recent report concluded that CyPA(R55A) CyPA R55A may have more rotamase activity than previously suspected ( 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280410 10077670 395101 20996 11179 SOD1 SOD SOD 14 3.2 importance of rotamase activity in modifying the effect of mutant SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280411 10077670 395102 20996 11179 SOD1 SOD SOD-induced 9 2.4 The findings that rotamase activity protects cells from mutant SOD-induced cell death and that there is roughly similar rotamase activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280413 10077670 395102 20996 11179 SOD1 SOD SOD 34 3.2 WT- and mutant SOD-expressing cells suggests that cells expressing mutant SOD have a greater reliance on rotamase activity and has implications 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280415 10077670 395104 20996 11179 SOD1 SOD SOD 1 3.2 Mutant SOD may increase the oxidative modification of proteins ( 30 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280416 10077670 395107 20996 11179 SOD1 SOD SOD 14 3.2 especially sensitive to the free radical damage induced by mutant SOD because of their high oxidative activity at least partly resulting 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280417 10077670 395109 17055 9253 PPIA CYPA CyPA 2 1.3 In fact CyPA has been shown to be transported by slow axonal transport 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280418 10077670 395110 20996 11179 SOD1 SOD SOD 11 3.2 also may have a role in the normal folding of SOD itself to help stabilize the enzyme or its dimers 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280419 10077670 395111 20996 11179 SOD1 SOD SOD 10 3.2 This activity may be especially critical for abnormal FALS-associated mutant SOD function because SOD mutations may destabilize SOD or the dimer 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280420 10077670 395111 20996 11179 SOD1 SOD SOD 13 3.2 be especially critical for abnormal FALS-associated mutant SOD function because SOD mutations may destabilize SOD or the dimer ( 3 37 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280421 10077670 395111 20996 11179 SOD1 SOD SOD 17 3.2 abnormal FALS-associated mutant SOD function because SOD mutations may destabilize SOD or the dimer ( 3 37 and may lead to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280422 10077670 395113 20996 11179 SOD1 SOD SOD 3 3.2 We found that SOD activity decreased slightly more after mutant SOD expression than after 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280423 10077670 395113 20996 11179 SOD1 SOD SOD 10 3.2 We found that SOD activity decreased slightly more after mutant SOD expression than after SODWT expression suggesting that the mutant enzyme 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280424 10077670 395113 20996 11179 SOD1 SOD SOD 35 3.2 WT to the effects of CsA perhaps because the mutant SOD was more sensitive to a decline in rotamase activity and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280426 10077670 395114 20996 11179 SOD1 SOD SOD 12 3.2 may be that other proteins perhaps ones that interact with SOD are more sensitive to decreased rotamase activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280427 10077670 395118 20996 11179 SOD1 SOD SOD 18 3.2 death seen after CsA treatment of PC12 cells expressing mutant SOD is related to its proapoptotic effect on these cells because 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280429 10077670 395119 14373 7808 NGF NGF NGF 11 1.2 addition CsA actually decreased cell death in PC12 cells after NGF withdrawal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280431 10077670 395129 20996 11179 SOD1 SOD SOD 9 3.2 Figure 1 ( A Western blot analysis of SOD from PC12 cells 3 days after mock infection (lane lane 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280434 10077670 395132 14373 7808 NGF NGF NGF 16 1.2 assayed 3 days after AdV infection or 1 day after NGF withdrawal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280435 10077670 395134 14373 7808 NGF NGF NGF 34 1.2 PC12 cells ( A and show a protective effect after NGF removal ( B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280438 10077670 395138 17055 9253 PPIA CYPA CyPA 10 1.3 5 Effect of overexpression of WTCyPA or an isomerase-deficient CyPA(R55A) CyPA R55A on PC12 cell death induced by SODV148G expression ( 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280439 10077670 395138 14373 7808 NGF NGF NGF 24 1.2 cell death induced by SODV148G expression ( A or after NGF withdrawal ( B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280440 10077670 395139 3870 1706 CD8A CD8 CD8 7 0.0 As a control cells were transfected with CD8 cDNA 1 JUMiner_v2.2 1 1 cd8; 0 0 0 0 0 0 0 0 280441 10077670 395141 20996 11179 SOD1 SOD SOD 5 3.2 Table 1 Mean rotamase and SOD activity _amp_#x0005b percent of control (mock-infected) mock-infected PC12 Cells_amp_#x0005d 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280442 10077670 395142 17055 9253 PPIA CYPA CyPA 2 1.3 Table 2 CyPA overexpression rescues PC12 cells from SODV148G-induced death as well as 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280445 10077670 395143 20996 11179 SOD1 SOD SOD 4 3.2 ALS amyotrophic lateral sclerosis SOD Cu/Zn Cu Zn superoxide dismutase-1 FALS familial ALS CyP cyclophilin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280447 10077670 395143 14373 7808 NGF NGF NGF 15 1.2 Zn superoxide dismutase-1 FALS familial ALS CyP cyclophilin WT wild-type NGF nerve growth factor AdV adenovirus CsA cyclosporin A NMDA N 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280452 10077670 395146 20996 11179 SOD1 SOD SOD 7 3.2 In 1993 mutations in Cu/Zn Cu Zn superoxide dismutase-1 (SOD) SOD were found to be associated with 20_amp_#x00025 of cases of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280454 10077670 395147 20996 11179 SOD1 SOD SOD-induced 15 2.4 investigations into the molecular mechanisms underlying the pathogenesis of mutant SOD-induced FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280455 10077670 395148 20996 11179 SOD1 SOD SOD 0 3.2 SOD is a ubiquitously expressed homodimeric cytosolic enzyme that dismutates superoxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280456 10077670 395149 20996 11179 SOD1 SOD SOD 1 3.2 Mutant SOD has been hypothesized to cause FALS not through a loss 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280457 10077670 395149 20996 11179 SOD1 SOD SOD 32 3.2 or an augmentation of a normally present nondismutase activity of SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280458 10077670 395150 20996 11179 SOD1 SOD SOD 26 3.2 transgenic mice ( 4 5 that suggest cells expressing mutant SOD do not necessarily have decreased dismutase function 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280459 10077670 395151 20996 11179 SOD1 SOD SOD 3 3.2 In addition a SOD knockout mouse has normal motor neuron development ( 6 demonstrating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280460 10077670 395152 20996 11179 SOD1 SOD SOD 4 3.2 The toxicity of mutant SOD has been proposed to involve one or more of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280461 10077670 395153 20996 11179 SOD1 SOD SOD 11 3.2 recently has been reported that the expression of FALS-associated mutant SOD in nerve growth factor (NGF)-differentiated NGF -differentiated PC12 cells primary 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280462 10077670 395153 14373 7808 NGF NGF NGF 16 1.2 expression of FALS-associated mutant SOD in nerve growth factor (NGF)-differentiated NGF -differentiated PC12 cells primary sympathetic neurons and hippocampal neurons leads 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280463 10077670 395154 20996 11179 SOD1 SOD SOD-induced 8 2.4 The present study explores the relationship of mutant SOD-induced death to calcineurin a calcium/calmodulin-dependent calcium calmodulin-dependent phosphatase and characterizes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280466 10077670 395156 20996 11179 SOD1 SOD SOD 23 3.2 proline residues aids normal folding and assembly of proteins including SOD and has other cellular functions ( 15 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280467 10077670 395157 20996 11179 SOD1 SOD SOD 5 3.2 A recent report demonstrated that SOD normally protects calcineurin from inactivation ( 16 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280469 10077670 395159 20996 11179 SOD1 SOD SOD 10 3.2 The present investigation demonstrates that the proapoptotic activity of mutant SOD is not related to calcineurin inhibition 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280470 10077670 395160 20996 11179 SOD1 SOD SOD 17 3.2 CsA CsG and FK506 enhance cell death induced by mutant SOD and that this enhancement depends on rotamase inhibition 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280472 10077670 395161 20996 11179 SOD1 SOD SOD 5 3.2 These findings suggest that mutant SOD may lead to increased protein damage or turnover and a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277401 10385054 390302 20996 11179 SOD1 SOD SODs 2 2.7 Superoxide dismutases (SODs) SODs are enzymes that can influence free radical processes in irradiated 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277402 10385054 390302 20996 11179 SOD1 SOD SODs 22 2.7 irradiated cells and there is some evidence that manipulation of SODs can affect survival of cells after radiation treatments 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277403 10385054 390303 20996 11179 SOD1 SOD1 SOD-1 0 10.2 SOD-1 associated FALS mutants may have an altered radiation response due 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277404 10385054 390304 20996 11179 SOD1 SOD1 SOD-1 14 10.2 ability of the lymphoblastoid cell lines from FALS patients with SOD-1 gene mutations patients with sporadic ALS and controls to handle 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277407 10385054 390305 20996 11179 SOD1 SOD1 SOD-1 25 10.2 radical-reactive fluorochrome in the cells from familial ALS patients with SOD-1 gene mutations (2.14_amp_#xb1;1.06 2.14_amp_#xb1 1.06 Gy _amp_#x2212 1 and patients 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277409 10385054 390307 20996 11179 SOD1 SOD1 SOD-1 9 10.2 The ability of lymphoblastoid cells from FALS patients with SOD-1 gene mutations to scavenge radiation-induced free radicals is not compromised 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277411 10385054 390311 20996 11179 SOD1 SOD1 SOD-1 31 10.2 and defects in the Cu/Zn Cu Zn superoxide dismutase (SOD-1) SOD-1 gene 2 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277412 10385054 390312 20996 11179 SOD1 SOD1 SOD-1 1 10.2 The SOD-1 gene encodes the cytosolic SOD-1 protein which catalyses the dismutation 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277413 10385054 390312 20996 11179 SOD1 SOD1 SOD-1 6 10.2 The SOD-1 gene encodes the cytosolic SOD-1 protein which catalyses the dismutation of superoxide anions (O O 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277414 10385054 390313 20996 11179 SOD1 SOD1 SOD-1 1 10.2 However SOD-1 can also generate free radicals 3 and SOD-1 associated FALS 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277415 10385054 390313 20996 11179 SOD1 SOD1 SOD-1 11 10.2 However SOD-1 can also generate free radicals 3 and SOD-1 associated FALS mutants have been shown to enhance the production 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277416 10385054 390313 20996 11179 SOD1 SOD SOD 55 2.7 radicals 6 and it has been demonstrated that manipulation of SOD activity can influence the cellular radiation response 7 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277418 10385054 390314 20996 11179 SOD1 SOD1 SOD-1 8 10.2 Cells from FALS patients with mutations in the SOD-1 gene might therefore have a reduced tolerance of ROS and 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277421 10385054 390315 20996 11179 SOD1 SOD1 SOD-1 19 10.2 in lymphoblastoid cell-lines from FALS patients with mutations in the SOD-1 gene and to examine the ability of FALS cells to 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277422 10385054 390318 20996 11179 SOD1 SOD1 SOD-1 26 10.2 ( n =2 and Gly 37 Arg ( n =1 SOD-1 gene mutations 8 and a known UK FALS patient with 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277423 10385054 390318 20996 11179 SOD1 SOD1 SOD-1 46 10.2 FALS patient with a Ile 149 Thr mutation in the SOD-1 gene 9 patients with sporadic ALS and matched spouse-controls were 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277430 10385054 390341 20996 11179 SOD1 SOD1 SOD-1 14 10.2 1 in the lymhpoblastoid cell lines from FALS patients with SOD-1 gene mutations were 1.50 and 1.26 ( Ala 4 Val 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277433 10385054 390347 20996 11179 SOD1 SOD1 SOD-1 26 10.2 DNA damage might be expected in lymphoblastoid cell lines with SOD-1 gene mutations 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277434 10385054 390348 20996 11179 SOD1 SOD1 SOD-1 16 10.2 reduced ability of lymphobiastoid cells from either FALS patients with SOD-1 gene mutations or from patients with sporadic ALS to cope 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277436 10385054 390350 20996 11179 SOD1 SOD1 SOD-1 20 10.2 production of hydroperoxides and double-strand DNA breaks is equivalent in SOD-1 associated FALS SALS and control lymphoblastoid cell lines 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277442 10385054 390352 20996 11179 SOD1 SOD SOD 12 2.7 lines used in this study demonstrate a wide range of SOD activity regardless of the presence of the SOD-1 gene mutation 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277443 10385054 390352 20996 11179 SOD1 SOD1 SOD-1 20 10.2 range of SOD activity regardless of the presence of the SOD-1 gene mutation (data data not shown 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277445 10385054 390354 20996 11179 SOD1 SOD1 SOD-1 24 10.2 the hypothesis that a gain of an adverse function of SOD-1 rather than a loss of function may lead to motor 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277446 10385054 390355 20996 11179 SOD1 SOD1 SOD-1 7 10.2 An abnormal gain of function could enable SOD-1 to catalyse other reactions that are normally unfavorable e.g nitration 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277449 10385054 390361 20996 11179 SOD1 SOD1 SOD-1 14 10.2 1 in the lymphoblastoid cell lines of FALS patients with SOD-1 gene mutations (FALS), FALS patients with sporadic ALS (SALS) SALS 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277451 10385054 390367 20996 11179 SOD1 SOD1 SOD-1 13 10.2 1 in the lymphoblastoid cell lines of FALS patients with SOD-1 gene mutations (FALS), FALS patients with sporadic ALS (SALS) SALS 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272909 10593879 381898 20996 11179 SOD1 SOD1 SOD1 35 6.2 in mice transfected with a mutant Cu Zn-superoxide dismutase (SOD1) SOD1 gene from humans with familial ALS mice transfected with the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272911 10593879 381898 20996 11179 SOD1 SOD1 SOD1 48 6.2 humans with familial ALS mice transfected with the normal human SOD1 gene and normal mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272915 10593879 381904 20996 11179 SOD1 SOD1 SOD1 20 6.2 impairment of its detoxification pathways perhaps by changed interactions between SOD1 and H 2 O 2 detoxification enzymes._amp_#151 Liu D. Wen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272917 10593879 381907 20996 11179 SOD1 SOD1 SOD1 10 6.2 of a single-site mutation in the Cu Zn-superoxide dismutase (SOD1) SOD1 gene in familial ALS (FALS) FALS patients (2 2 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272921 10593879 381909 20996 11179 SOD1 SOD1 SOD1 4 6.2 To explore how mutant SOD1 (mSOD1) mSOD1 causes ALS Gurney and colleagues (5) 5 produced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272922 10593879 381909 20996 11179 SOD1 SOD1 mSOD1 5 3.0 To explore how mutant SOD1 (mSOD1) mSOD1 causes ALS Gurney and colleagues (5) 5 produced a transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272925 10593879 381909 20996 11179 SOD1 SOD1 SOD1 25 6.2 model by introducing a human (with with ALS disease mutant SOD1 (mSOD1) mSOD1 gene (Gly Gly 93 Ala G93A into mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272926 10593879 381909 20996 11179 SOD1 SOD1 mSOD1 26 3.0 introducing a human (with with ALS disease mutant SOD1 (mSOD1) mSOD1 gene (Gly Gly 93 Ala G93A into mice these transfected 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272928 10593879 381910 20996 11179 SOD1 SOD1 SOD1 5 6.2 Since then over 50 different SOD1 mutants have been identified in FALS families (6) 6 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272930 10593879 381912 20996 11179 SOD1 SOD1 SOD1 2 6.2 Screening revealed SOD1 mutations with reduced SOD1 activity in 16 of 73 (22%) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272931 10593879 381912 20996 11179 SOD1 SOD1 SOD1 6 6.2 Screening revealed SOD1 mutations with reduced SOD1 activity in 16 of 73 (22%) 22% ALS families (7) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272933 10593879 381912 20996 11179 SOD1 SOD1 SOD1 22 6.2 22% ALS families (7) 7 suggesting that a loss of SOD1 function sometimes occurs in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272935 10593879 381913 20996 11179 SOD1 SOD1 SOD1 3 6.2 Mutations of the SOD1 gene reduce superoxide dismutase activity (2 2 3 8 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272936 10593879 381915 20996 11179 SOD1 SOD1 SOD1 17 6.2 found that transgenic mice expressing high levels of mutant human SOD1 protein became paralyzed even though the animal's own normal SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272937 10593879 381915 20996 11179 SOD1 SOD1 SOD1 27 6.2 SOD1 protein became paralyzed even though the animal's own normal SOD1 gene remained intact while similar overexpression of normal human SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272938 10593879 381915 20996 11179 SOD1 SOD1 SOD1 37 6.2 SOD1 gene remained intact while similar overexpression of normal human SOD1 did not produce ALS (5) 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272940 10593879 381917 20996 11179 SOD1 SOD1 SOD1 8 6.2 This result and the significantly increased expression of SOD1 mRNA in spinal cord motor neurons in sporadic ALS (13) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272942 10593879 381917 20996 11179 SOD1 SOD1 mSOD1 22 3.0 motor neurons in sporadic ALS (13) 13 suggest that the mSOD1 protein gains a new function that damages motor neurons (5) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272943 10593879 381918 20996 11179 SOD1 SOD1 SOD1 7 6.2 It has been demonstrated in vitro that SOD1 can catalyze dissociation of H 2 O 2 to OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272944 10593879 381918 20996 11179 SOD1 SOD1 mSOD1 27 3.0 OH (14 14 15 and that the OH-generating function of mSOD1 (G93A G93A and A4V is enhanced relative to that of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272945 10593879 381918 20996 11179 SOD1 SOD1 SOD1 39 6.2 and A4V is enhanced relative to that of the normal SOD1 enzyme (16 16 17 18 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272946 10593879 381919 20996 11179 SOD1 SOD1 mSOD1 10 3.0 X-ray crystallographic studies show that the active channel of the mSOD1 containing copper and zinc is slightly larger than that of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272947 10593879 381919 20996 11179 SOD1 SOD1 SOD1 23 6.2 and zinc is slightly larger than that of the normal SOD1 enzyme (3) 3 thus the metal atoms are more accessible 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272948 10593879 381920 20996 11179 SOD1 SOD1 SOD1 2 6.2 The mutant SOD1 might catalyze more OH formation because its Cu is more 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272949 10593879 381921 20996 11179 SOD1 SOD1 SOD1 11 6.2 there is strong disagreement regarding the possibility that the mutant SOD1 gains a new function to catalyze OH formation from H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272950 10593879 381923 20996 11179 SOD1 SOD1 SOD1 15 6.2 OH levels are not significantly different between mutant (G37R) G37R SOD1 transgenic mice and controls (20) 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272951 10593879 381924 20996 11179 SOD1 SOD1 SOD1 25 6.2 (CSF) CSF in G93A transgenic mice than in normal and SOD1 transgenic mice (21) 21 and an elevated level of OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272953 10593879 381925 20996 11179 SOD1 SOD1 SOD1 17 6.2 is no difference in catalytic capability in vitro between mutant SOD1 and normal SOD1 in producing OH from H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272954 10593879 381925 20996 11179 SOD1 SOD1 SOD1 20 6.2 in catalytic capability in vitro between mutant SOD1 and normal SOD1 in producing OH from H 2 O 2 questioning the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272955 10593879 381926 20996 11179 SOD1 SOD1 SOD1 18 6.2 examined in vivo the in vitro finding that on mutation SOD1 gains a new function catalyzing OH formation from H 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272956 10593879 381927 20996 11179 SOD1 SOD1 mSOD1 11 3.0 the levels of ROS in the G93A transgenic mice (mSOD1 mSOD1 mice normal SOD1 transgenic mice (SOD1 SOD1 mice and normal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272957 10593879 381927 20996 11179 SOD1 SOD1 SOD1 14 6.2 ROS in the G93A transgenic mice (mSOD1 mSOD1 mice normal SOD1 transgenic mice (SOD1 SOD1 mice and normal mice (or or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272958 10593879 381927 20996 11179 SOD1 SOD1 SOD1 17 6.2 transgenic mice (mSOD1 mSOD1 mice normal SOD1 transgenic mice (SOD1 SOD1 mice and normal mice (or or the littermates of G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272960 10593879 381928 20996 11179 SOD1 SOD1 mSOD1 12 3.0 indicate that the in vitro finding of OH formation by mSOD1 using H 2 O 2 as a substrate reported previously 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272965 10593879 381932 20996 11179 SOD1 SOD1 SOD1 45 6.2 in the spinal cord (32) 32 in mutant (G93A) G93A SOD1 transgenic mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272969 10593879 381939 20996 11179 SOD1 SOD1 SOD1 7 6.2 Our results support that the mutation of SOD1 indeed induces oxidative stress and correlate SOD1 mutation to elevated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272970 10593879 381939 20996 11179 SOD1 SOD1 SOD1 14 6.2 the mutation of SOD1 indeed induces oxidative stress and correlate SOD1 mutation to elevated H 2 O 2 OH and oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272971 10593879 381942 20996 11179 SOD1 SOD1 SOD1 16 6.2 the Jackson laboratory were used mice transfected with the mutant SOD1 gene (G93A) G93A from humans with FALS-B6SJL-TgN(SOD1-G93A)1Gur,mice FALS-B6SJL-TgN SOD1-G93A 1Gur 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272972 10593879 381942 20996 11179 SOD1 SOD1 SOD1 27 6.2 with FALS-B6SJL-TgN(SOD1-G93A)1Gur,mice FALS-B6SJL-TgN SOD1-G93A 1Gur mice transfected with normal human SOD1 gene B6SJL-TgN(SOD1)2Gur, B6SJL-TgN SOD1 2Gur and normal control mice (B6SJLF1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272973 10593879 381942 20996 11179 SOD1 SOD1 SOD1 29 6.2 1Gur mice transfected with normal human SOD1 gene B6SJL-TgN(SOD1)2Gur, B6SJL-TgN SOD1 2Gur and normal control mice (B6SJLF1 B6SJLF1 or littermates of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272974 10593879 381942 20996 11179 SOD1 SOD1 mSOD1 38 3.0 2Gur and normal control mice (B6SJLF1 B6SJLF1 or littermates of mSOD1 and SOD1 mice without gene transfection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272975 10593879 381942 20996 11179 SOD1 SOD1 SOD1 38 6.2 2Gur and normal control mice (B6SJLF1 B6SJLF1 or littermates of mSOD1 and SOD1 mice without gene transfection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272976 10593879 381942 20996 11179 SOD1 SOD1 SOD1 40 6.2 normal control mice (B6SJLF1 B6SJLF1 or littermates of mSOD1 and SOD1 mice without gene transfection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272978 10593879 381943 20996 11179 SOD1 SOD1 mSOD1 22 3.0 and MDA the onset of the ALS symptoms in the mSOD1 mice we used was delayed due to a small transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272979 10593879 381944 20996 11179 SOD1 SOD1 mSOD1 1 3.0 Therefore mSOD1 SOD1 and Nc mice were used at 6-6.5 months of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272980 10593879 381944 20996 11179 SOD1 SOD1 SOD1 2 6.2 Therefore mSOD1 SOD1 and Nc mice were used at 6-6.5 months of age 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272981 10593879 381945 20996 11179 SOD1 SOD1 mSOD1 1 3.0 The mSOD1 mice used for the measurement of O 2 and H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272982 10593879 381945 20996 11179 SOD1 SOD1 mSOD1 36 3.0 by 4-5 months for those mutants therefore 2.5- to 3-month-old mSOD1 mice and matching age SOD1 and Nc mice were used 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272983 10593879 381945 20996 11179 SOD1 SOD1 SOD1 41 6.2 mutants therefore 2.5- to 3-month-old mSOD1 mice and matching age SOD1 and Nc mice were used while paralysis was developing in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272984 10593879 381946 20996 11179 SOD1 SOD1 mSOD1 14 3.0 levels of O 2 were different among the littermates of mSOD1 mice littermates of SOD1 mice and the normal control mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272985 10593879 381946 20996 11179 SOD1 SOD1 SOD1 18 6.2 were different among the littermates of mSOD1 mice littermates of SOD1 mice and the normal control mice (B6SJLF1); B6SJLF1 no difference 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272986 10593879 381947 20996 11179 SOD1 SOD1 mSOD1 11 3.0 the B6SJLF1 normal control mice are a valid control for mSOD1 mice our definition of normal control (Nc) Nc mice includes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272987 10593879 381947 20996 11179 SOD1 SOD1 mSOD1 26 3.0 control (Nc) Nc mice includes B6SJLF1 mice and littermates of mSOD1 and SOD mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272988 10593879 381947 20996 11179 SOD1 SOD SOD 28 1.9 Nc mice includes B6SJLF1 mice and littermates of mSOD1 and SOD mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272991 10593879 381952 20996 11179 SOD1 SOD1 SOD1 3 6.2 The mutation of SOD1 significantly increases the levels of OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272993 10593879 381954 20996 11179 SOD1 SOD1 mSOD1 14 3.0 5-DHBA (mean_amp_#177; mean_amp_#177 SD is 980 _amp_#177 240 nM in mSOD1 mice ( n =8 300 _amp_#177 120 nM in SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272994 10593879 381954 20996 11179 SOD1 SOD1 SOD1 24 6.2 mSOD1 mice ( n =8 300 _amp_#177 120 nM in SOD1 mice ( n =5 and 400 _amp_#177 190 nM in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272995 10593879 381954 20996 11179 SOD1 SOD1 mSOD1 43 3.0 nM in Nc mice ( n =6 ~3.3-fold higher in mSOD1 mice than in SOD1 mice ( P =0.0001 and 2.5-fold 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272996 10593879 381954 20996 11179 SOD1 SOD1 SOD1 47 6.2 ( n =6 ~3.3-fold higher in mSOD1 mice than in SOD1 mice ( P =0.0001 and 2.5-fold higher than in Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272997 10593879 381955 20996 11179 SOD1 SOD1 mSOD1 14 3.0 3-DHBA (mean_amp_#177; mean_amp_#177 SD is 650 _amp_#177 130 nM in mSOD1 mice 330 _amp_#177 90 nM in SOD1 mice and 350 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272998 10593879 381955 20996 11179 SOD1 SOD1 SOD1 21 6.2 130 nM in mSOD1 mice 330 _amp_#177 90 nM in SOD1 mice and 350 _amp_#177 190 nM in Nc mice ~2.0-fold 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272999 10593879 381955 20996 11179 SOD1 SOD1 mSOD1 34 3.0 350 _amp_#177 190 nM in Nc mice ~2.0-fold higher in mSOD1 mice than in SOD1 mice ( P =0.0006 and 1.9-fold 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273000 10593879 381955 20996 11179 SOD1 SOD1 SOD1 38 6.2 in Nc mice ~2.0-fold higher in mSOD1 mice than in SOD1 mice ( P =0.0006 and 1.9-fold higher than in Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273001 10593879 381956 20996 11179 SOD1 SOD1 mSOD1 9 3.0 Both 2,5- and 2 3-DHBA levels are significantly higher in mSOD1 mice than in SOD1 and Nc mice but there is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273002 10593879 381956 20996 11179 SOD1 SOD1 SOD1 13 6.2 3-DHBA levels are significantly higher in mSOD1 mice than in SOD1 and Nc mice but there is no significant difference between 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273003 10593879 381956 20996 11179 SOD1 SOD1 SOD1 25 6.2 Nc mice but there is no significant difference between the SOD1 and Nc mice ( P =0.3 for 2 5-DHBA and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273004 10593879 381956 20996 11179 SOD1 SOD1 SOD1 43 6.2 and 0.8 for 2 3-DHBA direct in vivo evidence that SOD1 mutation elevates the levels of OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273005 10593879 381957 20996 11179 SOD1 SOD1 SOD1 15 6.2 the first time using G93A transgenic mice that mutation of SOD1 elevates levels of both H 2 O 2 and OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273006 10593879 381958 20996 11179 SOD1 SOD1 SOD1 15 6.2 H 2 O 2 level is increased in the mutant SOD1 transgenic mice but not in the mice overexpressing normal human 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273007 10593879 381958 20996 11179 SOD1 SOD1 SOD1 26 6.2 transgenic mice but not in the mice overexpressing normal human SOD1 is particularly important with significant implications about the pathogenesis of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273009 10593879 381959 20996 11179 SOD1 SOD1 mSOD1 16 3.0 hypothesis and indicate that the new function gained by the mSOD1 includes both catalyzing H 2 O 2 conversion to OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273010 10593879 381960 20996 11179 SOD1 SOD1 mSOD1 13 3.0 20 appeared to rule out elevation of OH production in mSOD1 transgenic mice and reports (18 18 23 as to whether 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273011 10593879 381960 20996 11179 SOD1 SOD1 SOD1 25 6.2 mice and reports (18 18 23 as to whether mutant SOD1 catalyzes increased production of OH from H 2 O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273012 10593879 381961 20996 11179 SOD1 SOD1 SOD1 8 6.2 However in our in vivo results mutation of SOD1 clearly raised H 2 O 2 levels and induced more 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273013 10593879 381962 20996 11179 SOD1 SOD1 mSOD1 19 3.0 greater ratio of OH]/[H OH H 2 O 2 in mSOD1 mice (0.23) 0.23 than in SOD1 and Nc mice (0.17 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273014 10593879 381962 20996 11179 SOD1 SOD1 SOD1 24 6.2 2 O 2 in mSOD1 mice (0.23) 0.23 than in SOD1 and Nc mice (0.17 0.17 and 0.16 respectively supports the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273015 10593879 381962 20996 11179 SOD1 SOD1 mSOD1 36 3.0 mice (0.17 0.17 and 0.16 respectively supports the notion that mSOD1 mice have a higher capability of converting H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273016 10593879 381962 20996 11179 SOD1 SOD1 SOD1 51 6.2 capability of converting H 2 O 2 to OH than SOD1 and Nc mice do 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273018 10593879 381966 20996 11179 SOD1 SOD1 SOD1 0 6.2 SOD1 mice contain both the SOD1 enzyme from the transfected normal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273019 10593879 381966 20996 11179 SOD1 SOD1 SOD1 5 6.2 SOD1 mice contain both the SOD1 enzyme from the transfected normal human SOD1 (hSOD1) hSOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273020 10593879 381966 20996 11179 SOD1 SOD1 SOD1 12 6.2 contain both the SOD1 enzyme from the transfected normal human SOD1 (hSOD1) hSOD1 gene and the mouse's own SOD1 (endogenous endogenous 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273021 10593879 381966 20996 11179 SOD1 SOD1 hSOD1 13 1.9 the SOD1 enzyme from the transfected normal human SOD1 (hSOD1) hSOD1 gene and the mouse's own SOD1 (endogenous endogenous SOD1 eSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273022 10593879 381966 20996 11179 SOD1 SOD1 SOD1 19 6.2 normal human SOD1 (hSOD1) hSOD1 gene and the mouse's own SOD1 (endogenous endogenous SOD1 eSOD1 mSOD1 mice contain the G93A mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273023 10593879 381966 20996 11179 SOD1 SOD1 SOD1 21 6.2 (hSOD1) hSOD1 gene and the mouse's own SOD1 (endogenous endogenous SOD1 eSOD1 mSOD1 mice contain the G93A mutant SOD1 and eSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273024 10593879 381966 20996 11179 SOD1 SOD1 mSOD1 23 3.0 gene and the mouse's own SOD1 (endogenous endogenous SOD1 eSOD1 mSOD1 mice contain the G93A mutant SOD1 and eSOD1 whereas Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273025 10593879 381966 20996 11179 SOD1 SOD1 SOD1 29 6.2 (endogenous endogenous SOD1 eSOD1 mSOD1 mice contain the G93A mutant SOD1 and eSOD1 whereas Nc mice contain only eSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273026 10593879 381967 20996 11179 SOD1 SOD1 SOD1 26 6.2 thereby reduce the level of O 2 has the order SOD1 mice > mSOD1 mice > Nc mice and the opposite 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273027 10593879 381967 20996 11179 SOD1 SOD1 mSOD1 29 3.0 level of O 2 has the order SOD1 mice > mSOD1 mice > Nc mice and the opposite order for the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273028 10593879 381967 20996 11179 SOD1 SOD1 mSOD1 48 3.0 order for the level of O 2 Nc mice > mSOD1 mice > SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273029 10593879 381967 20996 11179 SOD1 SOD1 SOD1 51 6.2 level of O 2 Nc mice > mSOD1 mice > SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273030 10593879 381969 20996 11179 SOD1 SOD1 SOD1 9 6.2 All together our results demonstrate that the mutation of SOD1 induced more OH formation from elevated H 2 O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273033 10593879 381970 20996 11179 SOD1 SOD1 SOD1 42 6.2 H 2 O 2 may be converted to OH by SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273034 10593879 381971 20996 11179 SOD1 SOD1 SOD1 16 6.2 ability more H 2 O 2 should be produced in SOD1 mice however no accumulation of H 2 O 2 was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273035 10593879 381971 20996 11179 SOD1 SOD1 SOD1 29 6.2 no accumulation of H 2 O 2 was observed in SOD1 mice compared to Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273036 10593879 381972 20996 11179 SOD1 SOD1 mSOD1 21 3.0 which is the normal catalytic function of GSH-Px and catalase mSOD1 mice had significantly higher levels of H 2 O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273037 10593879 381972 20996 11179 SOD1 SOD1 SOD1 37 6.2 of H 2 O 2 and OH than did the SOD1 and Nc mice and significantly lower levels of O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273038 10593879 381973 20996 11179 SOD1 SOD1 mSOD1 3 3.0 This suggests that mSOD1 gains a new function blocking H 2 O 2 conversion 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273039 10593879 381974 20996 11179 SOD1 SOD1 SOD1 43 6.2 O 2 caused by increasing or decreasing levels of wild-type SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273040 10593879 381977 20996 11179 SOD1 SOD1 hSOD1 4 1.9 Because overexpression of hSOD1 or knocking out eSOD1 did not change the onset and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273043 10593879 381978 20996 11179 SOD1 SOD1 SOD1 17 6.2 of mice show that although addition of mutant and normal SOD1 both decrease O 2 concentrations concentrations of H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273044 10593879 381978 20996 11179 SOD1 SOD1 SOD1 38 6.2 2 increase with the presence of mutated but not normal SOD1 contrary to their assumption 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273045 10593879 381979 20996 11179 SOD1 SOD1 hSOD1 14 1.9 results that H 2 O 2 formed by overexpression of hSOD1 is efficiently destroyed whereas more of that produced by the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273046 10593879 381979 20996 11179 SOD1 SOD1 SOD1 26 6.2 efficiently destroyed whereas more of that produced by the mutant SOD1 escapes into the tissue where it may produce damaging OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273047 10593879 381980 20996 11179 SOD1 SOD1 SOD1 22 6.2 O 2 detoxification pathway a crucial change whereby mutation of SOD1 leads to ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273050 10593879 381982 20996 11179 SOD1 SOD1 mSOD1 13 3.0 possible to discover this problem in vitro by using purified mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273051 10593879 381983 20996 11179 SOD1 SOD1 SOD1 2 6.2 The deleterious SOD1 mutations typically are in the interaction regions crucial to subunit 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273052 10593879 381983 20996 11179 SOD1 SOD1 SOD1 23 6.2 folding and dimer contact (3) 3 explaining why there is SOD1 aggregation only in the G93A and G85R transgenic mice but 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273053 10593879 381983 20996 11179 SOD1 SOD1 SOD1 39 6.2 and G85R transgenic mice but not in the mice overexpressing SOD1 (19) 19 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273054 10593879 381984 20996 11179 SOD1 SOD1 SOD1 1 6.2 The SOD1 dimer may act in tandem as a superoxide dismutase and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273055 10593879 381986 20996 11179 SOD1 SOD1 mSOD1 28 3.0 evidenced by the accumulation of H 2 O 2 in mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273056 10593879 381988 20996 11179 SOD1 SOD1 SOD1 17 6.2 radicals their work supports a relationship between free radicals and SOD1 mutation in FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273057 10593879 381989 20996 11179 SOD1 SOD1 SOD1 18 6.2 2 O 2 of fibroblasts from FALS patients with an SOD1 mutation is higher than for controls suggests that the mechanism 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273058 10593879 381992 20996 11179 SOD1 SOD1 mSOD1 15 3.0 O 2 levels in the dialysates are also elevated in mSOD1 mice is consistent with this explanation since H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273059 10593879 381993 20996 11179 SOD1 SOD1 mSOD1 27 3.0 level of H 2 O 2 in the cells in mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273061 10593879 381996 20996 11179 SOD1 SOD1 mSOD1 9 3.0 The elevated level of H 2 O 2 in mSOD1 mice supports the notion that the increased levels of OH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273062 10593879 381996 20996 11179 SOD1 SOD1 SOD1 35 6.2 partly formed from H 2 O 2 by the mutant SOD1 however a contribution of peroxynitrate cannot be ruled out since 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273063 10593879 381996 20996 11179 SOD1 SOD1 mSOD1 56 3.0 we have found that the level of nitric oxide in mSOD1 mice is also significantly higher than in SOD1 and Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273064 10593879 381996 20996 11179 SOD1 SOD1 SOD1 64 6.2 oxide in mSOD1 mice is also significantly higher than in SOD1 and Nc mice (65) 65 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273065 10593879 381997 20996 11179 SOD1 SOD1 hSOD1 7 1.9 Based on the observations that overexpression of hSOD1 did not change the onset and progress of the disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273067 10593879 381998 20996 11179 SOD1 SOD1 SOD1 10 6.2 It has been suggested that the deleterious effect of mutant SOD1 on motor neurons in ALS is not related to increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273069 10593879 381999 20996 11179 SOD1 SOD1 mSOD1 18 3.0 of protein DNA and membrane lipids are significantly higher in mSOD1 mice than in SOD1 and Nc mice but not between 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273070 10593879 381999 20996 11179 SOD1 SOD1 SOD1 22 6.2 membrane lipids are significantly higher in mSOD1 mice than in SOD1 and Nc mice but not between SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273071 10593879 381999 20996 11179 SOD1 SOD1 SOD1 29 6.2 mice than in SOD1 and Nc mice but not between SOD1 and Nc mice is consistent with some other reports (8 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273072 10593879 382000 20996 11179 SOD1 SOD1 mSOD1 16 3.0 membrane lipid oxidation together with elevated level of OH in mSOD1 mice support the hypothesis that OH-triggered oxidation of major cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273073 10593879 382001 20996 11179 SOD1 SOD1 SOD1 25 6.2 been revealed the finding that there are higher levels of SOD1 in motoneurons relative to other neurons (66) 66 implicates a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273075 10593879 382001 20996 11179 SOD1 SOD1 mSOD1 51 3.0 selective degeneration of motoneurons in ALS because higher levels of mSOD1 are probably present in those neurons relative to others when 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273076 10593879 382019 20996 11179 SOD1 SOD1 mSOD1 23 3.0 EC detection in the three groups of mice (8 8 mSOD1 5 SOD1 and 6 Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273077 10593879 382019 20996 11179 SOD1 SOD1 SOD1 25 6.2 in the three groups of mice (8 8 mSOD1 5 SOD1 and 6 Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273078 10593879 382024 20996 11179 SOD1 SOD1 mSOD1 9 3.0 b Chromatogram of 10 microl dialysate obtained from a mSOD1 mouse 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273079 10593879 382026 20996 11179 SOD1 SOD1 SOD1 9 6.2 c Chromatogram of 10 microl dialysate obtained from a SOD1 mouse 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273080 10593879 382049 20996 11179 SOD1 SOD1 mSOD1 13 3.0 of reduced cytochrome c measured in the perfusates collected from mSOD1 ( n =6 SOD1 ( n =3 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273081 10593879 382049 20996 11179 SOD1 SOD1 SOD1 17 6.2 measured in the perfusates collected from mSOD1 ( n =6 SOD1 ( n =3 and Nc mice ( n =6 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273082 10593879 382051 20996 11179 SOD1 SOD1 mSOD1 13 3.0 of reduced cytochrome c measured in spinal cord tissue in mSOD1 ( n =3 SOD1 ( n =3 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273083 10593879 382051 20996 11179 SOD1 SOD1 SOD1 17 6.2 measured in spinal cord tissue in mSOD1 ( n =3 SOD1 ( n =3 and Nc mice ( n =4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273084 10593879 382056 20996 11179 SOD1 SOD1 mSOD1 12 3.0 in microdialysates was measured by HPLC and fluorescence detection in mSOD1 ( n =8 SOD1 ( n =7 and Nc ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273085 10593879 382056 20996 11179 SOD1 SOD1 SOD1 16 6.2 by HPLC and fluorescence detection in mSOD1 ( n =8 SOD1 ( n =7 and Nc ( n =9 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273086 10593879 382061 20996 11179 SOD1 SOD1 mSOD1 10 3.0 Protein carbonyl content in the mouse spinal cord tissue of mSOD1 SOD1 and Nc mice was measured spectrophotometrically after labeling with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273087 10593879 382061 20996 11179 SOD1 SOD1 SOD1 11 6.2 carbonyl content in the mouse spinal cord tissue of mSOD1 SOD1 and Nc mice was measured spectrophotometrically after labeling with DNPH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273097 10593879 382141 20996 11179 SOD1 SOD1 mSOD1 20 3.0 all measurements to determine whether the mean results obtained from mSOD1 SOD1 and Nc mice were significantly different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273098 10593879 382141 20996 11179 SOD1 SOD1 SOD1 21 6.2 measurements to determine whether the mean results obtained from mSOD1 SOD1 and Nc mice were significantly different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273099 10593879 382142 20996 11179 SOD1 SOD1 SOD1 3 6.2 The mutation of SOD1 significantly increases the levels of H 2 O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273100 10593879 382144 20996 11179 SOD1 SOD1 mSOD1 17 3.0 2 (mean_amp_#177; mean_amp_#177 SD is 2.8 _amp_#177 0.3 microM in mSOD1 mice ( n =4 1.9 _amp_#177 0.2 microM in SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273101 10593879 382144 20996 11179 SOD1 SOD1 SOD1 27 6.2 mSOD1 mice ( n =4 1.9 _amp_#177 0.2 microM in SOD1 mice ( n =3 and 2.1 _amp_#177 0.4 microM in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273102 10593879 382145 20996 11179 SOD1 SOD1 mSOD1 11 3.0 levels of H 2 O 2 are significantly higher in mSOD1 mice than in SOD1 ( P =0.005 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273103 10593879 382145 20996 11179 SOD1 SOD1 SOD1 15 6.2 O 2 are significantly higher in mSOD1 mice than in SOD1 ( P =0.005 and Nc mice ( P =0.007 but 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273104 10593879 382145 20996 11179 SOD1 SOD1 SOD1 33 6.2 P =0.007 but there is no significant difference between the SOD1 and Nc mice ( P =0.6 indicating that mutant SOD1in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273105 10593879 382145 20996 11179 SOD1 SOD1 mSOD1 45 3.0 Nc mice ( P =0.6 indicating that mutant SOD1in the mSOD1 mice also elevates H 2 O 2 levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273106 10593879 382147 20996 11179 SOD1 SOD1 mSOD1 14 3.0 levels of O 2 in the perfusates collected from the mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273107 10593879 382147 20996 11179 SOD1 SOD1 SOD1 15 6.2 of O 2 in the perfusates collected from the mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273108 10593879 382148 20996 11179 SOD1 SOD1 mSOD1 15 3.0 cytochrome c (mean_amp_#177; mean_amp_#177 SD is 0.060 _amp_#177 0.011 in mSOD1 mice ( n =6 0.037 _amp_#177 0.004 in SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273109 10593879 382148 20996 11179 SOD1 SOD1 SOD1 24 6.2 in mSOD1 mice ( n =6 0.037 _amp_#177 0.004 in SOD1 mice ( n =3 and 0.130 _amp_#177 0.030 in Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273110 10593879 382149 20996 11179 SOD1 SOD1 mSOD1 26 3.0 2 are significantly higher in normal control mice than in mSOD1 ( P =0.0007 and SOD1 mice ( P =0.002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273111 10593879 382149 20996 11179 SOD1 SOD1 SOD1 31 6.2 normal control mice than in mSOD1 ( P =0.0007 and SOD1 mice ( P =0.002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273112 10593879 382150 20996 11179 SOD1 SOD1 mSOD1 10 3.0 The level of O 2 is also significantly higher in mSOD1 than in SOD1 mice ( P =0.01 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273113 10593879 382150 20996 11179 SOD1 SOD1 SOD1 13 6.2 O 2 is also significantly higher in mSOD1 than in SOD1 mice ( P =0.01 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273114 10593879 382151 20996 11179 SOD1 SOD1 mSOD1 16 3.0 of O 2 in the spinal cord tissue of the mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273115 10593879 382151 20996 11179 SOD1 SOD1 SOD1 17 6.2 O 2 in the spinal cord tissue of the mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273116 10593879 382152 20996 11179 SOD1 SOD1 mSOD1 19 3.0 absorbance g wet weight tissue is 158 _amp_#177 10 in mSOD1 mice ( n =3 138 _amp_#177 10 in SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273117 10593879 382152 20996 11179 SOD1 SOD1 SOD1 28 6.2 in mSOD1 mice ( n =3 138 _amp_#177 10 in SOD1 mice ( n =3 and 186 _amp_#177 12 in Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273118 10593879 382153 20996 11179 SOD1 SOD1 mSOD1 26 3.0 tissue of normal control mice is significantly higher than in mSOD1 ( P =0.02 and SOD1 mice ( P =0.003 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273119 10593879 382153 20996 11179 SOD1 SOD1 SOD1 31 6.2 is significantly higher than in mSOD1 ( P =0.02 and SOD1 mice ( P =0.003 and is also higher in mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273120 10593879 382153 20996 11179 SOD1 SOD1 mSOD1 41 3.0 SOD1 mice ( P =0.003 and is also higher in mSOD1 than in SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273121 10593879 382153 20996 11179 SOD1 SOD1 SOD1 44 6.2 P =0.003 and is also higher in mSOD1 than in SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273123 10593879 382155 20996 11179 SOD1 SOD1 SOD1 2 6.2 Mutation of SOD1 significantly increases membrane peroxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273124 10593879 382156 20996 11179 SOD1 SOD1 mSOD1 15 3.0 of MDA in the dialysates collected from the CSF in mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273125 10593879 382156 20996 11179 SOD1 SOD1 SOD1 16 6.2 MDA in the dialysates collected from the CSF in mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273127 10593879 382157 20996 11179 SOD1 SOD1 mSOD1 14 3.0 MDA (mean_amp_#177; mean_amp_#177 SD is 70 _amp_#177 15 nM in mSOD1 mice ( n =8 40 _amp_#177 5 nM in SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273128 10593879 382157 20996 11179 SOD1 SOD1 SOD1 24 6.2 mSOD1 mice ( n =8 40 _amp_#177 5 nM in SOD1 mice ( n =7 and 30 _amp_#177 10 nM in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273129 10593879 382158 20996 11179 SOD1 SOD1 mSOD1 6 3.0 The MDA level in dialysates in mSOD1 mice is 1.8-fold that in SOD1 mice ( P =0.0005 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273130 10593879 382158 20996 11179 SOD1 SOD1 SOD1 12 6.2 level in dialysates in mSOD1 mice is 1.8-fold that in SOD1 mice ( P =0.0005 and 2.3-fold higher than in Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273131 10593879 382159 20996 11179 SOD1 SOD1 SOD1 6 6.2 There was no significant difference between SOD1 and Nc mice ( P =0.1 suggesting that overexpression of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273132 10593879 382159 20996 11179 SOD1 SOD1 SOD1 18 6.2 Nc mice ( P =0.1 suggesting that overexpression of normal SOD1 does not increase peroxidation of membrane lipids 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273133 10593879 382160 20996 11179 SOD1 SOD1 mSOD1 7 3.0 The significantly higher levels of MDA in mSOD1 mice than in SOD1 and Nc mice demonstrate that oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273134 10593879 382160 20996 11179 SOD1 SOD1 SOD1 11 6.2 significantly higher levels of MDA in mSOD1 mice than in SOD1 and Nc mice demonstrate that oxidative damage to membrane phospholipids 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273135 10593879 382160 20996 11179 SOD1 SOD1 SOD1 30 6.2 membrane phospholipids indeed occurs after the induction of the mutant SOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273136 10593879 382161 20996 11179 SOD1 SOD1 SOD1 3 6.2 The mutation of SOD1 significantly increases protein oxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273137 10593879 382163 20996 11179 SOD1 SOD1 mSOD1 15 3.0 SD is 2.31 _amp_#177 0.16 nmol/mg nmol mg protein in mSOD1 mice 1.95 _amp_#177 0.09 nmol/mg nmol mg protein in SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273138 10593879 382163 20996 11179 SOD1 SOD1 SOD1 23 6.2 mSOD1 mice 1.95 _amp_#177 0.09 nmol/mg nmol mg protein in SOD1 mice and 1.94 _amp_#177 0.13 nmol/mg nmol mg in Nc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273139 10593879 382164 20996 11179 SOD1 SOD1 mSOD1 12 3.0 carbonyl content in spinal cord tissue is 1.2-fold higher in mSOD1 mice than in SOD1 ( P =0.0002 and Nc ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273140 10593879 382164 20996 11179 SOD1 SOD1 SOD1 16 6.2 cord tissue is 1.2-fold higher in mSOD1 mice than in SOD1 ( P =0.0002 and Nc ( P =0.0004 mice_amp_#151 a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273141 10593879 382164 20996 11179 SOD1 SOD1 SOD1 44 6.2 two controls ( P =0.9 indicating that overexpression of normal SOD1 does not induce protein oxidation and only mutant SOD1 in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273142 10593879 382164 20996 11179 SOD1 SOD1 SOD1 53 6.2 normal SOD1 does not induce protein oxidation and only mutant SOD1 in mSOD1 mice causes significantly more protein oxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273143 10593879 382164 20996 11179 SOD1 SOD1 mSOD1 55 3.0 does not induce protein oxidation and only mutant SOD1 in mSOD1 mice causes significantly more protein oxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273144 10593879 382165 20996 11179 SOD1 SOD1 SOD1 3 6.2 The mutation of SOD1 significantly increases DNA oxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273145 10593879 382168 20996 11179 SOD1 SOD1 mSOD1 9 3.0 The average concentration (from from three samples of 8-OHdG in mSOD1 mice is 0.27 _amp_#177 0.06 fmol/mg fmol mg wet tissue 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273146 10593879 382168 20996 11179 SOD1 SOD1 mSOD1 28 3.0 _amp_#177 0.12 fmol/microg fmol microg DNA (mean_amp_#177; mean_amp_#177 SD 10 mSOD1 mouse spinal cords were measured as three samples 8-OHdG was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273147 10593879 382168 20996 11179 SOD1 SOD1 SOD1 47 6.2 8-OHdG was undetectable in the same amount of tissue from SOD1 or Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273148 10593879 382169 20996 11179 SOD1 SOD1 mSOD1 5 3.0 Thus DNA oxidation occurs in mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273149 10593879 382170 20996 11179 SOD1 SOD1 SOD1 39 6.2 and reduction of O 2 in the presence of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273150 10593879 382171 20996 11179 SOD1 SOD1 SOD1 12 6.2 by in vivo experiments the in vitro discovery that mutant SOD1 gains a new function catalyzing more OH production from H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273151 10593879 382173 20996 11179 SOD1 SOD1 SOD1 13 6.2 also indicate that the new function gained by the mutant SOD1 enzyme is not only catalyzing more OH formation but also 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267123 10627601 371017 8046 4092 GAD1 GAD GAD 9 0.6 GABAergic cortical neurons were labeled using glutamic acid decarboxylase (GAD; GAD Developmental Studies Hybridoma Bank at the University of Iowa Iowa 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267124 10627601 371020 8046 4092 GAD1 GAD GAD 13 0.6 solution at 1 6000 for SMI-32 and 1 500 for GAD were performed for 48-72 hr at 4degreeC 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267139 10627601 371056 8046 4092 GAD1 GAD GAD 20 0.6 for either SMI-32 (for for identifying spinal motor neurons or GAD (for for identifying GABAergic cortical neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267144 10627601 371087 8790 4572 GRIA2 GLUR2 GluR2 43 1.9 Yin et al. 1994 may express low levels of the GluR2 AMPA subunit (which which confers Ca impermeability to heteromeric AMPA 14 JUMiner_v2.2 1 0 0 2 4572 TotalCon:2<>4572|GRIA2|2891|Complete__4594|GRM2|2912|Complete__<>AvaiableGeneRif=2<>BEST:4572|GRIA2|0.00109155541817198<>ScoreDetail__4594|GRM2|0.000364598856902915__4572|GRIA2|0.00109155541817198__ 0 0 0 0 0 267145 10627601 371087 8790 4572 GRIA2 GLUR2 GluR2 78 1.9 both of these populations are comprised of AMPA subunits lacking GluR2 14 JUMiner_v2.2 1 0 0 2 4572 TotalCon:2<>4572|GRIA2|2891|Complete__4594|GRM2|2912|Complete__<>AvaiableGeneRif=2<>BEST:4572|GRIA2|0.00109155541817198<>ScoreDetail__4594|GRM2|0.000364598856902915__4572|GRIA2|0.00109155541817198__ 0 0 0 0 0 267163 10627601 371122 8046 4092 GAD1 GAD GAD 20 0.6 for SMI-32 GABAergic cortical neurons were identified by staining for GAD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267876 10643818 372625 14352 7794 NFKB1 NF-kB NF-kB 24 1.3 cGMP followed by activation of cGMP-dependent kinase and phosphorylation of NF-kB proteins and possibly CREB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267877 10643818 372625 4911 2345 CREB1 CREB CREB 28 1.3 of cGMP-dependent kinase and phosphorylation of NF-kB proteins and possibly CREB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267878 10643818 372642 4911 2345 CREB1 CREB CREB 3 1.3 The transcription factor CREB is a likely substrate for cGMP-dependent kinase that has been 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267879 10643818 372654 7333 11920 FAS FAS Fas 47 0.6 TNF-receptor-dependent signaling 9 10 and 11 and engagement of the Fas antigen 12 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000708498551406617<>ScoreDetail__11920|FAS|0.000708498551406617__3594|FASN|0.000615254271478426__ 0 0 0 0 0 267880 10643818 372655 14352 7794 NFKB1 NF-kB NF-kB 18 1.3 nervous system expression of heme oxygenase-1 and nuclear localization of NF-kB p50 13 are intimately associated with the outlined pathway because 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267881 10643818 372655 3889 11919 CD40 p50 p50 19 1.1 system expression of heme oxygenase-1 and nuclear localization of NF-kB p50 13 are intimately associated with the outlined pathway because heme 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267882 10643818 372655 14352 7794 NFKB1 NF-kB NF-kB 42 1.3 because heme oxygenase-1 may activate cGMP kinase 7 while the NF-kB proteins p50 and p49 are substrates for this enzyme (Weber, 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267883 10643818 372655 3889 11919 CD40 p50 p50 44 1.1 oxygenase-1 may activate cGMP kinase 7 while the NF-kB proteins p50 and p49 are substrates for this enzyme (Weber, Weber unpublished 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267884 10643818 372655 21252 26333 SRFBP1 p49 p49 46 0.6 activate cGMP kinase 7 while the NF-kB proteins p50 and p49 are substrates for this enzyme (Weber, Weber unpublished results 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>26333|SRFBP1|153443|Complete__9369|PRIM1|5557|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 267885 10643818 372656 4911 2345 CREB1 CREB CREB 13 1.3 also induces expression of c-Fos possibly via activation of SRE CREB or FAP 14 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267886 10643818 372656 4169 1848 CEL FAP FAP 15 1.0 expression of c-Fos possibly via activation of SRE CREB or FAP 14 1 JUMiner_v2.2 1 0 0 2 3590 TotalCon:4<>3590|FAP|2191|Complete__1848|CEL|1056|Complete__14373|GLMN|11146|Complete__583|APC|324|Complete__<>AvaiableGeneRif=4<>BEST:3590|FAP|0.00088164479274856<>ScoreDetail__14373|GLMN|0.000374531835205993__1848|CEL|0.000447105478014074__3590|FAP|0.00088164479274856__583|APC|0.000521687179385948__ 0 0 0 0 0 267888 10643818 372664 926 620 APP amyloid amyloid 13 1.8 factors for familial Alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein E presenilin 1 and presenilin 2 genes 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267889 10643818 372665 926 620 APP amyloid amyloid 11 1.8 mechanisms of action of these diverse molecules include regulation of amyloid production and of the metabolism of reactive oxygen intermediates so 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267890 10643818 372665 926 620 APP amyloid amyloid 32 1.8 that malfunctioning of these gene products causes elevated generation of amyloid _amp_#x3b2 protein and of reactive oxygen species ( Table 1 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267891 10643818 372666 926 620 APP amyloid amyloid 13 1.8 stress may sensitize neurons to the apoptotic signals induced by amyloid (see see later creating a double burden 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267892 10643818 372667 17461 9508 PSEN1 PS1 PS1 1 0.9 Presenilins (PS1 PS1 and PS2 contribute to the regulation of apoptosis with the 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>9508|PSEN1|5663|Complete__20640|TAS2R62P|338399|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 267893 10643818 372667 17462 9509 PSEN2 PS2 PS2 1 2.4 Presenilins (PS1 PS1 and PS2 contribute to the regulation of apoptosis with the 15 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>9509|PSEN2|5664|Complete__20642|TAS2R64P|338412|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 267894 10643818 372667 17462 9509 PSEN2 PS2 PS2 3 2.4 Presenilins (PS1 PS1 and PS2 contribute to the regulation of apoptosis with the wild-type of 15 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>9509|PSEN2|5664|Complete__20642|TAS2R64P|338412|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 267895 10643818 372667 17462 9509 PSEN2 STM2 STM2 16 3.2 the regulation of apoptosis with the wild-type of Alzheimer's gene STM2 (PS2) PS2 exerting anti-apoptotic effects 16 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267896 10643818 372667 17462 9509 PSEN2 PS2 PS2 17 2.4 of apoptosis with the wild-type of Alzheimer's gene STM2 (PS2) PS2 exerting anti-apoptotic effects 16 15 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>9509|PSEN2|5664|Complete__20642|TAS2R64P|338412|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 267897 10643818 372670 926 620 APP amyloid amyloid 17 1.8 -catenin can activate _amp_#x3b3 -secretase the enzyme that releases the amyloid fragment A_amp_#x3b2;(1-42), A_amp_#x3b2 1-42 with a consequent increase in the 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267898 10643818 372670 926 620 APP amyloid amyloid 27 1.8 A_amp_#x3b2;(1-42), A_amp_#x3b2 1-42 with a consequent increase in the excreted amyloid _amp_#x3b2 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267899 10643818 372671 912 613 APOE APOE ApoE 2 1.3 Apolipoprotein E (ApoE) ApoE protects neurons from hydrogen peroxide toxicity and binds specific metal 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267900 10643818 372673 926 620 APP amyloid amyloid 6 1.8 Apolipoprotein E may also protect from _amp_#x3b2 -amyloid peptide toxicity by binding to amyloid _amp_#x3b2 and under certain 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267901 10643818 372673 926 620 APP amyloid amyloid 12 1.8 also protect from _amp_#x3b2 -amyloid peptide toxicity by binding to amyloid _amp_#x3b2 and under certain circumstances acting as kinetic inhibitor of 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267902 10643818 372673 926 620 APP amyloid amyloid 23 1.8 _amp_#x3b2 and under certain circumstances acting as kinetic inhibitor of amyloid formation 18 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267903 10643818 372674 926 620 APP amyloid amyloid 7 1.8 The major proteinaceous component of plaques is _amp_#x3b2 -amyloid the abnormal cleavage product of the amyloid precursor protein (APP) 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267904 10643818 372674 926 620 APP amyloid amyloid 14 1.8 plaques is _amp_#x3b2 -amyloid the abnormal cleavage product of the amyloid precursor protein (APP) APP 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267905 10643818 372674 926 620 APP APP APP 17 0.3 the abnormal cleavage product of the amyloid precursor protein (APP) APP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267906 10643818 372675 926 620 APP amyloid amyloid 5 1.8 Various metals can bind to amyloid precursor protein and influence its conformation stability and homophilic interactions 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267907 10643818 372676 926 620 APP APP APP 0 0.3 APP may bind copper and catalyze a redox reaction that reduces 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267908 10643818 372676 926 620 APP amyloid amyloid 22 1.8 Cu I and gives rise to cystine formation in the amyloid precursor protein 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267909 10643818 372678 926 620 APP amyloid amyloid 15 1.8 the binding of zinc which can lead to precipitation of amyloid protein 20 may also be associated with changes in the 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267910 10643818 372679 926 620 APP amyloid amyloid 4 1.8 While the function of amyloid precursor protein as a free radical generator may contribute to 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267911 10643818 372679 926 620 APP amyloid amyloid 21 1.8 generator may contribute to affecting neuron viability the concentrations of amyloid _amp_#x3b2 required to generate free radicals are in general moderately 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267912 10643818 372680 926 620 APP amyloid amyloid 7 1.8 Furthermore the accumulation of intercellular masses of amyloid in contrast to the soluble molecules is not suitable to 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267913 10643818 372681 926 620 APP amyloid amyloid 5 1.8 An alternative mechanism by which amyloid _amp_#x3b2 may cause oxidative stress in neurons as well as 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267914 10643818 372683 14352 7794 NFKB1 NF-kB NF-kB 13 1.3 RAGE may increase lipid peroxidation as well as activation of NF-kB p50 22 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267915 10643818 372683 3889 11919 CD40 p50 p50 14 1.1 may increase lipid peroxidation as well as activation of NF-kB p50 22 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267916 10643818 372684 926 620 APP amyloid amyloid 18 1.8 -acetylcysteine 23 and inhibition of lipoxygenase protects hippocampal neurons from amyloid _amp_#x3b2 toxicity 24 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267917 10643818 372686 926 620 APP amyloid amyloid 10 1.8 The oxidative stress generated via production of free radicals by amyloid or via amyloid-dependent signaling can be increased by the common 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267918 10643818 372686 926 620 APP amyloid amyloid-dependent 13 1.0 generated via production of free radicals by amyloid or via amyloid-dependent signaling can be increased by the common risk factors through 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267920 10643818 372740 16745 9065 PLCG1 PLC PLC 7 0.6 PLA 2 phopholipase A 2 PLC phospholipase C DAG diacyl glycerol AA arachidonic acid PKC protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267921 10643818 372740 14533 7872 NOS1 NOS NOS 23 0.9 AA arachidonic acid PKC protein kinase C GPX glutathione peroxidase NOS NO synthetase LTP long-term potentiation 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000583435278444126<>ScoreDetail__7873|NOS2A|0.000554595872352032__7872|NOS1|0.000583435278444126__ 0 0 0 0 0 267923 10643818 372745 926 620 APP amyloid amyloid 12 1.8 affected in Alzheimer's disease share two common mechanisms control of amyloid _amp_#x3b2 secretion and of oxidative stress leading to apoptosis 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 267924 10643818 372746 926 620 APP amyloid amyloid 6 1.8 The mechanism of apoptosis induction by amyloid _amp_#x3b2 converges with the signal transduction cascade that mediates long-term 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 268171 10671549 373491 22671 11998 TP53 p53 p53 3 5.8 Tumor suppressor protein p53 and cell cycle inhibitor p21 accumulate as an early sign 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268172 10671549 373491 4059 1784 CDKN1A p21 p21 8 1.4 Tumor suppressor protein p53 and cell cycle inhibitor p21 accumulate as an early sign of S -nitrosoglutathione-mediated toxicity 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268173 10671549 373495 1576 990 BCL2 Bcl-2 Bcl-2 13 4.3 susceptibility of the WT cells to higher and more stable Bcl-2 and decreased reactive oxygen species 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268174 10671549 373497 1576 990 BCL2 Bcl-2 Bcl-2 8 4.3 Furthermore G93A cells showed a significant decrease of Bcl-2 expression and as target of NO-derived radicals showed lower cytochrome 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268175 10671549 373511 1576 990 BCL2 Bcl-2 Bcl-2 4 4.3 Constitutive expression of high Bcl-2 protein levels by transfection experiments has proven that Bcl-2 or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268176 10671549 373511 1576 990 BCL2 Bcl-2 Bcl-2 13 4.3 high Bcl-2 protein levels by transfection experiments has proven that Bcl-2 or related family members can protect from NO-mediated apoptosis ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268177 10671549 373512 22671 11998 TP53 p53 p53 5 5.8 The tumor suppressor gene product p53 is able to modulate apoptosis in DNA-damaged cell ( 17 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268178 10671549 373518 20996 11179 SOD1 SOD SOD 4 2.4 The enzyme superoxide dismutase (SOD) SOD may play a fundamental role in modulating NO toxicity since 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268179 10671549 373519 20996 11179 SOD1 SOD SOD 10 2.4 As matter of fact cells producing an increased amount of SOD were resistant to NO-mediated toxicity ( 24 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268180 10671549 373521 20996 11179 SOD1 SOD SOD 28 2.4 sclerosis (FALS FALS are pro-apoptotic agents although they retain enzymatic SOD activity ( 26 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268181 10671549 373524 1576 990 BCL2 Bcl-2 Bcl-2 19 4.3 cells is associated with a canonical sequence of events including Bcl-2 p53 and p21 modulation cytochrome c release in the cytosol 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268182 10671549 373524 22671 11998 TP53 p53 p53 20 5.8 is associated with a canonical sequence of events including Bcl-2 p53 and p21 modulation cytochrome c release in the cytosol and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268183 10671549 373524 4059 1784 CDKN1A p21 p21 22 1.4 with a canonical sequence of events including Bcl-2 p53 and p21 modulation cytochrome c release in the cytosol and caspase 3 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268184 10671549 373525 20996 11179 SOD1 SOD SOD 4 2.4 Cells carrying wild type SOD are protected from NO-mediated apoptosis whereas cells transfected with the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268185 10671549 373525 20996 11179 SOD1 SOD SOD 16 2.4 protected from NO-mediated apoptosis whereas cells transfected with the mutant SOD are more susceptible 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268188 10671549 373541 20996 11179 SOD1 SOD SOD 18 2.4 type Cu Zn-SOD (named named WT or with a mutated SOD G93A (named named G93A were obtained as described previously ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268189 10671549 373542 20997 11180 SOD2 Mn-SOD Mn-SOD 10 1.9 Transfected cells had the same antioxidant pattern such as of Mn-SOD as SH-SY5Y cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268196 10671549 373581 22671 11998 TP53 p53 p53 0 5.8 p53 p21 and Bcl-2 Proteins Detection--Cell pellet was resuspended in lysis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268197 10671549 373581 4059 1784 CDKN1A p21 p21 1 1.4 p53 p21 and Bcl-2 Proteins Detection--Cell pellet was resuspended in lysis buffer 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268198 10671549 373581 1576 990 BCL2 Bcl-2 Bcl-2 3 4.3 p53 p21 and Bcl-2 Proteins Detection--Cell pellet was resuspended in lysis buffer containing 10 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268199 10671549 373583 22671 11998 TP53 p53 p53 33 5.8 microg of proteins were loaded on a 10 (for for p53 or 12% (for for p21 and Bcl-2 polyacrylamide gel 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268200 10671549 373583 4059 1784 CDKN1A p21 p21 37 1.4 on a 10 (for for p53 or 12% (for for p21 and Bcl-2 polyacrylamide gel 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268201 10671549 373583 1576 990 BCL2 Bcl-2 Bcl-2 39 4.3 10 (for for p53 or 12% (for for p21 and Bcl-2 polyacrylamide gel 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268202 10671549 373596 20996 11179 SOD1 SOD SOD 4 2.4 Supernatants were used for SOD activity and protein content assay 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268203 10671549 373598 20997 11180 SOD2 Mn-SOD Mn-SOD 6 1.9 Under these conditions the activity of Mn-SOD is almost fully inhibited ( 33 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268206 10671549 373638 20996 11179 SOD1 SOD SOD 5 2.4 However cells transfected with normal SOD were much less protected than against NO-mediated apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268208 10671549 373642 20996 11179 SOD1 SOD SOD 13 2.4 be strengthened by O 2 via formation of peroxynitrite and SOD that catalytically removes O 2 is therefore indicated as a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268209 10671549 373644 20996 11179 SOD1 SOD SOD 5 2.4 However cells transfected with a SOD mutant (G93A G93A as active as the wild type were 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268210 10671549 373645 20996 11179 SOD1 SOD SOD 23 2.4 NO-mediated apoptosis and that additional properties of the G93A mutant SOD potentiate apoptogenic stimuli of NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268211 10671549 373650 22671 11998 TP53 p53 p53 10 5.8 In our model apoptosis was characterized by an induction of p53 protein which is able to induce either growth arrest or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268212 10671549 373651 22671 11998 TP53 p53 p53 16 5.8 is dependent upon sequence-specific DNA binding and transcriptional activation of p53 target genes such as p21 which is an inhibitor of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268213 10671549 373651 4059 1784 CDKN1A p21 p21 21 1.4 binding and transcriptional activation of p53 target genes such as p21 which is an inhibitor of cyclin-dependent kinases and thereby blocks 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268214 10671549 373651 22671 11998 TP53 p53 p53 38 5.8 cyclin-dependent kinases and thereby blocks cell cycle progression ( 42 p53 increase was an early response to GSNO treatment in fact 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268215 10671549 373651 22671 11998 TP53 p53 p53 66 5.8 entered the apoptotic pathway they showed the same degree of p53 accumulation as the other cell lines tested 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268216 10671549 373652 22671 11998 TP53 p53 p53 1 5.8 Furthermore p53 accumulation and activation leads to p21 increase in all the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268217 10671549 373652 4059 1784 CDKN1A p21 p21 7 1.4 Furthermore p53 accumulation and activation leads to p21 increase in all the three cell types however the cleavage 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268218 10671549 373652 4059 1784 CDKN1A p21 p21 20 1.4 all the three cell types however the cleavage product of p21 was observed only in the G93A and SH-SY5Y cells at 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268219 10671549 373653 4059 1784 CDKN1A p21 p21 5 1.4 It has been demonstrated that p21 cleavage could be reproduced in extracts prepared from irradiated cells 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268220 10671549 373654 4059 1784 CDKN1A p21 p21 7 1.4 From these observations it was suggested that p21 may serve as a critical checkpoint regulator for both cell 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268221 10671549 373654 22671 11998 TP53 p53 p53-mediated 24 0.6 regulator for both cell cycle arrest and apoptosis during the p53-mediated DNA damage response ( 42 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268222 10671549 373666 1576 990 BCL2 Bcl-2 Bcl-2 17 4.3 on Bax and/or and or Bid two members of the Bcl-2 protein family ( 57 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268223 10671549 373668 1576 990 BCL2 Bcl-2 Bcl-2 3 4.3 In our experiments Bcl-2 was down-regulated by the GSNO treatment in SH-SY5Y cells whereas 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268224 10671549 373670 1576 990 BCL2 Bcl-2 Bcl-2 15 4.3 prone to NO-induced apoptosis we propose a causative role for Bcl-2 in the increased susceptibility of G93A cells to apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268225 10671549 373671 1576 990 BCL2 Bcl-2 Bcl-2 9 4.3 It has been suggested that the antiapoptotic effects of Bcl-2 be at least in part due to its antioxidant activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268226 10671549 373672 1576 990 BCL2 Bcl-2 Bcl-2 38 4.3 modulators of physiological signal transduction ( 60 is increased when Bcl-2 is down-regulated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268227 10671549 373677 20996 11179 SOD1 SOD SOD 24 2.4 a factor protecting neurons from NO-induced apoptosis whereas the G93A SOD mutant despite high dismutating activity increased intracellular flux of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268231 10671549 373687 1576 990 BCL2 Bcl-2 Bcl-2 6 4.3 A vicious circle including down-regulation of Bcl-2 and deviating redox activity of copper in the G93A mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268239 10671549 373709 22671 11998 TP53 p53 p53 1 5.8 Immunoreactive p53 protein ( C and immunoreactive p21 protein ( D were 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268240 10671549 373709 4059 1784 CDKN1A p21 p21 8 1.4 Immunoreactive p53 protein ( C and immunoreactive p21 protein ( D were measured by Western blotting using monoclonal 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268241 10671549 373712 1576 990 BCL2 Bcl-2 Bcl-2 0 4.3 Bcl-2 content of SH-SY5Y cells and effects on it by Cu 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268242 10671549 373713 1576 990 BCL2 Bcl-2 Bcl-2 0 4.3 Bcl-2 immunoreactive protein was detected by Western blotting using a monoclonal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268245 10671549 373739 20996 11179 SOD1 SOD SOD 0 2.4 SOD activity (not not shown and protein levels of WT and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268246 10671549 373740 20996 11179 SOD1 SOD SOD 1 2.4 Furthermore SOD activity of the three cell lines was unaffected by GSNO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268247 10671549 373740 20996 11179 SOD1 SOD SOD 19 2.4 by GSNO treatment (not not shown as well as the SOD protein content as assessed by Western blot analysis (Fig Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268248 10671549 373742 22671 11998 TP53 p53 p53 7 5.8 Apoptotic Markers Cytochrome c Release Caspase Activation p53 Accumulation p21 Increase and Bcl2 Down-regulation-- To examine the sequence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268249 10671549 373742 4059 1784 CDKN1A p21 p21 9 1.4 Apoptotic Markers Cytochrome c Release Caspase Activation p53 Accumulation p21 Increase and Bcl2 Down-regulation-- To examine the sequence of events 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268250 10671549 373742 1576 990 BCL2 Bcl2 Bcl2 12 1.0 Cytochrome c Release Caspase Activation p53 Accumulation p21 Increase and Bcl2 Down-regulation-- To examine the sequence of events occurring upon GSNO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268251 10671549 373749 22671 11998 TP53 p53 p53 4 5.8 The tumor suppressor gene p53 is known to be a member of the DNA damage-response 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268252 10671549 373750 22671 11998 TP53 p53 p53 5 5.8 It has been demonstrated that p53 protein increases in response to NO donors and that it 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268253 10671549 373751 22671 11998 TP53 p53 p53 6 5.8 Fig 3 C shows that the p53 protein was stably expressed in neuroblastoma cells to a varying 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268254 10671549 373751 22671 11998 TP53 p53 p53 25 5.8 a varying extent in particular WT cells showed a lower p53 protein level with respect to SH-SY5Y cells and G93A cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268255 10671549 373752 22671 11998 TP53 p53 p53 3 5.8 Upon GSNO treatment p53 significantly accumulated even in the WT cells reaching comparable values 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268256 10671549 373754 22671 11998 TP53 p53 p53 16 5.8 almost disappeared after GSNO treatment supporting the current opinion that p53 activation involves phosphorylation of the protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268257 10671549 373755 22671 11998 TP53 p53 p53 6 5.8 In response to DNA damage human p53 is phosphorylated within its transactivation domain at serine 15 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268258 10671549 373756 22671 11998 TP53 p53 p53 8 5.8 In order to confirm further a role for p53 activation in the GSNO-mediated toxicity we analyze the expression of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268259 10671549 373756 4059 1784 CDKN1A p21 p21 19 1.4 activation in the GSNO-mediated toxicity we analyze the expression of p21 which is a potent inhibitor of cell cycle kinases also 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268260 10671549 373757 22671 11998 TP53 p53 p53 8 5.8 It has been demonstrated that ectopic expression of p53 alone could induce p21 expression followed by p21 cleavage and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268261 10671549 373757 4059 1784 CDKN1A p21 p21 12 1.4 been demonstrated that ectopic expression of p53 alone could induce p21 expression followed by p21 cleavage and apoptosis ( 43 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268262 10671549 373757 4059 1784 CDKN1A p21 p21 16 1.4 expression of p53 alone could induce p21 expression followed by p21 cleavage and apoptosis ( 43 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268263 10671549 373758 4059 1784 CDKN1A p21 p21 5 1.4 Fig 3 D shows that p21 is expressed in SH-SY5Y cells and that the protein accumulated 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.00153772593219844<>ScoreDetail__1784|CDKN1A|0.00153772593219844__11616|TCEAL1|0.000796080832823025__ 0 0 0 0 0 268264 10671549 373760 22671 11998 TP53 p53 p53 13 5.8 a 2-fold indication as follows first it is confirmatory of p53 activation and second it indicates that G93A (at at higher 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268265 10671549 373761 1576 990 BCL2 Bcl-2 Bcl-2 0 4.3 Bcl-2 protein modulation is responsible for cell survival or suicide constitutive 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268266 10671549 373761 1576 990 BCL2 Bcl-2 Bcl-2 14 4.3 responsible for cell survival or suicide constitutive expression of high Bcl-2 protein levels by transfection experiments has proven that Bcl-2 or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268267 10671549 373761 1576 990 BCL2 Bcl-2 Bcl-2 23 4.3 high Bcl-2 protein levels by transfection experiments has proven that Bcl-2 or related family members can protect cells from NO-mediated apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268268 10671549 373762 1576 990 BCL2 Bcl-2 Bcl-2 18 4.3 analysis untreated SH-SY5Y and WT cells express high levels of Bcl-2 protein whereas G93A cells show a much lower content (Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268269 10671549 373762 1576 990 BCL2 Bcl-2 Bcl-2 37 4.3 content (Fig Fig 4 48 h of GSNO treatment decreased Bcl-2 expression although to a different extent in particular Bcl-2 content 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268270 10671549 373762 1576 990 BCL2 Bcl-2 Bcl-2 46 4.3 decreased Bcl-2 expression although to a different extent in particular Bcl-2 content of G93A cells was at the limit of detection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268271 10671549 373763 20996 11179 SOD1 SOD SOD 43 2.4 apoptosis of G93A cells cannot be explained in terms of SOD level 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268273 10671549 373768 20996 11179 SOD1 SOD SOD 15 2.4 or hydroxyl radical formation has been demonstrated for fully active SOD mutants associated with FALS ( 47 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268275 10671549 373775 20996 11179 SOD1 SOD SOD 19 2.4 not significantly affected either by the transfection with the mutant SOD or by the GSNO treatment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 263998 10742195 364641 2163 1325 C4BPA PrP PrP 30 1.9 a theme echoed in the recent proposal that A_amp_#x3b2 and PrP the proteins respectively involved in Alzheimer_amp_#x2019 s disease and prion 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264000 10742195 364687 20291 11014 SLC30A3 ZNT3 ZnT3 21 1.0 have cloned and characterized in the past five years is ZnT3 whose protein resides on synaptic vesicle membranes of zinc-containing neurons 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264001 10742195 364688 20291 11014 SLC30A3 ZNT3 ZnT3 3 1.0 The phenotype of ZnT3 knockout mice was recently reported by this group 7 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264002 10742195 364693 3838 1613 CCS CCS CCS 23 0.9 the elaboration of the copper chaperone of superoxide dismutase (CCS) CCS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264003 10742195 364695 3838 1613 CCS CCS CCS 1 0.9 Recently CCS was reported to play an essential role in loading Cu 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264004 10742195 364695 20996 11179 SOD1 SOD SOD 16 1.4 essential role in loading Cu 2 onto superoxide dismutase (SOD)1 SOD 1 under conditions of low cytosolic Cu 2 8 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264005 10742195 364696 20996 11179 SOD1 SOD1 SOD1 16 1.9 it shows that the cell possesses machinery to ensure that SOD1 antioxidant activity (which which depends upon a Cu 2 catalytic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264006 10742195 364697 20996 11179 SOD1 SOD1 SOD1 5 1.9 It is proposed that although SOD1 has a very high affinity (femtomolar) femtomolar Cu 2 -binding 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264007 10742195 364697 3838 1613 CCS CCS CCS 20 0.9 (femtomolar) femtomolar Cu 2 -binding site and does not require CCS to be loaded with Cu 2 when Cu 2 is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264008 10742195 364697 3838 1613 CCS CCS CCS 53 0.9 so low (less less than one atom per cell that CCS facilitates Cu 2 loading onto SOD1 by competing against the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264009 10742195 364697 20996 11179 SOD1 SOD1 SOD1 59 1.9 atom per cell that CCS facilitates Cu 2 loading onto SOD1 by competing against the pool of cytosolic Cu 2 scavengers 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264010 10742195 364698 3838 1613 CCS CCS CCS 4 0.9 The crystal structure of CCS reveals a dimeric protein with one domain resembling the metallochaperone 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264011 10742195 364698 1277 798 ATOX1 ATX1 Atx1 16 2.1 a dimeric protein with one domain resembling the metallochaperone protein Atx1 and a second domain resembling SOD1 itself but lacking its 2 JUMiner_v2.2 1 0 0 2 798 TotalCon:2<>10548|ATXN1|6310|Complete__798|ATOX1|475|Complete__<>AvaiableGeneRif=2<>BEST:798|ATOX1|0.000931343788486646<>ScoreDetail__10548|ATXN1|0.00045331700007959__798|ATOX1|0.000931343788486646__ 0 0 0 0 0 264012 10742195 364698 20996 11179 SOD1 SOD1 SOD1 22 1.9 resembling the metallochaperone protein Atx1 and a second domain resembling SOD1 itself but lacking its metal-binding sites and catalytic-site residues 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264013 10742195 364699 3838 1613 CCS CCS CCS 3 0.9 The work on CCS the Cu 2 ATPases and MT underscores the understanding that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264014 10742195 364701 23482 12442 TYR tyrosinase tyrosinase 19 1.0 function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2 hydroxylase free or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264015 10742195 364704 20996 11179 SOD1 SOD1 SOD1 51 1.9 unlikely to play any role in disease biochemistry outside of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264016 10742195 364712 20996 11179 SOD1 SOD1 SOD1 4 1.9 Familial amyotrophic lateral sclerosis SOD1 and copper 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264017 10742195 364713 20996 11179 SOD1 SOD SOD 16 1.4 the elucidation of how a mutation of Cu/Zn Cu Zn SOD (SOD1) SOD1 engenders a gain of function that changes this 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264018 10742195 364713 20996 11179 SOD1 SOD1 SOD1 17 1.9 of how a mutation of Cu/Zn Cu Zn SOD (SOD1) SOD1 engenders a gain of function that changes this ubiquitous antioxidant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264019 10742195 364714 20996 11179 SOD1 SOD1 SOD1 13 1.9 abundant literature on the oxidative insult caused by the FALS-linked SOD1 mutation 15 and 16 as well as the formation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264020 10742195 364714 20996 11179 SOD1 SOD1 SOD1 26 1.9 mutation 15 and 16 as well as the formation of SOD1 aggregates in affected motor neurons and glia 17 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264021 10742195 364717 20996 11179 SOD1 SOD1 SOD1 17 1.9 I believe will become fundamental not only to understanding how SOD1 mutations cause FALS but also how well known toxic proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264022 10742195 364717 2163 1325 C4BPA PrP PrP 32 1.9 also how well known toxic proteins such as A_amp_#x3b2 and PrP could function as antioxidants (see see below 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264023 10742195 364719 20996 11179 SOD1 SOD SOD 4 1.4 Alone it has a SOD activity with a rate constant the same as SOD1 itself 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264024 10742195 364719 20996 11179 SOD1 SOD1 SOD1 13 1.9 a SOD activity with a rate constant the same as SOD1 itself 18 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264025 10742195 364720 20996 11179 SOD1 SOD1 SOD1 4 1.9 The purpose of the SOD1 protein is to harness this activity of Cu 2 without 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264026 10742195 364721 20996 11179 SOD1 SOD1 SOD1 9 1.9 Hence the Cu 2 at the active site of SOD1 has the potential to be abnormally redox reactive generating unwanted 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264027 10742195 364722 20996 11179 SOD1 SOD1 SOD1 21 1.9 19 describing a likely mechanism for the pathogenicity of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264028 10742195 364723 20996 11179 SOD1 SOD1 SOD1 2 1.9 The pathogenic SOD1 mutations do not cause a loss of function when the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264029 10742195 364724 20996 11179 SOD1 SOD SOD 14 1.4 al 19 observed that altered Cu 2 coordination made Zn-deficient SOD (wild wild type or mutant a more efficient oxidant able 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264030 10742195 364725 20996 11179 SOD1 SOD SOD 5 1.4 The altered reactivity of Zn-deficient SOD enables it to be reduced by cellular reductants (such such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264031 10742195 364726 20996 11179 SOD1 SOD SOD 0 1.4 SOD then donates an electron to O 2 to generate O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264032 10742195 364727 20996 11179 SOD1 SOD1 SOD1 2 1.9 Thus if SOD1 loses Zn 2 its catalytic activity is diminished while it 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264033 10742195 364728 20996 11179 SOD1 SOD1 SOD1 7 1.9 The O 2 _amp_#x2212 formed by Zn-deficient SOD1 might not be released as a free intermediate which would 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264034 10742195 364728 20996 11179 SOD1 SOD1 SOD1 21 1.9 released as a free intermediate which would explain why excess SOD1 fails to slow disease progression in FALS/SOD1 FALS SOD1 transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264035 10742195 364728 20996 11179 SOD1 SOD1 SOD1 28 1.9 excess SOD1 fails to slow disease progression in FALS/SOD1 FALS SOD1 transgenic mice 17 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264036 10742195 364729 20996 11179 SOD1 SOD1 SOD1 10 1.9 Intriguingly Estevez et al 19 found that apo SOD1 was not neurotoxic in cell culture whereas Zn-deficient Cu-loaded SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264037 10742195 364729 20996 11179 SOD1 SOD1 SOD1 20 1.9 SOD1 was not neurotoxic in cell culture whereas Zn-deficient Cu-loaded SOD1 was neurotoxic an effect that could be rescued by treatment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264038 10742195 364729 20996 11179 SOD1 SOD1 SOD1 48 1.9 the treatment efficacy of Cu 2 chelators upon FALS/SOD1 FALS SOD1 transgenic mice 22 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264039 10742195 364733 926 620 APP amyloid amyloid 4 1.0 Familial AD-linked mutations of amyloid precursor protein (APP), APP presenilin-1 and presenilin-2 increase both cerebral 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 264040 10742195 364733 926 620 APP APP APP 7 0.3 Familial AD-linked mutations of amyloid precursor protein (APP), APP presenilin-1 and presenilin-2 increase both cerebral A_amp_#x3b2 burden and A_amp_#x3b2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264041 10742195 364734 12369 6893 MAPT tau tau 26 0.3 many of the other neuropathological features of AD including intraneuronal tau abnormalities and neuronal loss 23 as well as signs of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264042 10742195 364735 926 620 APP amyloid amyloid 29 1.0 minor free soluble species in biological fluids is enriched in amyloid deposits 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 264043 10742195 364741 926 620 APP amyloid amyloid 45 1.0 perhaps explaining why these animals do not form cerebral A_amp_#x3b2 amyloid 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 264045 10742195 364742 912 613 APOE APOE apoE 10 1.3 We have also reported 25 that apolipoprotein E (apoE) apoE modulates the precipitation of A_amp_#x3b2 by Cu 2 and Zn 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264046 10742195 364742 912 613 APOE APOE apoE 27 1.3 by Cu 2 and Zn 2 which is important because apoE isoforms segregate with the genetic risk for AD inheritance of 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264047 10742195 364746 926 620 APP amyloid amyloid 4 1.0 Zn 2 in A_amp_#x3b2 amyloid deposits has recently been detected by histological fluorescent techniques in 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 264048 10742195 364753 926 620 APP amyloid amyloid 28 1.0 that we have found on human A_amp_#x3b2 extracted from AD amyloid 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 264049 10742195 364762 20996 11179 SOD1 SOD SOD-like 18 1.4 cell-culture data indicate that Cu/Zn-loaded Cu Zn-loaded A_amp_#x3b2 possesses catalytic SOD-like activity and that A_amp_#x3b2 1-42 has greater activity than A_amp_#x3b2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264050 10742195 364763 20996 11179 SOD1 SOD1 SOD1 18 1.9 be mechanistically related to the oxidative stress induced by mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264053 10742195 364766 2163 1325 C4BPA PrP PrP 6 1.9 The infectious particle is a protein PrP Sc that collects in the CJD-affected brain and is a 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264055 10742195 364766 2163 1325 C4BPA PrP PrP 26 1.9 is a modified and protease-resistant form of a ubiquitous protein PrP c 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264056 10742195 364767 2163 1325 C4BPA PrP PrP 25 1.9 was the publication by David Brown et al 35 that PrP c possesses SOD activity 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264057 10742195 364767 20996 11179 SOD1 SOD SOD 28 1.4 by David Brown et al 35 that PrP c possesses SOD activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264058 10742195 364768 2163 1325 C4BPA PrP PrP 15 1.9 of the earlier work of Brown (and and others characterizing PrP c as a Cu 2 -binding protein exhibiting high-affinity cooperative 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264059 10742195 364769 926 620 APP APP APP 6 0.3 Therefore it is especially intriguing that APP the A_amp_#x3b2 precursor which has second Cu 2 -binding and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264060 10742195 364769 2163 1325 C4BPA PrP PrP 52 1.9 out of cells 40 an activity resembling that proposed for PrP c 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264061 10742195 364770 2163 1325 C4BPA PrP PrP 1 1.9 Unlike PrP c interaction with Cu 2 37 the A_amp_#x3b2 precursor interaction 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264062 10742195 364771 20996 11179 SOD1 SOD SOD 1 1.4 The SOD activity of PrP c is also intriguing because of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264063 10742195 364771 2163 1325 C4BPA PrP PrP 4 1.9 The SOD activity of PrP c is also intriguing because of the neuropathological similarities between 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264065 10742195 364772 2163 1325 C4BPA PrP PrP 2 1.9 Assuming that PrP c and A_amp_#x3b2 are indeed also physiological SOD-type antioxidants then 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264068 10742195 364774 20996 11179 SOD1 SOD1 SOD1 2 1.9 Like mutant SOD1 PrP sc might be a modification of PrP that induces 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264069 10742195 364774 2163 1325 C4BPA PrP PrP 3 1.9 Like mutant SOD1 PrP sc might be a modification of PrP that induces a 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264070 10742195 364774 2163 1325 C4BPA PrP PrP 10 1.9 Like mutant SOD1 PrP sc might be a modification of PrP that induces a Cu 2 -related gain of function perhaps 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264071 10742195 364775 2163 1325 C4BPA PrP PrP 13 1.9 supported by recent reports that Cu 2 treatment of denatured PrP Sc restores protease resistance and infectivity 42 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264072 10742195 364776 2163 1325 C4BPA PrP PrP 8 1.9 Also the respective conformations of strain variants of PrP Sc have now been reported to depend upon Cu 2 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264073 10742195 364777 2163 1325 C4BPA PrP PrP 12 1.9 Recently we have reported 44 that the copper-binding domain of PrP c reduces Cu 2 and uses O 2 to produce 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264076 10742195 364781 20996 11179 SOD1 SOD1 SOD1 2 1.9 In normal SOD1 Cu A_amp_#x3b2 or PrP c the Cu 2 active site 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264077 10742195 364781 2163 1325 C4BPA PrP PrP 5 1.9 In normal SOD1 Cu A_amp_#x3b2 or PrP c the Cu 2 active site would be shielded from 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.00135577372604021<>ScoreDetail__1325|C4BPA|0.000940860215053763__47|ABCB6|0.0003584229390681__9353|PRDX2|0.00135577372604021__9449|PRNP|0.000841788623648039__ 0 0 0 0 0 264078 10742195 364799 20996 11179 SOD1 SOD SOD 2 1.4 A manganese SOD SOD2 is the mitochondrial equivalent of SOD1 preventing O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264079 10742195 364799 20997 11180 SOD2 SOD2 SOD2 3 0.9 A manganese SOD SOD2 is the mitochondrial equivalent of SOD1 preventing O 2 _amp_#x2212 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264080 10742195 364799 20996 11179 SOD1 SOD1 SOD1 9 1.9 A manganese SOD SOD2 is the mitochondrial equivalent of SOD1 preventing O 2 _amp_#x2212 from reacting with sensitive substrates such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264081 10742195 364799 166 118 ACO2 aconitase aconitase 21 1.3 O 2 _amp_#x2212 from reacting with sensitive substrates such as aconitase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264082 10742195 364800 20997 11180 SOD2 SOD2 SOD2 3 0.9 Knockout mice for SOD2 die within the first week of life from heart failure 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264083 10742195 364802 20997 11180 SOD2 SOD2 SOD2 13 0.9 the heart failure and subsequent early neonatal death of the SOD2 knockout mice the ROS produced within the developing brain reach 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264085 10742195 364803 20997 11180 SOD2 SOD2 SOD2 4 0.9 By two weeks the SOD2 mutant mice develop a profound spongiform encephalopathy accompanied by gliosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 265595 10795881 367404 20996 11179 SOD1 SOD1 SOD1 10 1.4 In one or two percentage of patients mutations in the SOD1 gene are known to underly the disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 265596 10795881 367407 20996 11179 SOD1 SOD1 SOD1-related 11 0.9 evidence for oxidative stress is not only found in mutant SOD1-related familial amyotrophic lateral sclerosis but also in sporadic amyotrophic lateral 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 266053 10826922 368226 20996 11179 SOD1 SOD SODs 4 1.4 Eight mutant Cu Zn-superoxide dismutases (SODs) SODs related to familial amyotrophic lateral sclerosis (FALS) FALS were produced 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 266054 10826922 368227 20996 11179 SOD1 SOD SOD 14 1.4 with Chelex 100 resin decreased Cu contents as well as SOD activities in all mutant Cu Zn-SODs indicating that the affinities 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 266055 10826922 368229 20996 11179 SOD1 SOD SOD 1 1.4 Both SOD activities and their reactive oxidant forming correlated well with the 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 266056 10826922 368231 20996 11179 SOD1 SOD1 SOD1 8 1.4 Since hyaline inclusions found in FALS patients with SOD1 mutations contained components which were reactive to anti-Cu Zn-SOD antibody 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 266057 10826922 368231 20996 11179 SOD1 SOD1 SOD1 24 1.4 to anti-Cu Zn-SOD antibody a primary reaction caused by mutant SOD1 may be attributed to their propensity to form aggregates 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 266058 10826922 368232 20996 11179 SOD1 SOD1 SOD1 5 1.4 Aggregated but still active mutant SOD1 would be expected to mediate the formation of reactive oxygen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 261644 10899935 360033 20996 11179 SOD1 SOD1 SOD1 23 0.9 by overexpression of wild-type antioxidant Cu Zn superoxide dismutase (SOD1) SOD1 that promotes CN activity and protects it from oxidative inactivation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 261645 10899935 360034 20996 11179 SOD1 SOD1 SOD1s 6 0.9 On the contrary overexpression of mutant SOD1s associated with familial amyotrophic lateral sclerosis (FALS) FALS impairs CN 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 261646 10899935 360035 20996 11179 SOD1 SOD1 SOD1-linked 13 0.9 that CN might be a target in the pathogenesis of SOD1-linked FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262248 10930589 361584 20996 11179 SOD1 SOD1 SOD1 20 5.1 is associated with more than 70 different mutations in the SOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262249 10930589 361585 20996 11179 SOD1 SOD1 SOD1 16 5.1 lines derived from FALS patients with 16 different mutations in SOD1 gene exhibit significant increase of intracellular reactive oxygen species (ROS) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262254 10930589 361586 20996 11179 SOD1 SOD1 SOD1 7 5.1 The ROS generation did not correlate with SOD1 activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262259 10930589 361591 20996 11179 SOD1 SOD1 SOD1 17 5.1 increased H 2 O 2 could be generated by mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262262 10930589 361596 20996 11179 SOD1 SOD1 SOD1 19 5.1 in the gene for cytosolic Cu Zn superoxide dismutase ( SOD1 CuZnSOD 1 and 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262263 10930589 361597 20996 11179 SOD1 SOD1 SOD1 0 5.1 SOD1 functions as a homodimeric enzyme that is widely expressed and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262264 10930589 361598 20996 11179 SOD1 SOD1 SOD1 4 5.1 The mechanisms by which SOD1 mutations cause selective motor neuron degeneration is not clearly understood 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262265 10930589 361599 20996 11179 SOD1 SOD1 SOD1 1 5.1 However SOD1 activity in red blood cells of most SOD1 mutant heterozygotes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262266 10930589 361599 20996 11179 SOD1 SOD1 SOD1 9 5.1 However SOD1 activity in red blood cells of most SOD1 mutant heterozygotes is reduced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262267 10930589 361600 20996 11179 SOD1 SOD1 SOD1 12 5.1 be less than 50% in some cases suggesting that mutant SOD1 may affect the activity of the wildtype enzyme 2 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262268 10930589 361601 20996 11179 SOD1 SOD1 SOD1 2 5.1 Evidence from SOD1 transgenic mice and SOD1 knockout mice suggests that reduced dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262269 10930589 361601 20996 11179 SOD1 SOD1 SOD1 6 5.1 Evidence from SOD1 transgenic mice and SOD1 knockout mice suggests that reduced dismutase activity is not the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262270 10930589 361602 20996 11179 SOD1 SOD1 SOD1 1 5.1 Decreased SOD1 activity in ALS patients would be expected to lead to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262272 10930589 361603 20996 11179 SOD1 SOD1 SOD1 1 5.1 Mutant SOD1 was shown to have increased peroxidase activity over wildtype SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262273 10930589 361603 20996 11179 SOD1 SOD1 SOD1 11 5.1 SOD1 was shown to have increased peroxidase activity over wildtype SOD1 in vitro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262274 10930589 361604 20996 11179 SOD1 SOD1 SOD1 2 5.1 Thus mutant SOD1 may produce more free radicals than wild SOD1 7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262275 10930589 361604 20996 11179 SOD1 SOD1 SOD1 10 5.1 Thus mutant SOD1 may produce more free radicals than wild SOD1 7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262276 10930589 361605 20996 11179 SOD1 SOD1 SOD1 15 5.1 show any difference in peroxidase activity of mutant and wildtype SOD1 8 and 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262277 10930589 361606 20996 11179 SOD1 SOD1 SOD1 12 5.1 was shown this discrepancy was due to different preparations of SOD1 proteins and experimental conditions 8 and 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262279 10930589 361607 20996 11179 SOD1 SOD1 SOD1 17 5.1 (ROS) ROS in lymphoblast cell lines derived from patients with SOD1 linked FALS sporadic ALS and normal controls (spouses spouses of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262282 10930589 361609 20996 11179 SOD1 SOD1 SOD1 28 5.1 were similar in all groups despite a 45% decrease in SOD1 activity in FALS mutants 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262284 10930589 361631 20996 11179 SOD1 SOD SOD 0 2.2 SOD assay 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262285 10930589 361632 20996 11179 SOD1 SOD SOD 1 2.2 Total SOD activity was determined by its ability to catalyze the disproportionation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262286 10930589 361634 20997 11180 SOD2 MnSOD MnSOD 9 1.9 Cyanide (3 3 mM was used to distinguish between resistant MnSOD and the sensitive CuZnSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262289 10930589 361648 20996 11179 SOD1 SOD1 SOD1 10 5.1 No significant correlation was observed between relative C-DCF fluorescence and SOD1 activity in all groups at resting levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262290 10930589 361649 20996 11179 SOD1 SOD1 SOD1 14 5.1 with menadione showed an inverse correlation of C-DCF fluorescence with SOD1 activity ( r =0.6 P _amp_#x3c 0.001 ( Table 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262292 10930589 361652 20996 11179 SOD1 SOD1 SOD1 17 5.1 is unlikely to be increased in FALS cells despite reduced SOD1 activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262295 10930589 361655 20996 11179 SOD1 SOD1 SOD1 5 5.1 Previous studies have shown that SOD1 is inhibited by a number of metal chelating agents e.g 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262297 10930589 361656 20996 11179 SOD1 SOD1 SOD1 2 5.1 Reaction of SOD1 with DDC requires two molecule of DDC (i) i one 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262298 10930589 361656 20996 11179 SOD1 SOD1 SOD1 19 5.1 (i) i one molecule interacts with the copper center of SOD1 with retention of activity (ii) ii while a second molecule 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262307 10930589 361662 20996 11179 SOD1 SOD1 SOD1 8 5.1 This suggests the interaction of DDC with mutant SOD1 may be altered and that wildtype SOD1 contributes approximately 30_amp_#x2013 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262308 10930589 361662 20996 11179 SOD1 SOD1 SOD1 15 5.1 DDC with mutant SOD1 may be altered and that wildtype SOD1 contributes approximately 30_amp_#x2013 50% of C-DCF fluorescence in resting cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262311 10930589 361665 20996 11179 SOD1 SOD1 SOD1 0 5.1 SOD1 is a major source of H 2 O 2 in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262312 10930589 361674 14533 7872 NOS1 NOS NOS 23 1.2 ascorbic acid -nitroarginine an inhibitor of nitric oxide synthase (NOS) NOS 27 did not affect the C-DCF fluorescence in resting cells 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000703463367777734<>ScoreDetail__7873|NOS2A|0.000703463367777734__7872|NOS1|0.000654307898112955__ 0 0 0 0 0 262313 10930589 361675 14533 7872 NOS1 NOS NOS 25 1.2 all groups with -nitroarginine treatment suggesting a protective role of NOS in menadione stressed cells 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000703463367777734<>ScoreDetail__7873|NOS2A|0.000703463367777734__7872|NOS1|0.000654307898112955__ 0 0 0 0 0 262314 10930589 361680 20996 11179 SOD1 SOD1 SOD1 3 5.1 Since mutations in SOD1 are associated with FALS and activity of SOD1 is decreased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262315 10930589 361680 20996 11179 SOD1 SOD1 SOD1 11 5.1 mutations in SOD1 are associated with FALS and activity of SOD1 is decreased (primarily primarily due to decreased half life of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262316 10930589 361680 20996 11179 SOD1 SOD1 SOD1 22 5.1 decreased (primarily primarily due to decreased half life of mutant SOD1 we investigated whether this would lead to increased free radical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262317 10930589 361683 20996 11179 SOD1 SOD1 SOD1 15 5.1 O 2 ._amp_#x2212 is cleared very quickly from cells by SOD1 28 even when SOD1 is reduced by 50% 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262318 10930589 361683 20996 11179 SOD1 SOD1 SOD1 21 5.1 cleared very quickly from cells by SOD1 28 even when SOD1 is reduced by 50% 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262319 10930589 361686 20996 11179 SOD1 SOD1 SOD1 7 5.1 Our hypothesis is that copper in mutant SOD1 is available to O 2 ._amp_#x2212 only or mostly in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262320 10930589 361687 20996 11179 SOD1 SOD1 SOD1 18 5.1 it is reported to have a greater interaction with mutant SOD1 than with wildtype SOD1 7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262321 10930589 361687 20996 11179 SOD1 SOD1 SOD1 22 5.1 have a greater interaction with mutant SOD1 than with wildtype SOD1 7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262322 10930589 361688 20996 11179 SOD1 SOD1 SOD1 16 5.1 hypothesis of increased H 2 O 2 generation by mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262323 10930589 361691 20996 11179 SOD1 SOD1 SOD1 10 5.1 has shown that DDC reacts with Cu(II) Cu II of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262326 10930589 361693 20996 11179 SOD1 SOD1 SOD1 5 5.1 The reaction of DDC with SOD1 was shown to occur in two phases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262329 10930589 361695 20996 11179 SOD1 SOD1 SOD1 16 5.1 a modest concentration of DDC (0.1_amp_#x2013;1.0 0.1_amp_#x2013 1.0 mM and SOD1 retains its full dismutase activity 19 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262331 10930589 361696 20996 11179 SOD1 SOD1 SOD1 7 5.1 Phase 2 involves displacement of Cu(II) Cu II from SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262332 10930589 361697 20996 11179 SOD1 SOD1 SOD1 17 5.1 Cu(II) Cu II polymerize into colloidal particles stabilized by unfolded SOD1 protein subunits 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262334 10930589 361698 20996 11179 SOD1 SOD1 SOD1 21 5.1 equal to 10 mM and leads to a loss of SOD1 dismutase activity 19 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262336 10930589 361699 20996 11179 SOD1 SOD1 SOD1 3 5.1 The contribution of SOD1 to C-DCF fluorescence in our studies was demonstrated by using 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262338 10930589 361700 20996 11179 SOD1 SOD1 SOD1 14 5.1 Fig 3A and B suggests that hydrogen peroxide generated by SOD1 was indeed involved in the oxidation of C-DCDHF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262339 10930589 361701 20996 11179 SOD1 SOD1 SOD1 22 5.1 cells suggesting either altered interaction or modified stoichiometry between mutant SOD1 and DDC 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262342 10930589 361702 14533 7872 NOS1 NOS NOS 19 1.2 vitamin C and the flavinoid quercetin but not inhibitor of NOS supports the conclusion that C-DCDHF was oxidized by H 2 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000703463367777734<>ScoreDetail__7873|NOS2A|0.000703463367777734__7872|NOS1|0.000654307898112955__ 0 0 0 0 0 262343 10930589 361703 14533 7872 NOS1 NOS NOS 18 1.2 biological membranes against lipid peroxidation and -nitroarginine (inhibitor inhibitor of NOS showed no effect in ROS levels of all groups tested 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000703463367777734<>ScoreDetail__7873|NOS2A|0.000703463367777734__7872|NOS1|0.000654307898112955__ 0 0 0 0 0 262345 10930589 361707 20996 11179 SOD1 SOD1 SOD1 35 5.1 2 O 2 damage due to increased concentrations of mutant SOD1 in these cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262346 10930589 361708 20996 11179 SOD1 SOD1 SOD1 5 5.1 Such an accumulation of mutant SOD1 has been reported in FALS spinal cords 33 and could 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 255944 11020331 350862 14921 8125 OGG1 OGG1 OGG1 15 0.6 either endonuclease III from Escherichia coli or 8-oxoguanine N-glycosylase (OGG1) OGG1 from yeast investigators can rapidly determine the amount of oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 255945 11020331 350862 14921 8125 OGG1 OGG1 OGG1-sensitive 34 0.6 pyrimidine damage (endonuclease endonuclease III-sensitive sites or purine damage (OGG1-sensitive OGG1-sensitive sites in cellular DNA respectively 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257588 11050436 352957 20997 11180 SOD2 MnSOD MnSOD-depleted 21 1.9 inhibitors on superoxide production in isolated whole mitochondria compared with MnSOD-depleted submitochondrial particles also suggests that there is a sidedness to 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257589 11050436 352958 20997 11180 SOD2 MnSOD MnSOD 32 1.9 is likewise suggested by the presence of appreciable levels of MnSOD in the mitochondrial matrix and the comparatively low levels of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257590 11050436 352958 20997 11180 SOD2 MnSOD MnSOD 49 1.9 comparatively low levels of superoxide production by whole mitochondria containing MnSOD ( Ref 23 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257592 11050436 352964 166 118 ACO2 aconitase aconitase 8 1.3 For example damage to the cytosolic isoenzyme of aconitase evident after exposure to superoxide results in the release of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257593 11050436 352965 166 118 ACO2 aconitase aconitase 8 1.3 The damage to other systems such as mitochondrial aconitase complex I and succinate dehydrogenase which also have important functional 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257594 11050436 352965 20997 11180 SOD2 MnSOD MnSOD 25 1.9 also have important functional iron-sulphur centres becomes very pronounced in MnSOD knockout mice where superoxide produced in the mitochondria is not 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257595 11050436 352969 20997 11180 SOD2 MnSOD MnSOD 25 1.9 birth with the severe phenotypic changes evident in mice lacking MnSOD which suggests that either the mitochondria are more susceptible to 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257596 11050436 352972 20997 11180 SOD2 MnSOD MnSOD 27 1.9 from patients with complex I deficiency displayed significant elevations of MnSOD sometimes two- to threefold whereas patients with defects in complex 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257597 11050436 352974 20997 11180 SOD2 MnSOD MnSOD 21 1.9 symptoms (EI EI and CD were less likely to induce MnSOD above the basal levels normally seen in fibroblasts whereas patients 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257598 11050436 352974 20997 11180 SOD2 MnSOD MnSOD 46 1.9 LD FILA which were usually fatal always had elevations of MnSOD ( 20 and 27 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257599 11050436 352975 20997 11180 SOD2 MnSOD MnSOD 17 1.9 increased superoxide production from complex I with no increase in MnSOD ( 26 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257600 11050436 352976 20997 11180 SOD2 MnSOD MnSOD 8 1.9 The correlation of increased levels of expression of MnSOD with a poor prognosis in complex I deficiency suggests that 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257601 11050436 352976 20997 11180 SOD2 MnSOD MnSOD 26 1.9 deficiency suggests that responding to the increased superoxide by inducing MnSOD could itself be detrimental in the long term because of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257602 11050436 352977 20997 11180 SOD2 MnSOD MnSOD 16 1.9 radical were demonstrated in cell lines with increased induction of MnSOD ( 28 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257603 11050436 352978 20997 11180 SOD2 MnSOD MnSOD 42 1.9 to form increased amounts of superoxide (iv) iv induction of MnSOD (v) v increased formation of hydrogen peroxide from superoxide via 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257604 11050436 352978 20997 11180 SOD2 MnSOD MnSOD 52 1.9 (v) v increased formation of hydrogen peroxide from superoxide via MnSOD or (vi) vi transformation of hydrogen peroxide to hydroxyl radicals 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257613 11050436 353012 20997 11180 SOD2 MnSOD MnSOD 3 1.9 The overexpression of MnSOD in cultured rat glioma cells made those cells more sensitive 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257614 11050436 353012 20997 11180 SOD2 MnSOD MnSOD 26 1.9 to damage by radiation and carcinogens 45 and 46 whereas MnSOD overexpression in mouse heart is protective against adriamycin-induced cardiotoxicity 47 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257617 11050436 353043 166 118 ACO2 aconitase aconitase 11 1.3 alternative scenario superoxide attacks enzymes (usually usually hydrolyases such as aconitase with 4Fe-4S centres releasing ferrous ions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257618 11050436 353049 14261 7715 NDUFS8 TYKY TYKY 11 1.9 are then passed to two 4Fe-4S centres in the 23-kDa TYKY subunit and a single 4Fe-4S centre in the 20-kDa PSST 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257619 11050436 353049 14260 7714 NDUFS7 PSST PSST 21 1.9 TYKY subunit and a single 4Fe-4S centre in the 20-kDa PSST subunit both of which are associated with the membrane-spanning segment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257620 11050436 353049 14260 7714 NDUFS7 PSST PSST 77 1.9 in the matrix arm of the enzyme and one in PSST 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257621 11050436 353050 14260 7714 NDUFS7 PSST PSST 27 1.9 drawn with a single reduction site encompassing the 49-kDa and PSST subunits at the right-hand side of the complex 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257622 11050436 353051 14260 7714 NDUFS7 PSST PSST 20 1.9 49-kDa subunit and rotenone inhibition of the complex at the PSST subunit are shown but it is possible to draw a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257623 11050436 353052 14261 7715 NDUFS8 TYKY TYKY 4 1.9 Boxes depicted in the TYKY and PSST subunits show the cubic arrangement of the 4Fe-4S 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257624 11050436 353052 14260 7714 NDUFS7 PSST PSST 6 1.9 Boxes depicted in the TYKY and PSST subunits show the cubic arrangement of the 4Fe-4S centres with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257626 11050436 353066 13735 7455 MT-ND1 ND1 ND1 8 0.9 MtDNA genes include those for complex I ( ND1 ND2 ND3 ND4 ND4L ND5 ND6 for complex III ( 1 JUMiner_v2.2 1 0 0 2 16951 TotalCon:2<>16951|IVNS1ABP|10625|Complete__7455|MT-ND1|4535|Complete__<>AvaiableGeneRif=2<>BEST:16951|IVNS1ABP|0.000657871550579749<>ScoreDetail__16951|IVNS1ABP|0.000657871550579749__7455|MT-ND1|0.000481349009480008__ 0 0 0 0 0 257627 11050436 353066 13736 7456 MT-ND2 ND2 ND2 10 0.9 MtDNA genes include those for complex I ( ND1 ND2 ND3 ND4 ND4L ND5 ND6 for complex III ( cyt 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257628 11050436 353066 13737 7458 MT-ND3 ND3 ND3 12 0.9 MtDNA genes include those for complex I ( ND1 ND2 ND3 ND4 ND4L ND5 ND6 for complex III ( cyt b 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257629 11050436 353066 13738 7459 MT-ND4 ND4 ND4 14 0.9 genes include those for complex I ( ND1 ND2 ND3 ND4 ND4L ND5 ND6 for complex III ( cyt b for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257630 11050436 353066 13739 7460 MT-ND4L ND4L ND4L 16 1.9 include those for complex I ( ND1 ND2 ND3 ND4 ND4L ND5 ND6 for complex III ( cyt b for complex 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257631 11050436 353066 13740 7461 MT-ND5 ND5 ND5 18 0.9 those for complex I ( ND1 ND2 ND3 ND4 ND4L ND5 ND6 for complex III ( cyt b for complex IV 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257632 11050436 353066 13741 7462 MT-ND6 ND6 ND6 20 0.9 for complex I ( ND1 ND2 ND3 ND4 ND4L ND5 ND6 for complex III ( cyt b for complex IV ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257633 11050436 353066 13729 7414 MT-ATP6 ATP6 ATP6 43 1.9 IV ( COXI COXII COXIII and for complex V ( ATP6 ATP8 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257634 11050436 353066 13730 7415 MT-ATP8 ATP8 ATP8 45 1.9 ( COXI COXII COXIII and for complex V ( ATP6 ATP8 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257637 11050436 353069 20997 11180 SOD2 MnSOD MnSOD 25 1.9 O 2 by CuZnSOD if in the matrix space by MnSOD 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257638 11050436 353070 8759 4553 GPX1 GPX1 GPX-1 13 0.9 peroxide in both compartments is achieved by glutathione peroxidase (GPX-1), GPX-1 which exists both in the cytosol and in the mitochondrial 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 253638 11223912 347837 14533 7872 NOS1 nNOS nNOS 34 2.2 molecules such as calmodulin and neuronal nitric oxide synthase (nNOS), nNOS in the cytoplasm 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 253679 11228742 347972 3889 11919 CD40 p50 p50 14 0.3 in the nervous system is composed of the DNA-binding subunits p50 and p65 complexed with an inhibitory I kappa B-alpha molecule 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 253680 11228742 347972 8569 16769 GORASP1 p65 p65 16 0.1 nervous system is composed of the DNA-binding subunits p50 and p65 complexed with an inhibitory I kappa B-alpha molecule 6 JUMiner_v2.2 1 0 0 2 16769 TotalCon:2<>16769|GORASP1|64689|Complete__11509|SYT1|6857|Complete__<>AvaiableGeneRif=2<>BEST:16769|GORASP1|0.000546746856205577<>ScoreDetail__16769|GORASP1|0.000546746856205577__11509|SYT1|0.000512032770097286__ 0 0 0 0 0 249596 11328670 340452 20997 11180 SOD2 MnSOD MnSOD 3 2.9 Manganese superoxide dismutase (MnSOD) MnSOD is essential for life as dramatically illustrated by the neonatal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249597 11328670 340452 20997 11180 SOD2 MnSOD MnSOD 21 2.9 by the neonatal lethality of mice that are deficient in MnSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249598 11328670 340453 20997 11180 SOD2 MnSOD MnSOD 11 2.9 addition mice expressing only 50% of the normal compliment of MnSOD demonstrate increased susceptibility to oxidative stress and severe mitochondrial dysfunction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249599 11328670 340454 20997 11180 SOD2 MnSOD MnSOD 10 2.9 Thus it is important to know the status of both MnSOD protein levels and activity in order to assess its role 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249600 11328670 340455 20997 11180 SOD2 MnSOD MnSOD 5 2.9 Numerous studies have shown that MnSOD can be induced to protect against pro-oxidant insults resulting from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249601 11328670 340456 20997 11180 SOD2 MnSOD MnSOD 4 2.9 In addition overexpression of MnSOD has been shown to protect against pro-apoptotic stimuli as well 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249602 11328670 340457 20997 11180 SOD2 MnSOD MnSOD 7 2.9 Conversely several studies have reported declines in MnSOD activity during diseases including cancer aging progeria asthma and transplant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249603 11328670 340459 20997 11180 SOD2 MnSOD MnSOD 1 2.9 Certainly MnSOD gene expression or other defects could play a role in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249604 11328670 340460 20997 11180 SOD2 MnSOD MnSOD 9 2.9 However based on recent findings regarding the susceptibility of MnSOD to oxidative inactivation it is equally likely that post-translational modification 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249605 11328670 340460 20997 11180 SOD2 MnSOD MnSOD 21 2.9 oxidative inactivation it is equally likely that post-translational modification of MnSOD may account for the loss of activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249606 11328670 340461 20997 11180 SOD2 MnSOD MnSOD 6 2.9 Our laboratory has recently demonstrated that MnSOD is tyrosine nitrated and inactivated during human kidney allograft rejection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249607 11328670 340462 20997 11180 SOD2 MnSOD MnSOD 29 2.9 nitrate critical tyrosine residues and to induce dityrosine formation in MnSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249608 11328670 340463 20997 11180 SOD2 MnSOD MnSOD 5 2.9 Tyrosine nitration and inactivation of MnSOD would lead to increased levels of superoxide and concomitant increases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 249609 11328670 340464 20997 11180 SOD2 MnSOD MnSOD 7 2.9 This article assesses the important role of MnSOD activity in various pathological states in light of this potentially 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 251528 11396274 343499 20996 11179 SOD1 SOD1 SOD1 2 1.2 Neurochemistry of SOD1 and familial amyotrophic lateral sclerosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242766 11513882 330566 20996 11179 SOD1 SOD1 SOD1 17 6.0 lateral sclerosis (fALS) fALS are linked to mutations in the SOD1 gene which encodes the copper/zinc copper zinc superoxide dismutase (CuZnSOD) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242767 11513882 330569 20996 11179 SOD1 SOD SOD 13 4.3 monitored calcineurin activity in the presence of mutant and wild-type SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242768 11513882 330570 20996 11179 SOD1 SOD SOD 13 4.3 the degree of protection against inactivation of calcineurin by different SOD mutants correlates with the severity of the phenotype associated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242769 11513882 330570 20996 11179 SOD1 SOD1 SOD1 32 6.0 with the different mutations suggesting a potential role for calcineurin_amp_#x2013 SOD1 interaction in the etiology of fALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242770 11513882 330573 20996 11179 SOD1 SOD1 SOD1 3 6.0 Mutations in the SOD1 gene which encodes the enzyme copper/zinc copper zinc superoxide dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242771 11513882 330577 20996 11179 SOD1 SOD1 SOD1 8 6.0 Today more than 70 different mutations of the SOD1 gene are known ranging from mutations that are associated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242772 11513882 330578 20996 11179 SOD1 SOD1 SOD1 5 6.0 Recently it was shown that SOD1 protects calcineurin a serine/threonine-specific serine threonine-specific calcium/calmodulin-dependent calcium calmodulin-dependent phosphoprotein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242774 11513882 330581 20996 11179 SOD1 SOD1 SOD1 20 6.0 the last years the primary molecular targets of the mutated SOD1 in fALS are still unknown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242775 11513882 330583 20996 11179 SOD1 SOD SODs 8 2.2 In this study we report that the mutant SODs were significantly less protective against calcineurin inactivation and that the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242776 11513882 330603 20996 11179 SOD1 SOD SODs 3 2.2 Wt and mutant SODs were purified and demetalated by Ni-NTA-affinity chromatography using imidazole (500 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242777 11513882 330608 20996 11179 SOD1 SOD SOD 0 4.3 SOD assay and activity staining 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242778 11513882 330614 20996 11179 SOD1 SOD SOD 5 4.3 For atomic emission spectrometry (AES), AES SOD proteins were washed five times in refolding buffer (Centrex Centrex 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242782 11513882 330627 20996 11179 SOD1 SOD SOD 28 4.3 okadaic acid (5 5 _amp_#x3bc m 200 _amp_#x3bc g of SOD proteins and water ad 40 _amp_#x3bc l 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242783 11513882 330632 20996 11179 SOD1 SOD1 SOD1 11 6.0 test the hypothesis that calcineurin is a target of mutated SOD1 we used recombinant wt enzyme and three variants associated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242785 11513882 330635 20996 11179 SOD1 SOD SOD 13 4.3 native electropherograms with NBT showed a corresponding pattern with wt SOD showing the highest activity followed by the D90A mutant whereas 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242787 11513882 330642 20996 11179 SOD1 SOD SODs 30 2.2 conveyed the most protection of calcineurin activity of the mutant SODs studied 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242788 11513882 330644 20996 11179 SOD1 SOD SOD 29 4.3 loss of over 60% of the protection confered by wt SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242789 11513882 330645 20996 11179 SOD1 SOD SOD 7 4.3 This effect was not due to reduced SOD activity of the mutant SODs compared to wt when the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242790 11513882 330645 20996 11179 SOD1 SOD SODs 12 2.2 was not due to reduced SOD activity of the mutant SODs compared to wt when the amounts of wt or mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242791 11513882 330645 20996 11179 SOD1 SOD SOD 23 4.3 compared to wt when the amounts of wt or mutant SOD were quadrupled (800 800 ng the loss of protection of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242792 11513882 330645 20996 11179 SOD1 SOD SOD 43 4.3 calcineurin activity was magnified rather than reduced for the fALS SOD mutants ( Fig 2b dark bars however the differences in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242793 11513882 330646 20996 11179 SOD1 SOD SOD 2 4.3 While wt SOD maintained its protective effect on calcineurin activity and co-incubation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242794 11513882 330646 20996 11179 SOD1 SOD SODs 16 2.2 effect on calcineurin activity and co-incubation of calcineurin with the SODs associated with benign (D9OA) D9OA and classic (G93A) G93A fALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242795 11513882 330646 20996 11179 SOD1 SOD SOD 35 4.3 only showed a slight reduction compared to 200 ng of SOD the SOD associated with the most severe form of fALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242796 11513882 330646 20996 11179 SOD1 SOD SOD 37 4.3 a slight reduction compared to 200 ng of SOD the SOD associated with the most severe form of fALS (A4V) A4V 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242797 11513882 330646 20996 11179 SOD1 SOD hSOD 65 2.2 activity meaning that over 80% of the protection of wt hSOD were lost due to this mutation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242798 11513882 330648 20996 11179 SOD1 SOD SOD 9 4.3 To address the observation that increased amounts of mutant SOD compounded the loss of calcineurin activity we tested a mixture 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242799 11513882 330651 20996 11179 SOD1 SOD SODs 6 2.2 Our results thus demonstrate that mutant SODs can reduce the protection conferred by wt SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242800 11513882 330651 20996 11179 SOD1 SOD SOD 14 4.3 that mutant SODs can reduce the protection conferred by wt SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242801 11513882 330652 20996 11179 SOD1 SOD1 SOD1 7 6.0 This observation supports the hypothesis that the SOD1 mutations found in fALS result in a negative gain of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242802 11513882 330652 20996 11179 SOD1 SOD SOD 32 4.3 in a reduction of the protection of calcineurin by wt SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242803 11513882 330655 20996 11179 SOD1 SOD SOD 9 4.3 How the different mutations in the ubiquitously expressed enzyme SOD cause the highly specific neuropathological phenotype associated with fALS remains 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242804 11513882 330661 20996 11179 SOD1 SOD SOD 36 4.3 CuZnSOD 5 which itself accounts for 2% of brain protein SOD and calcineurin are both among the most abundant proteins in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242805 11513882 330663 20996 11179 SOD1 SOD SODs 7 2.2 In this study we report that mutated SODs loose their capacity to protect calcineurin from oxidative inactivation as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242806 11513882 330665 20996 11179 SOD1 SOD SOD 1 4.3 The SOD mutant showing the least protective effect (A4V) A4V is associated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242807 11513882 330666 20996 11179 SOD1 SOD1 SOD1 20 6.0 reduced calcineurin activity in human neuroblastoma cells transfected with mutated SOD1 and in the forebrains of fALS-transgenic mice 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242808 11513882 330667 20996 11179 SOD1 SOD SOD 5 4.3 Moreover when the amount of SOD protein was quadrupled in the assay the wt maintained its 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242809 11513882 330669 20996 11179 SOD1 SOD SOD 18 4.3 the wt CuZnSOD protein and not simply the presence of SOD activity is needed for the protection of calcineurin from oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242810 11513882 330669 20996 11179 SOD1 SOD SOD-generated 41 2.2 that the increased inactivation of calcineurin is mediated by mutated SOD-generated oxidative species different from superoxide a hypothesis that has already 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242811 11513882 330670 20996 11179 SOD1 SOD SOD 13 4.3 be in accordance with the notion that overexpression of wt SOD together with fALS-associated SOD is not protective 21 an observation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242812 11513882 330670 20996 11179 SOD1 SOD SOD 17 4.3 the notion that overexpression of wt SOD together with fALS-associated SOD is not protective 21 an observation that is strengthened by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242813 11513882 330670 20996 11179 SOD1 SOD SODs 39 2.2 by the fact that a mixture of wt and mutant SODs only confers an intermediate rate of protection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242814 11513882 330671 20996 11179 SOD1 SOD SOD 6 4.3 The partial protective effect of wt SOD when mixed with mutant SOD may be explained by the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242815 11513882 330671 20996 11179 SOD1 SOD SOD 11 4.3 partial protective effect of wt SOD when mixed with mutant SOD may be explained by the necessity of SOD to bind 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242816 11513882 330671 20996 11179 SOD1 SOD SOD 19 4.3 with mutant SOD may be explained by the necessity of SOD to bind to calcineurin to exert its protective effect 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242817 11513882 330672 20996 11179 SOD1 SOD SODs 3 2.2 Wt and mutant SODs therefore would compete for binding to calcineurin so that part 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242818 11513882 330672 20996 11179 SOD1 SOD SOD 24 4.3 of the calcineurin molecules still could be protected by wt SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242819 11513882 330673 20996 11179 SOD1 SOD1 SOD1 10 6.0 It has to be noted however that the recombinant reconstituted SOD1 proteins used in this study show an abnormal zinc content 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242820 11513882 330674 20996 11179 SOD1 SOD1 SOD1 4 6.0 A reduced affinity of SOD1 mutants for zinc is an observation that has already been 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242821 11513882 330676 20996 11179 SOD1 SOD1 SOD1 3 6.0 However our wt SOD1 gives exactly the same rate of protection as SOD1 purified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242822 11513882 330676 20996 11179 SOD1 SOD1 SOD1 12 6.0 wt SOD1 gives exactly the same rate of protection as SOD1 purified from erythrocytes and the D90A mutation which shows a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242824 11513882 330682 20996 11179 SOD1 SOD SODs 12 2.2 of our results a reduction of calcineurin activity by mutant SODs would therefore lead to prolonged NMDA receptor-channel openings and therefore 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242825 11513882 330683 20996 11179 SOD1 SOD1 SOD1 10 6.0 This would explain why glutamate potentiates the toxicity of mutant SOD1 in motor neurons 22 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242826 11513882 330684 20996 11179 SOD1 SOD SODs 29 2.2 systems and a higher Ca content in cells expressing mutant SODs or in mutant SOD1 transgenic mice has been observed 23 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242827 11513882 330684 20996 11179 SOD1 SOD1 SOD1 33 6.0 Ca content in cells expressing mutant SODs or in mutant SOD1 transgenic mice has been observed 23 24 and 25 a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242829 11513882 330689 20996 11179 SOD1 SOD1 SOD1 3 6.0 Characterization of the SOD1 proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242830 11513882 330690 20996 11179 SOD1 SOD1 SOD1 2 6.0 The recombinant SOD1 proteins are characterized by a reduced activity and a reduced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242831 11513882 330691 20996 11179 SOD1 SOD1 SOD1 6 6.0 Lower panel Activity staining of recombinant SOD1 proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242832 11513882 330698 20996 11179 SOD1 SOD SOD 38 4.3 activity can be preserved by addition of erythrocyte (ery) ery SOD or recombinant human (hr) hr SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242833 11513882 330698 20996 11179 SOD1 SOD SOD 43 4.3 of erythrocyte (ery) ery SOD or recombinant human (hr) hr SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242834 11513882 330699 20996 11179 SOD1 SOD SODs 2 2.2 Recombinant mutant SODs associated with fALS are less protective 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242835 11513882 330700 20996 11179 SOD1 SOD SODs 8 2.2 Addition of quadruple amounts of wt or mutant SODs (black black bars reduces the protective ability of the mutants 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242836 11513882 330702 20996 11179 SOD1 SOD SOD 15 4.3 n =6 * P _amp_#x3c 0.05 significantly different from wt SOD by Student_amp_#x2019 s t -test ** P _amp_#x3c 0.01 significantly 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242837 11513882 330702 20996 11179 SOD1 SOD SOD 27 4.3 t -test ** P _amp_#x3c 0.01 significantly different from wt SOD by Student_amp_#x2019 s t -test 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242838 11513882 330704 20996 11179 SOD1 SOD SODs 6 2.2 A mixture of wt and mutant SODs confers intermediate protection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242839 11513882 330705 20996 11179 SOD1 SOD SOD 3 4.3 Addition of wt SOD (400 400 ng to mutant SOD1s (400 400 ng results 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242840 11513882 330705 20996 11179 SOD1 SOD1 SOD1s 8 2.2 Addition of wt SOD (400 400 ng to mutant SOD1s (400 400 ng results in intermediate protective ability against oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 242841 11513882 330707 20996 11179 SOD1 SOD SOD 15 4.3 n =4 ** P _amp_#x3c 0.01 significantly different from mutant SOD alone by Student_amp_#x2019 s t -test 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245332 11562447 333745 12359 6876 MAPK14 p38 p38 6 0.3 Another protein that was affected was synaptophysin/p38 synaptophysin p38 1 JUMiner_v2.2 1 0 0 2 1189 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:1189|AHSA1|0.000600790513833992<>ScoreDetail__1189|AHSA1|0.000600790513833992__6878|MAPK4|0.000494635798983625__6871|MAPK1|0.000518538276873833__6876|MAPK14|0.000324932352982844__ 0 0 0 0 0 245372 11562447 333872 12705 7097 MIF GIF Gif-sur-Yvette-Cedex 16 0.3 et Mol_amp_eacute culaire Center National de la Recherche Scientifique 91198 Gif-sur-Yvette-Cedex France 11 JUMiner_v2.2 1 0 0 2 7408 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:7408|MT3|0.00045766590389016<>ScoreDetail__7097|MIF|0.000263290488741501__7408|MT3|0.00045766590389016__4268|GIF|0.000296442687747036__ 0 0 0 0 0 238885 11679167 325565 7975 3951 FXN FRDA FRDA 27 2.0 in diseases related to oxidative stress such as ALS or FRDA (see see Sections 4.3 and 4.4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238886 11679167 325585 166 118 ACO2 aconitase aconitase 12 1.3 oxidise 4Fe_amp_#x2013 4S clusters in enzymes such as the mitochondrial aconitase (citric citric acid cycle homoaconitase (lysine lysine biosynthesis and isopropyl 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238887 11679167 325586 20997 11180 SOD2 MnSOD MnSOD 33 2.4 superoxide dismutases (either either the cytosolic CuZnSOD or the mitochondrial MnSOD or both ( Srinivasan et al. 2000 De Freitas et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238888 11679167 325587 166 118 ACO2 aconitase aconitase 5 1.3 The inactivation of mitochondrial enzymes (aconitase) aconitase results in an impaired respiratory activity that limits the capacity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238894 11679167 325634 8885 20374 GSX1 GSH1 GSH1 3 1.5 The disruption of GSH1 gene encoding the rate-limiting enzyme of glutathione biosynthesis increases hydrogen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238895 11679167 325635 8885 20374 GSX1 GSH1 gsh1 23 1.5 its role in oxidative stress resistance as suppressors of the gsh1 mutation that decreased the rate of generation of petites did 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238896 11679167 325636 58 48 ABCB7 Atm1p Atm1p 0 1.9 Atm1p an ATP-binding cassette transporter that controls iron homeostasis within the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238897 11679167 325637 58 48 ABCB7 Atm1p Atm1p 2 1.9 Loss of Atm1p increases free iron levels and leads to the accumulation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238898 11679167 325657 17875 9827 RAD9A RAD9 RAD9-dependent 27 1.0 the level of cell cycle arrest hydrogen peroxide induces a RAD9-dependent arrest in G 2 while superoxide causes a RAD9-independent arrest 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238899 11679167 325657 17875 9827 RAD9A RAD9 RAD9-independent 37 1.0 a RAD9-dependent arrest in G 2 while superoxide causes a RAD9-independent arrest in G 1 ( Flattery-O'Brien and Dawes 1998 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238900 11679167 325674 8885 20374 GSX1 GSH1 GSH1 14 1.5 is also correlated with glutathione levels as the expression of GSH1 and GSH2 genes coding for the two enzymes involved in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238901 11679167 325674 8886 24959 GSX2 GSH2 GSH2 14 1.5 is also correlated with glutathione levels as the expression of GSH1 and GSH2 genes coding for the two enzymes involved in 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238902 11679167 325674 8886 24959 GSX2 GSH2 GSH2 16 1.5 correlated with glutathione levels as the expression of GSH1 and GSH2 genes coding for the two enzymes involved in glutathione synthesis 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238903 11679167 325678 20997 11180 SOD2 MnSOD MnSOD 22 2.4 such as the increase of the mitochondrial superoxide dismutase (MnSOD) MnSOD activity by ethanol the high ethanol sensitivity of S cerevisiae 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238904 11679167 325678 20997 11180 SOD2 MnSOD MnSOD 36 2.4 the high ethanol sensitivity of S cerevisiae cells deficient in MnSOD ( Costa and Costa and the induction of CTT1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238905 11679167 325683 20996 11179 SOD1 SOD SODs 14 1.9 glucose consuming cultures some of the antioxidant defences such as SODs catalases and peroxidases are present at a very low level 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238906 11679167 325688 14366 7804 NFYA HAP2 Hap2 23 1.6 sensing of oxygen and different trans-acting factors _amp_#x2013 Hap1p Hap2/3/4/5p Hap2 3 4 5p and Rox1p are involved in this gene 2 JUMiner_v2.2 1 0 0 2 7804 TotalCon:2<>4812|HAP1|9001|Complete__7804|NFYA|4800|Complete__<>AvaiableGeneRif=2<>BEST:7804|NFYA|0.000672883733272679<>ScoreDetail__4812|HAP1|0.000235388086189067__7804|NFYA|0.000672883733272679__ 0 0 0 0 0 238907 11679167 325699 20997 11180 SOD2 SOD2 SOD2 14 2.7 in oxidative stress only two genes are under Hap1p regulation SOD2 and CTT1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238908 11679167 325702 20997 11180 SOD2 SOD2 SOD2 6 2.7 Hap1p is a positive regulator of SOD2 promoter in glucose growing cells ensuring a basel level of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238909 11679167 325704 4829 2294 COX8A COX COX 20 1.4 of anoxia on the expression of the nuclear aerobic genes COX indicated the existence of a signalling pathway from the mitochondria 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 238910 11679167 325711 8413 4330 GLRX GRX grx 42 0.3 sod 1_amp_#x394 sod 2_amp_#x394 glutathione ( gsh 1_amp_#x394 glutaredoxin ( grx 5_amp_#x394 ubiquinol ( coq 3_amp_#x394 or poliamines ( spe 2_amp_#x394 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238911 11679167 325714 20997 11180 SOD2 SOD2 SOD2 11 2.7 regulates the transcriptional activation of the antioxidant genes such as SOD2 (mitochondrial mitochondrial superoxide dismutase CTA1 (peroxisomal peroxisomal catalase CTT1 (cytosolic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238912 11679167 325715 14366 7804 NFYA HAP2 Hap2 3 1.6 The heteromeric complex Hap2/3/4/5p Hap2 3 4 5p binds CCAAT sequences and is responsible for 2 JUMiner_v2.2 1 0 0 2 7804 TotalCon:2<>4812|HAP1|9001|Complete__7804|NFYA|4800|Complete__<>AvaiableGeneRif=2<>BEST:7804|NFYA|0.000672883733272679<>ScoreDetail__4812|HAP1|0.000235388086189067__7804|NFYA|0.000672883733272679__ 0 0 0 0 0 238913 11679167 325715 20997 11180 SOD2 SOD2 SOD2 22 2.7 induction of several genes important for respiration as well as SOD2 and UBI4 ( Pinkham et al. 1997 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238914 11679167 325716 20997 11180 SOD2 SOD2 SOD2 16 2.7 growth in a non-fermentable carbon source the transcriptional activation of SOD2 and CTT1 genes is also regulated by Msn2p and Msn4p 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238917 11679167 325721 22704 12015 TPO TPX mTpx 10 0.3 Other antioxidant defences such as Ccp1p Cta1p Cup1p Gpx1p and mTpx are induced during respiratory growth however the regulatory mechanisms remain 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238922 11679167 325736 8046 4092 GAD1 GAD1 GAD1 27 1.2 and the loss/overexpression loss overexpression of glutamate decarboxylase gene ( GAD1 decreases/increases decreases increases hydrogen peroxide resistance ( Coleman et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238926 11679167 325753 23454 12435 TXN TRX trx 10 1.0 Indeed Yap1p is constitutively active in thioredoxin deficient mutants ( trx 1_amp_#x394 trx 2_amp_#x394 ( Izawa et al. 1999 and the 14 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000786057063757646<>ScoreDetail__12435|TXN|0.000786057063757646__25507|VAC14|0.000445103275724812__ 0 0 0 0 0 238927 11679167 325753 23454 12435 TXN TRX trx 12 1.0 is constitutively active in thioredoxin deficient mutants ( trx 1_amp_#x394 trx 2_amp_#x394 ( Izawa et al. 1999 and the whole genome 14 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000786057063757646<>ScoreDetail__12435|TXN|0.000786057063757646__25507|VAC14|0.000445103275724812__ 0 0 0 0 0 238928 11679167 325754 23455 17772 TXN2 TRX2 TRX2 13 1.3 thioredoxin peroxidase Tpx1p is essential for the transcriptional activation of TRX2 and TRR1 genes ( Ross et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238929 11679167 325754 23154 12343 TRNAR1 TRR1 TRR1 15 2.1 Tpx1p is essential for the transcriptional activation of TRX2 and TRR1 genes ( Ross et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238930 11679167 325763 7683 3796 FOS AP-1 AP-1 3 1.0 Interestingly the yeast AP-1 family (Yap1p) Yap1p of proteins are involved in the sensing 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.000690327903657676<>ScoreDetail__3796|FOS|0.000589427478778065__3797|FOSB|0.000430286040559442__6205|JUNB|0.000524076987970417__6204|JUN|0.000690327903657676__6206|JUND|0.000602707937557334__ 0 0 0 0 0 238932 11679167 325772 4940 12024 CRISP2 TPX1 TPX1 4 1.6 Indeed the induction of TPX1 (thioredoxin thioredoxin peroxidase gene is Skn7p- and Yap1p-dependent and is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238935 11679167 325800 166 118 ACO2 aconitase aconitase 21 1.3 destroy the 4Fe_amp_#x2013 4S clusters of mitochondrial enzymes (e.g., e.g. aconitase leading to an impaired respiratory activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238936 11679167 325809 166 118 ACO2 aconitase aconitase 23 1.3 a delay in the reversible inactivation of the superoxide-sensitive enzyme aconitase suggesting that the extension of life-span is associated with the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238938 11679167 325810 543 391 AKT1 AKT Akt 9 0.0 is an homologue of the mammalian protein kinase B/Akt, B Akt which is involved in insulin signalling apoptosis and cellular proliferation 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 238939 11679167 325811 543 391 AKT1 AKT Akt 10 0.0 Sch9/Rim15 Sch9 Rim15 and the C elegans DAF-2/AGE-1/Akt/DAF16 DAF-2 AGE-1 Akt DAF16 pathways play similar roles in regulating ageing and stress 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 238940 11679167 325817 1576 990 BCL2 Bcl-2 Bcl-2 13 2.6 been identified as being major regulators of apoptosis including the Bcl-2 family and caspases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238941 11679167 325818 1576 990 BCL2 Bcl-2 Bcl-2 1 2.6 The Bcl-2 family of proteins consist of anti-apoptotic proteins such as Bcl-2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238942 11679167 325818 1576 990 BCL2 Bcl-2 Bcl-2 11 2.6 Bcl-2 family of proteins consist of anti-apoptotic proteins such as Bcl-2 and Bcl-x(L), Bcl-x L and pro-apoptotic proteins such as Bax 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238943 11679167 325818 1578 992 BCL2L1 Bcl-X Bcl-x 13 1.0 proteins consist of anti-apoptotic proteins such as Bcl-2 and Bcl-x(L), Bcl-x L and pro-apoptotic proteins such as Bax and Bak ( 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238944 11679167 325818 1514 949 BAK1 BAK Bak 21 0.0 Bcl-x(L), Bcl-x L and pro-apoptotic proteins such as Bax and Bak ( Gross et al. 1999 2 JUMiner_v2.2 1 1 bak; 0 0 0 0 0 0 0 0 238945 11679167 325826 1540 959 BAX BAX BAX 4 0.3 Indeed the expression of BAX stimulates the production of reactive oxygen species ( Madeo et 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238947 11679167 325828 1540 959 BAX BAX BAX 33 0.3 apoptosis ( Madeo et al. 1999 (ii) ii expression of BAX decreases the intracellular levels of glutathione decreases the mitochondrial membrane 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238948 11679167 325828 1540 959 BAX BAX BAX 72 0.3 S-transferase/peroxidase S-transferase peroxidase ( Kampranis et al. 2000 (iii) iii BAX lethality is higher under respiratory conditions and is suppressed in 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238949 11679167 325828 1576 990 BCL2 Bcl-2 Bcl-2 163 2.6 lacking superoxide dismutase is extended by overexpressing the anti-apoptotic protein Bcl-2 ( Longo et al. 1999 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238950 11679167 325832 1576 990 BCL2 Bcl-2 Bcl-2 5 2.6 The regulatory role of the Bcl-2 members e.g. depends on their ability to regulate the mitochondrial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238951 11679167 325833 1576 990 BCL2 Bcl-2 Bcl-2 2 2.6 In yeast Bcl-2 proteins interact with the voltage-dependent anion channel (VDAC) VDAC and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238952 11679167 325833 20221 10990 SLC25A4 ANT ANT 16 0.6 anion channel (VDAC) VDAC and the adenine nucleotide translocator (ANT), ANT and these proteins are components of the mitochondrial permeability transition 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238953 11679167 325835 20221 10990 SLC25A4 ANT ANT 1 0.6 However ANT is not essential for Bax-induced cytochrome c release from the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238956 11679167 325846 20996 11179 SOD1 SOD SOD 35 1.9 been utilised for ALS research on clarifying the role of SOD mutations 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238959 11679167 325852 20996 11179 SOD1 SOD1 SOD1 26 1.9 the use of S cerevisiae in elucidating the mechanism of SOD1 mediated disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238960 11679167 325854 7975 3951 FXN FRDA FRDA 2 2.0 Friedreich's ataxia (FRDA) FRDA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238961 11679167 325902 8604 4455 GPD1 GPD1 Gpd1 3 0.3 Zwf1 glucose-6-phosphate dehydrogenase Gpd1 glycerol phosphate dehydrogenase Gpp2 glycerol phosphate phosphatase YBR149W glycerol dehydrogenase 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238962 11679167 325902 8046 4092 GAD1 GAD1 Gad1 17 1.2 Gpp2 glycerol phosphate phosphatase YBR149W glycerol dehydrogenase Dak1 dihydroxyacetone kinase Gad1 glutamate decarboxylase Uga5 succinate semialdehyde dehydrogenase 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238963 11679167 325905 9691 5232 HSPA1A HSP HSP 37 0.9 the Hsf1p increase the expression of heat shock proteins (HSP) HSP and chaperones Yap1p and Skn7p upregulate antioxidant genes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 239731 11701756 326726 20996 11179 SOD1 SOD1 SOD1 31 0.9 mutations of the antioxidant enzyme Cu Zn superoxide dismutase (SOD1), SOD1 namely in neuroblastoma cells expressing either SOD1 mutant G93A or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 239732 11701756 326726 20996 11179 SOD1 SOD1 SOD1 38 0.9 superoxide dismutase (SOD1), SOD1 namely in neuroblastoma cells expressing either SOD1 mutant G93A or mutant H46R and in brain areas from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 239733 11701756 326727 20996 11179 SOD1 SOD1 SOD1 8 0.9 In this work we report that while wild-type SOD1 has a protective effect calcineurin is oxidatively inactivated by mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 239734 11701756 326727 20996 11179 SOD1 SOD1 SOD1s 19 0.9 has a protective effect calcineurin is oxidatively inactivated by mutant SOD1s in vitro this inactivation is mediated by reactive oxygen species 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 239735 11701756 326729 20996 11179 SOD1 SOD1 SOD1s 8 0.9 These findings demonstrate that both wild-type and mutant SOD1s can interfere directly with calcineurin activity and further support the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234240 11796206 317450 20996 11179 SOD1 SOD1 sod1 19 1.9 one fifth of these cases are associated with mutations in sod1 the gene that encodes human CuZnSOD 1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234241 11796206 317453 20996 11179 SOD1 SOD SOD 14 1.9 severe motor neuron degenerative syndrome despite normal or above normal SOD activities 2 3 4 and 5 whereas neither transgenic mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234242 11796206 317458 20996 11179 SOD1 SOD SOD 25 1.9 because in vitro remetallation may not reflect the state of SOD mutants in vivo we developed a yeast model system to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234243 11796206 317470 20996 11179 SOD1 SOD1 SOD-1 5 1.9 Yeast strains expressing the human SOD-1 mutant genes (G93A, G93A G93C A4V and L38V or the 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234244 11796206 317471 20996 11179 SOD1 SOD1 SOD1 12 1.9 were placed under the control of the wild type yeast SOD1 promoter and inserted into the high copy yeast/ yeast E 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234245 11796206 317471 5896 13748 DLEU2 LEU2 LEU2 29 1.0 yeast/ yeast E coli shuttle vector YEP351 which contains the LEU2 selectable marker 1 JUMiner_v2.2 1 0 0 2 1706 TotalCon:4<>13748|DLEU2|8847|No_GeneRif__13747|DLEU1|10301|Complete__1706|CD8A|925|Complete__1707|CD8B|926|Complete__<>AvaiableGeneRif=3<>BEST:1706|CD8A|0.000593707536322776<>ScoreDetail__1706|CD8A|0.000593707536322776__1707|CD8B|0.000376293508936971__13747|DLEU1|0.000128281878046695__ 0 0 0 0 0 234246 11796206 317472 20996 11179 SOD1 SOD1 sod1 11 1.9 plasmid was transformed into the Saccharomyces cerevisiae strain EG118 ( sod1 _amp_#x2212 which lacks the CuZnSOD polypeptide 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234247 11796206 317490 20996 11179 SOD1 SOD1 sod1 26 1.9 human and FALS mutant CuZnSOD proteins were expressed in an sod1 _amp_#x2212 strain of the yeast Saccharomyces cerevisiae in order to 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234248 11796206 317491 20996 11179 SOD1 SOD SOD 15 1.9 of expression of the CuZnSOD proteins as well as the SOD activities of crude cytosol preparations were similar in the strains 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234249 11796206 317491 20996 11179 SOD1 SOD SOD 40 1.9 those expressing FALS mutant CuZnSODs although slightly higher levels of SOD activity were sometimes found for the strains expressing the human 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234250 11796206 317495 20996 11179 SOD1 SOD SOD 36 1.9 in the copper site of the enzyme and is fully SOD active 11 making it highly likely that the same situation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230677 11905995 311193 20996 11179 SOD1 SOD1 SOD1-mediated 12 2.2 antioxidative activity or decreased oxygen free radical propagation prevent mutant SOD1-mediated motor neuron cell death and increase amyotrophic lateral sclerosis-like transgenic 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230679 11905995 311195 20996 11179 SOD1 SOD SOD 17 2.2 neuron degeneration in transgenic mice overexpressing mutant superoxide dismutase (SOD)1 SOD 1 gene and mitochondrial abnormality is observed in human ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230681 11905995 311197 20996 11179 SOD1 SOD1 SOD1 25 2.7 neuron-like cell death with mutant G93A-SOD1 but not with wild-type SOD1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230682 11905995 311198 20997 11180 SOD2 MnSOD MnSOD 6 2.2 Similarly overexpression of mitochondrial antioxidative genes MnSOD and GPX4 by stable transfection significantly increased NSC-34 motor neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230683 11905995 311198 8762 4556 GPX4 GPX4 GPX4 8 1.2 Similarly overexpression of mitochondrial antioxidative genes MnSOD and GPX4 by stable transfection significantly increased NSC-34 motor neuron-like cell resistance 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230684 11905995 311198 20996 11179 SOD1 SOD1 SOD1 21 2.7 transfection significantly increased NSC-34 motor neuron-like cell resistance to mutant SOD1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230685 11905995 311199 20996 11179 SOD1 SOD1 SOD1-mediated 11 2.2 with spin trapping molecule 5' 5'-dimethylpryrroline-N-oxide (DMPO), DMPO prevented mutant SOD1-mediated mitochondrial dysfunction and cell death 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230686 11905995 311201 20996 11179 SOD1 SOD1 SOD1-mediated 12 2.2 suggest a causal relationship between enhanced oxidative stress and mutant SOD1-mediated motor neuron degeneration considering that enhanced oxygen free radical production 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230687 11905995 311201 20996 11179 SOD1 SOD1 SOD1 26 2.7 considering that enhanced oxygen free radical production results from the SOD1 structural alterations 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232195 11978481 313820 14533 7872 NOS1 nNOS nNOS 18 2.7 isoforms of nitric oxide synthase neuronal nitric oxide synthase (nNOS), nNOS endothelial nitric oxide synthase (eNOS), eNOS and inducible nitric oxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232196 11978481 313820 14538 7876 NOS3 eNOS eNOS 23 2.2 nitric oxide synthase (nNOS), nNOS endothelial nitric oxide synthase (eNOS), eNOS and inducible nitric oxide synthase (iNOS) iNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232197 11978481 313820 14535 7873 NOS2A iNOS iNOS 29 2.7 oxide synthase (eNOS), eNOS and inducible nitric oxide synthase (iNOS) iNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232198 11978481 313848 166 118 ACO2 aconitase aconitase 12 1.3 immunochemical probe for oxidative damage it was demonstrated that mitochondrial aconitase was particularly vulnerable to oxidative damage accompanying aging in drosophila 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232200 11978481 313865 926 620 APP amyloid amyloid 7 1.0 The neuropathologic hallmarks are senile plaques containing _amp_#x3b2 -amyloid and neurofibrillary tangles which occur in pyramidal neurons of the 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 232201 11978481 313875 12369 6893 MAPT tau tau 14 2.7 aggregates which are largely made up of the microtubule-associated protein tau 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232202 11978481 313878 926 620 APP amyloid amyloid 6 1.0 Histochemical methods showed 4-hydroxynonenal staining of amyloid deposits 32 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 232203 11978481 313902 14533 7872 NOS1 NOS NOS 13 2.7 3-nitrotyrosine generation are also attenuated in mice deficient in inducible NOS 48 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000842862777810578<>ScoreDetail__7873|NOS2A|0.000732793134912405__7872|NOS1|0.000842862777810578__ 0 0 0 0 0 232216 11978481 313929 14533 7872 NOS1 nNOS nNOS 7 2.7 An increase in neuronal nitric oxide synthase (nNOS) nNOS was found in motor neurons in one study 65 66 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232217 11978481 313930 14533 7872 NOS1 nNOS nNOS 7 2.7 Other recent studies showed no alteration in nNOS in motor neurons but showed an increase in nNOS in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232218 11978481 313930 14533 7872 NOS1 nNOS nNOS 16 2.7 in nNOS in motor neurons but showed an increase in nNOS in reactive astrocytes in ALS spinal cord and subcortical white 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224443 12218958 300508 20996 11179 SOD1 SOD SOD 2 1.9 Superoxide dismutase (SOD) SOD catalyzes the conversion of single electron reduced species of molecular 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224444 12218958 300509 20996 11179 SOD1 SOD SOD 5 1.9 There are several classes of SOD that differ in their metal binding ability distribution in different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224445 12218958 300510 20996 11179 SOD1 SOD1 SOD1 6 2.4 Among these Cu Zn superoxide dismutase (SOD1) SOD1 is widely distributed and comprises 90% of the total SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224446 12218958 300510 20996 11179 SOD1 SOD SOD 16 1.9 SOD1 is widely distributed and comprises 90% of the total SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224447 12218958 300512 20996 11179 SOD1 SOD SODs 7 1.9 The present review describes the role of SODs especially Cu Zn SOD in several diseases such as familial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224448 12218958 300512 20996 11179 SOD1 SOD SOD 11 1.9 present review describes the role of SODs especially Cu Zn SOD in several diseases such as familial amyotrophic lateral sclerosis (FALS), 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224449 12218958 300513 20996 11179 SOD1 SOD1 SOD1 3 2.4 Mutations in the SOD1 gene cause a familial form of amyotrophic lateral sclerosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224450 12218958 300514 20996 11179 SOD1 SOD1 SOD1 5 2.4 The mechanism by which mutant SOD1 causes the degeneration of motor neurons is not well understood 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224451 12218958 300515 20996 11179 SOD1 SOD1 SOD1s 7 1.9 Transgenic mice expressing multiple copies of FALS-mutant SOD1s develop an ALS-like motor neuron disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 224453 12218958 300517 20996 11179 SOD1 SOD1 SOD1 6 2.4 Various observations and conclusions linking mutant SOD1 and FALS are discussed in this review in detail 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226056 12368231 302530 20996 11179 SOD1 SOD1 SOD1 2 1.2 Overexpression of SOD1 protects vulnerable motor neurons after spinal cord injury by attenuating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226057 12368231 302531 20996 11179 SOD1 SOD1 SOD1 3 1.2 Defective Cu Zn-superoxide dismutase (SOD1) SOD1 is responsible for some types of amyotrophic lateral sclerosis and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226059 12368231 302532 20996 11179 SOD1 SOD1 SOD1 15 1.2 mild spinal cord injury (SCI); SCI however the involvement of SOD1 ROS and apoptosis in their death has not been clarified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226061 12368231 302533 20996 11179 SOD1 SOD1 SOD1-overexpressing 6 1.2 Mild compression SCI was induced in SOD1-overexpressing transgenic rats and wild-type littermates 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226062 12368231 302538 20996 11179 SOD1 SOD1 SOD1 25 1.2 apoptotic VMN death after SCI and that increased levels of SOD1 in VMN reduce oxidative stress thereby attenuating the activation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218361 12392777 292016 20996 11179 SOD1 SOD1 SOD-1 10 2.4 in the brain include Cu/Zn Cu Zn superoxide dismutase (SOD-1) SOD-1 and Mn superoxide dismutase (SOD-2) SOD-2 which catalyze the conversion 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218362 12392777 292016 20997 11180 SOD2 SOD2 SOD-2 15 1.2 Zn superoxide dismutase (SOD-1) SOD-1 and Mn superoxide dismutase (SOD-2) SOD-2 which catalyze the conversion of O 2 _amp_#x221a _amp_#x2212 to 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218372 12392777 292033 20997 11180 SOD2 SOD2 SOD-2 15 1.2 influence the expression of a large number of genes including SOD-2 50 179 and 180 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218375 12392777 292035 3893 1682 CD47 IAP IAPs 11 0.3 induces the expression of the so-called inhibitor-of apoptosis proteins (IAPs), IAPs Bcl-2 and calbindins 179 and 270 13 JUMiner_v2.2 1 0 0 2 5329 TotalCon:4<>1682|CD47|961|Complete__5329|IAPP|3375|Complete__28880|MAGT1|84061|Complete__437|ALPI|248|Complete__<>AvaiableGeneRif=4<>BEST:5329|IAPP|0.000451216596741021<>ScoreDetail__437|ALPI|0.000281395722785014__1682|CD47|0.000379486163350659__5329|IAPP|0.000451216596741021__28880|MAGT1|0.000440445479141761__ 0 0 0 0 0 218376 12392777 292035 1576 990 BCL2 Bcl-2 Bcl-2 12 1.3 the expression of the so-called inhibitor-of apoptosis proteins (IAPs), IAPs Bcl-2 and calbindins 179 and 270 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 221142 12437573 295643 20996 11179 SOD1 SOD1 SOD1 17 1.2 in human neuroblastoma cells expressing Cu Zn superoxide dismutase (SOD1) SOD1 mutant G93A and in brain areas from G93A transgenic mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 221143 12437573 295644 20996 11179 SOD1 SOD1 SOD1 13 1.2 the possibility that by interfering directly with calcineurin activity mutant SOD1 can modulate pathways of signal transduction mediated by redox-sensitive transcription 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 221144 12437573 295645 14352 7794 NFKB1 NF-kappaB NF-kappaB 11 0.6 paper we report a calcineurin-dependent activation of nuclear factor-kappaB (NF-kappaB) NF-kappaB induced by the expression of familial amyotrophic lateral sclerosis (fALS)-SOD1s 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 221145 12437573 295646 14352 7794 NFKB1 NF-kappaB NF-kappaB 10 0.6 of the phosphorylation state of IkappaBalpha (the the inhibitor of NF-kappaB translocation into the nucleus and induction of cyclooxygenase 2 are 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216913 12548704 290249 16300 8784 PDE5A PDE5 PDE5 1 1.3 Selective PDE5 inhibitors (dipyridamole, dipyridamole T-1032 and zaprinast as well as a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216917 12548704 290251 16300 8784 PDE5A PDE5 PDE5 4 1.3 Immunohistochemical staining confirmed that PDE5 and PKG are located in almost all rat lumbar spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216918 12548704 290252 16300 8784 PDE5A PDE5 PDE5 9 1.3 Furthermore semiquantitative analysis of the immunostaining intensity revealed that PDE5 was more abundant in motor neurons than in nonmotor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216919 12548704 290253 16300 8784 PDE5A PDE5 PDE5 10 1.3 Our results suggest that this difference in the amount of PDE5 may be responsible for the vulnerability of motor neurons to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216920 12548704 290254 16300 8784 PDE5A PDE5 PDE5 11 1.3 addition the results of this study raise the possibility that PDE5 inhibitors might be used as a treatment for amyotrophic lateral 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207523 12614931 278044 9462 5013 HMOX1 HO-1 HO-1 4 3.4 Expression of heme oxygenase-1 (HO-1), HO-1 a marker of oxidative stress also increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207529 12614931 278060 20017 10940 SLC1A2 EAAT2 EAAT2 20 1.5 receptor subunit and a much greater perisomatic expression of the EAAT2 protein the glial glutamate transporter which is particularly vulnerable to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207538 12614931 278094 18312 670 RHOD Rho Rho 17 0.0 measured by uptake of the lipophilic cation rhodamine 123 (Rho Rho 123 Fluka Chemie CH into mitochondria 1 JUMiner_v2.2 1 1 ras 0 0 0 0 0 0 0 0 207539 12614931 278098 18312 670 RHOD Rho Rho 9 0.0 The cells were then resuspended in 1 ml of Rho 123 (10 10 _amp_#x3bc;g/ml) _amp_#x3bc g ml for 30 min 1 JUMiner_v2.2 1 1 ras 0 0 0 0 0 0 0 0 207543 12614931 278109 9462 5013 HMOX1 HO-1 HO-1 0 3.4 HO-1 mRNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207544 12614931 278110 9462 5013 HMOX1 HO-1 HO-1 3 3.4 The heme oxygenase-1 (HO-1) HO-1 mRNA level was measured by Northern Blot analysis as previously 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207545 12614931 278117 6054 2983 DNTT TDT TdT 13 0.3 by the TUNEL technique which uses terminal deoxynucleotidyl transferase (TdT) TdT to catalyse the binding of FITC-conjugated dUTP to DNA strand 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207546 12614931 278121 6054 2983 DNTT TDT TdT 20 0.3 mixture (Roche Roche Molecular Biochemicals Monza Italy containing dUTP-FITC and TdT and incubated for 60 min at 37 _amp_#xb0 C in 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207547 12614931 278140 18312 670 RHOD Rho Rho 24 0.0 NSC-34 motor neurons by selective uptake of the lipophilic cation Rho 123 into mitochondria ( Fig 3 1 JUMiner_v2.2 1 1 ras 0 0 0 0 0 0 0 0 207548 12614931 278143 18312 670 RHOD Rho Rho 10 0.0 The histograms of relative MMP measured by fluorescent emission from Rho 123 taken up by mitochondria in control and EA-exposed NSC-34 1 JUMiner_v2.2 1 1 ras 0 0 0 0 0 0 0 0 207553 12614931 278150 9462 5013 HMOX1 HO-1 HO-1 12 3.4 marker of oxidative stress we also measured the induction of HO-1 mRNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207554 12614931 278151 9462 5013 HMOX1 HO-1 HO-1 7 3.4 Exposure to 100 _amp_#x3bc M EA promptly increased HO-1 mRNA with a massive rise 3 h after treatment (respectively 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207568 12614931 278197 9462 5013 HMOX1 HO-1 HO-1 7 3.4 GSH depletion by EA induced expression of HO-1 which has been reported to be protective in different models 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207569 12614931 278198 9462 5013 HMOX1 HO-1 HO-1 4 3.4 The end products of HO-1 enzymatic activity potentially act as antioxidants 45 and can thus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207570 12614931 278198 12337 6871 MAPK1 p38 p38 36 1.7 manner as an anti-apoptotic messenger possibly through activation of the p38 mitogen-activated protein kinase (MAPK) MAPK signal transduction pathway 46 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.000789849615733871<>ScoreDetail__1189|AHSA1|0.000120336943441637__6878|MAPK4|0.000528623001547189__6871|MAPK1|0.000789849615733871__6876|MAPK14|0.000634195101121851__ 0 0 0 0 0 207571 12614931 278198 12337 6871 MAPK1 MAPK MAPK 40 1.7 possibly through activation of the p38 mitogen-activated protein kinase (MAPK) MAPK signal transduction pathway 46 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207572 12614931 278199 9462 5013 HMOX1 HO-1 HO-1 4 3.4 However the role of HO-1 in our model requires further investigation since proapoptotic signals prevailed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207573 12614931 278200 9462 5013 HMOX1 HO-1 HO-1 4 3.4 Interestingly increased immunoreactivity for HO-1 and p38MAPK were detected in human and mouse ALS 47 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207578 12614931 278226 9462 5013 HMOX1 HO-1 HO-1 3 3.4 The heme oxygenase-1 (HO-1) HO-1 mRNA signal is shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 208008 12618129 278684 4829 2294 COX8A COX COX 16 1.2 (succinate_amp_#x2013;cytochrome succinate_amp_#x2013 cytochrome c reductase IV (cytochrome cytochrome c oxidase COX and the mitochondrial matrix enzyme citrate synthase (CS) CS were 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 208013 12618129 278703 4829 2294 COX8A COX COX 5 1.2 For example in 143B-derived cybrids COX excess capacity is such that even a stop codon mutation 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 208014 12618129 278703 4829 2294 COX8A COX COX 18 1.2 is such that even a stop codon mutation in a COX subunit can be tolerated up to 40% heteroplasmy before an 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 208015 12618129 278705 4829 2294 COX8A COX COX 8 1.2 Accordingly 5 _amp_#x3bc M KCN a specific inhibitor of COX was added either at the beginning of the assay ( 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 208016 12618129 278708 4829 2294 COX8A COX COX 10 1.2 Because KCN competes with oxygen for the catalytic site on COX KCN inhibition increased to approximately 20% at O 2-50%RA 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 208028 12618129 278724 4829 2294 COX8A COX COX 10 1.2 of the mitochondrial respiratory chain complexes I III II III COX and of the nuclear encoded mitochondrial matrix enzyme citrate synthase 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 208034 12618129 278729 4829 2294 COX8A COX COX 29 1.2 DCFDA and incubated in medium containing increasing concentrations of the COX inhibitor KCN from 0 to 10 _amp_#x3bc M 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 208064 12618129 278794 4829 2294 COX8A COX COX 10 1.2 NADH cytochrome c reductase II III succinate cytochrome c reductase COX cytochrome c oxidase 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 209620 12654515 280252 20996 11179 SOD1 SOD1 SOD1 7 3.7 The increased oxidative stress induced by mutant SOD1 is associated with motor neuron degeneration in both human ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209622 12654515 280252 20996 11179 SOD1 SOD1 SOD1 23 3.7 degeneration in both human ALS and transgenic mice expressing mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209623 12654515 280253 23910 12680 VEGFA VEGF VEGF 4 4.3 Vascular endothelial growth factor (VEGF) VEGF is neurotrophic and also protects from hypoxia-induced neuronal injury 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209624 12654515 280254 23910 12680 VEGFA VEGF VEGF 4 4.3 The potential role of VEGF in preventing mutant SOD1-mediated motor neuron cell death was examined 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209625 12654515 280254 20996 11179 SOD1 SOD1 SOD1-mediated 8 1.7 The potential role of VEGF in preventing mutant SOD1-mediated motor neuron cell death was examined using a mouse NSC34 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209626 12654515 280255 20996 11179 SOD1 SOD1 SOD1 12 3.7 adenovirus containing mutant G93A-SOD1 but not vector control or wild-type SOD1 increased cellular oxidative stress and motor neuron-like cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209627 12654515 280256 23910 12680 VEGFA VEGF VEGF 5 4.3 However NSC34 cells pretreated with VEGF displayed a dose-dependent resistance to oxidative damage from hydrogen peroxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209628 12654515 280256 22551 11892 TNF TNF TNF-A 16 1.2 displayed a dose-dependent resistance to oxidative damage from hydrogen peroxide TNF-_amp_#x3b1 and mutant G93A-SOD1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209629 12654515 280257 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF activated both PI3-K and MAPK activities in mouse NSC34 motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209630 12654515 280257 16616 8978 PIK3CG PI3K PI3-K 3 2.6 VEGF activated both PI3-K and MAPK activities in mouse NSC34 motor neuron-like cells 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209631 12654515 280257 12337 6871 MAPK1 MAPK MAPK 5 2.2 VEGF activated both PI3-K and MAPK activities in mouse NSC34 motor neuron-like cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209632 12654515 280258 12337 6871 MAPK1 MAPK MAPK 12 2.2 and constitutively active as well as dominant negative mutants of MAPK and PI3-K revealed that the protective effects of VEGF were 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209633 12654515 280258 16616 8978 PIK3CG PI3K PI3-K 14 2.6 active as well as dominant negative mutants of MAPK and PI3-K revealed that the protective effects of VEGF were mediated via 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209634 12654515 280258 23910 12680 VEGFA VEGF VEGF 21 4.3 of MAPK and PI3-K revealed that the protective effects of VEGF were mediated via the PI3-K activity and that MAPK activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209635 12654515 280258 16616 8978 PIK3CG PI3K PI3-K 26 2.6 that the protective effects of VEGF were mediated via the PI3-K activity and that MAPK activation was not associated with NSC34 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209636 12654515 280258 12337 6871 MAPK1 MAPK MAPK 30 2.2 of VEGF were mediated via the PI3-K activity and that MAPK activation was not associated with NSC34 cell survival 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209637 12654515 280259 23910 12680 VEGFA VEGF VEGF-induced 1 3.8 Furthermore VEGF-induced downstream Akt activation promoted motor neuron-like NSC34 cell survival in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209638 12654515 280259 543 391 AKT1 AKT Akt 3 0.1 Furthermore VEGF-induced downstream Akt activation promoted motor neuron-like NSC34 cell survival in the presence 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209639 12654515 280260 23910 12680 VEGFA VEGF VEGF 1 4.3 Thus VEGF protected mouse NSC34 motor neuron-like cell death from mutant G93A-SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209640 12654515 280260 16616 8978 PIK3CG PI3K PI3-K 14 2.6 motor neuron-like cell death from mutant G93A-SOD1 effects via PI3-K/Akt PI3-K Akt activation 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209641 12654515 280260 543 391 AKT1 AKT Akt 14 0.3 neuron-like cell death from mutant G93A-SOD1 effects via PI3-K/Akt PI3-K Akt activation 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209644 12654515 280266 20996 11179 SOD1 SOD1 SOD1 10 3.7 discovery that mutations of the copper_amp_#x2013 zinc superoxide dismutase (SOD1) SOD1 gene cause a portion of human familial ALS and that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209646 12654515 280266 20996 11179 SOD1 SOD1 SOD1 26 3.7 human familial ALS and that transgenic animal models expressing mutant SOD1 mimic human ALS have contributed significantly to our understanding of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209649 12654515 280267 20996 11179 SOD1 SOD1 SOD1 4 3.7 The G93A mutation in SOD1 (G93A-SOD1) G93A-SOD1 is one of the 90 currently known mutations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209651 12654515 280268 20996 11179 SOD1 SOD1 SOD1-mediated 6 1.7 Nevertheless effective approaches to prevent mutant SOD1-mediated motor neuron death remain largely unidentified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209652 12654515 280269 23910 12680 VEGFA VEGF VEGF 5 4.3 Recently vascular endothelial growth factor (VEGF) VEGF has been demonstrated to have neurotrophic effects by promoting neuronal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209653 12654515 280270 23910 12680 VEGFA VEGF VEGF 9 4.3 Knockout mice with deleted hypoxic response elements in the VEGF promoter region develop a motor neuron-like disease mimicking human ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209655 12654515 280270 23910 12680 VEGFA VEGF VEGF 26 4.3 motor neuron-like disease mimicking human ALS 40 suggesting that hypoxia-mediated VEGF expression may be associated with motor neuron degeneration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209656 12654515 280271 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF also known as vascular permeability factor is a dimeric glycoprotein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209657 12654515 280271 7629 3763 FLT1 FLT1 Flt-1 21 0.6 binds to endothelial cell specific receptors fms-like tyrosine kinase (Flt-1) Flt-1 and fetal liver kinase (Flk-1) Flk-1 16 and 36 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209658 12654515 280271 10981 6307 KDR FLK1 Flk-1 26 0.3 fms-like tyrosine kinase (Flt-1) Flt-1 and fetal liver kinase (Flk-1) Flk-1 16 and 36 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209660 12654515 280272 23910 12680 VEGFA VEGF VEGF 4 4.3 Acting through these receptors VEGF is believed to initiate several intracellular signal transduction systems including 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209661 12654515 280272 16616 8978 PIK3CG PI3K PI3-K 17 2.6 initiate several intracellular signal transduction systems including phosphatidylinositol 3-kinase (PI3-K) PI3-K and mitogen-activated protein kinase (MAPK) MAPK 42 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209662 12654515 280272 12337 6871 MAPK1 MAPK MAPK 22 2.2 including phosphatidylinositol 3-kinase (PI3-K) PI3-K and mitogen-activated protein kinase (MAPK) MAPK 42 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209663 12654515 280273 23910 12680 VEGFA VEGF VEGF 10 4.3 Hypoxia and spinal cord injury have been demonstrated to increase VEGF expression 19 20 and 35 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209664 12654515 280274 23910 12680 VEGFA VEGF VEGF 6 4.3 Neuronal or neuronal-like cells pretreated with VEGF prevent glutamate- and hypoxia/ischemia-mediated hypoxia ischemia-mediated cell death in vitro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209665 12654515 280275 23910 12680 VEGFA VEGF VEGF 5 4.3 More importantly topical application of VEGF reduces ischemia-mediated brain damage in vivo 19 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209666 12654515 280276 23910 12680 VEGFA VEGF VEGF 9 4.3 Although some studies have focused on the effects of VEGF on the central nervous system (CNS), CNS the potential role 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209667 12654515 280276 23910 12680 VEGFA VEGF VEGF 20 4.3 the central nervous system (CNS), CNS the potential role of VEGF in motor neuron survival by mutant SOD1 effects remains largely 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209668 12654515 280276 20996 11179 SOD1 SOD1 SOD1 27 3.7 potential role of VEGF in motor neuron survival by mutant SOD1 effects remains largely unknown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209669 12654515 280277 23910 12680 VEGFA VEGF VEGF 13 4.3 the NSC34 motor neuron-like cell culture model to test whether VEGF can prevent mutant SOD1-mediated motor neuron degeneration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209670 12654515 280277 20996 11179 SOD1 SOD1 SOD1-mediated 17 1.7 cell culture model to test whether VEGF can prevent mutant SOD1-mediated motor neuron degeneration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209672 12654515 280278 23910 12680 VEGFA VEGF VEGF 22 4.3 causes severe disease onset and progression was used to analyze VEGF effects on motor neuron degeneration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209673 12654515 280279 23910 12680 VEGFA VEGF VEGF 7 4.3 We demonstrate that NSC34 cells pretreated with VEGF reduces mutant G93A-SOD1- TNF-_amp_#x3b1;- and hydrogen peroxide-mediated motor neuron-like cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209674 12654515 280280 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF activates both PI3-K and MAPK activities in NSC34 motor neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209675 12654515 280280 16616 8978 PIK3CG PI3K PI3-K 3 2.6 VEGF activates both PI3-K and MAPK activities in NSC34 motor neuron-like cells 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209676 12654515 280280 12337 6871 MAPK1 MAPK MAPK 5 2.2 VEGF activates both PI3-K and MAPK activities in NSC34 motor neuron-like cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209677 12654515 280281 12337 6871 MAPK1 MAPK MAPK 12 2.2 pharmacological inhibitors and constitutively active and dominant negative mutants of MAPK and PI3-K we further demonstrate that PI3-K activity but not 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209678 12654515 280281 16616 8978 PIK3CG PI3K PI3-K 14 2.6 and constitutively active and dominant negative mutants of MAPK and PI3-K we further demonstrate that PI3-K activity but not MAPK activity 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209679 12654515 280281 16616 8978 PIK3CG PI3K PI3-K 19 2.6 negative mutants of MAPK and PI3-K we further demonstrate that PI3-K activity but not MAPK activity protects mouse NSC34 cells from 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209680 12654515 280281 12337 6871 MAPK1 MAPK MAPK 23 2.2 and PI3-K we further demonstrate that PI3-K activity but not MAPK activity protects mouse NSC34 cells from mutant G93A-SOD1 effects 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209681 12654515 280282 543 391 AKT1 AKT Akt 5 0.0 In addition we show that Akt activation promotes NSC34 motor neuron-like cell survival in the presence 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209682 12654515 280283 23910 12680 VEGFA VEGF VEGF 8 4.3 Thus we propose that the neurotrophic-like activity of VEGF on mouse NSC34 motor neuron-like cell survival is mediated by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209683 12654515 280283 16616 8978 PIK3CG PI3K PI3-K 22 2.6 neuron-like cell survival is mediated by activation of the PI3-K/Akt PI3-K Akt pathway 2 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209684 12654515 280283 543 391 AKT1 AKT Akt 22 0.3 cell survival is mediated by activation of the PI3-K/Akt PI3-K Akt pathway 2 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209685 12654515 280286 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF was purchased from Calbiochem (San San Diego CA USA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209686 12654515 280287 22551 11892 TNF TNF TNF-A 0 1.2 TNF-_amp_#x3b1 N -acetyl-cysteine (N-AC), N-AC 5_amp_#x2032 5_amp_#x2032 -dimethylpryrroline-N -oxide (DMPO), DMPO 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209688 12654515 280289 20996 11179 SOD1 SOD1 SOD1 3 3.7 Polyclonal antibody against SOD1 was purchased from Chemicon International (Temecula, Temecula CA USA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209690 12654515 280297 16616 8978 PIK3CG PI3K PI3-K 4 2.6 Wild-type and constitutively active PI3-K catalytic subunit p110 (myristoylated) myristoylated and dominant negative PI3-K regulatory 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209691 12654515 280297 19369 16860 SART3 p110 p110 7 1.3 Wild-type and constitutively active PI3-K catalytic subunit p110 (myristoylated) myristoylated and dominant negative PI3-K regulatory subunit p85 were 1 JUMiner_v2.2 1 0 0 2 2557 TotalCon:2<>2557|CUX1|1523|Complete__16860|SART3|9733|Complete__<>AvaiableGeneRif=2<>BEST:2557|CUX1|0.00106563676060789<>ScoreDetail__16860|SART3|0.000284861985968147__2557|CUX1|0.00106563676060789__ 0 0 0 0 0 209692 12654515 280297 16616 8978 PIK3CG PI3K PI3-K 12 2.6 active PI3-K catalytic subunit p110 (myristoylated) myristoylated and dominant negative PI3-K regulatory subunit p85 were purchased from Upstate Biochemical (Lake Lake 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209693 12654515 280297 16618 8979 PIK3R1 p85 p85 15 0.6 subunit p110 (myristoylated) myristoylated and dominant negative PI3-K regulatory subunit p85 were purchased from Upstate Biochemical (Lake Lake Placid NY USA 1 JUMiner_v2.2 1 0 0 2 8979 TotalCon:3<>8979|PIK3R1|5295|Complete__8980|PIK3R2|5296|Complete__14950|PPP1R13B|23368|Complete__<>AvaiableGeneRif=3<>BEST:8979|PIK3R1|0.000988827623103241<>ScoreDetail__8980|PIK3R2|0.000960689045936396__14950|PPP1R13B|0.000437680693864439__8979|PIK3R1|0.000988827623103241__ 0 0 0 0 0 209694 12654515 280298 543 391 AKT1 AKT Akt 6 0.0 Constitutively active (myristoylated) myristoylated and dominant negative Akt (K179M-Akt) K179M-Akt were kindly provided by Dr Alfonso Bellacosa Fox 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209696 12654515 280306 23910 12680 VEGFA VEGF VEGF 6 4.3 Mouse NSC34 cells were pretreated with VEGF for 30 min and then infected with 2_amp_#xd7 10 6 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209697 12654515 280307 23910 12680 VEGFA VEGF VEGF 25 4.3 with complete medium either in the presence or absence of VEGF for various lengths of time before analysis 32 2.5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209699 12654515 280327 12337 6871 MAPK1 MAP MAP 0 2.2 MAP kinase activation assay 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209700 12654515 280328 12337 6871 MAPK1 MAP MAP 0 2.2 MAP kinase activation was measured by the phosphorylation of ERK1/2 ERK1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209701 12654515 280328 12339 6877 MAPK3 ERK1 ERK1 9 2.7 MAP kinase activation was measured by the phosphorylation of ERK1/2 ERK1 2 using anti-phospho-ERK1/2 anti-phospho-ERK1 2 antibody (Cell Cell Signaling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209702 12654515 280329 23910 12680 VEGFA VEGF VEGF-stimulated 3 3.8 Briefly control and VEGF-stimulated NSC34 cells were washed twice with ice-cold PBS and lysed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209703 12654515 280330 12337 6871 MAPK1 ERK ERK 30 2.2 membrane and probed with anti-phospho-ERK1/2 anti-phospho-ERK1 2 antibody that recognizes ERK only when it is phosphorylated at Thr202 and Tyr204 (Cell 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00125947265897189<>ScoreDetail__3393|EPHB2|0.000713962991934831__6871|MAPK1|0.00125947265897189__ 0 0 0 0 0 209705 12654515 280333 16618 8979 PIK3R1 p85 p85 5 0.6 Cell lysates were immunoprecipitated with p85 antibody and were subsequently used for PI3-K activity assay 1 JUMiner_v2.2 1 0 0 2 8979 TotalCon:3<>8979|PIK3R1|5295|Complete__8980|PIK3R2|5296|Complete__14950|PPP1R13B|23368|Complete__<>AvaiableGeneRif=3<>BEST:8979|PIK3R1|0.000988827623103241<>ScoreDetail__8980|PIK3R2|0.000960689045936396__14950|PPP1R13B|0.000437680693864439__8979|PIK3R1|0.000988827623103241__ 0 0 0 0 0 209706 12654515 280333 16616 8978 PIK3CG PI3K PI3-K 12 2.6 were immunoprecipitated with p85 antibody and were subsequently used for PI3-K activity assay 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209707 12654515 280336 3870 1706 CD8A p32 p32 22 0.3 kinase reaction was initiated by adding 10 _amp_#x3bc Ci of p32 ATP (6000 6000 Ci/mmol, Ci mmol DuPont-NEN Boston MA USA 1 JUMiner_v2.2 1 0 0 2 1243 TotalCon:2<>1243|C1QBP|708|Complete__1706|CD8A|925|Complete__<>AvaiableGeneRif=2<>BEST:1243|C1QBP|0.00110424028268551<>ScoreDetail__1706|CD8A|0.00105025520219867__1243|C1QBP|0.00110424028268551__ 0 0 0 0 0 209708 12654515 280342 543 391 AKT1 AKT Akt 0 0.0 Akt activation assay 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209709 12654515 280343 543 391 AKT1 AKT Akt 0 0.0 Akt activation was examined by Western blotting with phosphorylation specific Akt 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209710 12654515 280343 543 391 AKT1 AKT Akt 10 0.0 Akt activation was examined by Western blotting with phosphorylation specific Akt antibody (Cell Cell Signaling 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209713 12654515 280347 23910 12680 VEGFA VEGF VEGF-treated 11 3.8 expressed as mean_amp_#xb1 S.E.M and the differences between vehicle- and VEGF-treated mouse NSC34 motor neuron-like cells were analyzed using two-tailed Student 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209714 12654515 280351 20996 11179 SOD1 SOD1 SOD1-mediated 11 1.7 oxidative stress appears to be an early event of mutant SOD1-mediated motor neuron degeneration although the causal relationships between mutant SOD1-mediated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209715 12654515 280351 20996 11179 SOD1 SOD1 SOD1-mediated 21 1.7 SOD1-mediated motor neuron degeneration although the causal relationships between mutant SOD1-mediated oxidative stress and mutant SOD1-mediated motor neuron death are not 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209716 12654515 280351 20996 11179 SOD1 SOD1 SOD1-mediated 26 1.7 the causal relationships between mutant SOD1-mediated oxidative stress and mutant SOD1-mediated motor neuron death are not fully elucidated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209717 12654515 280352 20996 11179 SOD1 SOD1 SOD1 6 3.7 Infection with adenovirus containing human wild-type SOD1 (WT-SOD1) WT-SOD1 and human mutant G93A-SOD1 (G93A-SOD1) G93A-SOD1 increased target 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209719 12654515 280355 22551 11892 TNF TNF TNF-A 19 1.2 neuron-like cell death similar to that of hydrogen peroxide and TNF-_amp_#x3b1 ( Fig 1D 3.2 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209720 12654515 280356 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF protects from mutant SOD1- TNF-_amp_#x3b1;- and H 2 O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209721 12654515 280356 20996 11179 SOD1 SOD1 SOD1- 4 1.7 VEGF protects from mutant SOD1- TNF-_amp_#x3b1;- and H 2 O 2 -mediated mouse NSC34 motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209722 12654515 280357 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF and vehicle pretreated mouse NSC34 cells were infected with adenovirus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209723 12654515 280357 22551 11892 TNF TNF TNF-A 17 1.2 were infected with adenovirus containing mutant G93A-SOD1 and exposed to TNF-_amp_#x3b1 and hydrogen peroxide respectively 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209724 12654515 280358 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF treatment was associated with significant increases in cell survival in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209725 12654515 280358 20996 11179 SOD1 SOD1 mSOD1 14 1.7 with significant increases in cell survival in the presence of mSOD1 TNF-_amp_#x3b1 and hydrogen peroxide ( Fig 2 3.3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209726 12654515 280358 22551 11892 TNF TNF TNF-A 15 1.2 significant increases in cell survival in the presence of mSOD1 TNF-_amp_#x3b1 and hydrogen peroxide ( Fig 2 3.3 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209727 12654515 280359 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF transiently activates PI3-K and MAPK activities 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209728 12654515 280359 16616 8978 PIK3CG PI3K PI3-K 3 2.6 VEGF transiently activates PI3-K and MAPK activities 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209729 12654515 280359 12337 6871 MAPK1 MAPK MAPK 5 2.2 VEGF transiently activates PI3-K and MAPK activities 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209730 12654515 280360 16616 8978 PIK3CG PI3K PI3-K 0 2.6 PI3-K and/or and or MAPK signaling pathways underlie critical components of 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209731 12654515 280360 12337 6871 MAPK1 MAPK MAPK 2 2.2 PI3-K and/or and or MAPK signaling pathways underlie critical components of the survival-related activity of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209732 12654515 280361 23910 12680 VEGFA VEGF VEGF 4 4.3 Thus we tested whether VEGF regulates PI3-K and/or and or MAPK activation in NSC34 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209733 12654515 280361 16616 8978 PIK3CG PI3K PI3-K 6 2.6 Thus we tested whether VEGF regulates PI3-K and/or and or MAPK activation in NSC34 cells 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209734 12654515 280361 12337 6871 MAPK1 MAPK MAPK 8 2.2 Thus we tested whether VEGF regulates PI3-K and/or and or MAPK activation in NSC34 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209735 12654515 280362 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF induced concentration- and time-dependent increases in PI3-K and MAPK activities 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209736 12654515 280362 16616 8978 PIK3CG PI3K PI3-K 7 2.6 VEGF induced concentration- and time-dependent increases in PI3-K and MAPK activities ( Fig 3 and Fig 4 suggesting 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209737 12654515 280362 12337 6871 MAPK1 MAPK MAPK 9 2.2 VEGF induced concentration- and time-dependent increases in PI3-K and MAPK activities ( Fig 3 and Fig 4 suggesting that these 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209738 12654515 280362 23910 12680 VEGFA VEGF VEGF-associated 25 3.8 and Fig 4 suggesting that these pathways may potentially mediate VEGF-associated motor neuron-like cell protection 3.4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209739 12654515 280363 23910 12680 VEGFA VEGF VEGF-mediated 0 3.8 VEGF-mediated PI3-K activity not MAPK activity promotes mouse NSC34 motor neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209740 12654515 280363 16616 8978 PIK3CG PI3K PI3-K 1 2.6 VEGF-mediated PI3-K activity not MAPK activity promotes mouse NSC34 motor neuron-like cell 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209741 12654515 280363 12337 6871 MAPK1 MAPK MAPK 4 2.2 VEGF-mediated PI3-K activity not MAPK activity promotes mouse NSC34 motor neuron-like cell survival in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209742 12654515 280363 20996 11179 SOD1 SOD1 SOD1 18 3.7 NSC34 motor neuron-like cell survival in the presence of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209743 12654515 280364 16616 8978 PIK3CG PI3K PI3-K 8 2.6 To further examine the respective contributions of the PI3-K and MAPK signaling pathways to VEGF-induced cell survival the PI3-K 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209744 12654515 280364 12337 6871 MAPK1 MAPK MAPK 10 2.2 To further examine the respective contributions of the PI3-K and MAPK signaling pathways to VEGF-induced cell survival the PI3-K inhibitors LY294002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209745 12654515 280364 23910 12680 VEGFA VEGF VEGF-induced 14 3.8 respective contributions of the PI3-K and MAPK signaling pathways to VEGF-induced cell survival the PI3-K inhibitors LY294002 at 50 _amp_#x3bc M 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209746 12654515 280364 16616 8978 PIK3CG PI3K PI3-K 18 2.6 PI3-K and MAPK signaling pathways to VEGF-induced cell survival the PI3-K inhibitors LY294002 at 50 _amp_#x3bc M or Wortmannin at 20 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209747 12654515 280364 12337 6871 MAPK1 MAPK MAPK 34 2.2 at 20 _amp_#x3bc M (data data not shown and the MAPK inhibitor PD98059 at 20 _amp_#x3bc M were administered to the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209748 12654515 280365 16616 8978 PIK3CG PI3K PI3-K 0 2.6 PI3-K blockers reduced NSC34 cell viability even in the presence of 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209749 12654515 280365 23910 12680 VEGFA VEGF VEGF 11 4.3 blockers reduced NSC34 cell viability even in the presence of VEGF ( Fig 5A while PD98059 did not modify cell survival 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209750 12654515 280366 16616 8978 PIK3CG PI3K PI3-K 10 2.6 In addition transfection with the constitutively active catalytic subunit of PI3-K P110 but not with the constitutively active MEK1 the upstream 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209751 12654515 280366 19369 16860 SART3 P110 P110 11 1.3 addition transfection with the constitutively active catalytic subunit of PI3-K P110 but not with the constitutively active MEK1 the upstream activating 1 JUMiner_v2.2 1 0 0 2 2557 TotalCon:2<>2557|CUX1|1523|Complete__16860|SART3|9733|Complete__<>AvaiableGeneRif=2<>BEST:2557|CUX1|0.00106563676060789<>ScoreDetail__16860|SART3|0.000284861985968147__2557|CUX1|0.00106563676060789__ 0 0 0 0 0 209752 12654515 280366 12297 6840 MAP2K1 MEK1 MEK1 18 2.2 subunit of PI3-K P110 but not with the constitutively active MEK1 the upstream activating kinase of ERK prevented mutant G93A-SOD1-mediated NSC34 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209753 12654515 280366 12337 6871 MAPK1 ERK ERK 24 2.2 with the constitutively active MEK1 the upstream activating kinase of ERK prevented mutant G93A-SOD1-mediated NSC34 cell death ( Fig 5B 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00125947265897189<>ScoreDetail__3393|EPHB2|0.000713962991934831__6871|MAPK1|0.00125947265897189__ 0 0 0 0 0 209754 12654515 280367 16616 8978 PIK3CG PI3K PI3-K 9 2.6 Conversely transfections with the dominant negative regulatory subunit of PI3-K P85 promoted cell death even in the presence of VEGF 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209755 12654515 280367 16618 8979 PIK3R1 P85 P85 10 0.6 Conversely transfections with the dominant negative regulatory subunit of PI3-K P85 promoted cell death even in the presence of VEGF while 1 JUMiner_v2.2 1 0 0 2 8979 TotalCon:3<>8979|PIK3R1|5295|Complete__8980|PIK3R2|5296|Complete__14950|PPP1R13B|23368|Complete__<>AvaiableGeneRif=3<>BEST:8979|PIK3R1|0.000988827623103241<>ScoreDetail__8980|PIK3R2|0.000960689045936396__14950|PPP1R13B|0.000437680693864439__8979|PIK3R1|0.000988827623103241__ 0 0 0 0 0 209756 12654515 280367 23910 12680 VEGFA VEGF VEGF 19 4.3 PI3-K P85 promoted cell death even in the presence of VEGF while transfection with dominant negative MEK1 was void of any 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209757 12654515 280367 12297 6840 MAP2K1 MEK1 MEK1 25 2.2 in the presence of VEGF while transfection with dominant negative MEK1 was void of any effect on NSC34 cell viability after 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209758 12654515 280368 23910 12680 VEGFA VEGF VEGF 4 4.3 Activation of Akt by VEGF contributes to the protection from mutant SOD1-mediated motor neuron-like cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209759 12654515 280368 20996 11179 SOD1 SOD1 SOD1-mediated 11 1.7 of Akt by VEGF contributes to the protection from mutant SOD1-mediated motor neuron-like cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209760 12654515 280368 543 391 AKT1 AKT Akt 2 0.1 Activation of Akt by VEGF contributes to the protection from mutant SOD1-mediated motor 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209761 12654515 280369 16616 8978 PIK3CG PI3K PI3-K 6 2.6 One of the downstream effectors of PI3-K is Akt activation 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209762 12654515 280369 543 391 AKT1 AKT Akt 8 0.1 One of the downstream effectors of PI3-K is Akt activation 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209763 12654515 280370 23910 12680 VEGFA VEGF VEGF 5 4.3 We therefore initially examined whether VEGF treatment of NSC34 cells was associated with Akt phosphorylation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209764 12654515 280370 543 391 AKT1 AKT Akt 13 0.0 examined whether VEGF treatment of NSC34 cells was associated with Akt phosphorylation 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209765 12654515 280371 23910 12680 VEGFA VEGF VEGF 4 4.3 Indeed cells exposed to VEGF displayed concentration- and time-dependent Akt activation ( Fig 5D and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209766 12654515 280371 543 391 AKT1 AKT Akt 9 0.0 Indeed cells exposed to VEGF displayed concentration- and time-dependent Akt activation ( Fig 5D and E 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209767 12654515 280372 23910 12680 VEGFA VEGF VEGF 18 4.3 resulted in a significant reduction in the protective effect by VEGF on survival of NSC34 cells infected with mutant G93A-SOD1 ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209768 12654515 280372 543 391 AKT1 AKT Akt 7 0.0 Overexpression of the dominant negative mutant of Akt resulted in a significant reduction in the protective effect by 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209769 12654515 280373 543 391 AKT1 AKT Akt 6 0.0 In contrast expression of constitutively active Akt increased cell survival despite the presence of mutant G93A-SOD1 ( 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209770 12654515 280374 23910 12680 VEGFA VEGF VEGF 10 4.3 Taken together the data indicate that activation of Akt by VEGF contributes to the protection from NSC34 motor neuron-like cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209771 12654515 280374 20996 11179 SOD1 SOD1 SOD1 26 3.7 NSC34 motor neuron-like cell death associated with expression of mutant SOD1 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209772 12654515 280374 543 391 AKT1 AKT Akt 8 0.1 Taken together the data indicate that activation of Akt by VEGF contributes to the protection from NSC34 motor neuron-like 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209773 12654515 280376 23910 12680 VEGFA VEGF VEGF 6 4.3 In this study we show that VEGF administration significantly protects from the decreased cell viability induced by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209774 12654515 280377 23910 12680 VEGFA VEGF VEGF 8 4.3 We further demonstrate that the protective effects of VEGF are critically dependent on the activation of the PI3-K-Akt pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209775 12654515 280377 12337 6871 MAPK1 MAPK MAPK 22 2.2 on the activation of the PI3-K-Akt pathway and independent of MAPK activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209776 12654515 280378 23910 12680 VEGFA VEGF VEGF 11 4.3 lines of evidence prompted us to examine the effects of VEGF on mutant SOD1-mediated motor neuron-like cell death (i) i VEGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209777 12654515 280378 20996 11179 SOD1 SOD1 SOD1-mediated 14 1.7 prompted us to examine the effects of VEGF on mutant SOD1-mediated motor neuron-like cell death (i) i VEGF acts as a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209778 12654515 280378 23910 12680 VEGFA VEGF VEGF 20 4.3 VEGF on mutant SOD1-mediated motor neuron-like cell death (i) i VEGF acts as a neurotrophic factor preventing hypoxia (ischemia)-mediated ischemia -mediated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209779 12654515 280378 23910 12680 VEGFA VEGF VEGF 62 4.3 (iii) iii disruption of the hypoxic response elements in the VEGF promoter region of transgenic mice elicits a pattern of motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209781 12654515 280378 20996 11179 SOD1 SOD1 SOD1 93 3.7 in a mouse model 40 and (iv) iv mutations of SOD1 result in enhanced oxidative stress and contribute at least partially 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209782 12654515 280379 23910 12680 VEGFA VEGF VEGF 7 4.3 Thus one of the beneficial effects of VEGF on cell survival could theoretically be ascribed to a protective 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209783 12654515 280380 23910 12680 VEGFA VEGF VEGF 7 4.3 Our findings confirm such an hypothesis whereby VEGF is effective in preventing mutant SOD1-induced mouse NSC34 motor neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209784 12654515 280380 20996 11179 SOD1 SOD1 SOD1-induced 13 1.7 such an hypothesis whereby VEGF is effective in preventing mutant SOD1-induced mouse NSC34 motor neuron-like cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209785 12654515 280381 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF was initially identified as an angiogenic factor that stimulates endothelial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209786 12654515 280382 23910 12680 VEGFA VEGF VEGF 2 4.3 More recently VEGF was shown to induce neuroprotective functions both in vitro and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209787 12654515 280383 23910 12680 VEGFA VEGF VEGF 2 4.3 For example VEGF rescues HN33 and hippocampal neuronal cells from the apoptosis induced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209788 12654515 280384 23910 12680 VEGFA VEGF VEGF 1 4.3 Furthermore VEGF exerts direct neurotrophic effects on axonal outgrowth and neuronal survival 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209789 12654515 280385 23910 12680 VEGFA VEGF VEGF 5 4.3 Our current findings indicate that VEGF promotes motor neuron-like cell survival in the presence of mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209790 12654515 280385 20996 11179 SOD1 SOD1 SOD1 16 3.7 promotes motor neuron-like cell survival in the presence of mutant SOD1 thereby supporting the notion that deficits in VEGF protein induction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209791 12654515 280385 23910 12680 VEGFA VEGF VEGF 24 4.3 of mutant SOD1 thereby supporting the notion that deficits in VEGF protein induction or release may contribute to motor neuron degeneration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209792 12654515 280386 23910 12680 VEGFA VEGF VEGF 5 4.3 These results also suggest that VEGF may have beneficial therapeutic effects in the prevention of motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209794 12654515 280387 23910 12680 VEGFA VEGF VEGF 5 4.3 It is well established that VEGF can activate both PI3-K and MAPK (MEK/ERK) MEK ERK pathways 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209795 12654515 280387 16616 8978 PIK3CG PI3K PI3-K 9 2.6 It is well established that VEGF can activate both PI3-K and MAPK (MEK/ERK) MEK ERK pathways yet the protective effect 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209796 12654515 280387 12337 6871 MAPK1 MAPK MAPK 11 2.2 is well established that VEGF can activate both PI3-K and MAPK (MEK/ERK) MEK ERK pathways yet the protective effect of VEGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209797 12654515 280387 12337 6871 MAPK1 ERK ERK 12 2.2 that VEGF can activate both PI3-K and MAPK (MEK/ERK) MEK ERK pathways yet the protective effect of VEGF on motor neuron-like 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00125947265897189<>ScoreDetail__3393|EPHB2|0.000713962991934831__6871|MAPK1|0.00125947265897189__ 0 0 0 0 0 209798 12654515 280387 23910 12680 VEGFA VEGF VEGF 19 4.3 MAPK (MEK/ERK) MEK ERK pathways yet the protective effect of VEGF on motor neuron-like cell survival upon the expression of mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209799 12654515 280388 12337 6871 MAPK1 MAPK MAPK 8 2.2 While the specific functional roles played by the MAPK pathway are unclear it is likely that this pathway may 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209801 12654515 280389 16616 8978 PIK3CG PI3K PI3-K 18 2.6 of Matsuzaki et al 34 who showed that both the PI3-K and MAPK pathways participate in neuronal cell protection by VEGF 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209802 12654515 280389 12337 6871 MAPK1 MAPK MAPK 20 2.2 et al 34 who showed that both the PI3-K and MAPK pathways participate in neuronal cell protection by VEGF against glutamate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209803 12654515 280389 23910 12680 VEGFA VEGF VEGF 28 4.3 PI3-K and MAPK pathways participate in neuronal cell protection by VEGF against glutamate excitotoxicity in primary rat hippocampal neuronal cultures 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209804 12654515 280390 20996 11179 SOD1 SOD1 SOD1 49 3.7 intrinsic characteristics of the neurotoxic initiators (glutamate glutamate vs mutant SOD1 leading to heterogeneities in downstream kinase recruitment and regulation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209805 12654515 280391 16616 8978 PIK3CG PI3K PI3-K 10 2.6 It has become apparent that activation of kinases such as PI3-K or MAPK does not constitute an isolated event but rather 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209806 12654515 280391 12337 6871 MAPK1 MAPK MAPK 12 2.2 become apparent that activation of kinases such as PI3-K or MAPK does not constitute an isolated event but rather represents a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209807 12654515 280393 16616 8978 PIK3CG PI3K PI3-K 6 2.6 Thus it is possible that the PI3-K/Akt PI3-K Akt signaling module recruited by VEGF in our experiments is 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209808 12654515 280393 23910 12680 VEGFA VEGF VEGF 11 4.3 possible that the PI3-K/Akt PI3-K Akt signaling module recruited by VEGF in our experiments is associated with survival and the activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209809 12654515 280393 12337 6871 MAPK1 MAPK MAPK-related 23 2.2 our experiments is associated with survival and the activation of MAPK-related signaling pathways is primarily related to proliferation in mouse NSC34 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209810 12654515 280393 543 391 AKT1 AKT Akt 6 0.3 Thus it is possible that the PI3-K/Akt PI3-K Akt signaling module recruited by VEGF in our experiments is associated 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209811 12654515 280394 16616 8978 PIK3CG PI3K PI3-K 16 2.6 activation is essential for implementation of the protective effect by PI3-K on mutant G93A-SOD1-mediated motor neuron-like cell survival 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209812 12654515 280394 543 391 AKT1 AKT Akt 5 0.0 Our experiments further revealed that Akt activation is essential for implementation of the protective effect by 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209813 12654515 280395 23910 12680 VEGFA VEGF VEGF 11 4.3 expression of dominant negative Akt blocked the protective function of VEGF while the expression of constitutively active Akt partially prevented mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209814 12654515 280395 20996 11179 SOD1 SOD1 SOD1-mediated 22 1.7 while the expression of constitutively active Akt partially prevented mutant SOD1-mediated motor neuron-like cell death even in the absence of VEGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209815 12654515 280395 23910 12680 VEGFA VEGF VEGF 32 4.3 SOD1-mediated motor neuron-like cell death even in the absence of VEGF ( Fig 5F 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209816 12654515 280395 543 391 AKT1 AKT Akt 5 0.0 Indeed expression of dominant negative Akt blocked the protective function of VEGF while the expression of 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209817 12654515 280395 543 391 AKT1 AKT Akt 18 0.0 protective function of VEGF while the expression of constitutively active Akt partially prevented mutant SOD1-mediated motor neuron-like cell death even in 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209818 12654515 280396 16616 8978 PIK3CG PI3K PI3-K 17 2.6 is now well established as a critical protein activated by PI3-K governing the balance between survival and apoptosis 7 and 13 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209819 12654515 280396 543 391 AKT1 AKT Akt 6 0.0 These findings are not surprising since Akt is now well established as a critical protein activated by 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209820 12654515 280397 543 391 AKT1 AKT Akt 2 0.0 Once phosphorylated Akt has been demonstrated to promote cell survival by inactivation of 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209821 12654515 280398 23910 12680 VEGFA VEGF VEGF 10 4.3 It is unclear what apoptosis-related targets are specifically repressed by VEGF in the mutant SOD1-infected NSC34 motor neuron-like system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209822 12654515 280398 20996 11179 SOD1 SOD1 SOD1-infected 14 1.7 apoptosis-related targets are specifically repressed by VEGF in the mutant SOD1-infected NSC34 motor neuron-like system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209823 12654515 280399 23910 12680 VEGFA VEGF VEGF 8 4.3 However several lines of evidence suggest that the VEGF/Akt VEGF Akt pathway is particularly important to neuronal survival 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209824 12654515 280399 543 391 AKT1 AKT Akt 8 0.3 However several lines of evidence suggest that the VEGF/Akt VEGF Akt pathway is particularly important to neuronal survival 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209825 12654515 280400 23910 12680 VEGFA VEGF VEGF 12 4.3 exposed to a pre-conditioning hypoxic stimulus up-regulated the expression of VEGF and Akt and the activity of the latter was critical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209826 12654515 280400 543 391 AKT1 AKT Akt 14 0.1 a pre-conditioning hypoxic stimulus up-regulated the expression of VEGF and Akt and the activity of the latter was critical to increased 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209827 12654515 280401 543 391 AKT1 AKT Akt 4 0.0 Similarly expression of active Akt suppressed mouse hippocampal neuronal death induced by hypoxia glutamate or 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209828 12654515 280402 543 391 AKT1 AKT Akt 4 0.0 In addition activation of Akt was tightly linked to neuronal cell survival after traumatic brain 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209829 12654515 280404 23910 12680 VEGFA VEGF VEGF 9 4.3 Taken together these results suggest that hypoxia modulation of VEGF expression (activity) activity is essential to motor neuron survival 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209830 12654515 280405 16616 8978 PIK3CG PI3K PI3-K 7 2.6 We now demonstrate that the activation of PI3-K/Akt PI3-K Akt signaling pathways by VEGF can promote motor neuron-like cell 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209831 12654515 280405 23910 12680 VEGFA VEGF VEGF 11 4.3 that the activation of PI3-K/Akt PI3-K Akt signaling pathways by VEGF can promote motor neuron-like cell survival in the presence of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209832 12654515 280405 20996 11179 SOD1 SOD1 SOD1 23 3.7 promote motor neuron-like cell survival in the presence of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209833 12654515 280405 543 391 AKT1 AKT Akt 7 0.3 We now demonstrate that the activation of PI3-K/Akt PI3-K Akt signaling pathways by VEGF can promote motor neuron-like cell survival 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209834 12654515 280406 16616 8978 PIK3CG PI3K PI3-K 5 2.6 However since the activation of PI3-K/Akt PI3-K Akt is a transient event ( Fig 4 the long-lasting 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209835 12654515 280406 23910 12680 VEGFA VEGF VEGF 19 4.3 transient event ( Fig 4 the long-lasting protective function of VEGF on mutant SOD1-mediated motor neuron-like cell death may be due 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209836 12654515 280406 20996 11179 SOD1 SOD1 SOD1-mediated 22 1.7 Fig 4 the long-lasting protective function of VEGF on mutant SOD1-mediated motor neuron-like cell death may be due to the modulation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209837 12654515 280406 543 391 AKT1 AKT Akt 5 0.3 However since the activation of PI3-K/Akt PI3-K Akt is a transient event ( Fig 4 the long-lasting protective 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209838 12654515 280407 23910 12680 VEGFA VEGF VEGF 6 4.3 In summary we have shown that VEGF can protect from mutant SOD1- and oxidative stress-mediated motor neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209839 12654515 280407 20996 11179 SOD1 SOD1 SOD1- 11 1.7 summary we have shown that VEGF can protect from mutant SOD1- and oxidative stress-mediated motor neuron-like cell death in a cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209840 12654515 280408 16616 8978 PIK3CG PI3K PI3-K 13 2.6 pharmacological and molecular genetic approaches we have demonstrated that PI3-K/Akt PI3-K Akt activation is the primary contributor to the neuroprotective function 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209841 12654515 280408 23910 12680 VEGFA VEGF VEGF 24 4.3 activation is the primary contributor to the neuroprotective function of VEGF in mouse NSC34 motor neuron-like cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209842 12654515 280408 543 391 AKT1 AKT Akt 13 0.3 and molecular genetic approaches we have demonstrated that PI3-K/Akt PI3-K Akt activation is the primary contributor to the neuroprotective function of 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209844 12654515 280411 20996 11179 SOD1 SOD1 mSOD1 4 1.7 Expression of mutant G93A-SOD1 (mSOD1) mSOD1 increased NSC34 motor neuron-like cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209845 12654515 280412 20996 11179 SOD1 SOD1 SOD1 4 3.7 (A) A Western analysis of SOD1 expression in NSC34 motor neuron-like cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209847 12654515 280414 20996 11179 SOD1 SOD1 mSOD1 5 1.7 (B) B Expression of mutant G93A-SOD1 (mSOD1) mSOD1 increased cellular production of reactive oxygen species 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209849 12654515 280419 22551 11892 TNF TNF TNF-A 19 1.2 with WT-SOD1 mutant G93A-SOD1 or treated with hydrogen peroxide or TNF-_amp_#x3b1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209850 12654515 280422 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF reduced hydrogen peroxide- TNF-_amp_#x3b1;- and mutant SOD1-mediated NSC34 motor neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209851 12654515 280422 20996 11179 SOD1 SOD1 SOD1-mediated 7 1.7 VEGF reduced hydrogen peroxide- TNF-_amp_#x3b1;- and mutant SOD1-mediated NSC34 motor neuron-like cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209852 12654515 280423 23910 12680 VEGFA VEGF VEGF 1 4.3 (A) A VEGF reduced hydrogen peroxide-mediated NSC34 motor neuron-like cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209853 12654515 280424 23910 12680 VEGFA VEGF VEGF 8 4.3 NSC34 cells were pretreated with 100 ng/ml ng ml of VEGF or vehicle control for 30 min and then exposed to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209854 12654515 280426 22551 11892 TNF TNF TNF-A 13 1.2 A except that cells were treated with different concentrations of TNF-_amp_#x3b1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209855 12654515 280429 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF activated MAPK activity in mouse NSC34 motor neuron-like cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209856 12654515 280429 12337 6871 MAPK1 MAPK MAPK 2 2.2 VEGF activated MAPK activity in mouse NSC34 motor neuron-like cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209857 12654515 280430 23910 12680 VEGFA VEGF VEGF 11 4.3 with different doses (25_amp_#x2013;200 25_amp_#x2013 200 ng/ml) ng ml of VEGF and then assayed for ERK1/2 ERK1 2 phosphorylation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209858 12654515 280430 12339 6877 MAPK3 ERK1 ERK1 16 2.7 ng/ml) ng ml of VEGF and then assayed for ERK1/2 ERK1 2 phosphorylation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209859 12654515 280431 12337 6871 MAPK1 MAPK MAPK 4 2.2 (B) B The increase of MAPK activity in three independent experiments compared to that of vector 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209860 12654515 280431 12339 6877 MAPK3 ERK1 Erk1 18 2.7 independent experiments compared to that of vector control calibrated by Erk1 expression (mean_amp_#xb1;S.E.M.; mean_amp_#xb1 S.E.M. n =3 *statistically significant compared to 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209861 12654515 280432 23910 12680 VEGFA VEGF VEGF 9 4.3 NSC34 cells were treated with 100 ng/ml ng ml of VEGF for different lengths of time (30_amp_#x2013;180 30_amp_#x2013 180 min and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209862 12654515 280432 12339 6877 MAPK3 ERK1 ERK1 21 2.7 time (30_amp_#x2013;180 30_amp_#x2013 180 min and then assayed for ERK1/2 ERK1 2 phosphorylation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209863 12654515 280433 12337 6871 MAPK1 MAPK MAPK 4 2.2 (D) D The increase of MAPK activity in three independent experiments compared to that of vector 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209864 12654515 280433 12339 6877 MAPK3 ERK1 Erk1 18 2.7 independent experiments compared to that of vector control calibrated by Erk1 expression (mean_amp_#xb1;S.E.M.; mean_amp_#xb1 S.E.M. n =3 *statistically significant compared to 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209865 12654515 280435 23910 12680 VEGFA VEGF VEGF 0 4.3 VEGF activated PI3-K activity in mouse NSC34 motor neuron-like cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209866 12654515 280435 16616 8978 PIK3CG PI3K PI3-K 2 2.6 VEGF activated PI3-K activity in mouse NSC34 motor neuron-like cells 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209867 12654515 280436 23910 12680 VEGFA VEGF VEGF 9 4.3 (A) A NSC34 cells were treated with different doses of VEGF (25_amp_#x2013;200 25_amp_#x2013 200 ng/ml) ng ml and then assayed for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209868 12654515 280436 16616 8978 PIK3CG PI3K PI3-K 16 2.6 (25_amp_#x2013;200 25_amp_#x2013 200 ng/ml) ng ml and then assayed for PI3-K activity as described in Materials and methods 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209869 12654515 280437 16616 8978 PIK3CG PI3K PI3-K 4 2.6 (B) B The increase of PI3-K activity in three independent experiments compared to that of vector 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209870 12654515 280438 23910 12680 VEGFA VEGF VEGF 9 4.3 NSC34 cells were treated with 100 ng/ml ng ml of VEGF for different lengths of time (30_amp_#x2013;180 30_amp_#x2013 180 min and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209871 12654515 280438 16616 8978 PIK3CG PI3K PI3-K 21 2.6 of time (30_amp_#x2013;180 30_amp_#x2013 180 min and then assayed for PI3-K activity as described in Materials and methods 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209872 12654515 280439 16616 8978 PIK3CG PI3K PI3-K 4 2.6 (D) D The increase of PI3-K activity in three independent experiments compared to that of vector 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209873 12654515 280441 16616 8978 PIK3CG PI3K PI3-K 2 2.6 Activation of PI3-K/Akt PI3-K Akt pathways by VEGF contributed to the protection from mutant 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209874 12654515 280441 23910 12680 VEGFA VEGF VEGF 5 4.3 Activation of PI3-K/Akt PI3-K Akt pathways by VEGF contributed to the protection from mutant G93A-SOD1-mediated NSC34 motor neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209875 12654515 280441 543 391 AKT1 AKT Akt 2 0.3 Activation of PI3-K/Akt PI3-K Akt pathways by VEGF contributed to the protection from mutant G93A-SOD1-mediated 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209876 12654515 280442 16616 8978 PIK3CG PI3K PI3-K 1 2.6 (A) A PI3-K activity inhibitor LY294002 not MAPK activity inhibitor PD98059 contributed to 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209877 12654515 280442 12337 6871 MAPK1 MAPK MAPK 6 2.2 (A) A PI3-K activity inhibitor LY294002 not MAPK activity inhibitor PD98059 contributed to the loss of the protection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209878 12654515 280443 16616 8978 PIK3CG PI3K PI3-K 3 2.6 (B) B Constitutively active PI3-K catalytic subunit (p110), p110 not constitutively active MEK1 contributed to 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209879 12654515 280443 19369 16860 SART3 p110 p110 6 1.3 (B) B Constitutively active PI3-K catalytic subunit (p110), p110 not constitutively active MEK1 contributed to the protection from NSC34 1 JUMiner_v2.2 1 0 0 2 2557 TotalCon:2<>2557|CUX1|1523|Complete__16860|SART3|9733|Complete__<>AvaiableGeneRif=2<>BEST:2557|CUX1|0.00106563676060789<>ScoreDetail__16860|SART3|0.000284861985968147__2557|CUX1|0.00106563676060789__ 0 0 0 0 0 209880 12654515 280443 12297 6840 MAP2K1 MEK1 MEK1 10 2.2 Constitutively active PI3-K catalytic subunit (p110), p110 not constitutively active MEK1 contributed to the protection from NSC34 cell death from mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209881 12654515 280444 16618 8979 PIK3R1 p85 p85 3 0.6 (C) C Dominant negative p85 of PI3-K regulatory subunit not dominant negative MEK1 contributed to 1 JUMiner_v2.2 1 0 0 2 8979 TotalCon:3<>8979|PIK3R1|5295|Complete__8980|PIK3R2|5296|Complete__14950|PPP1R13B|23368|Complete__<>AvaiableGeneRif=3<>BEST:8979|PIK3R1|0.000988827623103241<>ScoreDetail__8980|PIK3R2|0.000960689045936396__14950|PPP1R13B|0.000437680693864439__8979|PIK3R1|0.000988827623103241__ 0 0 0 0 0 209882 12654515 280444 16616 8978 PIK3CG PI3K PI3-K 5 2.6 (C) C Dominant negative p85 of PI3-K regulatory subunit not dominant negative MEK1 contributed to the loss 11 JUMiner_v2.2 1 0 0 2 8978 TotalCon:3<>8975|PIK3CA|5290|Complete__8976|PIK3CB|5291|Complete__8978|PIK3CG|5294|Complete__<>AvaiableGeneRif=3<>BEST:8978|PIK3CG|0.00112435358630161<>ScoreDetail__8976|PIK3CB|0.000793446835849663__8978|PIK3CG|0.00112435358630161__8975|PIK3CA|0.000955397649064189__ 0 0 0 0 0 209883 12654515 280444 12297 6840 MAP2K1 MEK1 MEK1 11 2.2 Dominant negative p85 of PI3-K regulatory subunit not dominant negative MEK1 contributed to the loss of the protection from NSC34 cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209884 12654515 280445 23910 12680 VEGFA VEGF VEGF 9 4.3 NSC34 cells were treated with 100 ng/ml ng ml of VEGF for different lengths of time (30_amp_#x2013;180 30_amp_#x2013 180 min and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209885 12654515 280445 543 391 AKT1 AKT Akt 21 0.0 of time (30_amp_#x2013;180 30_amp_#x2013 180 min and then assayed for Akt activation as described in Materials and methods 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209886 12654515 280446 543 391 AKT1 AKT Akt 4 0.0 (E) E The increase of Akt activation in three independent experiments compared to that of vector 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209887 12654515 280447 23910 12680 VEGFA VEGF VEGF 15 4.3 while dominant negative Akt partially abolished the protective function of VEGF on NSC34 motor neuron survival upon expression of mutant G93A-SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209888 12654515 280447 543 391 AKT1 AKT Akt 3 0.0 (F) F Constitutively active Akt enhanced while dominant negative Akt partially abolished the protective function 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 209889 12654515 280447 543 391 AKT1 AKT Akt 8 0.0 (F) F Constitutively active Akt enhanced while dominant negative Akt partially abolished the protective function of VEGF on NSC34 motor 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 211271 12663085 281770 4682 2197 COL1A1 collagen collagen 4 0.3 Pentosidine increases in skin collagen and lens crystallin rectilinearly with age 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211274 12663085 281789 14282 7739 NEFL NF-L NF-L 10 1.6 have three isoforms which are referred to as light (NF-L), NF-L medium (NF-M), NF-M and heavy chains (NF-H) NF-H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211275 12663085 281789 14285 7734 NEFM NF-M NF-M 12 1.6 which are referred to as light (NF-L), NF-L medium (NF-M), NF-M and heavy chains (NF-H) NF-H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211276 12663085 281789 14280 7737 NEFH NFH NF-H 16 0.6 light (NF-L), NF-L medium (NF-M), NF-M and heavy chains (NF-H) NF-H 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211277 12663085 281790 14280 7737 NEFH NFH NF-H 4 0.6 The tail domain of NF-H has multiple repeats of Lys_amp_#x2013 Ser_amp_#x2013 Pro (KSP), KSP accounting 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211278 12663085 281796 12369 6893 MAPT tau tau 7 0.9 Inclusion bodies and intracellular deposits associated with tau are implicated in AD and other neurodegenerative diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211279 12663085 281797 12369 6893 MAPT tau tau 3 0.9 The glycation of tau has also been extensively studied with regard to AD 49 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211280 12663085 281798 12369 6893 MAPT tau tau 10 0.9 probed in soluble and insoluble PHF (paired paired helical filaments -tau from AD brains using anti-CML antibody 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211281 12663085 281799 12369 6893 MAPT tau tau 4 0.9 The results demonstrated that tau becomes glycated in PHF-tau and that the glycation may play 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211282 12663085 281800 12369 6893 MAPT tau tau 1 0.9 Glycated tau exhibited a loss of capacity in the promotion of microtubule 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211283 12663085 281801 20996 11179 SOD1 SOD1 SOD-1 6 2.7 Since mutations of the superoxide dismutase-1 (SOD-1) SOD-1 gene were first identified in 1993 it has been considered 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211285 12663085 281802 20996 11179 SOD1 SOD1 SOD-1 5 2.7 Bredesen advocated the possibility that SOD-1 even plays a role in sporadic ALS 7 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211287 12663085 281803 20996 11179 SOD1 SOD1 SOD-1 3 2.7 The glycation of SOD-1 under diabetic conditions has been studied extensively by Taniguchi et 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211288 12663085 281804 20996 11179 SOD1 SOD1 SOD-1 5 2.7 Glycation prompts the degradation of SOD-1 70 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211289 12663085 281805 20996 11179 SOD1 SOD1 SOD-1 11 2.7 the lens of diabetic rats glycation and the degradation of SOD-1 were clearly recognized 104 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211290 12663085 281806 20996 11179 SOD1 SOD1 SOD-1 1 2.7 Mutant SOD-1 is more easily glycated than normal SOD-1 and would therefore 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211291 12663085 281806 20996 11179 SOD1 SOD1 SOD-1 8 2.7 Mutant SOD-1 is more easily glycated than normal SOD-1 and would therefore be more rapidly degraded 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211292 12663085 281807 20996 11179 SOD1 SOD1 SOD-1 3 2.7 In addition mutant SOD-1 has a low affinity for copper 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211293 12663085 281808 20996 11179 SOD1 SOD1 SOD-1 6 2.7 Copper released from mutant or glycated SOD-1 would promote the generation of hydroxyl radicals by the Fenton 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211294 12663085 281812 5546 2728 DDOST AGE-R1 AGE-R1 19 3.3 receptor function three proteins have been reported as AGE-binding proteins AGE-R1 (oligosaccharyl oligosaccharyl transferase complex protein 48 (OST48)), OST48 AGE-R2 (80K-H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211295 12663085 281812 5546 2728 DDOST OST48 OST48 25 3.0 AGE-binding proteins AGE-R1 (oligosaccharyl oligosaccharyl transferase complex protein 48 (OST48)), OST48 AGE-R2 (80K-H 80K-H protein and AGE-R3 (galectin-3) galectin-3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211296 12663085 281812 17314 9411 PRKCSH AGE-R2 AGE-R2 26 3.5 proteins AGE-R1 (oligosaccharyl oligosaccharyl transferase complex protein 48 (OST48)), OST48 AGE-R2 (80K-H 80K-H protein and AGE-R3 (galectin-3) galectin-3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211297 12663085 281813 926 620 APP amyloid amyloid 12 1.0 al demonstrated that RAGE and SR mediate cell adhesion to amyloid _amp_#x3b2 protein (A_amp_#x3b2;) A_amp_#x3b2 and induction of oxidative stress 118 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 211298 12663085 281830 9462 5013 HMOX1 HO-1 HO-1 4 1.0 AGE coexisted with hemeoxygenase-1 (HO-1) HO-1 on neurofibrillary tangles 119 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211299 12663085 281831 9462 5013 HMOX1 HO-1 HO-1 1 1.0 Since HO-1 is induced under oxidative stress it was speculated that reactive 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211300 12663085 281831 12369 6893 MAPT tau tau 17 0.9 it was speculated that reactive oxygen species were produced by tau modified with AGE leading to the induction of HO-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211301 12663085 281831 9462 5013 HMOX1 HO-1 HO-1 26 1.0 by tau modified with AGE leading to the induction of HO-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211302 12663085 281834 12369 6893 MAPT tau tau 5 0.9 In vitro glycation of A_amp_#x3b2 tau and apoprotein E (apoE), apoE and their effects were investigated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211303 12663085 281834 912 613 APOE apoprotein apoprotein 7 1.0 In vitro glycation of A_amp_#x3b2 tau and apoprotein E (apoE), apoE and their effects were investigated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211304 12663085 281834 912 613 APOE APOE apoE 9 1.0 In vitro glycation of A_amp_#x3b2 tau and apoprotein E (apoE), apoE and their effects were investigated 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211305 12663085 281836 12369 6893 MAPT tau tau 7 0.9 In addition to hyperphosphorylation the glycation of tau leads to the formation of paired helical filaments in AD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211306 12663085 281837 912 613 APOE APOE apoE 3 1.0 The glycation of apoE impairs its binding to heparin 93 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211307 12663085 281838 12369 6893 MAPT tau tau 1 0.9 AGE-modified tau produced reactive oxygen species in cultured cells and also caused 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211319 12663085 281876 14535 7873 NOS2A iNOS iNOS 10 2.7 Wong et al reported that AGE-positive astrocytes and microglia expressing iNOS were found in AD brains and concluded that the activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211326 12663085 281889 926 620 APP amyloid amyloid 6 1.0 In this study most of the amyloid core of a subset of senile plaques showed no staining 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 211338 12663085 281904 912 613 APOE APOE apoE 20 1.0 major proteins of the CSF of AD patients including albumin apoE and transthyretin 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211342 12663085 281906 912 613 APOE APOE apoE 40 1.0 from plasma 90% of transthyretin synthesized by choroid plexus and apoE derived from astrocytes 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211345 12663085 281909 912 613 APOE APOE apoE 29 1.0 to in vitro glycation than does normal apoE3 while glycated apoE maintains its high binding affinity to A_amp_#x3b2 -peptide 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211350 12663085 281953 14535 7873 NOS2A NOS NOS 14 2.7 by antioxidants aminoguanidine and inhibitors of nitric oxide synthase (NOS) NOS 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000427726166974101<>ScoreDetail__7873|NOS2A|0.000427726166974101__7872|NOS1|0.000401885518748567__ 0 0 0 0 0 211352 12663085 281955 4682 2197 COL1A1 collagen collagen 15 0.3 survival of cultured DRG neurons were significantly reduced on glycated collagen IV and laminin 54 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211353 12663085 281966 14452 14374 NLRP1 NAC NAC 11 0.3 of MG and 3-DG was attenuated by N -acetylcysteine (NAC) NAC 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 211354 12663085 281967 14452 14374 NLRP1 NAC NAC 0 0.3 NAC can raise intracellular GSH levels and thereby provide cells with 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 211356 12663085 281968 14452 14374 NLRP1 NAC NAC 2 0.3 In addition NAC also reacts with MG directly and reversibly to form the 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 211357 12663085 281971 14535 7873 NOS2A NOS NOS 19 2.7 glycation AG has antioxidant properties 81 and also inhibits inducible NOS (iNOS) iNOS 100 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000427726166974101<>ScoreDetail__7873|NOS2A|0.000427726166974101__7872|NOS1|0.000401885518748567__ 0 0 0 0 0 211358 12663085 281971 14535 7873 NOS2A iNOS iNOS 20 2.7 has antioxidant properties 81 and also inhibits inducible NOS (iNOS) iNOS 100 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211364 12663085 281992 14535 7873 NOS2A iNOS iNOS 22 2.7 properties 81 and also inhibits inducible nitric oxide synthase (iNOS) iNOS 100 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211366 12663085 281996 926 620 APP amyloid amyloid 12 1.0 al reported preliminary findings suggesting that cross-link breakers can disaggregate amyloid deposits 111 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 211370 12663085 282008 20996 11179 SOD1 SOD1 SOD-1 3 2.7 Familial ALS and SOD-1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211374 12663085 282011 20996 11179 SOD1 SOD1 SOD-1 14 2.7 evidence that more than 50 mutations in the gene for SOD-1 the cytosolic copper/zinc-binding copper zinc-binding dimeric form of a protective 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211375 12663085 282012 20996 11179 SOD1 SOD1 SOD-1 5 2.7 A discussion of FALS with SOD-1 mutations is complicated because transgenic expression of different SOD-1 mutants 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211376 12663085 282012 20996 11179 SOD1 SOD1 SOD-1 14 2.7 with SOD-1 mutations is complicated because transgenic expression of different SOD-1 mutants in both mice and rats causes an ALS-like syndrome 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211378 12663085 282012 20996 11179 SOD1 SOD1 SOD-1 28 2.7 mice and rats causes an ALS-like syndrome independently of whether SOD-1 catalytic activity is changed 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211379 12663085 282013 20996 11179 SOD1 SOD1 SOD-1 10 2.7 These observations suggest that a novel gain-of-function effect of mutant SOD-1 may have a pathogenic role in FALS 33 and 85 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211380 12663085 282014 20996 11179 SOD1 SOD1 SOD-1 9 2.7 First an increase in the peroxidase activity of mutant SOD-1 leading to hydroxyl radical production was assumed while several authors 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211381 12663085 282016 20996 11179 SOD1 SOD1 SOD-1 15 2.7 argued against the copper-mediated theory of motor neuron degeneration in SOD-1 mutant mice 101 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211382 12663085 282017 20996 11179 SOD1 SOD1 SOD-1 2 2.7 Finally mutant SOD-1 has a tendency to form aggregates spontaneously 31 and 89 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211383 12663085 282019 20996 11179 SOD1 SOD1 SOD-1 36 2.7 phosphorylated neurofilament protein are the characteristic markers of FALS with SOD-1 mutations 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211384 12663085 282020 20996 11179 SOD1 SOD1 SOD-1 11 2.7 Shibata et al 83 demonstrated the presence of intense SOD-1 immunoreactivity in the NHIs of FALS patients with a heterozygous 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211385 12663085 282020 20996 11179 SOD1 SOD1 SOD-1 32 2.7 to Val substitution at codon 4 (Ala4Val) Ala4Val in the SOD-1 gene 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211387 12663085 282022 20996 11179 SOD1 SOD1 SOD-1 9 2.7 Of added interest is a recent report that mutant SOD-1 expressed in cultured cells abnormally aggregates in the cytoplasm 12.1.3 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211389 12663085 282024 20996 11179 SOD1 SOD1 SOD-1 34 2.7 heterozygous Ala to Val substitution at codon 4 in the SOD-1 gene 83 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211393 12663085 282027 20996 11179 SOD1 SOD1 SOD-1 7 2.7 No focal collection of either CML or SOD-1 was found in neurons of the controls 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211394 12663085 282028 20996 11179 SOD1 SOD1 SOD-1 6 2.7 In the light of evidence that SOD-1 is a protein that is susceptible to the Maillard reaction 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211396 12663085 282028 20996 11179 SOD1 SOD1 SOD-1 25 2.7 Maillard reaction the finding of the coexistence of CML and SOD-1 in NHIs points to the possibility that CML-modified SOD-1 is 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211398 12663085 282028 20996 11179 SOD1 SOD1 SOD-1 34 2.7 and SOD-1 in NHIs points to the possibility that CML-modified SOD-1 is deposited in NHIs 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211401 12663085 282029 20996 11179 SOD1 SOD1 SOD-1 26 2.7 with familial ALS have been shown to contain not only SOD-1 but also phosphorylated NFP and ubiquitin 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211402 12663085 282031 20996 11179 SOD1 SOD1 SOD-1 4 2.7 The decreased activity of SOD-1 by glycation is not necessarily considered to be the sole 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211403 12663085 282033 20996 11179 SOD1 SOD SOD-1-positive 9 1.4 Kato et al 35 and 37 found SOD-1-positive inclusions in astrocytes (astrocytic astrocytic hyaline inclusions or AHIs as 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211404 12663085 282033 20996 11179 SOD1 SOD1 SOD-1 29 2.7 as in neurons (NHIs) NHIs in patients with FALS with SOD-1 mutations and in transgenic mice expressing human SOD-1 with the 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211405 12663085 282033 20996 11179 SOD1 SOD1 SOD-1 37 2.7 FALS with SOD-1 mutations and in transgenic mice expressing human SOD-1 with the G85R mutation 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211423 12663085 282054 20996 11179 SOD1 SOD1 SOD-1 13 2.7 conducted in the spinal cords of FALS patients with the SOD-1 mutation (A4V) A4V in sporadic ALS patients and in age-matched 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211432 12663085 282059 14535 7873 NOS2A NOS NOSs 22 2.7 pentosidine were negative for stress-response proteins (SRPs), SRPs HNE acrolein NOSs and nitrotyrosine as representative markers of oxidative stress 35 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000427726166974101<>ScoreDetail__7873|NOS2A|0.000427726166974101__7872|NOS1|0.000401885518748567__ 0 0 0 0 0 211436 12663085 282061 20996 11179 SOD1 SOD SOD-1-related 17 1.4 of pyrraline and imidazolone supports the non-oxidative mechanism in the SOD-1-related degeneration of motor neurons 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211457 12663085 282091 5546 2728 DDOST AGE-R1 AGE-R1 15 3.3 receptors (other other than RAGE reported in the human brain AGE-R1 (oligosaccharyltransferase oligosaccharyltransferase family and AGE-R2 (substrate substrate of protein kinase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211458 12663085 282091 17314 9411 PRKCSH AGE-R2 AGE-R2 19 3.5 reported in the human brain AGE-R1 (oligosaccharyltransferase oligosaccharyltransferase family and AGE-R2 (substrate substrate of protein kinase C have been found in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211461 12663085 282092 5546 2728 DDOST AGE-R1 AGE-R1 32 3.3 and three FALS and three control brains with antibodies against AGE-R1 and AGE-R2 13 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211462 12663085 282092 17314 9411 PRKCSH AGE-R2 AGE-R2 32 3.5 and three FALS and three control brains with antibodies against AGE-R1 and AGE-R2 13 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211463 12663085 282092 17314 9411 PRKCSH AGE-R2 AGE-R2 34 3.5 FALS and three control brains with antibodies against AGE-R1 and AGE-R2 13 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211464 12663085 282093 5546 2728 DDOST AGE-R1 AGE-R1 3 3.3 They found that AGE-R1 immunoreactivity was co-localized with those of AGE SOD-1 and neurofilaments 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211465 12663085 282093 20996 11179 SOD1 SOD1 SOD-1 11 2.7 found that AGE-R1 immunoreactivity was co-localized with those of AGE SOD-1 and neurofilaments 12.7 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211468 12663085 282101 20996 11179 SOD1 SOD SOD 0 1.7 SOD and catalase activities were not changed suggesting that specific defects 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211470 12663085 282103 14452 14374 NLRP1 NAC NAC 10 0.3 To test this possibility we added glutathione-augmenting agents such as NAC and glutathione ethyl ester (GEE) GEE 24 h before MG 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>7625|NA|4663|No_GeneRif__14374|NLRP1|22861|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 212175 12684448 283323 20996 11179 SOD1 SOD SOD 16 2.2 sclerosis ROS glutamate excitotoxicity glutamate transport cell culture free radicals SOD nitrotyrosine AMPA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212178 12684448 283326 20996 11179 SOD1 SOD1 SOD1 18 2.2 linked to mutations in the enzyme superoxide dismutase 1 (SOD1) SOD1 (Rosen Rosen et al. 1993 the vast majority (90-95%) 90-95% 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212188 12684448 283343 20996 11179 SOD1 SOD1 SOD1 5 2.2 For spinal cord immunohistochemical studies SOD1 G93A transgenic mice (The The Jackson Laboratory Bar Harbor ME 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212189 12684448 283351 8254 4235 GFAP GFAP GFAP 10 2.5 studies using the astrocyte-specific marker glial fibrillary acidic protein (GFAP) GFAP confirmed the identity of cells with these morphological characteristics (see 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212190 12684448 283353 8254 4235 GFAP GFAP GFAP 15 2.5 blocked and exposed to primary antibody SMI-32 1 5000 and GFAP 1 400 (Dako, Dako Glostrup Denmark glutamate transporter GLT-1 (also 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212191 12684448 283353 20017 10940 SLC1A2 GLT-1 GLT-1 22 2.5 and GFAP 1 400 (Dako, Dako Glostrup Denmark glutamate transporter GLT-1 (also also known as EAAT2 0.17 microg/ml microg ml (kindly 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212192 12684448 283353 20017 10940 SLC1A2 EAAT2 EAAT2 26 2.5 Dako Glostrup Denmark glutamate transporter GLT-1 (also also known as EAAT2 0.17 microg/ml microg ml (kindly kindly supplied by Jeff Rothstein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212193 12684448 283357 20996 11179 SOD1 SOD1 SOD1 1 2.2 For SOD1 G93A transgenic mouse studies spinal cords were removed from 90- 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212201 12684448 283365 20996 11179 SOD1 SOD SOD 28 2.2 (MK-801)] MK-801 alone or in the presence of antioxidants (SOD, SOD 100 U/ml; U ml catalase 400 U/ml), U ml followed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212213 12684448 283383 20996 11179 SOD1 SOD SOD 18 2.2 seen in an annular pattern immediately surrounding MNs in the SOD mouse model of ALS is novel and lends support to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212227 12684448 283398 20996 11179 SOD1 SOD SOD 11 2.2 observed block of this oxidation by an extracellular antioxidant (SOD) SOD provides strong support for the idea that the ROS passes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212233 12684448 283402 20996 11179 SOD1 SOD SOD 8 2.2 In studies of glutamate transporters in ALS and SOD mutant mouse models there has been discussion as to whether 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212237 12684448 283406 20996 11179 SOD1 SOD SOD 15 2.2 motor neurons and ventral horn in ALS and/or and or SOD mutant mouse models (Abe Abe et al. 1995 Beal et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212238 12684448 283406 20996 11179 SOD1 SOD SOD 48 2.2 increased nitrotyrosine staining in an annular pattern around MNs in SOD mutant mice suggest that this species may be involved 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212243 12684448 283412 20996 11179 SOD1 SOD1 SOD1 12 2.2 a critical involvement of both cell types in the mutant SOD1 mouse models of ALS development of disease seems to require 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212248 12684448 283415 20017 10940 SLC1A2 GLT-1 GLT-1 25 2.5 an explanation for previous reports of oxidative modifications of the GLT-1 transporter in ALS (Pedersen Pedersen et al. 1998 Trotti et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212254 12684448 283418 20996 11179 SOD1 SOD SOD 24 2.2 compatible with a multiplicity of inciting mechanisms (e.g., e.g. mutant SOD leading into a common self-propagating disease pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212261 12684448 283444 20996 11179 SOD1 SOD SOD 35 2.2 MK-801 alone ( left or with addition of the antioxidant SOD (100 100 U/ml) U ml to the bath (+ AO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212262 12684448 283449 20996 11179 SOD1 SOD SOD 22 2.2 both the absence ( black or presence ( white of SOD with minimal response in other neurons ( squares 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212263 12684448 283450 20996 11179 SOD1 SOD SOD 45 2.2 ( bottom left or presence ( bottom right of extracellular SOD (+ AO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212265 12684448 283455 20996 11179 SOD1 SOD SOD 30 2.2 micro M MK-801 alone or with addition of the antioxidants SOD (100 100 U/ml) U ml and catalase (400 400 U/ml) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212266 12684448 283465 20996 11179 SOD1 SOD1 SOD1 6 2.2 Lumbar spinal cord sections from 3-month-old SOD1 transgenic mice ( G93A and nontransgenic controls ( non-TG ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212282 12684448 283483 20996 11179 SOD1 SOD SOD 8 2.2 With the addition of a cell-impermeant antioxidant enzyme (SOD, SOD 100 U/ml), U ml despite closely matched MN Delta F 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212284 12684448 283484 20996 11179 SOD1 SOD SOD 5 2.2 This selective effect of extracellular SOD on astrocytic responses suggests strongly that the ROS generated in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212285 12684448 283484 20996 11179 SOD1 SOD SOD 29 2.2 extracellular bath (in in which it can be quenched by SOD before inducing oxidation in neighboring glia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212289 12684448 283495 20996 11179 SOD1 SOD SOD 14 2.2 uptake was prevented by addition of cell-impermeant antioxidant enzymes (SOD, SOD 100 U/ml; U ml catalase 400 U/ml) U ml to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212291 12684448 283498 20996 11179 SOD1 SOD1 SOD1 28 2.2 use of transgenic mice expressing the G93A mutant form of SOD1 associated with familial forms of ALS (Gurney Gurney et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 203907 12718737 273323 20996 11179 SOD1 SOD SOD 6 1.7 Antioxidant enzymes such as superoxide dismutase (SOD), SOD catalase and glutathione peroxidase (GPx) GPx have demonstrated therapeutic efficacy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 203908 12718737 273325 20996 11179 SOD1 SOD SOD 2 1.7 Most recently SOD mimetics small molecules which mimic the activity of endogenous superoxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205107 12753090 274886 14533 7872 NOS1 nNOS nNOS 3 2.7 Proteasome activation and nNOS down-regulation in neuroblastoma cells expressing a Cu Zn superoxide dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205108 12753090 274886 20996 11179 SOD1 ALS ALS 17 1.9 expressing a Cu Zn superoxide dismutase mutant involved in familial ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00168801999439831<>ScoreDetail__5468|IGFALS|0.000488654063463946__11179|SOD1|0.00168801999439831__ 0 0 0 0 0 205109 12753090 274891 14533 7872 NOS1 nNOS nNOS 24 2.7 oxide production and down-regulation of neuronal nitric oxide synthase (nNOS) nNOS level were detected 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205110 12753090 274892 14533 7872 NOS1 nNOS nNOS 1 2.7 The nNOS down-regulation was correlated to increased proteolytic degradation by proteasome because 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205111 12753090 274892 14533 7872 NOS1 nNOS nNOS 15 2.7 to increased proteolytic degradation by proteasome because comparable levels of nNOS were detected in G93A and parental cells upon treatment with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205112 12753090 274893 14533 7872 NOS1 nNOS nNOS 12 2.7 rate of proteolysis observed in G93A cells was specific for nNOS as Cu Zn superoxide dismutase (Cu,Zn Cu Zn SOD degradation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205113 12753090 274893 20996 11179 SOD1 SOD SOD 18 1.9 for nNOS as Cu Zn superoxide dismutase (Cu,Zn Cu Zn SOD degradation by proteasome was influenced neither by its mutation nor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205114 12753090 274895 20996 11179 SOD1 SOD SOD 10 1.9 these results confirm the pro-oxidant activity of G93A Cu Zn SOD mutant and at the same time suggest a cross-talk between 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205390 12769802 275510 14352 7794 NFKB1 NF-kB NF-kB 15 0.3 the role played by the nuclear transcription factor -kB (NF-kB) NF-kB in apoptosis and in the pathogenesis of neurodegenerative disorders such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205392 12769802 275511 14352 7794 NFKB1 NF-kB NF-kB 7 0.3 The effects of ROS and antioxidants on NF-kB function and their relevance in the pathophysiology of neurodegenerative diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201131 12893007 269200 20996 11179 SOD1 SOD1 SOD1 14 2.9 in the gene for Cu/Zn Cu Zn superoxide dismutase (SOD1) SOD1 can be identified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201147 12893007 269226 926 620 APP amyloid amyloid 8 1.0 These patients carry mutant genes for membrane spanning amyloid precursor protein (APP) APP 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 201148 12893007 269226 926 620 APP APP APP 11 0.6 carry mutant genes for membrane spanning amyloid precursor protein (APP) APP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201149 12893007 269227 926 620 APP APP APP 0 0.6 APP have tree isoforms ( containing 695 751 and 770 amino 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201150 12893007 269229 926 620 APP amyloid amyloid 10 1.0 The core of these plaques contains a distinct form of amyloid _amp_#x3b2 -protein (BAP), BAP which is 40 amino acids in 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 201151 12893007 269229 19965 24624 SIL1 BAP BAP 12 0.1 plaques contains a distinct form of amyloid _amp_#x3b2 -protein (BAP), BAP which is 40 amino acids in length 6 JUMiner_v2.2 1 0 0 2 24624 TotalCon:2<>24624|SIL1|64374|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:24624|SIL1|0.000219298245614035<>ScoreDetail__24624|SIL1|0.000219298245614035__30306|PHB2|0__ 0 0 0 0 0 201152 12893007 269230 926 620 APP APP APP 9 0.6 BAP is derived by proteolysis from a much larger APP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201154 12893007 269231 926 620 APP APP APP 3 0.6 Normally degradation of APP involves a proteolytic cleavage in the middle of the BAP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201156 12893007 269232 926 620 APP APP APP 3 0.6 In AD the APP molecule is cut at both ends of the BAP domain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201157 12893007 269232 926 620 APP amyloid amyloid 28 1.0 molecule which is toxic and accumulates in neuritic plaques as amyloid fibrils ([ Price et al . 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 201160 12893007 269233 926 620 APP amyloid amyloid 4 1.0 However argument against the amyloid cascade toxicity in AD are cognitively normal individuals who have 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 201161 12893007 269235 12337 6871 MAPK1 MAP MAP 19 0.3 of an abnormal form of normally occurring microtubule-associated protein (MAP), MAP termed tau 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201162 12893007 269235 12369 6893 MAPT tau tau 21 2.2 abnormal form of normally occurring microtubule-associated protein (MAP), MAP termed tau 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201163 12893007 269236 12369 6893 MAPT tau tau 1 2.2 Normal tau proteins are microtubule binding proteins predominantly axonal that stabilize the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201164 12893007 269237 12369 6893 MAPT tau tau 3 2.2 In normal brain tau is phosphorylated but the phosphate groups are in postmortal tissue 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201165 12893007 269238 12369 6893 MAPT tau tau 2 2.2 In contrast tau protein in PHF is relatively resistant to postmortem dephosphorylation ([ 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201166 12893007 269239 12369 6893 MAPT tau tau 4 2.2 In AD phosphorylation of tau on aberrant site could result in a protein that does 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201180 12893007 269263 912 613 APOE APOE APOE 13 1.3 be associated with the inheritance of apolipoprotein E 4 (APOE) APOE alleles 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201181 12893007 269264 912 613 APOE APOE APOE 0 1.3 APOE genotype and advancing aging are interacting risk factors for late 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201187 12893007 269266 12369 6893 MAPT tau tau 9 2.2 HNE is toxic for P19 cells causing cross-linking of tau into high molecular weight substances that are conjugated with ubiquitin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201192 12893007 269277 12369 6893 MAPT tau tau 11 2.2 preferentially reacts with lysine residues that are prominent components of tau ( Uchida et al and are present in NFT and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201198 12893007 269285 20017 10940 SLC1A2 EAAT2 EAAT2 10 1.8 There is specific loss of the glial glutamate transporter protein EAAT2 in spinal cord of sALS cases ([ Fray et al 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201201 12893007 269288 20996 11179 SOD1 SOD SOD 21 2.9 with mutation in the gene encoding the superoxide dismutase (SOD SOD 1 protein ([ Rosen et al 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201202 12893007 269289 20996 11179 SOD1 SOD SOD 5 2.9 Most of the mutation in SOD 1 protein occur outside the active site and produce only 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201203 12893007 269290 20996 11179 SOD1 SOD SOD 0 2.9 SOD 1 is a Cu/Zn-binding Cu Zn-binding ubiquitous antioxidative enzyme that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201204 12893007 269292 20996 11179 SOD1 SOD SOD 5 2.9 Loss of function in mutant SOD 1 proposes that motor neurons injury occurs by direct toxic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201205 12893007 269293 20996 11179 SOD1 SOD SOD 7 2.9 Weakened affinity for copper in the mutant SOD with consequent leakage of copper which may produce competition between 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201206 12893007 269293 20996 11179 SOD1 SOD SOD 19 2.9 consequent leakage of copper which may produce competition between mutant SOD and other copper and zinc binding protein resulting in diminished 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201207 12893007 269294 20996 11179 SOD1 SOD SOD 13 2.9 mutations could cause an alteration in copper active site of SOD 1 ([ Deng et al 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201208 12893007 269295 20996 11179 SOD1 SOD SOD 9 2.9 Such changes could allow potential toxic gain of mutant SOD 1 to react with various subsidiary activities including peroxidase activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201209 12893007 269296 20996 11179 SOD1 SOD SOD 8 2.9 The wide active site channel of the mutant SOD 1 protein may enhance the access of peroxynitrite to the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201210 12893007 269298 20996 11179 SOD1 SOD SOD 1 2.9 Mutant SOD 1 A4V protein aggregation and accumulation in the anterior horns_amp_#x2019 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201215 12893007 269303 20017 10940 SLC1A2 EAAT2 EAAT2 19 1.8 of HNE was cause of modification of astrocytic glutamate transporter EAAT2 and impaired glutamate transport in ALS ( Pedersen et al 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201220 12893007 269309 20996 11179 SOD1 SOD SOD 6 2.9 The relationship between the oxidative stress SOD 1 aggregation and accumulation of specific advanced glycation end products 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201634 12901835 269760 20996 11179 SOD1 SOD1 SOD1 11 2.4 expression of mutant G93A copper/zinc copper zinc superoxide dismutase (SOD1), SOD1 associated with familial amyotrophic lateral sclerosis specifically causes a decrease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201636 12901835 269760 20996 11179 SOD1 SOD1 SOD1 52 2.4 in human neuroblastoma SH-SY5Y cells compared to cells overexpressing wild-type SOD1 and untransfected cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201638 12901835 269762 20996 11179 SOD1 SOD1 SOD1 5 2.4 No large aggregates of human SOD1 are detectable under basal growth conditions in any of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201640 12901835 269764 20996 11179 SOD1 SOD1 SOD1-generated 10 1.9 Our findings indicate that mitochondrial homeostasis is affected by mutant SOD1-generated ROS independently from the formation of aggregates and that this 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201644 12901835 269768 20996 11179 SOD1 SOD1 SOD1 30 2.4 coding for the antioxidant enzyme Cu Zn superoxide dismutase (SOD1) SOD1 Siddique et al 1991 Deng et al 1993 and Rosen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201645 12901835 269769 20996 11179 SOD1 SOD1 SOD1 0 2.4 SOD1 typically has an antioxidant function because it removes the superoxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201646 12901835 269770 20996 11179 SOD1 SOD1 sod1 3 2.4 However mutations in sod1 gene do not cause FALS through simple loss of dismutating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201647 12901835 269770 20996 11179 SOD1 SOD1 SOD1s 31 1.9 et al 1993 several lines of evidence indicate that mutant SOD1s are responsible for the death of motor neurons through the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201649 12901835 269773 20996 11179 SOD1 SOD1 SOD1 15 2.4 be responsible for the enhancement of the peroxidative activity of SOD1 as independently reported by two groups Wiedau-Pazos et al 1996 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201650 12901835 269775 20996 11179 SOD1 SOD1 SOD1s 10 1.9 The second hypothesis relies on the observation that misfolded mutant SOD1s might release their metal ions (copper copper and zinc and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201651 12901835 269777 20996 11179 SOD1 SOD1 SOD1 8 2.4 In particular decrease of the copper-buffering properties of SOD1 Steinkuhler et al 1991 could result in an increase of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201652 12901835 269780 20996 11179 SOD1 SOD1 SOD1s 8 1.9 It is not clear at present whether misfolded SOD1s would also bind copper ions and mediate increase in oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201653 12901835 269781 20996 11179 SOD1 SOD1 SOD1 42 2.4 neuron disease with mice devoid of the Copper Chaperone for SOD1 (CCS CCS _amp_#x2212;/_amp_#x2212;) _amp_#x2212 _amp_#x2212 does not rescue the phenotype 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201654 12901835 269781 3838 1613 CCS CCS CCS 43 1.2 with mice devoid of the Copper Chaperone for SOD1 (CCS CCS _amp_#x2212;/_amp_#x2212;) _amp_#x2212 _amp_#x2212 does not rescue the phenotype Subramaniam et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201655 12901835 269782 3838 1613 CCS CCS CCS 7 1.2 However although it is most probable that CCS is not directly involved in ALS mishandling of copper is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201657 12901835 269782 20996 11179 SOD1 SOD1 SOD1 30 2.4 as the major culprit in oxidative stress induced by mutant SOD1 Bush 2002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201659 12901835 269784 20996 11179 SOD1 SOD1 SOD1 8 2.4 The recent demonstration that a substantial amount of SOD1 (previously previously thought of as being exclusively a cytosolic enzyme 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201663 12901835 269788 20996 11179 SOD1 SOD1 SOD1-linked 12 1.9 reductase defects have been shown both in postmortem brains from SOD1-linked FALS patients Browne et al 1998 and in skeletal muscle 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201665 12901835 269789 20996 11179 SOD1 SOD1 SOD1 43 2.4 spinal motor neurons of transgenic mice carrying G93A mutant human SOD1 Warita et al 2001 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201668 12901835 269793 20996 11179 SOD1 SOD1 SOD1 21 2.4 by site-directed mutagenesis of the cDNA coding for that mutant SOD1 cloning in expression vectors and transfection of parental human neuroblastoma 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201672 12901835 269826 20996 11179 SOD1 SOD1 SOD1 20 2.4 using the Immun-blot kit from Bio-Rad with a polyclonal antihuman SOD1 antibody Steinkuhler et al 1991 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201674 12901835 269830 20996 11179 SOD1 SOD1 SOD1 18 2.4 for 2 h at 37_amp_#xb0 C with a monoclonal antimouse SOD1 antibody (Sigma) Sigma 1 300 and for 2 h at 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201679 12901835 269847 20996 11179 SOD1 SOD1 SOD1 25 2.4 0.05 in line with the well-known protective role of wild-type SOD1 overexpression against free radicals 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201688 12901835 269864 20996 11179 SOD1 SOD1 SOD1 3 2.4 Aggregation of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201689 12901835 269865 20996 11179 SOD1 SOD1 SOD1 9 2.4 It has been suggested that aggregation of misfolded mutant SOD1 contributes to neurodegeneration in FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201690 12901835 269866 20996 11179 SOD1 SOD1 SOD1 6 2.4 However it is still debated whether SOD1 aggregates represent a cause a correlate or a consequence of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201691 12901835 269867 20996 11179 SOD1 SOD1 SOD1 10 2.4 In all of our lines no large aggregates of human SOD1 are detectable after immunostaining in basal growth conditions ( Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201692 12901835 269868 20996 11179 SOD1 SOD1 SOD1 13 2.4 localized in the cytoplasm and roughly paralleled the level of SOD1 expression being more intense in transfected cells than in control 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201693 12901835 269869 20996 11179 SOD1 SOD1 SOD1-positive 12 1.9 specifically inhibit the proteasome activity with lactacystin for 16 h SOD1-positive aggregates localize in the cytoplasm of 30_amp_#x2013 40% cells expressing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201694 12901835 269869 20996 11179 SOD1 SOD1 SOD1s 23 1.9 localize in the cytoplasm of 30_amp_#x2013 40% cells expressing mutant SOD1s but not in control cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201695 12901835 269870 20996 11179 SOD1 SOD1 SOD1 11 2.4 is paralleled by the appearance of an insoluble fraction containing SOD1 in extracts from cells expressing mutant SOD1 as seen in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201696 12901835 269870 20996 11179 SOD1 SOD1 SOD1 18 2.4 insoluble fraction containing SOD1 in extracts from cells expressing mutant SOD1 as seen in Western blot experiments where detergent-soluble and -insoluble 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201698 12901835 269874 20996 11179 SOD1 SOD1 SOD1 16 2.4 to demonstrate that human neuroblastoma SH-SY5Y cell lines carrying G93A SOD1 mutation possess remarkable biochemical abnormalities compared to control cells such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201700 12901835 269876 20996 11179 SOD1 SOD1 SOD1 5 2.4 This provides evidence that G93A SOD1 mutation acts as a remarkable source of intracellular oxidative stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201703 12901835 269879 20996 11179 SOD1 SOD1 SOD1 26 2.4 and mitochondrial ultrastructural abnormalities were found in animal models carrying SOD1 mutations Wong et al 1995 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201705 12901835 269885 20996 11179 SOD1 SOD1 SOD1 14 2.4 be a direct consequence of the pro-oxidant activity of mutant SOD1 indeed the use of NAC promptly reverts both increase in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201710 12901835 269890 20996 11179 SOD1 SOD1 SOD1 21 2.4 survival and motor performance in transgenic mice with a G93A SOD1 mutation Andreassen et al 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201712 12901835 269892 20996 11179 SOD1 SOD1 SOD1 8 2.4 When we specifically inhibit the proteasome activity insoluble SOD1 aggregates localize in the cytoplasm of cells expressing mutant SOD1s 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201713 12901835 269892 20996 11179 SOD1 SOD1 SOD1s 18 1.9 SOD1 aggregates localize in the cytoplasm of cells expressing mutant SOD1s but not in control cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201714 12901835 269894 14373 7808 NGF NGF NGF 27 1.2 is not causative of death in nerve growth factor (NGF)-differentiated NGF -differentiated PC12 cells transfected with mutant SOD1s (SODMT, SODMT V148G 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201715 12901835 269894 20996 11179 SOD1 SOD1 SOD1s 33 1.9 growth factor (NGF)-differentiated NGF -differentiated PC12 cells transfected with mutant SOD1s (SODMT, SODMT V148G or A4V 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201716 12901835 269895 20996 11179 SOD1 SOD1 SOD1 38 2.4 survey on the properties of a large number of mutant SOD1 in vitro Hayward et al 2002 and Rodriguez et al 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202233 12909279 270764 20996 11179 SOD1 SOD1 SOD1 37 2.7 coding for the antioxidant enzyme Cu Zn superoxide dismutase (SOD1) SOD1 have been reported in fALS patients 21 and 80 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202234 12909279 270765 20996 11179 SOD1 SOD1 SOD1 0 2.7 SOD1 is a very well-characterised homodimeric enzyme present in virtually every 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202235 12909279 270766 20996 11179 SOD1 SOD1 SOD1 0 2.7 SOD1 binds zinc and copper ions with the Cu atom playing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202237 12909279 270767 20996 11179 SOD1 SOD1 SOD1 7 2.7 Linkage studies have revealed that mutations in SOD1 are responsible for 10_amp_#x2013 15% of fALS cases 40 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202238 12909279 270768 20996 11179 SOD1 SOD1 SOD1 7 2.7 To date there are about 100 different SOD1 point mutations ( www.als.org reported in fALS families with various 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202239 12909279 270769 20996 11179 SOD1 SOD1 SOD1 20 2.7 and result in alteration of amino acids scattered throughout the SOD1 structure while some mutations affect the active site others are 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202240 12909279 270773 20996 11179 SOD1 SOD1 SOD1s 10 1.9 For this reason the mechanisms through which expression of mutant SOD1s result in motoneuron injury and death are still controversial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202241 12909279 270774 20996 11179 SOD1 SOD1 SOD1 13 2.7 believed that the gain of a novel toxic function of SOD1 is responsible for the acquisition of the pathological phenotype 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202242 12909279 270776 20996 11179 SOD1 SOD1 SOD1 0 2.7 SOD1 is an abundant component of many cell types accounting for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202243 12909279 270777 20996 11179 SOD1 SOD1 SOD1 21 2.7 _amp_#x201c conformational_amp_#x201d diseases formation of insoluble aggregates of misfolded mutant SOD1 contributes to cell death in fALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202244 12909279 270778 20996 11179 SOD1 SOD1 SOD1 6 2.7 However it is still debated whether SOD1 aggregates represent a cause a correlate or a consequence of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202245 12909279 270779 20996 11179 SOD1 SOD1 SOD1 19 2.7 of sALS patients contain cytoplasmic aggregates that show immunoreactivity for SOD1 and ubiquitin similar inclusion bodies were also observed in SOD1-linked 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202246 12909279 270779 20996 11179 SOD1 SOD1 SOD1-linked 29 2.2 SOD1 and ubiquitin similar inclusion bodies were also observed in SOD1-linked fALS patients 12 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202247 12909279 270781 20996 11179 SOD1 SOD1 SOD1 7 2.7 More recent evidence questioned the relevance of SOD1 aggregates in the pathogenesis of fALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202248 12909279 270782 20996 11179 SOD1 SOD1 SOD1 9 2.7 For instance it has been reported that formation of SOD1 aggregates is independent of induction of cell death 52 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202249 12909279 270783 20996 11179 SOD1 SOD1 SOD1 0 2.7 SOD1 aggregates may be toxic through sequestration of other proteins required 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202250 12909279 270784 20996 11179 SOD1 SOD1 SOD1 1 2.7 Also SOD1 aggregates may reduce proteasome activity needed for normal protein turnover 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202252 12909279 270787 20996 11179 SOD1 SOD1 SOD1s 2 1.9 How mutant SOD1s cause oxidative stress and which molecules represent direct targets/propagators targets 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202254 12909279 270789 20996 11179 SOD1 SOD1 SOD1 17 2.7 the active site could exacerbate the reported peroxidative activity of SOD1 as suggested by studies in vitro 100 and in vivo 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202255 12909279 270793 20996 11179 SOD1 SOD1 SOD1 36 2.7 it has been suggested that aggregated but still active mutant SOD1 may mediate the formation of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202259 12909279 270800 20996 11179 SOD1 SOD1 SOD1 36 2.7 uptake intracellular delivery from chaperones (e.g e.g copper chaperone for SOD1 (CCS), CCS COX17 and Atx1 to specific targets (such such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202260 12909279 270800 3838 1613 CCS CCS CCS 37 1.2 delivery from chaperones (e.g e.g copper chaperone for SOD1 (CCS), CCS COX17 and Atx1 to specific targets (such such as SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202261 12909279 270800 4836 2264 COX17 COX17 COX17 38 0.6 from chaperones (e.g e.g copper chaperone for SOD1 (CCS), CCS COX17 and Atx1 to specific targets (such such as SOD1 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202262 12909279 270800 1277 798 ATOX1 ATX1 Atx1 40 1.3 (e.g e.g copper chaperone for SOD1 (CCS), CCS COX17 and Atx1 to specific targets (such such as SOD1 and cytochrome c 2 JUMiner_v2.2 1 0 0 2 798 TotalCon:2<>10548|ATXN1|6310|Complete__798|ATOX1|475|Complete__<>AvaiableGeneRif=2<>BEST:798|ATOX1|0.00121583085752467<>ScoreDetail__10548|ATXN1|0.000480397441004851__798|ATOX1|0.00121583085752467__ 0 0 0 0 0 202263 12909279 270800 20996 11179 SOD1 SOD1 SOD1 46 2.7 CCS COX17 and Atx1 to specific targets (such such as SOD1 and cytochrome c oxidase and/or and or storage in copper 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202264 12909279 270803 20996 11179 SOD1 SOD1 SOD1-linked 6 2.2 This is not the case in SOD1-linked fALS in which no alteration of total copper content is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202265 12909279 270803 3838 1613 CCS CCS CCS 25 1.2 content is observed not even in experimental conditions in which CCS is missing 90 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202266 12909279 270806 20996 11179 SOD1 SOD1 SOD1-linked 5 2.2 This may be occurring in SOD1-linked fALS since it is known that many mutant SOD1s do 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202267 12909279 270806 20996 11179 SOD1 SOD1 SOD1s 14 1.9 in SOD1-linked fALS since it is known that many mutant SOD1s do not bind metals properly in vitro and possibly in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202268 12909279 270807 20996 11179 SOD1 SOD1 SOD1s 13 1.9 ability to bind copper (and and zinc among different mutant SOD1s have been reported 42 this seems to be to a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202269 12909279 270807 20996 11179 SOD1 SOD1 SOD1 36 2.7 general characteristic of fALS-SOD1s reinforcing the previously suggested hypothesis that SOD1 plays a crucial role in copper buffering 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202270 12909279 270809 20996 11179 SOD1 SOD1 sod1 2 2.7 In man sod1 is present in a single copy per haploid genome and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202271 12909279 270809 20996 11179 SOD1 SOD1 SOD1 31 2.7 penetrance close to 1 with patients usually heterozygous for mutant SOD1 except for some families carrying the mutation D90A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202272 12909279 270810 20996 11179 SOD1 SOD1 SOD1 5 2.7 Therefore alteration of half of SOD1 molecules in patients may result in a relevant imbalance of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202273 12909279 270810 20996 11179 SOD1 SOD1 SOD1 25 2.7 of either copper buffering or copper chemistry especially considering that SOD1 is a very abundant protein representing up to 1% of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202274 12909279 270814 20996 11179 SOD1 SOD1 SOD1 42 2.7 models 16 and 32 inhibit the peroxidase activity of mutant SOD1 A4V and G93A in vitro 100 rescue elevation of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202277 12909279 270825 3838 1613 CCS CCS CCS 12 1.2 transgenic fALS-mice model alteration of Cu metabolism via removal of CCS does not induce decrease of serum Cp 90 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202278 12909279 270826 20996 11179 SOD1 SOD1 SOD1-linked 27 2.2 Cp has been described 68 that could be altered in SOD1-linked fALS because of copper mishandling and cause iron mishandling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202279 12909279 270827 20996 11179 SOD1 SOD SOD 24 1.9 yeast Saccharomyces cerevisiae 20 and 87 in which lack of SOD causes a substantial increase in the Fe demand of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202280 12909279 270830 20996 11179 SOD1 SOD SOD-defective 6 1.9 The increased Fe demand of the SOD-defective yeast cell may reflect its aim to continuously reconstitute the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202287 12909279 270837 166 118 ACO2 aconitase aconitase 28 1.3 involved in mitochondrial metabolism such as Complex I 53 and aconitase 51 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202290 12909279 270838 20996 11179 SOD1 SOD1 SOD1 12 2.7 an imbalance in ROS production_amp_#x2014 either caused directly by mutant SOD1 or indirectly by other mechanisms_amp_#x2014 could be responsible for damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202292 12909279 270839 20996 11179 SOD1 SOD1 SOD1-linked 14 2.2 complexes has been reported in patients and in models for SOD1-linked fALS 19 49 60 61 and 101 and there is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202294 12909279 270842 24231 12780 WNT2 IRP IRP-regulated 22 0.5 ii Fe_amp_#x2013 S-cluster status nor (iii) iii transcription of IRE_amp_#x2013 IRP-regulated genes have been studied in patients suffering from fALS or 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202297 12909279 270845 20996 11179 SOD1 SOD1 SOD1 17 2.7 that the metal-mediated free radical generation derived either from mutant SOD1 or from mishandled metal ions might be related to the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202300 12909279 270852 10668 6115 IREB2 IRP2 IRP-2 24 1.2 but also in the regulation of translation-regulatory factors such as IRP-2 a factor involved in intracellular iron metabolism which is broken 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202301 12909279 270853 10668 6115 IREB2 IRP2 IRP-2 10 1.2 In this view proteasomal inhibition may disrupt normal turnover of IRP-2 thus causing elevated Fe levels within the cell which_amp_#x2014 as 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202303 12909279 270856 20996 11179 SOD1 SOD1 SOD1-linked 18 2.2 clinically indistinguishable therefore studies on the less frequent genetically inherited SOD1-linked form of the disease are thought to be potentially useful 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202305 12909279 270857 20996 11179 SOD1 SOD1 SOD1 19 2.7 in order to understand cellular alterations induced by mutation of SOD1 17 and 48 up to date no study has shed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202306 12909279 270857 20996 11179 SOD1 SOD1 SOD1 54 2.7 patients and in the transgenic mice model (while while mutant SOD1 is expressed ubiquitously 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202311 12909279 270864 20996 11179 SOD1 SOD1 SOD1 6 2.7 Therefore the neurotoxic effect of mutant SOD1 seems to be not a simple consequence of its expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202312 12909279 270865 20996 11179 SOD1 SOD1 SOD1 15 2.7 findings indicating that neuroinflammatory processes mediate the pathogenic effect of SOD1 mutation (and, and more in general ALS pathogenesis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202315 12909279 270868 14533 7872 NOS1 NOS NOS 12 1.2 expression of several proteins such as nitric oxide synthase (NOS) NOS 93 and COX2 70 that might be involved in mechanisms 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000474682520103884<>ScoreDetail__7873|NOS2A|0.000474682520103884__7872|NOS1|0.000433079922414797__ 0 0 0 0 0 202316 12909279 270868 17610 9605 PTGS2 COX2 COX2 17 1.3 proteins such as nitric oxide synthase (NOS) NOS 93 and COX2 70 that might be involved in mechanisms of inflammation-mediated neurodegeneration 1 JUMiner_v2.2 1 1 UserEdit 0 2 9605 TotalCon:2<>7421|MT-CO2|4513|Complete__9605|PTGS2|5743|Complete__<>AvaiableGeneRif=2<>BEST:9605|PTGS2|0.000536714124144385<>ScoreDetail__7421|MT-CO2|0.000364928974008948__9605|PTGS2|0.000536714124144385__ 1 1 13732 7421 MT-CO2 0 202318 12909279 270869 17610 9605 PTGS2 COX2 COX2 1 1.3 Indeed COX2 and NOS activity are dramatically increased in post-mortem spinal cord 1 JUMiner_v2.2 1 1 UserEdit 0 2 9605 TotalCon:2<>7421|MT-CO2|4513|Complete__9605|PTGS2|5743|Complete__<>AvaiableGeneRif=2<>BEST:9605|PTGS2|0.000536714124144385<>ScoreDetail__7421|MT-CO2|0.000364928974008948__9605|PTGS2|0.000536714124144385__ 1 1 13732 7421 MT-CO2 0 202319 12909279 270869 14533 7872 NOS1 NOS NOS 3 1.2 Indeed COX2 and NOS activity are dramatically increased in post-mortem spinal cord samples from 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000474682520103884<>ScoreDetail__7873|NOS2A|0.000474682520103884__7872|NOS1|0.000433079922414797__ 0 0 0 0 0 202321 12909279 270870 17610 9605 PTGS2 COX2 COX2 3 1.3 Increased levels of COX2 and of the pro-inflammatory prostaglandin PGE2 were found in the 1 JUMiner_v2.2 1 1 UserEdit 0 2 9605 TotalCon:2<>7421|MT-CO2|4513|Complete__9605|PTGS2|5743|Complete__<>AvaiableGeneRif=2<>BEST:9605|PTGS2|0.000536714124144385<>ScoreDetail__7421|MT-CO2|0.000364928974008948__9605|PTGS2|0.000536714124144385__ 1 1 13732 7421 MT-CO2 0 202323 12909279 270871 17610 9605 PTGS2 COX2 COX2 4 1.3 Treatment with a selective COX2 inhibitor markedly inhibits production of PGE2 in the spinal cord 1 JUMiner_v2.2 1 1 UserEdit 0 2 9605 TotalCon:2<>7421|MT-CO2|4513|Complete__9605|PTGS2|5743|Complete__<>AvaiableGeneRif=2<>BEST:9605|PTGS2|0.000536714124144385<>ScoreDetail__7421|MT-CO2|0.000364928974008948__9605|PTGS2|0.000536714124144385__ 1 1 13732 7421 MT-CO2 0 202330 12909279 270879 20996 11179 SOD1 SOD1 SOD1 21 2.7 the only (partially) partially understood is the presence of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202331 12909279 270880 20996 11179 SOD1 SOD1 SOD1 7 2.7 The general concept is that upon mutation SOD1 is partially misfolded and binds copper improperly 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202333 12909279 270884 20996 11179 SOD1 SOD SOD-like 5 1.9 In both cases evidence of SOD-like activity arising from copper bound to peptide A_amp_#x3b2 and to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202334 12909279 270884 17264 9353 PRDX2 PrP PrP 18 1.1 from copper bound to peptide A_amp_#x3b2 and to the protein PrP respectively has been provided 11 and 47 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.000813320654702895<>ScoreDetail__1325|C4BPA|0.000515189789270757__47|ABCB6|0.000348999534667287__9353|PRDX2|0.000813320654702895__9449|PRNP|0.000539111205998924__ 0 0 0 0 0 202335 12909279 270885 17264 9353 PRDX2 PrP PrP 11 1.1 would not be surprising to learn that copper-bound A_amp_#x3b2 and PrP are also able to induce the formation of the noxious 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:4<>9353|PRDX2|7001|Complete__9449|PRNP|5621|Complete__47|ABCB6|10058|Complete__1325|C4BPA|722|Complete__<>AvaiableGeneRif=4<>BEST:9353|PRDX2|0.000813320654702895<>ScoreDetail__1325|C4BPA|0.000515189789270757__47|ABCB6|0.000348999534667287__9353|PRDX2|0.000813320654702895__9449|PRNP|0.000539111205998924__ 0 0 0 0 0 196454 14572730 262141 20996 11179 SOD1 SOD SOD 47 1.4 a mutant form of copper/zinc copper zinc superoxide dismutase (SOD) SOD 1 in patients with familial ALS which supports a crucial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186249 14625013 249317 20996 11179 SOD1 SOD1 mSOD1 11 1.4 human mutated form (G93A) G93A of Cu Zn-superoxide dismutase (mSOD1) mSOD1 develop motor neuron degeneration resembling amyotrophic lateral sclerosis 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186250 14625013 249320 20996 11179 SOD1 SOD1 mSOD1 22 1.4 0.375 g/kg) g kg on disease onset and survival of mSOD1 transgenic mice 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186251 14625013 249322 20996 11179 SOD1 SOD1 mSOD1 7 1.4 We conclude that zinc sulfate amplifies the mSOD1 transgenic mouse phenotype 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186253 14625013 249325 20996 11179 SOD1 SOD1 SOD1 16 1.4 but mutations in the gene encoding Cu Zn-superoxide dismutase (SOD1) SOD1 are found in approximately 2% of ALS patients 12 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186255 14625013 249326 20996 11179 SOD1 SOD1 SOD1 4 1.4 Transgenic mice overexpressing human SOD1 carrying the G93A mutation (mSOD1) mSOD1 develop a rapidly progressive 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186256 14625013 249326 20996 11179 SOD1 SOD1 mSOD1 9 1.4 Transgenic mice overexpressing human SOD1 carrying the G93A mutation (mSOD1) mSOD1 develop a rapidly progressive muscular weakness due to motor neuron 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186258 14625013 249327 20996 11179 SOD1 SOD1 SOD1 0 1.4 SOD1 is a metalloenzyme that catalyzes the conversion of superoxide to 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186259 14625013 249329 20996 11179 SOD1 SOD1 mSOD1 4 1.4 Such gained properties of mSOD1 include increased formation of free radicals with hydrogen peroxide as 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186260 14625013 249330 20996 11179 SOD1 SOD1 SOD1 7 1.4 In vitro studies showed that mutations in SOD1 destabilize the protein and decrease the affinity of SOD1 for 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186261 14625013 249330 20996 11179 SOD1 SOD1 SOD1 16 1.4 in SOD1 destabilize the protein and decrease the affinity of SOD1 for zinc up to 50-fold compared to the wild type 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186262 14625013 249331 20996 11179 SOD1 SOD1 SOD1 1 1.4 Zinc-deficient SOD1 leads to an increase in nitrotyrosine formation and induces apoptosis 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186263 14625013 249332 20996 11179 SOD1 SOD1 SOD1 8 1.4 This toxicity required copper to be bound to SOD1 and was not present when SOD1 was replete with zinc 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186264 14625013 249332 20996 11179 SOD1 SOD1 SOD1 14 1.4 to be bound to SOD1 and was not present when SOD1 was replete with zinc 3 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186265 14625013 249336 20996 11179 SOD1 SOD1 mSOD1 11 1.4 upregulation of MT's is seen in the spinal cord of mSOD1 transgenic mice 11 and reduction of MT-I and -II significantly 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186266 14625013 249336 20996 11179 SOD1 SOD1 mSOD1 27 1.4 and reduction of MT-I and -II significantly reduces survival of mSOD1 transgenic mice 10 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186267 14625013 249337 20996 11179 SOD1 SOD1 SOD1 36 1.4 expression of MT's would be neuroprotective in transgenic high-copy human SOD1 G93A mice (Jackson Jackson Laboratory Bar Harbor MN 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186268 14625013 249339 20996 11179 SOD1 SOD1 SOD1 2 1.4 G93A male SOD1 mice were crossbred with non-transgenic Balb/C Balb C females 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186269 14625013 249343 20996 11179 SOD1 SOD1 SOD1 4 1.4 Prior to the G93A SOD1 experiment the effect of high dose zinc sulphate on hematological 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186270 14625013 249345 20996 11179 SOD1 SOD1 SOD1 3 1.4 In the G93A SOD1 mice the hind-paw extension reflex test was performed 5 days 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186271 14625013 249367 20996 11179 SOD1 SOD1 mSOD1 2 1.4 In untreated mSOD1 transgenic mice a similar though clearly more intense staining pattern 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186272 14625013 249367 20996 11179 SOD1 SOD1 mSOD1 28 1.4 in immunoreactivity for MT's were observed between zinc-treated and untreated mSOD1 transgenic mice ( Figs 2B C 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186273 14625013 249368 20996 11179 SOD1 SOD1 mSOD1 33 1.4 would attenuate motor neuron death and thus extend survival of mSOD1 transgenic mice 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186274 14625013 249369 20996 11179 SOD1 SOD1 mSOD1 19 1.4 zinc sulphate (0.375 0.375 g/kg) g kg decreased survival of mSOD1 transgenic mice 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186275 14625013 249371 20996 11179 SOD1 SOD1 mSOD1 26 1.4 level in the spinal cord of both treated and untreated mSOD1 transgenic mice but a further upregulation of MT in the 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186276 14625013 249373 20996 11179 SOD1 SOD1 mSOD1 4 1.4 The selective toxicity in mSOD1 transgenic mice may be due to enhanced motor neuron death 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186277 14625013 249375 20996 11179 SOD1 SOD1 mSOD1 16 1.4 raises two related questions why is zinc not neuroprotective in mSOD1 transgenic mice and why does it even appear to accelerate 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186278 14625013 249376 20996 11179 SOD1 SOD1 mSOD1 27 1.4 maximum in the spinal cord (and and intestinal wall of mSOD1 transgenic mice 11 so that a further upregulation cannot be 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 186279 14625013 249377 20996 11179 SOD1 SOD1 mSOD1 42 1.4 direct toxic effect of zinc on motor neurons 18 of mSOD1 transgenic mice 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187161 14648077 250304 20996 11179 SOD1 SOD1 SOD1 18 7.9 developed both an antioxidant system containing superoxide dismutase 1 (SOD1) SOD1 and a redox system including peroxiredoxin2 (Prx2, Prx2 thioredoxin peroxidase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187162 14648077 250304 17264 9353 PRDX2 PRX2 Prx2 25 3.9 1 (SOD1) SOD1 and a redox system including peroxiredoxin2 (Prx2, Prx2 thioredoxin peroxidase and glutathione peroxidase1 (GPx1): GPx1 SOD1 converts superoxide 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187163 14648077 250304 8759 4553 GPX1 GPX1 GPx1 31 2.2 including peroxiredoxin2 (Prx2, Prx2 thioredoxin peroxidase and glutathione peroxidase1 (GPx1): GPx1 SOD1 converts superoxide radicals into hydrogen peroxide (H H 2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187164 14648077 250304 20996 11179 SOD1 SOD1 SOD1 32 7.9 peroxiredoxin2 (Prx2, Prx2 thioredoxin peroxidase and glutathione peroxidase1 (GPx1): GPx1 SOD1 converts superoxide radicals into hydrogen peroxide (H H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187165 14648077 250304 17264 9353 PRDX2 PRX2 Prx2 64 3.9 (H H 2 O and oxygen (O O 2 by Prx2 and GPx1 that directly regulate the redox system 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187166 14648077 250304 8759 4553 GPX1 GPX1 GPx1 66 2.2 2 O and oxygen (O O 2 by Prx2 and GPx1 that directly regulate the redox system 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187168 14648077 250305 17264 9353 PRDX2 PRX2 Prx2 12 3.9 biological significance of the interaction of the redox system (Prx2/GPx1) Prx2 GPx1 with SOD1 in SOD1-mutated motor neurons in vivo we 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187169 14648077 250305 8759 4553 GPX1 GPX1 GPx1 12 2.2 significance of the interaction of the redox system (Prx2/GPx1) Prx2 GPx1 with SOD1 in SOD1-mutated motor neurons in vivo we produced 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187170 14648077 250305 20996 11179 SOD1 SOD1 SOD1 14 7.9 the interaction of the redox system (Prx2/GPx1) Prx2 GPx1 with SOD1 in SOD1-mutated motor neurons in vivo we produced an affinity-purified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187171 14648077 250305 20996 11179 SOD1 SOD1 SOD1-mutated 16 1.7 of the redox system (Prx2/GPx1) Prx2 GPx1 with SOD1 in SOD1-mutated motor neurons in vivo we produced an affinity-purified rabbit antibody 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187172 14648077 250305 17264 9353 PRDX2 PRX2 Prx2 28 3.9 neurons in vivo we produced an affinity-purified rabbit antibody against Prx2 and investigated the immunohistochemical localization of Prx2 and GPx1 in 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187173 14648077 250305 17264 9353 PRDX2 PRX2 Prx2 35 3.9 rabbit antibody against Prx2 and investigated the immunohistochemical localization of Prx2 and GPx1 in neuronal Lewy body-like hyaline inclusions (LBHIs) LBHIs 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187174 14648077 250305 8759 4553 GPX1 GPX1 GPx1 37 2.2 against Prx2 and investigated the immunohistochemical localization of Prx2 and GPx1 in neuronal Lewy body-like hyaline inclusions (LBHIs) LBHIs in the 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187175 14648077 250305 20996 11179 SOD1 SOD1 SOD1 74 7.9 and an Ala Val substitution at codon 4 in the SOD1 gene as well as in transgenic rats expressing human SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187176 14648077 250305 20996 11179 SOD1 SOD1 SOD1 84 7.9 SOD1 gene as well as in transgenic rats expressing human SOD1 with H46R and G93A mutations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187177 14648077 250306 20996 11179 SOD1 SOD1 SOD1-mutated 7 1.7 The LBHIs in motor neurons from the SOD1-mutated FALS patients and transgenic rats showed identical immunoreactivities for Prx2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187178 14648077 250306 17264 9353 PRDX2 PRX2 Prx2 17 3.9 SOD1-mutated FALS patients and transgenic rats showed identical immunoreactivities for Prx2 and GPx1 the reaction product deposits with the antibodies against 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187179 14648077 250306 8759 4553 GPX1 GPX1 GPx1 19 2.2 patients and transgenic rats showed identical immunoreactivities for Prx2 and GPx1 the reaction product deposits with the antibodies against Prx2 and 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187180 14648077 250306 17264 9353 PRDX2 PRX2 Prx2 28 3.9 and GPx1 the reaction product deposits with the antibodies against Prx2 and GPx1 were localized in the LBHIs 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187181 14648077 250306 8759 4553 GPX1 GPX1 GPx1 30 2.2 the reaction product deposits with the antibodies against Prx2 and GPx1 were localized in the LBHIs 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187182 14648077 250307 20996 11179 SOD1 SOD1 SOD1 8 7.9 In addition the localizations of the immunoreactivities for SOD1 and Prx2/GPx1 Prx2 GPx1 were similar in the inclusions the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187183 14648077 250307 17264 9353 PRDX2 PRX2 Prx2 10 3.9 addition the localizations of the immunoreactivities for SOD1 and Prx2/GPx1 Prx2 GPx1 were similar in the inclusions the co-aggregation of Prx2/GPx1 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187184 14648077 250307 8759 4553 GPX1 GPX1 GPx1 10 2.2 the localizations of the immunoreactivities for SOD1 and Prx2/GPx1 Prx2 GPx1 were similar in the inclusions the co-aggregation of Prx2/GPx1 Prx2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187185 14648077 250307 17264 9353 PRDX2 PRX2 Prx2 19 3.9 GPx1 were similar in the inclusions the co-aggregation of Prx2/GPx1 Prx2 GPx1 with SOD1 in neuronal LBHIs in mutant SOD1-related FALS 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187186 14648077 250307 8759 4553 GPX1 GPX1 GPx1 19 2.2 were similar in the inclusions the co-aggregation of Prx2/GPx1 Prx2 GPx1 with SOD1 in neuronal LBHIs in mutant SOD1-related FALS patients 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187187 14648077 250307 20996 11179 SOD1 SOD1 SOD1 21 7.9 in the inclusions the co-aggregation of Prx2/GPx1 Prx2 GPx1 with SOD1 in neuronal LBHIs in mutant SOD1-related FALS patients and transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187188 14648077 250307 20996 11179 SOD1 SOD1 SOD1-related 27 1.7 Prx2/GPx1 Prx2 GPx1 with SOD1 in neuronal LBHIs in mutant SOD1-related FALS patients and transgenic rats was evident 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187189 14648077 250308 17264 9353 PRDX2 PRX2 Prx2 5 3.9 Based on the fact that Prx2/GPx1 Prx2 GPx1 directly regulates the redox system such co-aggregation of Prx2/GPx1 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187190 14648077 250308 8759 4553 GPX1 GPX1 GPx1 5 2.2 Based on the fact that Prx2/GPx1 Prx2 GPx1 directly regulates the redox system such co-aggregation of Prx2/GPx1 Prx2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187191 14648077 250308 17264 9353 PRDX2 PRX2 Prx2 14 3.9 GPx1 directly regulates the redox system such co-aggregation of Prx2/GPx1 Prx2 GPx1 with SOD1 in neuronal LBHIs may lead to the 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187192 14648077 250308 8759 4553 GPX1 GPX1 GPx1 14 2.2 directly regulates the redox system such co-aggregation of Prx2/GPx1 Prx2 GPx1 with SOD1 in neuronal LBHIs may lead to the breakdown 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187193 14648077 250308 20996 11179 SOD1 SOD1 SOD1 16 7.9 the redox system such co-aggregation of Prx2/GPx1 Prx2 GPx1 with SOD1 in neuronal LBHIs may lead to the breakdown of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187194 14648077 250308 20996 11179 SOD1 SOD1 SOD1-mediated 34 1.7 breakdown of the redox system itself thereby amplifying the mutant SOD1-mediated toxicity in mutant SOD1-linked FALS patients and transgenic rats expressing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187195 14648077 250308 20996 11179 SOD1 SOD1 SOD1-linked 38 1.7 system itself thereby amplifying the mutant SOD1-mediated toxicity in mutant SOD1-linked FALS patients and transgenic rats expressing human mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187196 14648077 250308 20996 11179 SOD1 SOD1 SOD1 47 7.9 mutant SOD1-linked FALS patients and transgenic rats expressing human mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187199 14648077 250313 20996 11179 SOD1 SOD SOD 11 1.7 first antioxidant enzyme group three isoforms of superoxide dismutase (SOD) SOD EC 1.15.1.1 have been identified SOD1 SOD2 and SOD3 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187200 14648077 250313 20996 11179 SOD1 SOD1 SOD1 17 7.9 of superoxide dismutase (SOD) SOD EC 1.15.1.1 have been identified SOD1 SOD2 and SOD3 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187201 14648077 250313 20997 11180 SOD2 SOD2 SOD2 18 0.9 superoxide dismutase (SOD) SOD EC 1.15.1.1 have been identified SOD1 SOD2 and SOD3 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187202 14648077 250313 20998 11181 SOD3 SOD3 SOD3 18 0.9 superoxide dismutase (SOD) SOD EC 1.15.1.1 have been identified SOD1 SOD2 and SOD3 9 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187203 14648077 250313 20998 11181 SOD3 SOD3 SOD3 20 0.9 (SOD) SOD EC 1.15.1.1 have been identified SOD1 SOD2 and SOD3 9 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187204 14648077 250314 17269 16753 PRDX6 PRX Prx 7 0.3 In the second enzyme group the peroxiredoxin (Prx) Prx and glutathione peroxidase (GPx) GPx families as well as catalase 2 JUMiner_v2.2 1 0 0 2 16753 TotalCon:2<>13797|PRX|57716|Complete__16753|PRDX6|9588|Complete__<>AvaiableGeneRif=2<>BEST:16753|PRDX6|0.000780469888783041<>ScoreDetail__16753|PRDX6|0.000780469888783041__13797|PRX|0.00061525129982669__ 0 0 0 0 0 187205 14648077 250315 20996 11179 SOD1 SOD SOD 1 1.7 Unlike SOD and catalase enzymes of the Prx and GPx families require 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187206 14648077 250315 17269 16753 PRDX6 PRX Prx 7 0.3 Unlike SOD and catalase enzymes of the Prx and GPx families require secondary enzymes and cofactors to function 2 JUMiner_v2.2 1 0 0 2 16753 TotalCon:2<>13797|PRX|57716|Complete__16753|PRDX6|9588|Complete__<>AvaiableGeneRif=2<>BEST:16753|PRDX6|0.000780469888783041<>ScoreDetail__16753|PRDX6|0.000780469888783041__13797|PRX|0.00061525129982669__ 0 0 0 0 0 187207 14648077 250319 17264 9353 PRDX2 PRX2 Prx2 1 3.9 Peroxiredoxin2 (Prx2) Prx2 is a novel organ-specific antioxidative enzyme that is mainly expressed 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187208 14648077 250320 17269 16753 PRDX6 PRX Prx 6 0.3 This protein is a member of Prx family whose members possess reactive cysteine residues 23 2 JUMiner_v2.2 1 0 0 2 16753 TotalCon:2<>13797|PRX|57716|Complete__16753|PRDX6|9588|Complete__<>AvaiableGeneRif=2<>BEST:16753|PRDX6|0.000780469888783041<>ScoreDetail__16753|PRDX6|0.000780469888783041__13797|PRX|0.00061525129982669__ 0 0 0 0 0 187209 14648077 250321 17264 9353 PRDX2 PRX2 Prx2 0 3.9 Prx2 requires thioredoxin reductase (TR) TR as a secondary enzyme as 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187210 14648077 250321 17264 9353 PRDX2 PRX2 Prx2 25 3.9 as cofactors to function at high efficiency the activity of Prx2 in the thioredoxin/TR/NADPH thioredoxin TR NADPH system is over five 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187211 14648077 250321 17264 9353 PRDX2 PRX2 Prx2 38 3.9 NADPH system is over five times higher than that of Prx2 by itself 5 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187212 14648077 250322 17264 9353 PRDX2 PRX2 Prx2 3 3.9 In this milieu Prx2 is also called thioredoxin peroxidase 1 (thioredoxin-dependent thioredoxin-dependent peroxide reductase 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187213 14648077 250323 17264 9353 PRDX2 PRX2 Prx2 13 3.9 to controlling the intracellular content of H 2 O 2 Prx2 directly regulates the redox signals of the thioredoxin/TR/NADPH thioredoxin TR 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187214 14648077 250324 8759 4553 GPX1 GPX1 GPx1 11 2.2 EC 1.11.1.9 a classical selenium-dependent isoform (also also assigned as GPx1 was first described as an enzyme that protects hemoglobin from 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187215 14648077 250324 9038 4827 HBB hemoglobin hemoglobin 20 1.0 as GPx1 was first described as an enzyme that protects hemoglobin from oxidative degradation in red blood cells 25 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187216 14648077 250326 8759 4553 GPX1 GPX1 GPx1 2 2.2 Among them GPx1 is considered as the major enzyme responsible for removing intracytoplasmic 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187217 14648077 250327 17264 9353 PRDX2 PRX2 Prx2 1 3.9 Like Prx2 GPx1 needs glutathione reductase (GR) GR as a secondary enzyme 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187218 14648077 250327 8759 4553 GPX1 GPX1 GPx1 2 2.2 Like Prx2 GPx1 needs glutathione reductase (GR) GR as a secondary enzyme as 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187219 14648077 250328 17264 9353 PRDX2 PRX2 Prx2 1 3.9 Therefore Prx2 and GPx1 directly control the redox system 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187220 14648077 250328 8759 4553 GPX1 GPX1 GPx1 3 2.2 Therefore Prx2 and GPx1 directly control the redox system 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187221 14648077 250329 20996 11179 SOD1 SOD1 SOD1 16 7.9 amyotrophic lateral sclerosis (FALS) FALS are caused by a mutant SOD1 15 17 18 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187222 14648077 250330 20996 11179 SOD1 SOD1 SOD1 0 7.9 SOD1 is thought to be an essential component of neuronal Lewy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187223 14648077 250330 20996 11179 SOD1 SOD1 SOD1-mutated 26 1.7 LBHIs in affected anterior horn cells are morphological hallmarks of SOD1-mutated motor neurons of FALS patients 3 11 12 13 14 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187224 14648077 250331 20996 11179 SOD1 SOD1 SOD1-mutated 6 1.7 To cope with destructive ROSs even SOD1-mutated motor neurons induce mutant and wild-type SOD1 as well as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187225 14648077 250331 20996 11179 SOD1 SOD1 SOD1 13 7.9 destructive ROSs even SOD1-mutated motor neurons induce mutant and wild-type SOD1 as well as Prx2 and GPx1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187226 14648077 250331 17264 9353 PRDX2 PRX2 Prx2 17 3.9 motor neurons induce mutant and wild-type SOD1 as well as Prx2 and GPx1 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187227 14648077 250331 8759 4553 GPX1 GPX1 GPx1 19 2.2 induce mutant and wild-type SOD1 as well as Prx2 and GPx1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187229 14648077 250332 17264 9353 PRDX2 PRX2 Prx2 2 3.9 Considering that Prx2 and GPx1 interact not only with wild-type SOD1 but also 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187230 14648077 250332 8759 4553 GPX1 GPX1 GPx1 4 2.2 Considering that Prx2 and GPx1 interact not only with wild-type SOD1 but also with mutant 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187231 14648077 250332 20996 11179 SOD1 SOD1 SOD1 10 7.9 Considering that Prx2 and GPx1 interact not only with wild-type SOD1 but also with mutant SOD1 the interaction of Prx2/GPx1 Prx2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187232 14648077 250332 20996 11179 SOD1 SOD1 SOD1 15 7.9 interact not only with wild-type SOD1 but also with mutant SOD1 the interaction of Prx2/GPx1 Prx2 GPx1 with SOD1 has been 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187233 14648077 250332 17264 9353 PRDX2 PRX2 Prx2 19 3.9 SOD1 but also with mutant SOD1 the interaction of Prx2/GPx1 Prx2 GPx1 with SOD1 has been suggested to contribute to mutant 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187234 14648077 250332 8759 4553 GPX1 GPX1 GPx1 19 2.2 but also with mutant SOD1 the interaction of Prx2/GPx1 Prx2 GPx1 with SOD1 has been suggested to contribute to mutant SOD1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187235 14648077 250332 20996 11179 SOD1 SOD1 SOD1 21 7.9 with mutant SOD1 the interaction of Prx2/GPx1 Prx2 GPx1 with SOD1 has been suggested to contribute to mutant SOD1 aggregation toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187236 14648077 250332 20996 11179 SOD1 SOD1 SOD1 29 7.9 GPx1 with SOD1 has been suggested to contribute to mutant SOD1 aggregation toxicity Prx2/GPx1 Prx2 GPx1 possibly aggregate as LBHIs in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187237 14648077 250332 17264 9353 PRDX2 PRX2 Prx2 32 3.9 been suggested to contribute to mutant SOD1 aggregation toxicity Prx2/GPx1 Prx2 GPx1 possibly aggregate as LBHIs in SOD1-mutated motor neurons 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187238 14648077 250332 8759 4553 GPX1 GPX1 GPx1 32 2.2 suggested to contribute to mutant SOD1 aggregation toxicity Prx2/GPx1 Prx2 GPx1 possibly aggregate as LBHIs in SOD1-mutated motor neurons 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187239 14648077 250332 20996 11179 SOD1 SOD1 SOD1-mutated 38 1.7 aggregation toxicity Prx2/GPx1 Prx2 GPx1 possibly aggregate as LBHIs in SOD1-mutated motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187240 14648077 250333 17264 9353 PRDX2 PRX2 Prx2 4 3.9 Furthermore the aggregation of Prx2/GPx1 Prx2 GPx1 might affect the intracytoplasmic redox regulation and amplify mutant 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187241 14648077 250333 8759 4553 GPX1 GPX1 GPx1 4 2.2 Furthermore the aggregation of Prx2/GPx1 Prx2 GPx1 might affect the intracytoplasmic redox regulation and amplify mutant SOD1-mediated 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187242 14648077 250333 20996 11179 SOD1 SOD1 SOD1-mediated 14 1.7 GPx1 might affect the intracytoplasmic redox regulation and amplify mutant SOD1-mediated toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187243 14648077 250334 17264 9353 PRDX2 PRX2 Prx2 9 3.9 To clarify the biological significance of the interaction of Prx2/GPx1 Prx2 GPx1 (redox redox system with SOD1 in SOD1-mutated motor neurons 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187244 14648077 250334 8759 4553 GPX1 GPX1 GPx1 9 2.2 clarify the biological significance of the interaction of Prx2/GPx1 Prx2 GPx1 (redox redox system with SOD1 in SOD1-mutated motor neurons in 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187245 14648077 250334 20996 11179 SOD1 SOD1 SOD1 13 7.9 the interaction of Prx2/GPx1 Prx2 GPx1 (redox redox system with SOD1 in SOD1-mutated motor neurons in vivo we first produced an 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187246 14648077 250334 20996 11179 SOD1 SOD1 SOD1-mutated 15 1.7 of Prx2/GPx1 Prx2 GPx1 (redox redox system with SOD1 in SOD1-mutated motor neurons in vivo we first produced an antibody against 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187247 14648077 250334 17264 9353 PRDX2 PRX2 Prx2 26 3.9 motor neurons in vivo we first produced an antibody against Prx2 and analyzed the characteristic expressions of both Prx2 and GPx1 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187248 14648077 250334 17264 9353 PRDX2 PRX2 Prx2 34 3.9 antibody against Prx2 and analyzed the characteristic expressions of both Prx2 and GPx1 in neuronal LBHIs in SOD1-mutated motor neurons of 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187249 14648077 250334 8759 4553 GPX1 GPX1 GPx1 36 2.2 Prx2 and analyzed the characteristic expressions of both Prx2 and GPx1 in neuronal LBHIs in SOD1-mutated motor neurons of humans and 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187250 14648077 250334 20996 11179 SOD1 SOD1 SOD1-mutated 41 1.7 expressions of both Prx2 and GPx1 in neuronal LBHIs in SOD1-mutated motor neurons of humans and animal models 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187251 14648077 250336 17264 9353 PRDX2 PRX2 Prx2 5 3.9 Preparation of polyclonal antibody against Prx2 A synthetic peptide corresponding to the C-terminal region of Prx2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187252 14648077 250336 17264 9353 PRDX2 PRX2 Prx2 15 3.9 Prx2 A synthetic peptide corresponding to the C-terminal region of Prx2 (amino amino acids 184_amp_#x2013 198 NH 2 -KPNVDDSKEYFSKHN-COOH with or 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187253 14648077 250337 17264 9353 PRDX2 PRX2 Prx2 18 3.9 of the C-terminal region of the human rat or mouse Prx2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187254 14648077 250339 17264 9353 PRDX2 PRX2 Prx2 6 3.9 To prepare immunogen 6 mg synthesized Prx2 peptide was conjugated with 6 mg keyhole limpet hemocyanin (KLH) 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187255 14648077 250344 17264 9353 PRDX2 PRX2 Prx2 17 3.9 an affinity column of immobilized KLH conjugated with the synthetic Prx2 peptide as described previously 16 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187256 14648077 250352 17264 9353 PRDX2 PRX2 Prx2 6 3.9 Fig 1 Specificity of antibody against Prx2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187257 14648077 250353 17264 9353 PRDX2 PRX2 Prx2 7 3.9 The immunoreactivity of the antibody to HSA-conjugated Prx2 peptide ( solid circles and native HSA ( open circles 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187258 14648077 250354 17264 9353 PRDX2 PRX2 Prx2 6 3.9 The anti-Prx2 antibody recognizes the HSA-conjugated Prx2 peptide but does not react with HAS ( Prx2 peroxiredoxin2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187259 14648077 250354 17264 9353 PRDX2 PRX2 Prx2 15 3.9 HSA-conjugated Prx2 peptide but does not react with HAS ( Prx2 peroxiredoxin2 ELISA enzyme-linked immunosorbent assay HAS human serum albumin 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187262 14648077 250358 20996 11179 SOD1 SOD1 SOD1 0 7.9 SOD1 analysis revealed that the members of the Japanese Oki family 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187263 14648077 250360 20996 11179 SOD1 SOD SOD 13 1.7 of five FALS cases ( FALS familial amyotrophic lateral sclerosis SOD superoxide dismutase LBHI Lewy body-like hyaline inclusion 2-bp two-base pair 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187265 14648077 250361 20996 11179 SOD1 SOD1 SOD1 18 7.9 transgenic line (H46R-4) H46R-4 in which the level of human SOD1 with the H46R mutation was 6 times the level of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187266 14648077 250361 20996 11179 SOD1 SOD1 SOD1 33 7.9 was 6 times the level of that of endogenous rat SOD1 27 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187267 14648077 250362 20996 11179 SOD1 SOD1 SOD1 14 7.9 transgenic line (G93A-39) G93A-39 in which the level of human SOD1 with the G93A mutation was 2.5 times the level of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187268 14648077 250362 20996 11179 SOD1 SOD1 SOD1 27 7.9 G93A mutation was 2.5 times the level of endogenous rat SOD1 27 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187269 14648077 250372 17264 9353 PRDX2 PRX2 Prx2 11 3.9 following primary antibodies were utilized an affinity-purified rabbit antibody against Prx2 (concentration: concentration 1 _amp_micro;g/ml), _amp_micro g ml a polyclonal antibody 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187270 14648077 250372 8759 4553 GPX1 GPX1 GPx1 19 2.2 concentration 1 _amp_micro;g/ml), _amp_micro g ml a polyclonal antibody to GPx1 diluted 1 2 000 in 1% bovine serum albumin-containing phosphate-buffered 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187271 14648077 250372 20996 11179 SOD1 SOD1 SOD1 41 7.9 BSA-PBS pH 7.4 2 and a polyclonal antibody to human SOD1 (diluted diluted 1 10 000 in 1% BSA-PBS pH 7.4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187272 14648077 250378 17264 9353 PRDX2 PRX2 Prx2 23 3.9 had been preabsorbed with an excess amount of the synthetic Prx2 peptide 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187273 14648077 250380 17264 9353 PRDX2 PRX2 Prx2 9 3.9 Results We successfully produced an affinity-purified rabbit antibody against Prx2 peptide (amino amino acids 184_amp_#x2013 198 although this amino acid 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187274 14648077 250380 17264 9353 PRDX2 PRX2 Prx2 37 3.9 of the human rat mouse Chinese hamster or Bos Taurus Prx2 this peptide does not share homology with other members of 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187275 14648077 250380 17269 16753 PRDX6 PRX Prx 49 0.3 peptide does not share homology with other members of the Prx family or any other peptide sequence in GenomeNet and applied 2 JUMiner_v2.2 1 0 0 2 16753 TotalCon:2<>13797|PRX|57716|Complete__16753|PRDX6|9588|Complete__<>AvaiableGeneRif=2<>BEST:16753|PRDX6|0.000780469888783041<>ScoreDetail__16753|PRDX6|0.000780469888783041__13797|PRX|0.00061525129982669__ 0 0 0 0 0 187276 14648077 250381 17264 9353 PRDX2 PRX2 Prx2 6 3.9 This anti-Prx2 antibody recognized the HSA-conjugated Prx2 peptide but did not react with HSA (Fig Fig 1 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187279 14648077 250387 20996 11179 SOD1 SOD1 SOD1-linked 2 1.7 In mutant SOD1-linked FALS patients the neuronal LBHIs were generally composed of eosinophilic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187280 14648077 250392 17264 9353 PRDX2 PRX2 Prx2 0 3.9 Prx2 immunoreactivity in normal spinal cords was identified in almost all 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187281 14648077 250393 17264 9353 PRDX2 PRX2 Prx2-immunostaining 2 3.3 In addition Prx2-immunostaining was found throughout the neuropil with considerably lower intensity (Fig 1 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187282 14648077 250394 17264 9353 PRDX2 PRX2 Prx2 7 3.9 With respect to the intracellular localization of Prx2 immunostaining of the neuronal cytoplasm and proximal dendrites was specifically 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187283 14648077 250396 17264 9353 PRDX2 PRX2 Prx2 16 3.9 that had been pretreated with an excess of the synthetic Prx2 produced no staining (Fig Fig 3 D 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187284 14648077 250399 8759 4553 GPX1 GPX1 GPx1 5 2.2 B C Immunostaining for GPx1 ( B and Prx2 ( C 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187285 14648077 250399 17264 9353 PRDX2 PRX2 Prx2 10 3.9 B C Immunostaining for GPx1 ( B and Prx2 ( C 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187286 14648077 250400 8759 4553 GPX1 GPX1 GPx1 0 2.2 GPx1 and Prx2 immunoreactivities are found diffusely in the neuropil with 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187287 14648077 250400 17264 9353 PRDX2 PRX2 Prx2 2 3.9 GPx1 and Prx2 immunoreactivities are found diffusely in the neuropil with considerably less 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187288 14648077 250401 8759 4553 GPX1 GPX1 GPx1 7 2.2 No counterstaining ( HE hematoxylin and eosin GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187289 14648077 250401 17264 9353 PRDX2 PRX2 Prx2 10 3.9 No counterstaining ( HE hematoxylin and eosin GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187290 14648077 250403 17264 9353 PRDX2 PRX2 Prx2 4 3.9 Fig 3 Detection of Prx2 and GPx1 in the normal motor neurons of the human 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187291 14648077 250403 8759 4553 GPX1 GPX1 GPx1 6 2.2 Fig 3 Detection of Prx2 and GPx1 in the normal motor neurons of the human spinal cord 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187292 14648077 250406 8759 4553 GPX1 GPX1 GPx1 6 2.2 B Immunostaining with the antibody against GPx1 showing GPx1-positive neurons 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187293 14648077 250406 8759 4553 GPX1 GPX1 GPx1-positive 8 1.9 B Immunostaining with the antibody against GPx1 showing GPx1-positive neurons 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187294 14648077 250407 17264 9353 PRDX2 PRX2 Prx2 6 3.9 C Immunostaining with the antibody to Prx2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187295 14648077 250409 8759 4553 GPX1 GPX1 GPx1 13 2.2 the normal motor neurons in the spinal cord co-express both GPx1 ( B and Prx2 ( C although their staining intensities 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187296 14648077 250409 17264 9353 PRDX2 PRX2 Prx2 18 3.9 in the spinal cord co-express both GPx1 ( B and Prx2 ( C although their staining intensities in neurons vary 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187297 14648077 250410 17264 9353 PRDX2 PRX2 Prx2 12 3.9 with anti-Prx2 antibody pretreated with an excess of the synthetic Prx2 peptide 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187298 14648077 250412 8759 4553 GPX1 GPX1 GPx1 1 2.2 E GPx1 immunostaining of the neuronal cytoplasm and proximal dendrites is observed 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187299 14648077 250413 17264 9353 PRDX2 PRX2 Prx2 1 3.9 F Prx2 immunostaining of the neuronal cytoplasm and proximal dendrites is observed 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187300 14648077 250414 8759 4553 GPX1 GPX1 GPx1 10 2.2 B _amp_#x2013 F No counterstaining ( HE hematoxylin and eosin GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187301 14648077 250414 17264 9353 PRDX2 PRX2 Prx2 13 3.9 No counterstaining ( HE hematoxylin and eosin GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187302 14648077 250415 17264 9353 PRDX2 PRX2 Prx2 21 3.9 _amp_micro m A neuropil staining pattern similar to that for Prx2 was observed with GPx1 weak GPx1 immunoreactivity was diffusely seen 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187303 14648077 250415 8759 4553 GPX1 GPX1 GPx1 25 2.2 staining pattern similar to that for Prx2 was observed with GPx1 weak GPx1 immunoreactivity was diffusely seen in the neuropil in 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187304 14648077 250415 8759 4553 GPX1 GPX1 GPx1 27 2.2 similar to that for Prx2 was observed with GPx1 weak GPx1 immunoreactivity was diffusely seen in the neuropil in transverse sections 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187305 14648077 250416 8759 4553 GPX1 GPX1 GPx1 0 2.2 GPx1 immunostaining was observed in the cytoplasm with cell bodies and 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187306 14648077 250417 17264 9353 PRDX2 PRX2 Prx2 5 3.9 The stainability and intensity of Prx2 and GPx1 in the normal anterior horn cells of the 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187307 14648077 250417 8759 4553 GPX1 GPX1 GPx1 7 2.2 The stainability and intensity of Prx2 and GPx1 in the normal anterior horn cells of the spinal cords 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187308 14648077 250418 17264 9353 PRDX2 PRX2 Prx2 14 3.9 the normal motor neurons in the spinal cords co-expressed both Prx2 and GPx1 (Fig Fig 3 A_amp_#x2013 C although the staining 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187309 14648077 250418 8759 4553 GPX1 GPX1 GPx1 16 2.2 motor neurons in the spinal cords co-expressed both Prx2 and GPx1 (Fig Fig 3 A_amp_#x2013 C although the staining intensities of 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187310 14648077 250419 20996 11179 SOD1 SOD1 SOD1 48 7.9 C family and the transgenic rats expressing two different human SOD1 mutations (H46R H46R and G93A were intensely immunostained by the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187311 14648077 250419 20996 11179 SOD1 SOD1 SOD1 61 7.9 and G93A were intensely immunostained by the antibody against human SOD1 (Figs Figs 4 A D 5 A D 6 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187312 14648077 250420 17264 9353 PRDX2 PRX2 Prx2 7 3.9 Most neuronal LBHIs were also immunoreactive for Prx2 although the intensity of Prx2 immunoreactivity in the LBHIs varied 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187313 14648077 250420 17264 9353 PRDX2 PRX2 Prx2 12 3.9 LBHIs were also immunoreactive for Prx2 although the intensity of Prx2 immunoreactivity in the LBHIs varied (Figs Figs 4 C F 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187314 14648077 250421 17264 9353 PRDX2 PRX2 Prx2 20 3.9 rats (H46R H46R and G93A showed a similar immunoreactivity for Prx2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187315 14648077 250422 17264 9353 PRDX2 PRX2 Prx2 1 3.9 The Prx2 immunolocalization in many intracytoplasmic and intraneuritic LBHIs was similar to 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187316 14648077 250422 20996 11179 SOD1 SOD1 SOD1 14 7.9 many intracytoplasmic and intraneuritic LBHIs was similar to that of SOD1 in both diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187317 14648077 250423 17264 9353 PRDX2 PRX2 Prx2 13 3.9 halo-type LBHIs the reaction product deposits of the antibody against Prx2 were generally restricted to the periphery (Fig Fig 4 C 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187318 14648077 250424 17264 9353 PRDX2 PRX2 Prx2 3 3.9 In ill-defined LBHIs Prx2 immunostaining was distributed throughout each inclusion 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187319 14648077 250425 17264 9353 PRDX2 PRX2 Prx2 6 3.9 In some inclusions however expression of Prx2 was observed in only part of the inclusion (Fig Fig 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187320 14648077 250426 8759 4553 GPX1 GPX1 GPx1 4 2.2 With respect to the GPx1 immunostaining in the neuronal LBHIs similar stainability and immunolocalization to 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187321 14648077 250426 17264 9353 PRDX2 PRX2 Prx2 15 3.9 immunostaining in the neuronal LBHIs similar stainability and immunolocalization to Prx2 were confirmed in the core and halo types as well 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187322 14648077 250427 8759 4553 GPX1 GPX1 GPx1 3 2.2 The immunoreactivity for GPx1 in the FALS patients was similar to that in the 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187323 14648077 250428 17264 9353 PRDX2 PRX2 Prx2 1 3.9 Like Prx2 the immunolocalization of GPx1 was similar to that of SOD1 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187324 14648077 250428 8759 4553 GPX1 GPX1 GPx1 5 2.2 Like Prx2 the immunolocalization of GPx1 was similar to that of SOD1 in both diseases 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187325 14648077 250428 20996 11179 SOD1 SOD1 SOD1 11 7.9 Prx2 the immunolocalization of GPx1 was similar to that of SOD1 in both diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187326 14648077 250429 8759 4553 GPX1 GPX1 GPx1-immunoreactive 0 1.9 GPx1-immunoreactive products in many core and halo-type inclusions were mainly localized 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187327 14648077 250431 20996 11179 SOD1 SOD1 SOD1 30 7.9 an FALS patient with a two-base pair deletion in the SOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187328 14648077 250432 20996 11179 SOD1 SOD1 SOD1 3 7.9 A Immunostaining for SOD1 immunoreactivity is mostly restricted to the halo 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187329 14648077 250433 8759 4553 GPX1 GPX1 GPx1 3 2.2 B Immunostaining for GPx1 immunoreactivity is located in the SOD1-positive portion of the LBHI 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187330 14648077 250433 20996 11179 SOD1 SOD1 SOD1-positive 9 1.7 B Immunostaining for GPx1 immunoreactivity is located in the SOD1-positive portion of the LBHI 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187331 14648077 250434 17264 9353 PRDX2 PRX2 Prx2 3 3.9 C Immunoreactivity for Prx2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187332 14648077 250435 20996 11179 SOD1 SOD1 SOD1 5 7.9 Co-localization of the three proteins SOD1 GPx1 and Prx2 in the LBHI is evident 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187333 14648077 250435 8759 4553 GPX1 GPX1 GPx1 6 2.2 Co-localization of the three proteins SOD1 GPx1 and Prx2 in the LBHI is evident 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187334 14648077 250435 17264 9353 PRDX2 PRX2 Prx2 8 3.9 Co-localization of the three proteins SOD1 GPx1 and Prx2 in the LBHI is evident 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187335 14648077 250436 20996 11179 SOD1 SOD1 SOD1 15 7.9 core and halo-type LBHI in a transgenic rat expressing human SOD1 with an H46R mutation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187336 14648077 250437 20996 11179 SOD1 SOD1 SOD1 2 7.9 Immunostaining for SOD1 ( D GPx1 ( E and Prx2 ( F 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187337 14648077 250437 8759 4553 GPX1 GPX1 GPx1 6 2.2 Immunostaining for SOD1 ( D GPx1 ( E and Prx2 ( F 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187338 14648077 250437 17264 9353 PRDX2 PRX2 Prx2 11 3.9 Immunostaining for SOD1 ( D GPx1 ( E and Prx2 ( F 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187339 14648077 250438 20996 11179 SOD1 SOD1 SOD1 5 7.9 Similar stainability and immunolocalization of SOD1 GPx1 and Prx2 in the LBHI are observed ( LBHI 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187340 14648077 250438 8759 4553 GPX1 GPX1 GPx1 6 2.2 Similar stainability and immunolocalization of SOD1 GPx1 and Prx2 in the LBHI are observed ( LBHI Lewy 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187341 14648077 250438 17264 9353 PRDX2 PRX2 Prx2 8 3.9 Similar stainability and immunolocalization of SOD1 GPx1 and Prx2 in the LBHI are observed ( LBHI Lewy body-like hyaline 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187342 14648077 250438 20996 11179 SOD1 SOD1 SOD1 25 7.9 LBHI Lewy body-like hyaline inclusion FALS familial amyotrophic lateral sclerosis SOD1 superoxide dismutase 1 GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187343 14648077 250438 8759 4553 GPX1 GPX1 GPx1 29 2.2 inclusion FALS familial amyotrophic lateral sclerosis SOD1 superoxide dismutase 1 GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187344 14648077 250438 17264 9353 PRDX2 PRX2 Prx2 32 3.9 amyotrophic lateral sclerosis SOD1 superoxide dismutase 1 GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187345 14648077 250441 20996 11179 SOD1 SOD1 SOD1 16 7.9 LBHI in an FALS patient with an A4V mutation in SOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187346 14648077 250442 20996 11179 SOD1 SOD1 SOD1 2 7.9 Immunostaining for SOD1 ( A GPx1 ( B and Prx2 ( C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187347 14648077 250442 8759 4553 GPX1 GPX1 GPx1 6 2.2 Immunostaining for SOD1 ( A GPx1 ( B and Prx2 ( C 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187348 14648077 250442 17264 9353 PRDX2 PRX2 Prx2 11 3.9 Immunostaining for SOD1 ( A GPx1 ( B and Prx2 ( C 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187349 14648077 250444 20996 11179 SOD1 SOD1 SOD1 17 7.9 an FALS patient with a two-base pair deletion in the SOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187350 14648077 250445 20996 11179 SOD1 SOD1 SOD1 2 7.9 Immunostaining for SOD1 ( D GPx1 ( E and Prx2 ( F 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187351 14648077 250445 8759 4553 GPX1 GPX1 GPx1 6 2.2 Immunostaining for SOD1 ( D GPx1 ( E and Prx2 ( F 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187352 14648077 250445 17264 9353 PRDX2 PRX2 Prx2 11 3.9 Immunostaining for SOD1 ( D GPx1 ( E and Prx2 ( F 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187353 14648077 250446 8759 4553 GPX1 GPX1 GPx1 1 2.2 Immunostaining GPx1 ( E and Prx2 ( F are observed in only 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187354 14648077 250446 17264 9353 PRDX2 PRX2 Prx2 6 3.9 Immunostaining GPx1 ( E and Prx2 ( F are observed in only part of the SOD1-positive 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187355 14648077 250446 20996 11179 SOD1 SOD1 SOD1-positive 17 1.7 Prx2 ( F are observed in only part of the SOD1-positive LBHI 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187356 14648077 250447 20996 11179 SOD1 SOD1 SOD1 26 7.9 LBHI Lewy body-like hyaline inclusion FALS familial amyotrophic lateral sclerosis SOD1 superoxide dismutase 1 GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187357 14648077 250447 8759 4553 GPX1 GPX1 GPx1 30 2.2 inclusion FALS familial amyotrophic lateral sclerosis SOD1 superoxide dismutase 1 GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187358 14648077 250447 17264 9353 PRDX2 PRX2 Prx2 33 3.9 amyotrophic lateral sclerosis SOD1 superoxide dismutase 1 GPx1 glutathione peroxidase1 Prx2 peroxiredoxin2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187359 14648077 250449 20996 11179 SOD1 SOD1 SOD1 15 7.9 the spinal anterior horn in a transgenic rat expressing human SOD1 with an H46R mutation immunostained with antibodies against SOD1 ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187360 14648077 250449 20996 11179 SOD1 SOD1 SOD1 24 7.9 human SOD1 with an H46R mutation immunostained with antibodies against SOD1 ( A and Prx2 ( B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187361 14648077 250449 17264 9353 PRDX2 PRX2 Prx2 29 3.9 H46R mutation immunostained with antibodies against SOD1 ( A and Prx2 ( B 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187362 14648077 250450 20996 11179 SOD1 SOD1 SOD1 11 7.9 and sausage-like LBHIs in the neuropil are positive for both SOD1 and Prx2 ( arrows ( SOD1 superoxide dismutase1 LBHI Lewy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187363 14648077 250450 17264 9353 PRDX2 PRX2 Prx2 13 3.9 LBHIs in the neuropil are positive for both SOD1 and Prx2 ( arrows ( SOD1 superoxide dismutase1 LBHI Lewy body-like hyaline 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187364 14648077 250450 20996 11179 SOD1 SOD1 SOD1 18 7.9 are positive for both SOD1 and Prx2 ( arrows ( SOD1 superoxide dismutase1 LBHI Lewy body-like hyaline inclusion Prx2 peroxiredoxin2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187365 14648077 250450 17264 9353 PRDX2 PRX2 Prx2 26 3.9 arrows ( SOD1 superoxide dismutase1 LBHI Lewy body-like hyaline inclusion Prx2 peroxiredoxin2 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187366 14648077 250452 20996 11179 SOD1 SOD1 SOD1 15 7.9 the spinal anterior horn in a transgenic rat expressing human SOD1 with an H46R mutation immunostained with antibodies against SOD1 ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187367 14648077 250452 20996 11179 SOD1 SOD1 SOD1 24 7.9 human SOD1 with an H46R mutation immunostained with antibodies against SOD1 ( A and GPx1 ( B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187368 14648077 250452 8759 4553 GPX1 GPX1 GPx1 29 2.2 H46R mutation immunostained with antibodies against SOD1 ( A and GPx1 ( B 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187369 14648077 250453 20996 11179 SOD1 SOD1 SOD1 9 7.9 Round LBHIs in the neuropil are positive for both SOD1 and GPx1 ( arrows ( SOD1 superoxide dismutase1 LBHI Lewy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187370 14648077 250453 8759 4553 GPX1 GPX1 GPx1 11 2.2 LBHIs in the neuropil are positive for both SOD1 and GPx1 ( arrows ( SOD1 superoxide dismutase1 LBHI Lewy body-like hyaline 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187371 14648077 250453 20996 11179 SOD1 SOD1 SOD1 16 7.9 are positive for both SOD1 and GPx1 ( arrows ( SOD1 superoxide dismutase1 LBHI Lewy body-like hyaline inclusion GPx1 glutathione peroxidase1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187372 14648077 250453 8759 4553 GPX1 GPX1 GPx1 24 2.2 arrows ( SOD1 superoxide dismutase1 LBHI Lewy body-like hyaline inclusion GPx1 glutathione peroxidase1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187373 14648077 250454 20996 11179 SOD1 SOD1 SOD1 15 7.9 50 _amp_micro m Noticeably the co-localization of the three proteins SOD1 Prx2 and GPx1 in neuronal LBHIs in SOD1-mutated FALS patients 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187374 14648077 250454 17264 9353 PRDX2 PRX2 Prx2 16 3.9 _amp_micro m Noticeably the co-localization of the three proteins SOD1 Prx2 and GPx1 in neuronal LBHIs in SOD1-mutated FALS patients and 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187375 14648077 250454 8759 4553 GPX1 GPX1 GPx1 18 2.2 Noticeably the co-localization of the three proteins SOD1 Prx2 and GPx1 in neuronal LBHIs in SOD1-mutated FALS patients and transgenic rats 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187376 14648077 250454 20996 11179 SOD1 SOD1 SOD1-mutated 23 1.7 three proteins SOD1 Prx2 and GPx1 in neuronal LBHIs in SOD1-mutated FALS patients and transgenic rats (H46R H46R and G93A was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187377 14648077 250456 17264 9353 PRDX2 PRX2 Prx2 12 3.9 LBHIs the precise intra-inclusional immunolocalizations of the three proteins differed Prx2 (Fig Fig 5 D F and GPx1 (Fig Fig 5 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187378 14648077 250456 8759 4553 GPX1 GPX1 GPx1 18 2.2 three proteins differed Prx2 (Fig Fig 5 D F and GPx1 (Fig Fig 5 D E immunostaining was observed in only 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187379 14648077 250456 20996 11179 SOD1 SOD1 SOD1-positive 32 1.7 E immunostaining was observed in only some areas of the SOD1-positive LBHIs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187380 14648077 250457 17264 9353 PRDX2 PRX2 Prx2 5 3.9 Discussion Under normal physiological conditions Prx2 and GPx1 immunoreactivities in the spinal cord anterior horns in 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187381 14648077 250457 8759 4553 GPX1 GPX1 GPx1 7 2.2 Discussion Under normal physiological conditions Prx2 and GPx1 immunoreactivities in the spinal cord anterior horns in humans and 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187382 14648077 250458 17263 9352 PRDX1 PRX1 Prx1 1 1.3 Like Prx1 26 33 intranuclear localization in some neurons is also observed 2 JUMiner_v2.2 1 0 0 2 9142 TotalCon:2<>9352|PRDX1|5052|Complete__9142|PRRX1|5396|Complete__<>AvaiableGeneRif=2<>BEST:9142|PRRX1|0.00120135497085237<>ScoreDetail__9352|PRDX1|0.000566692733651773__9142|PRRX1|0.00120135497085237__ 0 0 0 0 0 187383 14648077 250458 17264 9353 PRDX2 PRX2 Prx2 16 3.9 33 intranuclear localization in some neurons is also observed in Prx2 immunostaining 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187384 14648077 250459 17264 9353 PRDX2 PRX2 Prx2 3 3.9 Considering that endogenous Prx2 and GPx1 within the neuronal cytoplasm are extremely effective regulators 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187385 14648077 250459 8759 4553 GPX1 GPX1 GPx1 5 2.2 Considering that endogenous Prx2 and GPx1 within the neuronal cytoplasm are extremely effective regulators of the 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187386 14648077 250459 17264 9353 PRDX2 PRX2 Prx2 32 3.9 almost all of the normal spinal motor neurons co-expressed both Prx2 and GPx1 confirms that these motor neurons maintain themselves using 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187387 14648077 250459 8759 4553 GPX1 GPX1 GPx1 34 2.2 of the normal spinal motor neurons co-expressed both Prx2 and GPx1 confirms that these motor neurons maintain themselves using the intracellular 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187388 14648077 250459 17264 9353 PRDX2 PRX2 Prx2 45 3.9 that these motor neurons maintain themselves using the intracellular Prx2/GPx1 Prx2 GPx1 system that is the redox system 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187389 14648077 250459 8759 4553 GPX1 GPX1 GPx1 45 2.2 these motor neurons maintain themselves using the intracellular Prx2/GPx1 Prx2 GPx1 system that is the redox system 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187390 14648077 250460 20996 11179 SOD1 SOD1 SOD1 13 7.9 As expected 12 13 16 27 30 SOD1 protein (probably probably the mutant form was found to aggregate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187391 14648077 250460 20996 11179 SOD1 SOD1 SOD1 35 7.9 anterior horn cells as neuronal LBHIs in FALS patients with SOD1 gene mutations and transgenic rats expressing human SOD1 with H46R 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187392 14648077 250460 20996 11179 SOD1 SOD1 SOD1 43 7.9 patients with SOD1 gene mutations and transgenic rats expressing human SOD1 with H46R and G93A mutations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187393 14648077 250461 20996 11179 SOD1 SOD1 SOD1 3 7.9 Intense co-expression of SOD1 Prx2 and GPx1 in neuronal LBHIs in both diseases was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187394 14648077 250461 17264 9353 PRDX2 PRX2 Prx2 4 3.9 Intense co-expression of SOD1 Prx2 and GPx1 in neuronal LBHIs in both diseases was evident 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187395 14648077 250461 8759 4553 GPX1 GPX1 GPx1 6 2.2 Intense co-expression of SOD1 Prx2 and GPx1 in neuronal LBHIs in both diseases was evident 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187396 14648077 250462 20996 11179 SOD1 SOD1 SOD1-mutated 3 1.7 To eliminate ROSs SOD1-mutated motor neurons in mutant SOD1-linked FALS and transgenic rats (G46R 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187397 14648077 250462 20996 11179 SOD1 SOD1 SOD1-linked 8 1.7 To eliminate ROSs SOD1-mutated motor neurons in mutant SOD1-linked FALS and transgenic rats (G46R G46R and G93A induce mutant/wild-type 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187398 14648077 250462 20996 11179 SOD1 SOD1 SOD1 18 7.9 transgenic rats (G46R G46R and G93A induce mutant/wild-type mutant wild-type SOD1 as an antioxidant system and Prx2/GPx1 Prx2 GPx1 as a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187399 14648077 250462 17264 9353 PRDX2 PRX2 Prx2 24 3.9 mutant/wild-type mutant wild-type SOD1 as an antioxidant system and Prx2/GPx1 Prx2 GPx1 as a redox system 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187400 14648077 250462 8759 4553 GPX1 GPX1 GPx1 24 2.2 mutant wild-type SOD1 as an antioxidant system and Prx2/GPx1 Prx2 GPx1 as a redox system 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187402 14648077 250463 20996 11179 SOD1 SOD1 SOD1 7 7.9 In this in vivo milieu where mutant SOD1 exists Prx2 and GPx1 would aberrantly interact with the mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187403 14648077 250463 17264 9353 PRDX2 PRX2 Prx2 9 3.9 In this in vivo milieu where mutant SOD1 exists Prx2 and GPx1 would aberrantly interact with the mutant SOD1 which 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187404 14648077 250463 8759 4553 GPX1 GPX1 GPx1 11 2.2 this in vivo milieu where mutant SOD1 exists Prx2 and GPx1 would aberrantly interact with the mutant SOD1 which is assumed 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187405 14648077 250463 20996 11179 SOD1 SOD1 SOD1 18 7.9 exists Prx2 and GPx1 would aberrantly interact with the mutant SOD1 which is assumed to aggregate easily by itself 8 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187406 14648077 250464 20996 11179 SOD1 SOD1 SOD1 7 7.9 Among the multiple theories of how mutant SOD1 contributes to motor neuron death in mutant SOD1-related FALS and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187407 14648077 250464 20996 11179 SOD1 SOD1 SOD1-related 15 1.7 how mutant SOD1 contributes to motor neuron death in mutant SOD1-related FALS and transgenic animal models expressing human mutant SOD1 the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187408 14648077 250464 20996 11179 SOD1 SOD1 SOD1 24 7.9 mutant SOD1-related FALS and transgenic animal models expressing human mutant SOD1 the aggregation of mutant SOD1 in neurons leads to part 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187409 14648077 250464 20996 11179 SOD1 SOD1 SOD1 29 7.9 animal models expressing human mutant SOD1 the aggregation of mutant SOD1 in neurons leads to part of the mutant SOD1-mediated toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187410 14648077 250464 20996 11179 SOD1 SOD1 SOD1-mediated 38 1.7 mutant SOD1 in neurons leads to part of the mutant SOD1-mediated toxicity through the formation of advanced glycation endproduct-modified SOD1 that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187411 14648077 250464 20996 11179 SOD1 SOD1 SOD1 47 7.9 mutant SOD1-mediated toxicity through the formation of advanced glycation endproduct-modified SOD1 that is insoluble and cytotoxic 16 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187412 14648077 250465 20996 11179 SOD1 SOD1 SOD1 16 7.9 with a two-base pair deletion at codon 126 of the SOD1 gene (Oki Oki family and G85R transgenic mice has revealed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187413 14648077 250465 20996 11179 SOD1 SOD1 SOD1 31 7.9 G85R transgenic mice has revealed that not only does mutant SOD1 provoke inclusion formation but that normal SOD1 also co-aggregates in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187414 14648077 250465 20996 11179 SOD1 SOD1 SOD1 38 7.9 only does mutant SOD1 provoke inclusion formation but that normal SOD1 also co-aggregates in these inclusions 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187415 14648077 250466 20996 11179 SOD1 SOD1 SOD1 11 7.9 with the facts that there are neuronal LBHIs positive for SOD1 Prx2 and GPx1 in the milieu where mutant SOD1 exists 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187416 14648077 250466 17264 9353 PRDX2 PRX2 Prx2 12 3.9 the facts that there are neuronal LBHIs positive for SOD1 Prx2 and GPx1 in the milieu where mutant SOD1 exists but 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187417 14648077 250466 8759 4553 GPX1 GPX1 GPx1 14 2.2 that there are neuronal LBHIs positive for SOD1 Prx2 and GPx1 in the milieu where mutant SOD1 exists but no LBHIs 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187418 14648077 250466 20996 11179 SOD1 SOD1 SOD1 20 7.9 for SOD1 Prx2 and GPx1 in the milieu where mutant SOD1 exists but no LBHIs (no no aggregations exist under physiological 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187419 14648077 250466 17264 9353 PRDX2 PRX2 Prx2 38 3.9 physiological conditions our study demonstrates an aberrant interaction of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 the aggregation of which results in 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187420 14648077 250466 8759 4553 GPX1 GPX1 GPx1 38 2.2 conditions our study demonstrates an aberrant interaction of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 the aggregation of which results in neuronal 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187421 14648077 250466 20996 11179 SOD1 SOD1 SOD1 41 7.9 demonstrates an aberrant interaction of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 the aggregation of which results in neuronal LBHIs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187422 14648077 250467 17264 9353 PRDX2 PRX2 Prx2 5 3.9 In addition intra-inclusional co-aggregation of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 causes the intracytoplasmic reduction of Prx2/GPx1, 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187423 14648077 250467 8759 4553 GPX1 GPX1 GPx1 5 2.2 In addition intra-inclusional co-aggregation of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 causes the intracytoplasmic reduction of Prx2/GPx1, Prx2 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187424 14648077 250467 20996 11179 SOD1 SOD1 SOD1 8 7.9 In addition intra-inclusional co-aggregation of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 causes the intracytoplasmic reduction of Prx2/GPx1, Prx2 GPx1 thereby reducing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187425 14648077 250467 17264 9353 PRDX2 PRX2 Prx2 14 3.9 GPx1 with mutant SOD1 causes the intracytoplasmic reduction of Prx2/GPx1, Prx2 GPx1 thereby reducing the availability of the redox system 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187426 14648077 250467 8759 4553 GPX1 GPX1 GPx1 14 2.2 with mutant SOD1 causes the intracytoplasmic reduction of Prx2/GPx1, Prx2 GPx1 thereby reducing the availability of the redox system 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187427 14648077 250468 20996 11179 SOD1 SOD SOD 9 1.7 A similar aberrant interaction of the copper chaperone for SOD (CCS) CCS and SOD1 (probably probably CCS-mutant SOD1 also occurs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187428 14648077 250468 3838 1613 CCS CCS CCS 10 1.2 similar aberrant interaction of the copper chaperone for SOD (CCS) CCS and SOD1 (probably probably CCS-mutant SOD1 also occurs in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187429 14648077 250468 20996 11179 SOD1 SOD1 SOD1 12 7.9 interaction of the copper chaperone for SOD (CCS) CCS and SOD1 (probably probably CCS-mutant SOD1 also occurs in the formation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187430 14648077 250468 3838 1613 CCS CCS CCS-mutant 14 1.2 copper chaperone for SOD (CCS) CCS and SOD1 (probably probably CCS-mutant SOD1 also occurs in the formation of the neuronal LBHIs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187431 14648077 250468 20996 11179 SOD1 SOD1 SOD1 15 7.9 chaperone for SOD (CCS) CCS and SOD1 (probably probably CCS-mutant SOD1 also occurs in the formation of the neuronal LBHIs in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187432 14648077 250468 20996 11179 SOD1 SOD1 SOD1-linked 27 1.7 occurs in the formation of the neuronal LBHIs in mutant SOD1-linked FALS 19 and the mutant SOD1 transgenic mouse model 32 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187433 14648077 250468 20996 11179 SOD1 SOD1 SOD1 35 7.9 neuronal LBHIs in mutant SOD1-linked FALS 19 and the mutant SOD1 transgenic mouse model 32 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187434 14648077 250469 12369 6893 MAPT tau tau 16 0.8 been observed for normal cytosolic constitutive proteins including tubulin and tau protein as well as neuron-specific constitutive proteins containing phosphorylated neurofilament 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187435 14648077 250470 20996 11179 SOD1 SOD1 SOD1 18 7.9 normal constitutive proteins with the aberrant interaction of cytotoxic mutant SOD1 with Prx2/GPx1 Prx2 GPx1 directly regulating a redox system our 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187436 14648077 250470 17264 9353 PRDX2 PRX2 Prx2 20 3.9 with the aberrant interaction of cytotoxic mutant SOD1 with Prx2/GPx1 Prx2 GPx1 directly regulating a redox system our finding leads us 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187437 14648077 250470 8759 4553 GPX1 GPX1 GPx1 20 2.2 the aberrant interaction of cytotoxic mutant SOD1 with Prx2/GPx1 Prx2 GPx1 directly regulating a redox system our finding leads us to 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187438 14648077 250470 17264 9353 PRDX2 PRX2 Prx2 37 3.9 leads us to speculate that not only co-aggregation of Prx2/GPx1 Prx2 GPx1 and SOD1 into LBHIs but also intracytoplasmic reduction of 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187439 14648077 250470 8759 4553 GPX1 GPX1 GPx1 37 2.2 us to speculate that not only co-aggregation of Prx2/GPx1 Prx2 GPx1 and SOD1 into LBHIs but also intracytoplasmic reduction of Prx2/GPx1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187440 14648077 250470 20996 11179 SOD1 SOD1 SOD1 39 7.9 speculate that not only co-aggregation of Prx2/GPx1 Prx2 GPx1 and SOD1 into LBHIs but also intracytoplasmic reduction of Prx2/GPx1 Prx2 GPx1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187441 14648077 250470 17264 9353 PRDX2 PRX2 Prx2 47 3.9 and SOD1 into LBHIs but also intracytoplasmic reduction of Prx2/GPx1 Prx2 GPx1 in both diseases may partly contribute to the breakdown 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187442 14648077 250470 8759 4553 GPX1 GPX1 GPx1 47 2.2 SOD1 into LBHIs but also intracytoplasmic reduction of Prx2/GPx1 Prx2 GPx1 in both diseases may partly contribute to the breakdown of 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187443 14648077 250470 20996 11179 SOD1 SOD1 SOD1-mutated 64 1.7 to the breakdown of the redox system itself in these SOD1-mutated neurons and this may be one of the endogenous mechanisms 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187444 14648077 250472 17264 9353 PRDX2 PRX2 Prx2 10 3.9 remains to be determined whether this aberrant interaction of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 is a direct or an indirect 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187445 14648077 250472 8759 4553 GPX1 GPX1 GPx1 10 2.2 to be determined whether this aberrant interaction of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 is a direct or an indirect effect 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187446 14648077 250472 20996 11179 SOD1 SOD1 SOD1 13 7.9 whether this aberrant interaction of Prx2/GPx1 Prx2 GPx1 with mutant SOD1 is a direct or an indirect effect based on the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187447 14648077 250472 20996 11179 SOD1 SOD1 SOD1-mutated 26 1.7 direct or an indirect effect based on the pathogenesis of SOD1-mutated FALS disease itself or whether Prx2 and GPx1 play a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187448 14648077 250472 17264 9353 PRDX2 PRX2 Prx2 32 3.9 on the pathogenesis of SOD1-mutated FALS disease itself or whether Prx2 and GPx1 play a primary or a secondary role to 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187449 14648077 250472 8759 4553 GPX1 GPX1 GPx1 34 2.2 pathogenesis of SOD1-mutated FALS disease itself or whether Prx2 and GPx1 play a primary or a secondary role to mutant SOD1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187450 14648077 250472 20996 11179 SOD1 SOD1 SOD1 44 7.9 GPx1 play a primary or a secondary role to mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187451 14648077 250473 17264 9353 PRDX2 PRX2 Prx2 13 3.9 to emphasize that the aberrant interaction and co-aggregation of Prx2/GPx1 Prx2 GPx1 and SOD1 (probably probably Prx2/GPx1 Prx2 GPx1 and mutant 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187452 14648077 250473 8759 4553 GPX1 GPX1 GPx1 13 2.2 emphasize that the aberrant interaction and co-aggregation of Prx2/GPx1 Prx2 GPx1 and SOD1 (probably probably Prx2/GPx1 Prx2 GPx1 and mutant SOD1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187453 14648077 250473 20996 11179 SOD1 SOD1 SOD1 15 7.9 the aberrant interaction and co-aggregation of Prx2/GPx1 Prx2 GPx1 and SOD1 (probably probably Prx2/GPx1 Prx2 GPx1 and mutant SOD1 in FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187454 14648077 250473 17264 9353 PRDX2 PRX2 Prx2 17 3.9 co-aggregation of Prx2/GPx1 Prx2 GPx1 and SOD1 (probably probably Prx2/GPx1 Prx2 GPx1 and mutant SOD1 in FALS patients with SOD1 gene 2 JUMiner_v2.2 1 0 0 2 9353 TotalCon:2<>21338|PRRX2|51450|Complete__9353|PRDX2|7001|Complete__<>AvaiableGeneRif=2<>BEST:9353|PRDX2|0.000576953371140517<>ScoreDetail__9353|PRDX2|0.000576953371140517__21338|PRRX2|0.000482117812061711__ 0 0 0 0 0 187455 14648077 250473 8759 4553 GPX1 GPX1 GPx1 17 2.2 of Prx2/GPx1 Prx2 GPx1 and SOD1 (probably probably Prx2/GPx1 Prx2 GPx1 and mutant SOD1 in FALS patients with SOD1 gene mutations 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187456 14648077 250473 20996 11179 SOD1 SOD1 SOD1 20 7.9 GPx1 and SOD1 (probably probably Prx2/GPx1 Prx2 GPx1 and mutant SOD1 in FALS patients with SOD1 gene mutations and transgenic rats 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187457 14648077 250473 20996 11179 SOD1 SOD1 SOD1 25 7.9 Prx2/GPx1 Prx2 GPx1 and mutant SOD1 in FALS patients with SOD1 gene mutations and transgenic rats expressing human SOD1 mutations may 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187458 14648077 250473 20996 11179 SOD1 SOD1 SOD1 33 7.9 patients with SOD1 gene mutations and transgenic rats expressing human SOD1 mutations may amplify a more marked mutant SOD1-mediated toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187459 14648077 250473 20996 11179 SOD1 SOD1 SOD1-mediated 41 1.7 expressing human SOD1 mutations may amplify a more marked mutant SOD1-mediated toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188342 14660707 251303 12369 6893 MAPT tau tau 13 0.3 2 transients was assessed by determining the recovery time constant tau (_amp_#x003c4;) _amp_#x003c4 after fitting with a single-exponential function 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188353 14660707 251356 20996 11179 SOD1 SOD1 SOD1 20 1.1 inhibition are paralleled by observations in cell lines expressing mutant SOD1 which show increased basal Ca 2 loads ( Carri et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188354 14660707 251357 20996 11179 SOD1 SOD1 SOD1 23 1.1 resemble increased Na currents and enhanced neuronal excitability in mutant SOD1 mouse spinal MNs ( Kuo et al 2002 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188359 14660707 251377 20996 11179 SOD1 SOD1 SOD1 19 1.1 by a mutated Cu/Zn Cu Zn super oxide dismutase (SOD1) SOD1 is thought to be causally involved in MN degeneration ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188361 14660707 251379 23910 12680 VEGFA VEGF VEGF 12 2.8 on the observation that impaired vascular endothelial growth factor (VEGF) VEGF synthesis due to hypoxia selectively damages MNs ( Oosthuyse et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189412 14690536 252558 20996 11179 SOD1 SOD1 SOD1 2 2.7 Expression of SOD1 G93A or wild-type SOD1 in primary cultures of astrocytes down-regulates 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189413 14690536 252558 20996 11179 SOD1 SOD1 SOD1 6 2.7 Expression of SOD1 G93A or wild-type SOD1 in primary cultures of astrocytes down-regulates the glutamate transporter GLT-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189414 14690536 252558 20017 10940 SLC1A2 GLT-1 GLT-1 16 2.5 SOD1 in primary cultures of astrocytes down-regulates the glutamate transporter GLT-1 lack of involvement of oxidative stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189416 14690536 252560 20996 11179 SOD1 SOD1 SOD1 9 2.7 possible that mutations of Cu/Zn Cu Zn superoxide dismutase (SOD1), SOD1 responsible for about 20% of familial ALS down-regulates glutamate transporters 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189418 14690536 252561 20996 11179 SOD1 SOD1 hSOD1 13 2.7 astrocytes to investigate the effect of the FALS-linked mutant hSOD1(G93A) hSOD1 G93A and wild-type SOD1 (hSOD1wt) hSOD1wt on the glutamate uptake 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189419 14690536 252561 20996 11179 SOD1 SOD1 SOD1 16 2.7 effect of the FALS-linked mutant hSOD1(G93A) hSOD1 G93A and wild-type SOD1 (hSOD1wt) hSOD1wt on the glutamate uptake system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189420 14690536 252562 20996 11179 SOD1 SOD1 hSOD1 13 2.7 and RT-PCR it was shown that expression of either hSOD1(G93A) hSOD1 G93A or hSOD1wt in astrocytes produced down-regulation of the levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189421 14690536 252562 20017 10940 SLC1A2 GLT-1 GLT-1 27 2.5 astrocytes produced down-regulation of the levels of a glutamate transporter GLT-1 without alterations in its mRNA level hSOD1(G93A) hSOD1 G93A or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189422 14690536 252562 20996 11179 SOD1 SOD1 hSOD1 34 2.7 glutamate transporter GLT-1 without alterations in its mRNA level hSOD1(G93A) hSOD1 G93A or hSOD1wt expression caused a decrease of the monomeric 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189423 14690536 252562 20017 10940 SLC1A2 GLT-1 GLT-1 46 2.5 hSOD1wt expression caused a decrease of the monomeric form of GLT-1 without increasing oxidative multimers of GLT-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189424 14690536 252562 20017 10940 SLC1A2 GLT-1 GLT-1 52 2.5 the monomeric form of GLT-1 without increasing oxidative multimers of GLT-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189425 14690536 252563 20017 10940 SLC1A2 GLT-1 GLT-1 5 2.5 The effects were selective to GLT-1 since another glutamate transporter GLAST protein and mRNA levels were 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189426 14690536 252563 20018 10941 SLC1A3 GLAST GLAST 10 1.5 The effects were selective to GLT-1 since another glutamate transporter GLAST protein and mRNA levels were not altered 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189427 14690536 252564 20017 10940 SLC1A2 GLT-1 GLT-1 4 2.5 Reflecting the decrease in GLT-1 protein 3H d-aspartate uptake was reduced in cultures expressing hSOD1(G93A) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189428 14690536 252564 20996 11179 SOD1 SOD1 hSOD1 13 2.7 protein 3H d-aspartate uptake was reduced in cultures expressing hSOD1(G93A) hSOD1 G93A or hSOD1wt 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189429 14690536 252565 20017 10940 SLC1A2 GLT-1 GLT-1 4 2.5 The hSOD1-induced decline in GLT-1 protein and 3H d-aspartate uptake was not blocked by the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189430 14690536 252566 20996 11179 SOD1 SOD1 hSOD1 9 2.7 7'-dichlorofluorescein (DCF)-induced DCF -induced fluorescence revealed that expression of hSOD1(G93A) hSOD1 G93A or hSOD1wt in astrocytes does not lead to detectable 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189431 14690536 252567 20017 10940 SLC1A2 GLT-1 GLT-1 6 2.5 This study suggests that levels of GLT-1 protein in astrocytes are reduced rapidly by overexpression of hSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189432 14690536 252567 20996 11179 SOD1 SOD1 hSOD1 16 2.7 GLT-1 protein in astrocytes are reduced rapidly by overexpression of hSOD1 and is due to a property shared between the wild-type 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189701 14698606 252862 20996 11179 SOD1 SOD1 SOD1 24 2.2 linked to mutations in the enzyme superoxide dismutase 1 (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189702 14698606 252868 20996 11179 SOD1 SOD1 SOD1 17 2.2 recent years has addressed crucial issues including actions of mutant SOD1 modulation of glutamate transport roles of inflammation and the formation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189710 14698606 252897 8790 4572 GRIA2 GLUR2 GluR2 12 1.6 appear to comprise AMPA receptor subunits but to lack the GluR2 AMPA subunit which blocks Ca 2 permeability in heteromeric channels 14 JUMiner_v2.2 1 0 0 2 4572 TotalCon:2<>4572|GRIA2|2891|Complete__4594|GRM2|2912|Complete__<>AvaiableGeneRif=2<>BEST:4572|GRIA2|0.00104746630505174<>ScoreDetail__4594|GRM2|0.000699628930984706__4572|GRIA2|0.00104746630505174__ 0 0 0 0 0 189717 14698606 252906 20017 10940 SLC1A2 GLT-1 GLT-1 5 1.0 Specifically the astrocytic glutamate transporter GLT-1 (also also known as the excitatory amino acid transporter EAAT-2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189718 14698606 252906 20017 10940 SLC1A2 EAAT2 EAAT-2 14 1.0 GLT-1 (also also known as the excitatory amino acid transporter EAAT-2 appears to be particularly affected 34 and 35 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189721 14698606 252912 20996 11179 SOD1 SOD1 SOD1 21 2.2 reported in end-stage ALS 34 as well as in some SOD1 transgenic mice 37 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189724 14698606 252918 20996 11179 SOD1 SOD1 SOD1 36 2.2 transporter peptides have been reported in both ALS and the SOD1 mutant mouse model 46 and 47 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189727 14698606 252923 17610 9605 PTGS2 COX-2 COX-2 11 1.0 role for inflammation inhibitors of the enzyme cyclooxygenase 2 (COX-2) COX-2 have shown beneficial effects in SOD1 mutant mouse models 49 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189728 14698606 252923 20996 11179 SOD1 SOD1 SOD1 17 2.2 enzyme cyclooxygenase 2 (COX-2) COX-2 have shown beneficial effects in SOD1 mutant mouse models 49 and 50 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189730 14698606 252925 20996 11179 SOD1 SOD SOD 9 2.2 Another potential cause of aberrant oxidation is the mutant SOD itself 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189734 14698606 252929 20017 10940 SLC1A2 GLT-1 GLT-1 2 1.0 Indeed the GLT-1 transporter which is damaged in ALS is concentrated in astrocytic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189741 14698606 252934 20996 11179 SOD1 SOD1 SOD1 34 2.2 occurs in an annular pattern immediately surrounding motor neurons in SOD1 mutant mice 54 ( Figure 2c 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189753 14698606 252946 20996 11179 SOD1 SOD1 SOD1 13 2.2 explain how seemingly disparate inciting factors (for for instance mutant SOD1 environmental toxins trauma inflammation or infection could converge into a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189754 14698606 252948 20996 11179 SOD1 SOD1 SOD1 19 2.2 are integrally involved in disease pathogenesis expression of the mutant SOD1 in either motor neurons or astrocytes alone did not cause 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189755 14698606 252949 20996 11179 SOD1 SOD1 SOD1 5 2.2 Furthermore recent studies of mutant SOD1 chimeras indicate the dependence of motor neuron survival on the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190807 14739060 254314 14533 7872 NOS1 nNOS nNOS 36 1.9 account for NO production and include neuronal NO synthase (nNOS; nNOS type I inducible NO synthase (iNOS; iNOS typeII which is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190808 14739060 254314 14535 7873 NOS2A iNOS iNOS 42 1.9 NO synthase (nNOS; nNOS type I inducible NO synthase (iNOS; iNOS typeII which is produced in very large amounts by activated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190809 14739060 254314 14538 7876 NOS3 eNOS eNOS 59 1.9 by activated microglia (macrophages), macrophages and endothelial NO synthase (eNOS; eNOS type III In the CNS nNOS whose expression is regulated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190810 14739060 254314 14533 7872 NOS1 nNOS nNOS 65 1.9 endothelial NO synthase (eNOS; eNOS type III In the CNS nNOS whose expression is regulated by both physiological and pathophysiological stimuli 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190814 14739060 254317 14535 7873 NOS2A iNOS iNOS 15 1.9 in pathologic conditions especially NO coming from activated microglia (iNOS) iNOS or and from endothelial cells (eNOS) eNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190815 14739060 254317 14538 7876 NOS3 eNOS eNOS 21 1.9 activated microglia (iNOS) iNOS or and from endothelial cells (eNOS) eNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190819 14739060 254321 12337 6871 MAPK1 MAP MAP 28 0.3 for neurons astrocytes and microglia such as mitogene-activated protein (MAP) MAP kinase cascade activation ion transport calcium mobilization and apoptosis program 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190823 14739060 254345 14533 7872 NOS1 nNOS nNOS 17 1.9 series of enzymes including protein kinase C proteases phosphatases phospholipases nNOS and xanthine oxidase 32 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190829 14739060 254366 1576 990 BCL2 Bcl2 Bcl2 14 0.0 the release of apoptogenic mitochondrial mediators _amp_#x2022 Pro-apoptotic members of Bcl2 family _amp_#x2022 elevated levels of intra-cellular calcium such as that 1 JUMiner_v2.2 1 1 bcl2; 0 0 0 0 0 0 0 0 190830 14739060 254368 5854 21528 DIABLO SMAC Smac 31 1.3 the mitochondria into cytoplasm trigger the caspase chain _amp_#x2022 Smac/Diablo Smac Diablo binds to inhibitors of activated caspases and causes further 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190832 14739060 254372 864 576 APAF1 APAF1 Apaf1 6 0.3 Cytochrome c and the cytosolic factor Apaf1 activate the caspases while apoptosis-initiating factor and caspase activated DNase 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190836 14739060 254383 20996 11179 SOD1 SOD SOD 18 1.3 of motor neurons caused by a missense mutation of CuZn SOD (SOD1) SOD1 is an illustration of how these mechanisms can 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190837 14739060 254383 20996 11179 SOD1 SOD1 SOD1 19 2.1 neurons caused by a missense mutation of CuZn SOD (SOD1) SOD1 is an illustration of how these mechanisms can lead to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190838 14739060 254384 20996 11179 SOD1 SOD1 SOD1 7 2.1 In transgenic mice expressing the human mutant SOD1 gene syndrome develops with many features of ALS including specific 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190840 14739060 254385 20996 11179 SOD1 SOD1 SOD1 21 2.1 to compare the evolution for motor neurons degeneration in mutant SOD1 transgenic mouse with non-transgenic mouse and normal human SOD1 transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190841 14739060 254385 20996 11179 SOD1 SOD1 SOD1 30 2.1 mutant SOD1 transgenic mouse with non-transgenic mouse and normal human SOD1 transgenic mouse 46 50 47 48 and 49 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190842 14739060 254387 20996 11179 SOD1 SOD1 SOD1 4 2.1 The toxicity of mutant SOD1 seems to be due to a gain of function of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190843 14739060 254389 20996 11179 SOD1 SOD1 SOD1 5 2.1 It is also conceivable mutant SOD1 denatures more quickly in vivo than the normal form and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190844 14739060 254390 20996 11179 SOD1 SOD1 SOD1 9 2.1 Oxidative stress may be involved in misfolding of mutant SOD1 to form abnormal protein aggregates found as early as 1_amp_#xa0 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190845 14739060 254391 20996 11179 SOD1 SOD1 SOD1 11 2.1 disorganization of intermediate filaments could be due also to mutant SOD1 induced toxicity as their proteins are vulnerable to oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190847 14739060 254392 20996 11179 SOD1 SOD1 SOD1 19 2.1 in patients with sporadic ALS and in transgenic mice with SOD1 mutations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190848 14739060 254395 20996 11179 SOD1 SOD SOD 22 1.3 of ubiquinated cytoplasmic inclusion bodies some of which contain aggregated SOD 46 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190849 14739060 254397 20996 11179 SOD1 SOD1 SOD1 4 2.1 The studies on mutant SOD1 transgenic mice 46 and 63 revealed an up-regulation of gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190851 14739060 254401 926 620 APP amyloid amyloid 11 1.0 forms missense mutation have been identified for gene encoding _amp_#x3b2 -amyloid precursor protein as well as presenilin 1 (PSEN1) PSEN1 and 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 190852 14739060 254401 17461 9508 PSEN1 PSEN1 PSEN1 19 0.9 _amp_#x3b2 -amyloid precursor protein as well as presenilin 1 (PSEN1) PSEN1 and presenilin 2 (PSEN2) PSEN2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190853 14739060 254401 17462 9509 PSEN2 PSEN2 PSEN2 23 0.9 well as presenilin 1 (PSEN1) PSEN1 and presenilin 2 (PSEN2) PSEN2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190854 14739060 254402 12369 6893 MAPT tau tau 30 1.9 gene for _amp_#x3b1 2 -macrogobulin and perhaps the gene for tau protein and other factors including environmental contributions and occurrence by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190855 14739060 254402 912 613 APOE APOE APOE 18 0.0 a complex interaction among multiple predisposing genes such as variant APOE the gene for _amp_#x3b1 2 -macrogobulin and perhaps the gene 1 JUMiner_v2.2 1 1 apoe; 0 0 0 0 0 0 0 0 190856 14739060 254403 12369 6893 MAPT tau tau 14 1.9 tangles and senile plaques are both aggregation of proteins microtubular tau protein for the former accumulation of several aggregated proteins (_amp_#x3b2;-amyloid, 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190857 14739060 254403 926 620 APP amyloid amyloid 24 1.0 for the former accumulation of several aggregated proteins (_amp_#x3b2;-amyloid, _amp_#x3b2 -amyloid especially its toxic form A_amp_#x3b2 42 APOE 43 hyperphosphorylated tau 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 190858 14739060 254403 12369 6893 MAPT tau tau 37 1.9 -amyloid especially its toxic form A_amp_#x3b2 42 APOE 43 hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0 and 2 with an inflammatory reaction around 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190859 14739060 254403 926 620 APP amyloid amyloid 50 1.0 2 with an inflammatory reaction around the deposit of _amp_#x3b2 -amyloid for the latter 38 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 190860 14739060 254403 912 613 APOE APOE APOE 32 0.0 proteins (_amp_#x3b2;-amyloid, _amp_#x3b2 -amyloid especially its toxic form A_amp_#x3b2 42 APOE 43 hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0 and 2 with an 1 JUMiner_v2.2 1 1 apoe; 0 0 0 0 0 0 0 0 190861 14739060 254417 4772 26515 COQ10A Q10 Q10 11 0.9 a controlled trial in early PD oral treatment with coenzyme Q10 has slowed the progressive deterioration 56 and in aged mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190862 14739060 254434 166 118 ACO2 aconitase aconitase 9 1.3 may prevent the formation of Fe/S Fe S in mitochondrial aconitase and in complex I 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190864 14739060 254455 4772 26515 COQ10A Q10 Q10 12 0.9 affected sisters clinical and biochemical abnormalities improved remarkably with coenzyme Q10 supplementation 59 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190868 14739060 254479 22551 11892 TNF TNF TNF 27 0.3 amplification resulting in production of neurotoxins such as cytokine (TNF, TNF IL1 eicosanoides ROS and RNS 9 and 13 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190870 14739060 254479 10436 5991 IL1A IL1 IL1 28 0.2 resulting in production of neurotoxins such as cytokine (TNF, TNF IL1 eicosanoides ROS and RNS 9 and 13 5 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190872 14739060 254483 20997 11180 SOD2 MnSOD MnSOD 7 1.8 Tat protein decreases GSH and down regulate MnSOD gene expression leading to oxidative stress 16 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183143 15031734 244221 211 132 ACTB beta-actin beta-actin 24 0.3 significant protein carbonylation (for for example of creatine kinase and beta-actin 2 and nitration is observed in AD brains whereas increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183144 15031734 244223 20996 11179 SOD1 SOD SOD 15 2.2 the activity of the antioxidant proteins catalase superoxide dismutase ( SOD glutathione peroxidase and glutathione reductase are increased in the HIPPOCAMPUS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183148 15031734 244229 20017 10940 SLC1A2 GLT-1 GLT-1 35 1.0 inhibition of the neuronal glucose transporter type-3 the glutamate transporter GLT-1 (Ref Ref 13 as well as the Na K ATPases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183150 15031734 244230 10824 6204 JUN c-Jun c-Jun 2 1.3 HNE activates c-Jun aminoterminal kinases and mitogen-activated protein kinase-1 (also also known as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183151 15031734 244230 12359 6876 MAPK14 p38 p38 12 1.2 aminoterminal kinases and mitogen-activated protein kinase-1 (also also known as p38 thereby stimulating an apoptotic cascade 15 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.000586105713037067<>ScoreDetail__1189|AHSA1|0.000276525398256688__6878|MAPK4|0.000484348834213577__6871|MAPK1|0.000586105713037067__6876|MAPK14|0.000409638528257453__ 0 0 0 0 0 183169 15031734 244251 20996 11179 SOD1 SOD1 SOD1 19 1.9 neurodegenerative disorders (A A beta in AD alpha-synuclein in PD SOD1 in ALS frataxin in Friedreich's ataxia ( Box 1 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183172 15031734 244260 926 620 APP amyloid amyloid 25 1.0 peptide (A A beta that is cleaved from the membrane-bound amyloid precursor protein (APP) APP 33 34 35 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 183173 15031734 244260 926 620 APP APP APP 28 0.3 that is cleaved from the membrane-bound amyloid precursor protein (APP) APP 33 34 35 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183174 15031734 244261 926 620 APP APP APP 4 0.3 Although the function of APP is unknown recent evidence suggests it functions in maintaining copper 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183175 15031734 244263 926 620 APP amyloid amyloid 10 1.0 Recent results have highlighted the importance of Zn 2 in amyloid plaque formation for example age- and female-sex-related plaque formation in 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 183176 15031734 244267 926 620 APP amyloid amyloid 10 1.0 neurotransmission high concentrations of Zn (300 300 beta precipitation into amyloid commences in the synapse 36 41 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 183178 15031734 244274 926 620 APP amyloid amyloid 8 1.0 Notably the Fe that is found within the amyloid deposits of human brain and in amyloid-bearing APP transgenic mice 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 183179 15031734 244274 926 620 APP APP APP 16 0.3 within the amyloid deposits of human brain and in amyloid-bearing APP transgenic mice is redox-active 38 48 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183180 15031734 244286 20996 11179 SOD1 SOD1 SOD1 46 1.9 with the resulting coordination sphere reminiscent of that observed in SOD1 ( Fig 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183182 15031734 244294 926 620 APP amyloid amyloid 13 1.0 how zinc originating from the synapse becomes so enriched in amyloid in AD 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 183183 15031734 244297 926 620 APP amyloid amyloid 5 1.0 The Zn 2 in the amyloid mass partially quenches H 2 O 2 production which explains 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 183184 15031734 244297 926 620 APP amyloid amyloid 18 1.0 quenches H 2 O 2 production which explains why plaque amyloid burden correlates poorly with clinical dementia 54 whereas soluble A 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 183188 15031734 244324 20996 11179 SOD1 SOD SOD 22 2.2 protein in neural tissue in this instance copper/zinc copper zinc SOD 89 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183189 15031734 244325 20996 11179 SOD1 SOD SOD 7 2.2 There are more than 100 mutations of SOD associated with the familial forms of the disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183190 15031734 244326 20996 11179 SOD1 SOD SOD 19 2.2 these mutations lead to a toxic gain of function by SOD 90 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183191 15031734 244327 20996 11179 SOD1 SOD SOD 28 2.2 that the toxicity is due to misfolded aggregated forms of SOD whereas the other proposes that SOD becomes a pro-oxidant protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183192 15031734 244327 20996 11179 SOD1 SOD SOD 34 2.2 misfolded aggregated forms of SOD whereas the other proposes that SOD becomes a pro-oxidant protein generating ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183194 15031734 244329 20996 11179 SOD1 SOD SOD 2 2.2 Mutations of SOD a cupro-enzyme that detoxifies the ROS superoxide can convert the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183197 15031734 244331 20996 11179 SOD1 SOD SOD 10 2.2 These initial observations suggested that the toxicity associated with mutant SOD is the result of a corruption of the active site 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183198 15031734 244332 20996 11179 SOD1 SOD SOD 9 2.2 However if the copper at the active site of SOD is the culprit behind the toxicity then knocking out the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183199 15031734 244332 20996 11179 SOD1 SOD SOD 20 2.2 is the culprit behind the toxicity then knocking out the SOD copper chaperone (CCS), CCS which loads copper into the active 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183200 15031734 244332 3838 1613 CCS CCS CCS 23 0.9 the toxicity then knocking out the SOD copper chaperone (CCS), CCS which loads copper into the active site should abolish the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183201 15031734 244333 3838 1613 CCS CCS CCS 7 0.9 To test this hypothesis Subramaniam 97 crossed CCS knockout mice with an SOD mutant ALS mouse model the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183202 15031734 244333 20996 11179 SOD1 SOD SOD 12 2.2 this hypothesis Subramaniam 97 crossed CCS knockout mice with an SOD mutant ALS mouse model the phenotype of this cross showed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183204 15031734 244333 20996 11179 SOD1 SOD SOD 24 2.2 ALS mouse model the phenotype of this cross showed reduced SOD activity which is consistent with a low copper load in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183207 15031734 244335 20996 11179 SOD1 SOD SOD 16 2.2 the possibility that other redox-active lower-affinity metal-binding sites exist on SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183208 15031734 244336 20996 11179 SOD1 SOD SOD 26 2.2 98 and in vitro studies 99 with an H46R mutant SOD linked to familial ALS and which has no SOD activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183210 15031734 244336 20996 11179 SOD1 SOD SOD 35 2.2 mutant SOD linked to familial ALS and which has no SOD activity have shown that a surface-exposed cysteine residue in SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183211 15031734 244336 20996 11179 SOD1 SOD SOD 45 2.2 SOD activity have shown that a surface-exposed cysteine residue in SOD is also capable of coordinating copper and is redox active 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183221 15031734 244392 211 132 ACTB beta-actin beta-actin 0 0.3 beta-actin catalase creatine kinase frataxin glucose transporter type-3 glutathione peroxidase glutathione 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183222 15031734 244392 20996 11179 SOD1 SOD SOD 15 2.2 glucose transporter type-3 glutathione peroxidase glutathione reductase mitogen-activated protein kinase-1 SOD alpha-synuclein xanthine dehydrogenase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183226 15031734 244401 20996 11179 SOD1 SOD SOD 8 2.2 A beta amyloid-beta ROS reactive oxygen species SOD superoxide dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183234 15031734 244420 20996 11179 SOD1 SOD SOD 6 2.2 The normal function of superoxide dismutase (SOD) SOD is to convert toxic superoxide radicals into H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183235 15031734 244422 20996 11179 SOD1 SOD SOD 10 2.2 With age-dependent increases in copper levels low-affinity copper sites on SOD such as Cys111 are occupied these sites are redox active 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 177199 15105254 236594 926 620 APP amyloid amyloid 5 1.3 In Alzheimer's disease (AD), AD the amyloid beta-peptide generates reactive oxygen species and induces MAOS resulting in 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 169741 15208263 227119 20996 11179 SOD1 SOD1 SOD1 13 1.2 for the ubiquitous anti-oxidant enzyme Cu Zn superoxide dismutase (SOD1) SOD1 are associated with familial amyotrophic lateral sclerosis (fALS), fALS a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 169742 15208263 227120 20996 11179 SOD1 SOD1 SOD1 4 1.2 Expression of a mutant SOD1 typical of fALS patients restricted to either motor neurons or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 169743 15208263 227127 20996 11179 SOD1 SOD1 SOD1-linked 9 1.2 This cross-talk may be crucial for the pathogenesis of SOD1-linked fALS but also for the more common sporadic form of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 172997 15289674 231349 20996 11179 SOD1 SOD1 SOD1 4 2.7 Mutations in Cu/Zn-superoxide Cu Zn-superoxide dismutase (SOD1) SOD1 gene have been identified in familial amyotrophic lateral sclerosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 172998 15289674 231351 20996 11179 SOD1 SOD1 SOD1 18 2.7 hybrid cells (VSC4.1) VSC4.1 constitutively expressing a mutant (G93A) G93A SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 175551 15333927 234326 20996 11179 SOD1 SOD SOD 4 1.4 Cu Zn superoxide dismutase (Cu,Zn Cu Zn SOD is an essential enzyme for protecting cells from the toxic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 175552 15333927 234327 20996 11179 SOD1 SOD SOD 5 1.4 In humans two distinct Cu Zn SOD genes are located on chromosomes 4 and 21 and mutations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 175553 15333927 234328 20996 11179 SOD1 SOD SODs 16 0.9 chronically debilitating disease schistosomiasis also produce two distinct Cu Zn SODs in this case one cytosolic and one bearing a signal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166645 15480846 223893 12288 6834 MAOB MAOB MAO-B 16 0.9 MAO A and B have not been determined previously since MAO-B inhibitors have been shown to be neuroprotective in cellular and 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166646 15480846 223894 12287 6833 MAOA MAOA MAO-A 18 0.9 U74600F showed a preference for inhibition of rat brain mitochondrial MAO-A over MAO-B 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166647 15480846 223894 12288 6834 MAOB MAOB MAO-B 20 0.9 a preference for inhibition of rat brain mitochondrial MAO-A over MAO-B 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166648 15480846 223895 12287 6833 MAOA MAOA MAO-A 25 0.9 U74500A and U74006F showing a greater selectivity and potency for MAO-A 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166649 15480846 223897 12287 6833 MAOA MAOA MAO-A 3 0.9 The inhibitions of MAO-A and B by 21-amino steroids (Lazaroids) Lazaroids were time dependent 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166650 15480846 223899 12287 6833 MAOA MAOA MAO-A 8 0.9 Both Fe 2 and Fe 3 reverse the MAO-A and B inhibition induced by the latter chelators but not 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166651 15480846 223904 12287 6833 MAOA MAOA MAO-A 5 0.9 Keywords Iron chelators Lazaroids iron MAO-A and MAO-B inhibition reactive oxygen species dopamine neuron degeneration Parkinson 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166652 15480846 223904 12288 6834 MAOB MAOB MAO-B 7 0.9 Keywords Iron chelators Lazaroids iron MAO-A and MAO-B inhibition reactive oxygen species dopamine neuron degeneration Parkinson s disease 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151455 15812313 199883 20996 11179 SOD1 SOD1 SOD1 6 3.2 Mutations in the copper_amp_#47 zinc superoxide dismutase (SOD1) SOD1 gene are known to be responsible for familial amyotrophic lateral 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151456 15812313 199884 20996 11179 SOD1 SOD1 SOD1 7 3.2 Alteration of metal binding properties of mutant SOD1 has been proposed to play a role in the pathogenesis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151457 15812313 199885 20996 11179 SOD1 SOD1 SOD1 16 3.2 excess extracellular copper on motor neuronal cells expressing human mutant SOD1 (G93A), G93A and evaluated the neuroprotective effects of energy metabolism 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151458 15812313 199886 20996 11179 SOD1 SOD1 SOD1 7 3.2 Motoneuron-neuroblastoma hybrid (VSC VSC 4.1 cells expressing mutant SOD1 when treated with copper chloride showed reduced viability and increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151459 15812313 199888 20996 11179 SOD1 SOD1 SOD1 21 3.2 and production of reactive oxygen species in cells expressing mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151461 15812313 199891 20996 11179 SOD1 SOD1 SOD1 7 3.2 The mutation in the copper_amp_#47 zinc superoxide dismutase (SOD1) SOD1 gene is known to be associated with the familial ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151463 15812313 199891 20996 11179 SOD1 SOD1 SOD1 26 3.2 ALS (FALS) FALS because of some undefined property of mutant SOD1 protein _amp_#91 1 _amp_#93 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151464 15812313 199892 20996 11179 SOD1 SOD1 SOD1 0 3.2 SOD1 mutations cause the disease through a gain of function or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151465 15812313 199892 20996 11179 SOD1 SOD SOD 18 2.2 of function or by enhancing an unknown nondismutase activity of SOD _amp_#91 2 _amp_#93 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151466 15812313 199893 20996 11179 SOD1 SOD1 SOD1 5 3.2 Several pathophysiological mechanisms linking the SOD1 mutation with FALS have been proposed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151467 15812313 199894 20996 11179 SOD1 SOD1 SOD1 9 3.2 They include a failure to fold or degrade mutant SOD1 the formation of free radicals the susceptibility of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151468 15812313 199894 20996 11179 SOD1 SOD1 SOD1 19 3.2 SOD1 the formation of free radicals the susceptibility of mutant SOD1 to disulfide reduction and the release of free copper _amp_#91 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151469 15812313 199895 20996 11179 SOD1 SOD1 SOD1 11 3.2 hypotheses have been proposed concerning the metal binding properties of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151470 15812313 199897 20996 11179 SOD1 SOD1 SOD1 32 3.2 (NO), NO reacts with the Cu 2_amp_#43 ion of mutant SOD1 to produce nitronium ions which then nitrate proteins and induce 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151471 15812313 199899 20996 11179 SOD1 SOD1 SOD1 16 3.2 and Yim et al _amp_#91 7 _amp_#93 reported that mutant SOD1 has higher peroxidase activity than the wild type (WT), WT 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151472 15812313 199900 20996 11179 SOD1 SOD1 SOD1 11 3.2 et al _amp_#91 8 _amp_#93 proposed that the FALS-associated mutant SOD1 failed to bind or shield Cu 2_amp_#43 as effectively as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151473 15812313 199901 20996 11179 SOD1 SOD1 SOD1 28 3.2 by a mechanism involving the altered copper-dependent activity of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151474 15812313 199902 20996 11179 SOD1 SOD1 SOD1 7 3.2 If an altered copper binding capacity by SOD1 protein causes a toxic gain of function neurons with SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151475 15812313 199902 20996 11179 SOD1 SOD1 SOD1 17 3.2 SOD1 protein causes a toxic gain of function neurons with SOD1 mutations are likely to be more vulnerable to excess copper 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151476 15812313 199903 20996 11179 SOD1 SOD1 SOD1 2 3.2 Furthermore mutant SOD1 mice have significant elevations in brain or spinal cord copper 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151477 15812313 199904 20996 11179 SOD1 SOD1 SOD1 11 3.2 elevation of copper is probably copper bound to the over-expressed SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151478 15812313 199905 20996 11179 SOD1 SOD1 SOD1 1 3.2 Therefore SOD1 mutant neurons would be more vulnerable to an exogenous load 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151479 15812313 199907 16323 8806 PDHA1 PDH PDH 17 0.3 formation of 4-hydroxy nonenal and it inhibits pyruvate dehydrogenase (PDH) PDH by covalently modifying the lipoic acid moiety of the enzyme 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 17106 9279 PPM2C 0 151480 15812313 199908 16323 8806 PDHA1 PDH PDH 16 0.3 intermediate of energy metabolism thiamine and lipoic acid cofactors of PDH were tested to have neuroprotective effects against copper overload 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 17106 9279 PPM2C 0 151482 15812313 199911 20996 11179 SOD1 SOD1 SOD1 5 3.2 WT or mutant (G93A) G93A human SOD1 cDNA (a a gift from Dr Lawrence J Hayward University 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151483 15812313 199912 20996 11179 SOD1 SOD1 SOD1 28 3.2 USA with pcDNA3.1 vector containing cDNA encoding WT or G93A SOD1 and then selected using geneticin (G418 G418 sulfate Gibco 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151484 15812313 199914 20996 11179 SOD1 SOD1 SOD1 31 3.2 or pooled colonies were used for experiments after determining human SOD1 expression by Western blot and immunohistochemical staining 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151485 15812313 199915 20996 11179 SOD1 SOD1 SOD1 4 3.2 The cells expressing human SOD1 were cultured in a medium containing geneticin at 200 microg_amp_#47 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151486 15812313 199917 20996 11179 SOD1 SOD1 SOD1 17 3.2 (Cu Cu 2_amp_#43 on the death of cells expressing mutant SOD1 the cells were treated with various agents prior to exposing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151487 15812313 199932 20996 11179 SOD1 SOD1 SOD1 8 3.2 VSC 4.1 cells expressing human WT or mutant SOD1 (G93A) G93A were exposed to increasing concentrations of Cu 2_amp_#43 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151488 15812313 199934 20996 11179 SOD1 SOD1 SOD1 34 3.2 treatment (250 250 microM in cells expressing WT or mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151489 15812313 199935 20996 11179 SOD1 SOD1 SOD1 4 3.2 In cells expressing WT SOD1 Cu 2_amp_#43 -induced cell death was not affected by trolox 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151491 15812313 199938 20996 11179 SOD1 SOD1 SOD1 44 3.2 attenuate Cu 2_amp_#43 -induced neuronal death in cells expressing mutant SOD1 ( Fig 2a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151496 15812313 199947 20996 11179 SOD1 SOD1 SOD1 20 3.2 concentrations reduce the survival of VSC 4.1 cells expressing human SOD1 mutated at G93A and that pyruvate protects these cells from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151498 15812313 199948 20996 11179 SOD1 SOD1 SOD1 22 3.2 functioning of several enzymes including cytochrome c oxidase ceruloplasmin and SOD1 _amp_#91 13 _amp_#93 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151499 15812313 199951 20996 11179 SOD1 SOD1 SOD1 18 3.2 2_amp_#43 reduces the viability of VSC 4.1 cells expressing mutant SOD1 (G93A) G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151504 15812313 199962 20996 11179 SOD1 SOD1 SOD1 17 3.2 through this property in VSC 4.1 cells harboring the G93A SOD1 mutation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151507 15812313 199967 20996 11179 SOD1 SOD1 SOD1 18 3.2 free radical scavenging action in VSC 4.1 cells expressing mutant SOD1 (G93A) G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151509 15812313 199971 20996 11179 SOD1 SOD1 SOD1 13 3.2 found to be toxic to motor neuronal cells expressing mutant SOD1 and pyruvate attenuated this Cu 2_amp_#43 -induced neuronal death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151510 15812313 199972 20996 11179 SOD1 SOD1 SOD1 25 3.2 and energy metabolism enhancing actions in motor neurons harboring the SOD1 mutation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153881 15850589 203859 20996 11179 SOD1 SOD1 SOD1 5 5.7 Mutations of Cu/Zn Cu Zn superoxide dismutase (SOD1) SOD1 are found in patients with familial amyotrophic lateral sclerosis (FALS) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153882 15850589 203860 20996 11179 SOD1 SOD1 SOD1 24 5.7 with human wild type (wt) wt or mutant (G93A) G93A SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153884 15850589 203867 20996 11179 SOD1 SOD1 SOD1 8 5.7 In conclusion even a small amount of mutant SOD1 put motor neurons in a condition of oxidative stress and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153888 15850589 203876 20996 11179 SOD1 SOD1 SOD1 15 5.7 the gene encoding for Cu/Zn Cu Zn superoxide dismutase (SOD1) SOD1 and over 100 missense mutations have been described 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153889 15850589 203877 20996 11179 SOD1 SOD1 SOD1 0 5.7 SOD1 is a free radical-scavenging enzyme since it converts the superoxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153890 15850589 203878 20996 11179 SOD1 SOD1 SOD1 11 5.7 is now generally accepted that the toxic effect of mutant SOD1 is not due to the loss of dismutase activity but 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153891 15850589 203879 20996 11179 SOD1 SOD1 SOD1 16 5.7 oxidative chemistry and/or and or misfolding and aggregation of mutant SOD1 (for for a review see Ref 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153892 15850589 203880 20996 11179 SOD1 SOD1 SOD1 3 5.7 Apparently mutation converts SOD1 from an anti-apoptotic gene to a pro-apoptotic one 2 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153893 15850589 203881 20996 11179 SOD1 SOD1 SOD1 3 5.7 The presence of SOD1 not only in the cytosol but also in the mitochondrial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153894 15850589 203882 20996 11179 SOD1 SOD1 SOD1 12 5.7 and in vitro models were generated by genetic manipulation of SOD1 expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153895 15850589 203885 20996 11179 SOD1 SOD1 SOD1 13 5.7 previous in vitro studies of the toxic effects of mutant SOD1 were conducted in cells which did not have a motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153896 15850589 203886 20996 11179 SOD1 SOD1 SOD1 3 5.7 However while mutant SOD1 is ubiquitously expressed the selectivity of damage towards motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153897 15850589 203886 20996 11179 SOD1 SOD1 SOD1 26 5.7 that this cell type has a peculiar susceptibility to mutant SOD1 toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153898 15850589 203887 20996 11179 SOD1 SOD1 SOD1 3 5.7 Accordingly microinjected mutant SOD1 protein caused death in primary motor neurons but not in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153899 15850589 203888 20996 11179 SOD1 SOD1 SOD1 26 5.7 review see Ref 10 and by a selective enrichment of SOD1 in motor neurons of the spinal cord and brainstem 11 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153900 15850589 203889 20996 11179 SOD1 SOD1 SOD1 6 5.7 Recently the effects of human mutant SOD1 were investigated in the NSC-34 motor neuron-like cell line 12 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153901 15850589 203890 20996 11179 SOD1 SOD1 SOD1 27 5.7 wt or mutant G93ASOD1 and investigated the toxicity of mutant SOD1 expressed at levels close to those seen in the human 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153903 15850589 203896 20996 11179 SOD1 SOD1 SOD1 12 5.7 and generation of NSC-34 cell lines stably transfected with human SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153906 15850589 203899 20996 11179 SOD1 SOD1 SOD1 21 5.7 with the vector cloned with wt or G93A mutant human SOD1 cDNAs 16 using the LipofectAMINE PLUS reagent (Invitrogen Invitrogen Life 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153907 15850589 203901 20996 11179 SOD1 SOD1 SOD1 12 5.7 clones were isolated grown and tested for expression of human SOD1 protein by Western blotting 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153908 15850589 203902 20996 11179 SOD1 SOD1 SOD1 9 5.7 The NSC-34 cell lines transfected with vv or wt SOD1 or G93ASOD1 were maintained in selective medium (0.5 0.5 mg/mL 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153910 15850589 203905 20996 11179 SOD1 SOD1 SOD1 6 5.7 SDS PAGE and Western blotting of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153913 15850589 203909 20996 11179 SOD1 SOD1 SOD1 4 5.7 Protein bands identified by SOD1 antibody were detected using the ECL-Plus detection system (Amersham Amersham 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153915 15850589 203911 20996 11179 SOD1 SOD1 SOD1 8 5.7 The continued expression of wt and G93A human SOD1 was routinely checked in order to ensure the cell lines 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153916 15850589 203911 20996 11179 SOD1 SOD1 SOD1 27 5.7 cell lines expressed similar quantities of human wt and mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153919 15850589 203953 20996 11179 SOD1 SOD1 SOD1s 4 2.4 The expression of human SOD1s was measured with an anti-human SOD1 antibody which also cross-reacts 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153920 15850589 203953 20996 11179 SOD1 SOD1 SOD1 10 5.7 The expression of human SOD1s was measured with an anti-human SOD1 antibody which also cross-reacts with murine SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153921 15850589 203953 20996 11179 SOD1 SOD1 SOD1 17 5.7 with an anti-human SOD1 antibody which also cross-reacts with murine SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153922 15850589 203954 20996 11179 SOD1 SOD1 SOD1s 3 2.4 In SDS-PAGE human SOD1s migrate at a slower rate than mouse SOD1 18 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153923 15850589 203954 20996 11179 SOD1 SOD1 SOD1 11 5.7 SDS-PAGE human SOD1s migrate at a slower rate than mouse SOD1 18 and accordingly two bands were detected with mouse SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153924 15850589 203954 20996 11179 SOD1 SOD1 SOD1 21 5.7 SOD1 18 and accordingly two bands were detected with mouse SOD1 being the band with the lower molecular weight 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153925 15850589 203955 20996 11179 SOD1 SOD1 SOD1 2 5.7 No human SOD1 expression is seen in cells transfected with empty vector 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153926 15850589 203956 20996 11179 SOD1 SOD1 SOD1 22 5.7 in this study was about 30% of the endogenous mouse SOD1 as measured by densitometry ( Fig 1 C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153929 15850589 203972 20996 11179 SOD1 SOD1 SOD1 25 5.7 observed in NSC-34 cells transfected with the wt form of SOD1 while a shift towards a higher DCF fluorescence level was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153930 15850589 203972 20996 11179 SOD1 SOD1 SOD1 44 5.7 level was observed in NSC-34 cells transfected with the mutant SOD1 protein ( Fig 3 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153931 15850589 203973 20996 11179 SOD1 SOD1 SOD1 13 5.7 quantified measuring the average DCF fluorescence of living untransfected wt SOD1 and G93ASOD1 transfected cells ( Fig 3 B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153933 15850589 203976 20996 11179 SOD1 SOD1 SOD1 6 5.7 This suggests the two forms of SOD1 handle free radicals differently 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153935 15850589 203981 20996 11179 SOD1 SOD1 SOD1 29 5.7 of cells with depolarized mitochondria compared to untransfected or wt SOD1 transfected cell lines ( Fig 4 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153936 15850589 203989 20996 11179 SOD1 SOD1 SOD1 19 5.7 3 days limited the MTT reduction in NSC-34 expressing mutant SOD1 protein more than in NSC-34 expressing wt SOD1 or untransfected 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153937 15850589 203989 20996 11179 SOD1 SOD1 SOD1 27 5.7 expressing mutant SOD1 protein more than in NSC-34 expressing wt SOD1 or untransfected cells ( Fig 5 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153939 15850589 203992 20996 11179 SOD1 SOD1 SOD1 25 5.7 h caused preferential toxicity towards cells transfected with the mutant SOD1 (about about 35% decrease Fig 5 C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153942 15850589 204000 20996 11179 SOD1 SOD1 SOD1 22 5.7 (NSC-34) NSC-34 stably expressing the human mutant G93A form of SOD1 as representative of the SOD1 mutant forms seen in about 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153943 15850589 204000 20996 11179 SOD1 SOD1 SOD1 27 5.7 human mutant G93A form of SOD1 as representative of the SOD1 mutant forms seen in about 20% of FALS patients 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153944 15850589 204001 20996 11179 SOD1 SOD1 SOD1 13 5.7 containing G93ASOD1 had a lower viability than those expressing wt SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153945 15850589 204002 20996 11179 SOD1 SOD1 SOD1 20 5.7 though it was expressed at a lower level than normal SOD1 a condition similar to FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153946 15850589 204003 20996 11179 SOD1 SOD1 SOD1s 5 2.4 Apoptotic cell death by mutant SOD1s was shown in other cellular models but in these studies 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153947 15850589 204003 20996 11179 SOD1 SOD1 SOD1 27 5.7 was not investigated whether the expression level of the mutant SOD1 proteins was comparable to the level observed in the FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153948 15850589 204006 20996 11179 SOD1 SOD1 SOD1 4 5.7 The effect of mutant SOD1 on viability appeared when motor neurons were in the growth 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153949 15850589 204011 20996 11179 SOD1 SOD1 SOD1 12 5.7 event is the enhanced ROS formation in cells containing mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153951 15850589 204012 20996 11179 SOD1 SOD1 SOD1 8 5.7 This effect is peculiar to G93ASOD1 and wt SOD1 might in fact afford protection since it lowered intracellular ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153956 15850589 204017 20221 10990 SLC25A4 ANT ANT 30 0.0 particularly in MPTP components such as adenine nucleotide translocator (ANT) ANT 1 JUMiner_v2.2 1 1 adenine nucleotide translocator 0 0 0 0 0 0 0 0 153958 15850589 204019 20996 11179 SOD1 SOD1 SOD1 11 5.7 was also reduced in human neuroblastoma SH-SY5Y cells expressing mutant SOD1 in a ratio of 1 1 with the endogenous SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153959 15850589 204019 20996 11179 SOD1 SOD1 SOD1 20 5.7 SOD1 in a ratio of 1 1 with the endogenous SOD1 protein 24 and in primary motor neurons from G93A mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153960 15850589 204021 20996 11179 SOD1 SOD1 SOD1 4 5.7 The presence of mutant SOD1 in our cellular model caused the appearance of a population 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153961 15850589 204023 20996 11179 SOD1 SOD1 SOD1 3 5.7 Mitochondria of mutant SOD1 transgenic mice are also swollen and in addition abnormally vacuolated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153962 15850589 204024 20996 11179 SOD1 SOD1 SOD1 25 5.7 damage with some relationship with the high content of mutant SOD1 in some of these in vivo experimental models 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153964 15850589 204027 20996 11179 SOD1 SOD1 SOD1 19 5.7 more affected in these cells than in NSC-34 expressing wt SOD1 after exposure to rotenone EA or serum withdrawal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153967 15850589 204032 20996 11179 SOD1 SOD1 SOD1 9 5.7 Altered ETC activities were shown in FALS patients with SOD1 mutations (for for a review see Ref 9 in mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153968 15850589 204032 20996 11179 SOD1 SOD1 SOD1 20 5.7 mutations (for for a review see Ref 9 in mutant SOD1 transgenic mice 31 and 32 and in a cell culture 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153972 15850589 204036 20996 11179 SOD1 SOD1 SOD1 24 5.7 motor neurons to excitotoxicity 36 and motor neurons containing mutant SOD1 were more vulnerable to glutamate 25 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153975 15850589 204041 20996 11179 SOD1 SOD1 SOD1 3 5.7 A fraction of SOD1 is located in this space with the putative function to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153976 15850589 204042 20996 11179 SOD1 SOD1 SOD1 4 5.7 The presence of mutant SOD1 in the intermembrane space of FALS mitochondria might however be 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153977 15850589 204042 20996 11179 SOD1 SOD1 SOD1-associated 21 2.4 mitochondria might however be critical in the pathogenesis of mutant SOD1-associated FALS 32 38 and 39 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153978 15850589 204043 20996 11179 SOD1 SOD1 SOD1 7 5.7 Our study shows that overexpression of wt SOD1 did indeed reduce the ROS level in viable motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153982 15850589 204045 20997 11180 SOD2 MnSOD MnSOD 6 1.9 In agreement with this overexpression of MnSOD attenuates neuronal death in cellular models of FALS 12 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153983 15850589 204046 20996 11179 SOD1 SOD1 SOD1 31 5.7 disease onset and prolonged survival in transgenic mice with mutant SOD1 42 43 and 44 and rendered cells transfected with mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153984 15850589 204046 20996 11179 SOD1 SOD1 SOD1 43 5.7 42 43 and 44 and rendered cells transfected with mutant SOD1 more resistant to apoptosis 45 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153985 15850589 204046 1576 990 BCL2 BCL2 bcl2 9 0.0 Treatment with inhibitors of MPTP opening and overexpression of bcl2 which inhibits the opening of MPTP under stressful conditions delayed 14 JUMiner_v2.2 1 1 bcl2; 0 0 0 0 0 0 0 0 153986 15850589 204047 20996 11179 SOD1 SOD1 SOD1 13 5.7 scavengers reversed mitochondrial dysfunction and cell death due to mutant SOD1 in cell culture models of FALS 12 and 35 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153987 15850589 204048 20996 11179 SOD1 SOD1 SOD1 10 5.7 In conclusion this study found that motor neurons containing mutant SOD1 in amounts comparable to FALS patients are in a condition 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153988 15850589 204049 20996 11179 SOD1 SOD1 SOD1 17 5.7 determining the cell destiny in the presence of the mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153989 15850589 204051 20996 11179 SOD1 SOD1 SOD1 9 5.7 Fig 1._amp_#xa0 Morphology and transfection of NSC-34 cells with human SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153990 15850589 204053 20996 11179 SOD1 SOD1 SOD1 9 5.7 Panels B and C show the expression of human SOD1 after transient or stable transfection of NSC-34 cells with empty 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153991 15850589 204053 20996 11179 SOD1 SOD1 SOD1 27 5.7 cells with empty vector wild type or G93A mutant human SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153992 15850589 204054 20996 11179 SOD1 SOD1 SOD1 16 5.7 upper and lower bands correspond to the human and murine SOD1 respectively 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153996 15850589 204077 20996 11179 SOD1 SOD1 SOD1 9 5.7 Fig 6._amp_#xa0 Effect of sodium butyrate on expression of human SOD1 and mitochondrial function 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153997 15850589 204078 20996 11179 SOD1 SOD1 SOD1 12 5.7 shows the Western blot analysis of human wt or G93A SOD1 expression after 24 h treatment with sodium butyrate (NaB; NaB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142715 15863242 187979 20996 11179 SOD1 SOD1 SOD1 3 2.5 Cu/Zn-superoxide Cu Zn-superoxide dismutase 1 (SOD1), SOD1 encoded on chromosome 21 is a key enzyme in metabolism 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142716 15863242 187980 20996 11179 SOD1 SOD1 SOD1 4 2.5 Transgenic mice overexpressing human SOD1 (Tg-hSOD1) Tg-hSOD1 are useful model for Down syndrome (trisomy trisomy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142718 15863242 187984 20996 11179 SOD1 SOD1 SOD1 5 2.5 Our findings suggest that overexpressed SOD1 directly or by generating reactive oxygen species may lead to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142719 15863242 187987 20996 11179 SOD1 SOD1 hSOD1 6 3.0 The human Cu/Zn-superoxide Cu Zn-superoxide dismutase 1 gene (hSOD1) hSOD1 was the first chromosome 21 gene to be characterised ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142720 15863242 187988 20996 11179 SOD1 SOD1 SOD1 5 2.5 Later studies revealed overexpression of SOD1 mRNA protein and increased activity was detected in brains of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142721 15863242 187989 20996 11179 SOD1 SOD1 SOD1 6 2.5 Moreover transgenic mice expressing wild-type human SOD1 (Tg-hSOD1 Tg-hSOD1 mice were the first model for DS ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142722 15863242 187991 20996 11179 SOD1 SOD1 SOD1 16 2.5 deficit in DS no proof for a pathogenetic role of SOD1 in DS exists 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142723 15863242 187992 20996 11179 SOD1 SOD1 SOD1 2 2.5 Although increased SOD1 may lead to generation of reactive oxygen species and thus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142724 15863242 187992 20996 11179 SOD1 SOD1 SOD1 37 2.5 role in neurodegenerative mechanisms it was demonstrated that overexpression of SOD1 may be protective against apoptosis for hippocampal neurons ( Korenberg 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142725 15863242 188002 20996 11179 SOD1 SOD1 hSOD1 7 3.0 Transgenic mice about 3-month-old male harbouring the hSOD1 gene were obtained from Dr Jacqueline London University of Paris 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142726 15863242 188003 20996 11179 SOD1 SOD1 hSOD1 3 3.0 Generation of the hSOD1 transgenic line KT has been described previously ( Paris et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142727 15863242 188004 20996 11179 SOD1 SOD1 hSOD1 14 3.0 by injecting an 11.5 kb EcoRI_amp_#x2013 BamH1 fragment containing the hSOD1 gene into fertilised eggs from FVB/N FVB N mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142728 15863242 188013 20996 11179 SOD1 SOD1 SOD1 2 2.5 Measurement of SOD1 activity and immunostaining in WT and Tg-hSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142729 15863242 188014 20996 11179 SOD1 SOD1 hSOD1 1 3.0 For hSOD1 activity measurements hippocampal extracts of WT and Tg-hSOD1 mice were 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142730 15863242 188015 20996 11179 SOD1 SOD1 SOD1 2 2.5 Activity of SOD1 was assayed photochemically by measuring inhibition of nitroblue tetrazolium reduction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142731 15863242 188016 20996 11179 SOD1 SOD1 hSOD1 5 3.0 In Tg-hSOD1 mice immunostaining for hSOD1 was strong in the brain and no immunostaining occurred in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142732 15863242 188016 20996 11179 SOD1 SOD1 hSOD1 26 3.0 the CNS of WT indicating that labeling was specific for hSOD1 ( Jaarsma et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142738 15863242 188058 20996 11179 SOD1 SOD1 SOD1 3 2.5 Increased activity of SOD1 in hippocampus of Tg-hSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142739 15863242 188059 20996 11179 SOD1 SOD1 SOD1 2 2.5 Overexpression of SOD1 in hippocampus was evaluated by enzymatic activity using the classic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142740 15863242 188059 20996 11179 SOD1 SOD1 SOD1 21 2.5 the classic test of inhibition of nitroblue tetrazolium reduction by SOD1 and automatically assayed using a Ransod kit 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142741 15863242 188060 20996 11179 SOD1 SOD1 SOD1 1 2.5 The SOD1 activity was increased by factor 5 in blood 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142742 15863242 188061 20996 11179 SOD1 SOD1 SOD1 11 2.5 in hippocampus of 3-month-old Tg-SOD1 showed large increases in total SOD1 activity WT (2.5 2.5 _amp_#xb1 0.17 U/mg), U mg hemizygotes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142743 15863242 188061 20996 11179 SOD1 SOD1 hSOD1 19 3.0 WT (2.5 2.5 _amp_#xb1 0.17 U/mg), U mg hemizygotes (hSOD1/+, hSOD1 38.87 _amp_#xb1 2.04 U/mg) U mg and homozygotes (hSOD1/hSOD1, hSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142744 15863242 188061 20996 11179 SOD1 SOD1 hSOD1 26 3.0 hSOD1 38.87 _amp_#xb1 2.04 U/mg) U mg and homozygotes (hSOD1/hSOD1, hSOD1 hSOD1 47.79 _amp_#xb1 1.69 U/mg) U mg 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142745 15863242 188061 20996 11179 SOD1 SOD1 hSOD1 26 3.0 38.87 _amp_#xb1 2.04 U/mg) U mg and homozygotes (hSOD1/hSOD1, hSOD1 hSOD1 47.79 _amp_#xb1 1.69 U/mg) U mg 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142746 15863242 188066 20996 11179 SOD1 SOD1 hSOD1 11 3.0 large series of proteins were successfully represented and even transgenic hSOD1 was detected in 2-DE gels of Tg-hSOD1 mice ( Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142747 15863242 188079 20996 11179 SOD1 SOD1 SOD1 8 2.5 Antioxidant proteins showed no different expression except mouse SOD1 (mSOD1) mSOD1 (Unpublished Unpublished data Shin et al. 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142748 15863242 188079 20996 11179 SOD1 SOD1 mSOD1 9 1.7 Antioxidant proteins showed no different expression except mouse SOD1 (mSOD1) mSOD1 (Unpublished Unpublished data Shin et al. 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142749 15863242 188080 20996 11179 SOD1 SOD1 mSOD1 4 1.7 In addition spots of mSOD1 and hSOD1 showing high similarity ( Fig 3 (A)) A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142750 15863242 188080 20996 11179 SOD1 SOD1 hSOD1 6 3.0 In addition spots of mSOD1 and hSOD1 showing high similarity ( Fig 3 (A)) A were detected 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142751 15863242 188081 20996 11179 SOD1 SOD1 hSOD1 6 3.0 We observed that expression level of hSOD1 in hippocampus of homozygotes was significantly higher than that in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142752 15863242 188081 20996 11179 SOD1 SOD1 mSOD1 29 1.7 _amp_#xb1 1.804 versus 12.244 _amp_#xb1 2.259 P = 0.0259 while mSOD1 was significantly decreased in hippocampus of Tg-hSOD1 mice (Unpublished Unpublished 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142754 15863242 188090 20996 11179 SOD1 SOD1 SOD1-dependent 20 1.7 in hemizygous or homozygous Tg-hSOD1 mice revealing directly or indirectly SOD1-dependent alterations of several protein pathways and cascades systems that are 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142755 15863242 188092 21932 11655 TCP1 TCP1 TCP-1 4 1.3 Eight t-complex 1 proteins (TCP-1) TCP-1 were studied in DS brain the TCP-1 epsilon ( Yoo 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142756 15863242 188092 21932 11655 TCP1 TCP1 TCP-1 11 1.3 1 proteins (TCP-1) TCP-1 were studied in DS brain the TCP-1 epsilon ( Yoo et al. 2001a as well as alpha 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142757 15863242 188092 20996 11179 SOD1 SOD1 SOD1 54 2.5 the gamma subunit was here observed in hippocampus in the SOD1 overexpression animal model of DS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142758 15863242 188094 21932 11655 TCP1 TCP1 TCP-1 3 1.3 Alterations of the TCP-1 system are of particular interest as some subunits are chaperones 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142759 15863242 188099 6372 3189 EEF1A1 EF-Tu EF-Tu-like 34 2.1 of translation reflected by reduced expression of translation elongation factor EF-Tu-like protein P43 ( Table 2 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142760 15863242 188099 23430 12420 TUFM P43 P43 36 1.4 reflected by reduced expression of translation elongation factor EF-Tu-like protein P43 ( Table 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142762 15863242 188108 20996 11179 SOD1 SOD1 SOD1-mediated 22 2.0 catalyzing covalent attachment of ubiquitin to other proteins may reflect SOD1-mediated impaired protein handling in terms of ubiquitination 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142763 15863242 188114 20996 11179 SOD1 SOD1 SOD1 9 2.5 Multiple protein derangement may directly or indirectly depend on SOD1 overexpression impairment of translation (translation translation elongation or simply reflect 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142764 15863242 188123 20996 11179 SOD1 SOD1 mSOD1 2 1.7 Spots of mSOD1 and hSOD1 were demonstrated in hippocampus of Tg-hSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142765 15863242 188123 20996 11179 SOD1 SOD1 hSOD1 4 3.0 Spots of mSOD1 and hSOD1 were demonstrated in hippocampus of Tg-hSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142766 15863242 188124 20996 11179 SOD1 SOD1 hSOD1 3 3.0 Fig 3._amp_#xa0 Comparison of hSOD1 with mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142767 15863242 188124 20996 11179 SOD1 SOD1 mSOD1 5 1.7 Fig 3._amp_#xa0 Comparison of hSOD1 with mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142768 15863242 188125 20996 11179 SOD1 SOD1 hSOD1 3 3.0 (A) A Alignment of hSOD1 (P00441) P00441 with mSOD1 ( P08228 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142769 15863242 188125 20996 11179 SOD1 SOD1 mSOD1 6 1.7 (A) A Alignment of hSOD1 (P00441) P00441 with mSOD1 ( P08228 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142770 15863242 188127 20996 11179 SOD1 SOD1 hSOD1 7 3.0 This sequence alignment with CLUSTALW showed that hSOD1 has high similarity to mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142771 15863242 188127 20996 11179 SOD1 SOD1 mSOD1 12 1.7 alignment with CLUSTALW showed that hSOD1 has high similarity to mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142772 15863242 188128 20996 11179 SOD1 SOD1 mSOD1 3 1.7 MALDI-TOF spectrum of mSOD1 (B) B and hSOD1 (C) C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142773 15863242 188128 20996 11179 SOD1 SOD1 hSOD1 6 3.0 MALDI-TOF spectrum of mSOD1 (B) B and hSOD1 (C) C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144555 15896810 189879 7975 3951 FXN FRDA FRDA 18 4.3 neurodegenerative diseases including Parkinson's disease Alzheimer's disease Friedreich's ataxia (FRDA), FRDA multiple sclerosis and amyotrophic lateral sclerosis may involve the generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144558 15896810 189882 7975 3951 FXN FRDA FRDA 6 4.3 The precise sequence of events in FRDA pathogenesis is uncertain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144559 15896810 189884 7975 3951 FXN FRDA FRDA 29 4.3 addition that decreased expression of frataxin protein is associated with FRDA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144561 15896810 189885 7975 3951 FXN FRDA FRDA 7 4.3 Many approaches have been undertaken to understand FRDA but the heterogeneity of the etiologic factors makes it difficult 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144562 15896810 189886 7975 3951 FXN FRDA FRDA 24 4.3 and their interaction in a vicious cycle are central to FRDA pathogenesis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144563 15896810 189887 7975 3951 FXN FRDA FRDA 2 4.3 Brains of FRDA patients undergo many changes such as disruption of protein synthesis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144564 15896810 189889 9691 5232 HSPA1A HSP HSP 8 3.4 In the central nervous system heat shock protein (HSP) HSP synthesis is induced not only after hyperthermia but also following 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144566 15896810 189890 7975 3951 FXN FRDA FRDA 21 4.3 ALS multiple sclerosis (MS), MS Huntington's disease (HD) HD and FRDA are all associated with the presence of abnormal proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144567 15896810 189891 9691 5232 HSPA1A HSP HSPs 3 3.7 Among the various HSPs HSP32 also known as heme oxygenase I (HO-1), HO-1 has 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144568 15896810 189891 9462 5013 HMOX1 HO-1 HO-1 11 2.9 various HSPs HSP32 also known as heme oxygenase I (HO-1), HO-1 has received considerable attention as it has been recently demonstrated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144569 15896810 189891 9462 5013 HMOX1 HO-1 HO-1 23 2.9 received considerable attention as it has been recently demonstrated that HO-1 induction by generating the vasoactive molecule carbon monoxide and the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144571 15896810 189897 7975 3951 FXN FRDA FRDA 18 4.3 neurodegenerative diseases including Alzheimer's and Parkinson's diseases ALS MS and FRDA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144572 15896810 189901 10824 6204 JUN AP-1 AP-1 25 1.8 and/or and or DNA binding of numerous transcription factors including AP-1 fos jun myc erg-1 SAPK and NFkB 3 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.000551219090590182<>ScoreDetail__3796|FOS|0.000471461547043793__3797|FOSB|0.000441056650528258__6205|JUNB|0.000443975420090924__6204|JUN|0.000551219090590182__6206|JUND|0.000488816935939566__ 0 0 0 0 0 144573 15896810 189901 13925 7553 MYC MYC myc 28 0.3 DNA binding of numerous transcription factors including AP-1 fos jun myc erg-1 SAPK and NFkB 3 14 JUMiner_v2.2 1 0 0 2 7869 TotalCon:2<>7553|MYC|4609|Complete__7869|NOL3|8996|Complete__<>AvaiableGeneRif=2<>BEST:7869|NOL3|0.000550074040109986<>ScoreDetail__7553|MYC|0.000539740047168336__7869|NOL3|0.000550074040109986__ 0 0 0 0 0 144574 15896810 189901 12354 6886 MAPK9 SAPK SAPK 30 1.3 of numerous transcription factors including AP-1 fos jun myc erg-1 SAPK and NFkB 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144575 15896810 189901 14352 7794 NFKB1 NFKB NFkB 32 0.3 transcription factors including AP-1 fos jun myc erg-1 SAPK and NFkB 3 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144576 15896810 189905 9691 5232 HSPA1A HSP HSP 9 3.4 the central nervous system (CNS), CNS heat shock protein (HSP) HSP synthesis is induced not only after hyperthermia but also following 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144577 15896810 189906 9691 5232 HSPA1A HSP HSP 18 3.4 is harmful and can lead to cell death induction of HSP synthesis can result in stress tolerance and cytoprotection in a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144578 15896810 189908 1576 990 BCL2 Bcl-2 Bcl-2 23 1.0 as increased expression of heat shock proteins antioxidant enzymes and Bcl-2 may be triggered to withstand all the above mentioned pathogenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144579 15896810 189911 7975 3951 FXN FRDA FRDA 20 4.3 may play an essential role in neurodegenerative diseases such as FRDA 9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144580 15896810 189915 7975 3951 FXN FRDA FRDA 6 4.3 The precise sequence of events in FRDA pathogenesis is uncertain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144581 15896810 189917 7975 3951 FXN FRDA FRDA 33 4.3 addition that decreased expression of frataxin protein is associated with FRDA 11 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144583 15896810 189919 7975 3951 FXN FRDA FRDA 35 4.3 the oxidative stress hypothesis which may underlie the pathogenesis of FRDA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144584 15896810 189924 7975 3951 FXN FRDA FRDA 0 4.3 FRDA is an autosomal recessive degenerative disorder characterized by progressive gait 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144585 15896810 189925 7975 3951 FXN FRDA FRDA 2 4.3 Neuropathology in FRDA is characterized by early degeneration of large sensory neurons in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144586 15896810 189926 7975 3951 FXN FRDA FRDA 7 4.3 Hypertrophic cardiomyopathy is present in large proportion FRDA patients 12 and 13 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144587 15896810 189927 7975 3951 FXN FRDA FRDA 4 4.3 The causative mutation of FRDA is an abnormally expanded GAA triplet repeat in the first 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144589 15896810 189927 7975 3951 FXN FRDA FRDA 18 4.3 expanded GAA triplet repeat in the first intron of the FRDA gene on chromosome 9q13 14 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144590 15896810 189928 7975 3951 FXN FRDA FRDA 3 4.3 Ninety-eight percent of FRDA patients are homozygous for the GAA expansion the remainder carrying 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144592 15896810 189928 7975 3951 FXN FRDA FRDA 19 4.3 GAA expansion the remainder carrying a repeat expansion in one FRDA allele and a point mutation in the other 12 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144594 15896810 189929 7975 3951 FXN FRDA FRDA 7 4.3 The size of the GAA expansion in FRDA patients ranges from about 100 repeats to 1700 12 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144595 15896810 189930 7975 3951 FXN FRDA FRDA 8 4.3 The expression of a number of symptoms/signs symptoms signs in FRDA is dependent upon the length of the GAA repeat expansion 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144599 15896810 189933 7975 3951 FXN FRDA FRDA 3 4.3 Mutations in the FRDA gene either GAA expansions or point mutations result in reduced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144601 15896810 189934 7975 3951 FXN FRDA FRDA 10 4.3 In normal subjects the highest level of expression of the FRDA gene has been found in the heart and spinal cord 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144602 15896810 189935 7975 3951 FXN FRDA FRDA 10 4.3 The amount of residual frataxin in lymphoblastoid cell lines from FRDA patients correlates with the GAA expansion size in the smaller 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144608 15896810 189942 166 118 ACO2 aconitase aconitase 17 1.6 mitochondrial respiratory chain complexes I and II/III II III and aconitase activities have been demonstrated in post-mortem cardiac muscle samples from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144609 15896810 189942 7975 3951 FXN FRDA FRDA 30 4.3 been demonstrated in post-mortem cardiac muscle samples from patients with FRDA associated with reduced levels of mitochondrial DNA and with increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144612 15896810 189946 20997 11180 SOD2 MnSOD MnSOD 6 1.9 Up-regulation of protein manganese superoxide dismutase (MnSOD) MnSOD fails to occur in FRDA fibroblasts exposed to iron 25 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144613 15896810 189946 7975 3951 FXN FRDA FRDA 11 4.3 protein manganese superoxide dismutase (MnSOD) MnSOD fails to occur in FRDA fibroblasts exposed to iron 25 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144614 15896810 189947 14352 7794 NFKB1 NFKB NFkB 13 0.3 with the observation of absent activation of the redox-sensitive factor NFkB suggest that a NFkB-independent pathway that may not require free 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144615 15896810 189947 14352 7794 NFKB1 NFKB NFkB-independent 17 0.3 absent activation of the redox-sensitive factor NFkB suggest that a NFkB-independent pathway that may not require free radical signaling is responsible 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144616 15896810 189947 20997 11180 SOD2 MnSOD MnSOD 33 1.9 free radical signaling is responsible for the reduced induction of MnSOD 26 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144618 15896810 189955 7975 3951 FXN FRDA FRDA 9 4.3 Cardiac and skeletal muscle bioenergetics was investigated directly in FRDA patients using in vivo 31 P-MRS 41 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144620 15896810 189960 7975 3951 FXN FRDA FRDA 7 4.3 Cardiac bioenergetics was assessed in vivo in FRDA patients with and without left ventricular hypertrophy 43 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144621 15896810 189961 7975 3951 FXN FRDA FRDA 7 4.3 Cardiac PCr to ATP ratios in the FRDA group as a whole were reduced by about 40% 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144622 15896810 189962 7975 3951 FXN FRDA FRDA 13 4.3 were significantly reduced compared to controls in both groups of FRDA patients with normal and hypertrophic heart 43 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144623 15896810 189964 7975 3951 FXN FRDA FRDA 1 4.3 In FRDA the hypertrophic process may be compensatory and caused or contributed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144624 15896810 189966 7975 3951 FXN FRDA FRDA 19 4.3 have shown a reduced rate of mitochondrial ATP synthesis in FRDA patients 46 and 47 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144625 15896810 189968 7975 3951 FXN FRDA FRDA 7 4.3 Mitochondrial V max for ATP production in FRDA patients was also significantly lower than in a group of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144626 15896810 189968 7975 3951 FXN FRDA FRDA 48 4.3 se did not account for the reduced mitochondrial function in FRDA patients 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144631 15896810 189973 7975 3951 FXN FRDA FRDA 26 4.3 utilization of oxygen in response to exercise showed in several FRDA patients features related to inadequate oxygen utilization by muscle 48 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144633 15896810 190044 14533 7872 NOS1 NOS NOS 7 2.7 Accordingly as cytokines promote the induction of NOS in brain a possible role for a glial-derived NO_amp_#xb7 in 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144634 15896810 190045 14533 7872 NOS1 NOS NOS 21 2.7 study in which NADPH diaphorase (a a cytochemical marker of NOS activity positive glial cells have been identified in the substantia 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144635 15896810 190048 14533 7872 NOS1 nNOS nNOS 14 2.7 this it has been reported that the selective inhibition of nNOS prevents 1-methyl-4-phenyl-1 2 3 6-tetrahydropyridine (MPTP)-induced MPTP -induced Parkinsonism in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144636 15896810 190050 14533 7872 NOS1 NOS NOS 2 2.7 Role of NOS and NO in brain pathophysiology 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144637 15896810 190054 14533 7872 NOS1 NOS NOS 11 2.7 responsible for NO synthesis is the nitric oxide synthase (NOS) NOS family of enzymes which catalyse the conversion of arginine to 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144638 15896810 190055 14533 7872 NOS1 NOS NOS 0 2.7 NOS localized in the CNS and in the periphery 91 is 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144639 15896810 190055 14533 7872 NOS1 NOS NOS 20 2.7 is present in three well characterized isoforms (a) a neuronal NOS (nNOS, nNOS type I (b) b endothelial NOS (eNOS; eNOS 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144640 15896810 190055 14533 7872 NOS1 nNOS nNOS 21 2.7 in three well characterized isoforms (a) a neuronal NOS (nNOS, nNOS type I (b) b endothelial NOS (eNOS; eNOS type III 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144641 15896810 190055 14533 7872 NOS1 NOS NOS 26 2.7 a neuronal NOS (nNOS, nNOS type I (b) b endothelial NOS (eNOS; eNOS type III and (c) c inducible NOS (iNOS, 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144642 15896810 190055 14538 7876 NOS3 eNOS eNOS 27 2.2 NOS (nNOS, nNOS type I (b) b endothelial NOS (eNOS; eNOS type III and (c) c inducible NOS (iNOS, iNOS type 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144643 15896810 190055 14533 7872 NOS1 NOS NOS 33 2.7 endothelial NOS (eNOS; eNOS type III and (c) c inducible NOS (iNOS, iNOS type II 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144644 15896810 190055 14535 7873 NOS2A iNOS iNOS 34 2.7 (eNOS; eNOS type III and (c) c inducible NOS (iNOS, iNOS type II 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144645 15896810 190056 14533 7872 NOS1 NOS NOS 5 2.7 Activation of different isoforms of NOS requires various factors and co-factors 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144646 15896810 190057 14533 7872 NOS1 NOS NOS 13 2.7 complexes is a prerequisite before the functional active dimer exhibits NOS activity which depends also on cofactors such as tetrahydrobiopterin (BH 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.00100561390883972<>ScoreDetail__7873|NOS2A|0.000992779045329277__7872|NOS1|0.00100561390883972__ 0 0 0 0 0 144648 15896810 190057 7638 3768 FMN1 FMN FMN 27 0.2 also on cofactors such as tetrahydrobiopterin (BH BH 4 FAD FMN and NADPH 92 5 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144649 15896810 190058 14533 7872 NOS1 nNOS nNOS 3 2.7 In contrast to nNOS and eNOS iNOS can bind to calmodulin even at very 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144650 15896810 190058 14538 7876 NOS3 eNOS eNOS 5 2.2 In contrast to nNOS and eNOS iNOS can bind to calmodulin even at very low concentration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144651 15896810 190058 14535 7873 NOS2A iNOS iNOS 6 2.7 In contrast to nNOS and eNOS iNOS can bind to calmodulin even at very low concentration of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144652 15896810 190058 14535 7873 NOS2A iNOS iNOS 20 2.7 calmodulin even at very low concentration of intracellular calcium thus iNOS can exert its activity in a calcium-independent manner 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144653 15896810 190059 14535 7873 NOS2A iNOS iNOS 3 2.7 The levels of iNOS in the CNS are generally fairly low 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144654 15896810 190060 14535 7873 NOS2A iNOS iNOS 5 2.7 However an increased expression of iNOS in astrocytes and microglia occurs following viral infection and trauma 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144655 15896810 190061 14535 7873 NOS2A iNOS iNOS 2 2.7 Activation of iNOS requires gene transcription and the induction can be influenced by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144657 15896810 190066 20996 11179 SOD1 SOD SOD 15 1.4 three times faster than the rate of superoxide dismutase (SOD) SOD in catalyzing the dismutation of the superoxide anion to hydrogen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144658 15896810 190067 20996 11179 SOD1 SOD SOD 10 1.4 Therefore when present at appropriate concentrations NO effectively competes with SOD for O 2 _amp_#x2212 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144659 15896810 190074 8118 4141 GAPDH GAPDH GAPDH 12 1.6 demonstrated to stimulate the auto-ADP ribosylation of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) GAPDH by reacting with a critical cysteine with resulting binding of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144660 15896810 190074 8118 4141 GAPDH GAPDH GAPDH 30 1.6 resulting binding of NAD to the catalytic cysteine inhibition of GAPDH activity and depression of glycolysis 104 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144661 15896810 190078 9038 4827 HBB hemoglobin hemoglobin 11 1.0 Other heme protein targets for NO are catalase cytochrome c hemoglobin and peroxidase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144662 15896810 190079 166 118 ACO2 aconitase aconitase 18 1.6 sulfur cluster present in numerous enzymes including NADH-ubiquinone oxidoreductase cis -aconitase and NADH succinate oxidoreductase 108 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144663 15896810 190082 166 118 ACO2 aconitase aconitase 14 1.6 iron metabolism at the post-transcriptional level by interacting with cytosolic aconitase which after binding NO functions as iron responsive binding protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144664 15896810 190082 166 118 ACO2 aconitase aconitase 27 1.6 binding NO functions as iron responsive binding protein diminishing its aconitase activity 109 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144665 15896810 190104 926 620 APP amyloid amyloid 5 1.0 Accordingly the recent finding that _amp_#x3b2 -amyloid fragment 25_amp_#x2013 35 selectively decreases complex IV activity in isolated 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 144672 15896810 190130 7975 3951 FXN FRDA FRDA 39 4.3 glutathione bound to haemoglobin in erythrocytes have been demonstrated in FRDA patients 128 also associated with a significant elevation in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144673 15896810 190136 9691 5232 HSPA1A HSP HSP 3 3.4 In mammalian cells HSP synthesis is induced not only after hyperthermia but also following 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144674 15896810 190137 9691 5232 HSPA1A HSP HSP 18 3.4 is harmful and can lead to cell death induction of HSP synthesis can result in stress tolerance and cytoprotection against stress-induced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144675 15896810 190142 9691 5232 HSPA1A HSP HSPs 4 3.7 Some of the known HSPs include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144676 15896810 190142 9726 5269 HSPE1 HSP10 HSP10 7 1.9 Some of the known HSPs include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144677 15896810 190142 9708 5247 HSPB2 HSP27 HSP27 8 1.9 Some of the known HSPs include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or 1 JUMiner_v2.2 1 0 0 2 5246 TotalCon:2<>5246|HSPB1|3315|Complete__5247|HSPB2|3316|Complete__<>AvaiableGeneRif=2<>BEST:5246|HSPB1|0.000727030772142085<>ScoreDetail__5246|HSPB1|0.000727030772142085__5247|HSPB2|0.000567495945077214__ 0 0 0 0 0 144678 15896810 190142 9462 5013 HMOX1 HO-1 HO-1 11 2.9 the known HSPs include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or HSP72 HSP90 and HSP100/105 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144679 15896810 190142 19730 1546 SERPINH1 HSP47 HSP47 12 1.3 known HSPs include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or HSP72 HSP90 and HSP100/105 HSP100 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144680 15896810 190142 9718 5261 HSPD1 HSP60 HSP60 13 1.9 HSPs include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or HSP72 HSP90 and HSP100/105 HSP100 105 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144681 15896810 190142 9700 5241 HSPA8 HSC70 HSC70 14 1.9 include ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or HSP72 HSP90 and HSP100/105 HSP100 105 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144682 15896810 190142 9691 5232 HSPA1A HSP70 HSP70 15 5.5 ubiquitin HSP10 HSP27 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or HSP72 HSP90 and HSP100/105 HSP100 105 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144683 15896810 190142 9691 5232 HSPA1A HSP72 HSP72 17 3.4 HSP32 (or or HO-1 HSP47 HSP60 HSC70 HSP70 (or or HSP72 HSP90 and HSP100/105 HSP100 105 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144684 15896810 190144 9691 5232 HSPA1A HSP70 HSP70 0 5.5 HSP70 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144685 15896810 190146 9700 5241 HSPA8 HSC70 HSC70 5 1.9 Included in this family are HSC70 (heat heat shock cognate the constitutive form HSP70 (the the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144686 15896810 190146 9691 5232 HSPA1A HSP70 HSP70 12 5.5 family are HSC70 (heat heat shock cognate the constitutive form HSP70 (the the inducible form also referred to as HSP72 GRP75 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144687 15896810 190146 9691 5232 HSPA1A HSP72 HSP72 20 3.4 form HSP70 (the the inducible form also referred to as HSP72 GRP75 (a a constitutively expressed glucose-regulated protein found in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144688 15896810 190146 9701 5244 HSPA9 GRP75 GRP75 21 2.2 HSP70 (the the inducible form also referred to as HSP72 GRP75 (a a constitutively expressed glucose-regulated protein found in the endoplasmic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144689 15896810 190147 9691 5232 HSPA1A HSP70 HSP70 9 5.5 After a variety of central nervous system (CNS) CNS insults HSP70 is synthesized at high levels and is present in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144691 15896810 190149 9691 5232 HSPA1A HSP HSPs 14 3.7 shock factors (HSFs) HSFs within the cytosol by dissociating other HSPs that are normally bound to HSF 132 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144695 15896810 190150 9691 5232 HSPA1A HSP HSPs 32 3.7 different heat shock genes leading to transcription and synthesis of HSPs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144696 15896810 190151 9691 5232 HSPA1A HSP70 HSP70 8 5.5 After heat shock for instance the synthesis of HSP70 increases to a point to where it becomes the most 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144697 15896810 190152 9691 5232 HSPA1A HSP70 HSP70 2 5.5 Once synthesized HSP70 binds to denaturated proteins in an ATP-dependent manner 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144698 15896810 190155 9691 5232 HSPA1A HSP HSPs 4 3.7 In the nervous system HSPs are induced in a variety of pathological conditions including cerebral 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144699 15896810 190156 9691 5232 HSPA1A HSP HSPs 5 3.7 Expression of the gene encoding HSPs has been found in various cell populations within the nervous 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144700 15896810 190157 9691 5232 HSPA1A HSP HSPs 0 3.7 HSPs consist of both stress-inducible and constitutive family members 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144701 15896810 190159 9691 5232 HSPA1A HSP70 HSP70 20 5.5 gene transfer has become possible to overexpress the gene encoding HSP70 to test directly the hypothesis that stress proteins protects cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144702 15896810 190159 9691 5232 HSPA1A HSP70 HSP70 41 5.5 from injury and it has been demonstrated that overproduction of HSP70 leads to protection in several different models of nervous system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144703 15896810 190160 9691 5232 HSPA1A HSP70 HSP70 6 5.5 Following focal cerebral ischemia mRNA encoding HSP70 is synthesized in most ischemic cells except in areas of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144704 15896810 190161 9691 5232 HSPA1A HSP70 HSP70 0 5.5 HSP70 proteins is produced mainly in endothelial cells in the core 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144705 15896810 190162 9691 5232 HSPA1A HSP70 HSP70 9 5.5 It has been suggested that this neuronal expression of HSP70 outside an infarct can be used to define the ischemic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144706 15896810 190163 9691 5232 HSPA1A HSP HSP 12 3.4 of in vitro studies show that both heat shock and HSP overproduction protect CNS cells against both necrosis and apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144707 15896810 190165 9691 5232 HSPA1A HSP70 HSP70 5 5.5 Transfection of cultured astrocytes with HSP70 protects them from ischemia or glucose deprivation 140 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144708 15896810 190166 9691 5232 HSPA1A HSP70 HSP70 0 5.5 HSP70 has been demonstrated to inhibit caspase-3 activation caused by ceramide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144709 15896810 190166 10824 6204 JUN JUN JUN 14 1.8 to inhibit caspase-3 activation caused by ceramide and also affect JUN kinase and p38-kinase activation 141 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144710 15896810 190166 12359 6876 MAPK14 p38 p38-kinase 17 0.3 activation caused by ceramide and also affect JUN kinase and p38-kinase activation 141 11 JUMiner_v2.2 1 0 0 2 6878 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6878|MAPK4|0.000678050449441697<>ScoreDetail__1189|AHSA1|0.000428187822048044__6878|MAPK4|0.000678050449441697__6871|MAPK1|0.000563140228061107__6876|MAPK14|0.000537517353429365__ 0 0 0 0 0 144711 15896810 190167 9691 5232 HSPA1A HSP70 HSP70 2 5.5 In addition HSP70 binds to and modulates the function of BAG-1 the bcl-2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144713 15896810 190168 9691 5232 HSPA1A HSP HSP 17 3.4 between mechanisms of oxidative and/or and or nitrosative stress and HSP induction 143 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144714 15896810 190169 14352 7794 NFKB1 NFKB NFkB 19 0.3 shock response can exert its protective effects through inhibition of NFkB signaling pathway 132 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144715 15896810 190170 9691 5232 HSPA1A HSP70 Hsp70 18 5.5 cytokine-induced nitrosative stress is associated with an increased synthesis of Hsp70 stress proteins 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144716 15896810 190171 9691 5232 HSPA1A HSP70 Hsp70 2 5.5 Increase in Hsp70 protein expression was also found after treatment of cells with 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144717 15896810 190171 9691 5232 HSPA1A hsp70 hsp70 28 5.5 (SNP), SNP thus suggesting a role for NO in inducing hsp70 proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144718 15896810 190173 9691 5232 HSPA1A HSP HSPs 6 3.7 Ubiquitin is one of the smallest HSPs and is expressed throughout brain in response to ischemia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144719 15896810 190174 14352 7794 NFKB1 NFKB NFKB 14 0.3 targeting and chaperoning of proteins degraded in proteasomes which include NFKB cyclins HSFs hypoxia-inducible factor some apoptosis-related proteins tumor necrosis factor 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144721 15896810 190175 9708 5247 HSPB2 HSP27 HSP27 0 1.9 HSP27 is synthesized mainly in astrocytes in response to ischemic situations 1 JUMiner_v2.2 1 0 0 2 5246 TotalCon:2<>5246|HSPB1|3315|Complete__5247|HSPB2|3316|Complete__<>AvaiableGeneRif=2<>BEST:5246|HSPB1|0.000727030772142085<>ScoreDetail__5246|HSPB1|0.000727030772142085__5247|HSPB2|0.000567495945077214__ 0 0 0 0 0 144722 15896810 190177 22551 11892 TNF TNF TNF 6 1.2 It also protects against Fas-Apo-1 staurosporine TNF and etoposside-induced apoptotic cell death as well as H 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144723 15896810 190178 19730 1546 SERPINH1 HSP47 HSP47 0 1.3 HSP47 is synthesized mainly in microglia following cerebral ischemia and subarachnoid 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144724 15896810 190179 9718 5261 HSPD1 HSP60 HSP60 0 1.9 HSP60 glucose-regulated protein 75 (GRP75) GRP75 and HSP10 chaperone proteins within 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144725 15896810 190179 9701 5244 HSPA9 GRP75 GRP75 4 2.2 HSP60 glucose-regulated protein 75 (GRP75) GRP75 and HSP10 chaperone proteins within mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144726 15896810 190179 9726 5269 HSPE1 HSP10 HSP10 6 1.9 HSP60 glucose-regulated protein 75 (GRP75) GRP75 and HSP10 chaperone proteins within mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144727 15896810 190180 9701 5244 HSPA9 GRP75 GRP75 0 2.2 GRP75 and GRP78 also called oxygen-regulated proteins (ORPs) ORPs are produced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144728 15896810 190180 9697 5238 HSPA5 GRP78 GRP78 0 1.9 GRP75 and GRP78 also called oxygen-regulated proteins (ORPs) ORPs are produced 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144729 15896810 190180 9697 5238 HSPA5 GRP78 GRP78 2 1.9 GRP75 and GRP78 also called oxygen-regulated proteins (ORPs) ORPs are produced by low 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144730 15896810 190183 9462 5013 HMOX1 HO-1 HO-1 7 2.9 There are three isoforms of heme oxygenase HO-1 or inducible isoform HO-2 or constitutive isoform and the recently 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144731 15896810 190183 9463 5014 HMOX2 HO-2 HO-2 11 1.9 are three isoforms of heme oxygenase HO-1 or inducible isoform HO-2 or constitutive isoform and the recently discovered HO-3 149 150 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144732 15896810 190183 9027 4817 HARS2 HO3 HO-3 19 0.3 inducible isoform HO-2 or constitutive isoform and the recently discovered HO-3 149 150 151 152 153 and 154 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144733 15896810 190187 9462 5013 HMOX1 HO-1 HO-1 4 2.9 The iron released by HO-1 is bound by ferritin perhaps via a HO-1 chaperone function 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144734 15896810 190187 9462 5013 HMOX1 HO-1 HO-1 12 2.9 released by HO-1 is bound by ferritin perhaps via a HO-1 chaperone function 155 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144735 15896810 190189 9462 5013 HMOX1 HO-1 HO-1 5 2.9 Increasing evidence suggests that the HO-1 gene is redox regulated and contains in its promoter region 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144736 15896810 190190 926 620 APP amyloid amyloid 13 1.0 of heat shock proteins is closely related to that of amyloid precursor protein (APP), APP heat-shock proteins have been studied in 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 144737 15896810 190190 926 620 APP APP APP 16 0.3 is closely related to that of amyloid precursor protein (APP), APP heat-shock proteins have been studied in brains of patients with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144738 15896810 190191 9462 5013 HMOX1 HO-1 HO-1 6 2.9 Significant increases in the levels of HO-1 have been observed in AD brains in association with neurofibrillary 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144739 15896810 190191 9462 5013 HMOX1 HO-1 HO-1 21 2.9 in AD brains in association with neurofibrillary tangles 157 and HO-1 mRNA was found to be increased in AD neocortex and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144740 15896810 190192 9462 5013 HMOX1 HO-1 HO-1 0 2.9 HO-1 increase was not only in association with neurofibrillary tangles but 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144741 15896810 190193 9462 5013 HMOX1 HO-1 HO-1 8 2.9 It is conceivable that the dramatic increase in HO-1 in AD may be a direct response to increased free 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144742 15896810 190203 14352 7794 NFKB1 NFKB NFkB 15 0.3 cell line it has recently been shown that curcumin inhibits NFkB activation effectively preventing neuronal cell death 159 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144743 15896810 190204 9462 5013 HMOX1 HO-1 HO-1 12 2.9 evidence has demonstrated that curcumin is a potent inducer of HO-1 in vascular endothelial cells 7 and 167 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144745 15896810 190205 9462 5013 HMOX1 HO-1 HO-1 24 2.9 (CAPE), CAPE an active component of propolis as a novel HO-1 inducer 162 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144748 15896810 190211 7975 3951 FXN FRDA FRDA 3 4.3 Therapy advances in FRDA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144749 15896810 190212 7975 3951 FXN FRDA FRDA 6 4.3 The precise sequence of events in FRDA pathogenesis is uncertain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144750 15896810 190215 7975 3951 FXN FRDA FRDA 0 4.3 FRDA offers a unique opportunity to intervene with _amp_#x201c neuroprotective_amp_#x201d therapy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144751 15896810 190216 7975 3951 FXN FRDA FRDA 33 4.3 in the presence of advanced disease and established pathogenetic mechanisms FRDA patients can be diagnosed by genetic analysis either presymptomatically or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144752 15896810 190217 7975 3951 FXN FRDA FRDA 12 4.3 free radical production and deficit of oxidative phosphorylation shown in FRDA suggests that the mitochondrial respiration deficit may be amenable to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144753 15896810 190218 7975 3951 FXN FRDA FRDA 1 4.3 Three FRDA patients were treated for 4 to 9 months with idebenone 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144754 15896810 190220 7975 3951 FXN FRDA FRDA 27 4.3 equal or more than 20% in 17 out of 38 FRDA patients 173 and by two more recent idebenone trials 174 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144755 15896810 190221 7975 3951 FXN FRDA FRDA 13 4.3 daily also resulted in decreased markers of oxidative stress in FRDA patients 176 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144756 15896810 190222 7975 3951 FXN FRDA FRDA 37 4.3 hypertrophy (LVH) LVH and ataxia has been evaluated in ten FRDA patients 177 After 6 months of therapy cardiac PCr to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144757 15896810 190225 7975 3951 FXN FRDA FRDA 0 4.3 FRDA patients assessed neurologically using the semi-quantitative International Cooperative Ataxia Rating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144758 15896810 190227 4772 26515 COQ10A Q10 Q10 14 1.2 the efficacy of mitochondria-targeted and untargeted antioxidants derived from coenzyme Q10 and from vitamin E at preventing cell death due to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144759 15896810 190227 7975 3951 FXN FRDA FRDA 36 4.3 oxidative stress has been recently investigated in cultured fibroblasts from FRDA patients in which glutathione synthesis have been blocked 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144760 15896810 190231 7975 3951 FXN FRDA FRDA 7 4.3 Targeted antioxidants may have therapeutic potential in FRDA and in other disorders involving mitochondrial oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144761 15896810 190237 7975 3951 FXN FRDA FRDA 6 4.3 Given the physiopathological mechanisms responsible for FRDA selenium administration could represent another therapy strategy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144762 15896810 190244 7975 3951 FXN FRDA FRDA 33 4.3 address the toxicity of GPX mimetics in humans before human FRDA trials can be considered 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144763 15896810 190246 7975 3951 FXN FRDA FRDA 18 4.3 screening of compounds that have potential in the treatment of FRDA 183 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144764 15896810 190249 7975 3951 FXN FRDA FRDA 8 4.3 Since the discovery of the genetic basis of FRDA only few years ago the progress made in our understanding 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144765 15896810 190249 7975 3951 FXN FRDA FRDA 24 4.3 progress made in our understanding of the pathogenic mechanisms underlying FRDA has been remarkable 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144766 15896810 190250 7975 3951 FXN FRDA FRDA 11 4.3 the precise function of frataxin still remains to be defined FRDA has clearly been identified as a nuclear encoded mitochondrial disorder 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144767 15896810 190251 7975 3951 FXN FRDA FRDA 39 4.3 randomised trials which will confirm whether an early diagnosis of FRDA can be exploited to initiate antioxidant treatment and prevent the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 147177 15964487 194016 7333 11920 FAS FAS Fas-ligand 24 0.3 pathways initiated by several apoptotic stimuli including receptor activation by Fas-ligand ( Kavurma and Khachigian 2003 or glutamate ( Stout et 11 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000396558866669676<>ScoreDetail__11920|FAS|0.000396558866669676__3594|FASN|0.000367853204232248__ 0 0 0 0 0 147181 15964487 194023 20996 11179 SOD1 SOD1 SOD1 10 1.4 its administration in mice expressing a mutant superoxide dismutase (SOD1(G37R)) SOD1 G37R at late presymptomatic stage delayed the onset of motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 147182 15964487 194023 20996 11179 SOD1 SOD1 SOD1 31 1.4 and muscle strength decline and increased the longevity of SOD1(G37R) SOD1 G37R mice ( Kriz et al. 2002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 147183 15964487 194028 14535 7873 NOS2A iNOS iNOS 24 2.2 expression of cycloxygenase-2 caspase-1 and inducible nitric oxide synthase (iNOS) iNOS mRNA have been described ( Chen et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 147196 15964487 194170 14535 7873 NOS2A iNOS iNOS 20 2.2 death by other mechanisms such as inhibition of methaloproteases or iNOS expression ( Chen et al 2000 and Sadowski and Steinmeyer 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136104 16026864 180216 20996 11179 SOD1 SOD1 SOD1 27 2.2 induced by mutations in the enzyme superoxide dismutase 1 (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136111 16026864 180224 8790 4572 GRIA2 GLUR2 GluR2 25 1.3 of highly Ca 2 -permeable AMPA receptors which lack the GluR2 unit 4 14 15 and 16 a high neurofilament content 14 JUMiner_v2.2 1 0 0 2 4594 TotalCon:2<>4572|GRIA2|2891|Complete__4594|GRM2|2912|Complete__<>AvaiableGeneRif=2<>BEST:4594|GRM2|0.000802375888497567<>ScoreDetail__4594|GRM2|0.000802375888497567__4572|GRIA2|0.000640558482989497__ 0 0 0 0 0 136119 16026864 180239 20017 10940 SLC1A2 EAAT2 EAAT2 22 1.0 can be caused by oxidative damage to the glutamate transporter EAAT2 or by aberrant RNA processing 22 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136122 16026864 180242 20996 11179 SOD1 SOD1 SOD1 10 2.2 For the well-studied familial form of ALS induced by mutant SOD1 the involvement of Ca 2 has been demonstrated in cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136123 16026864 180243 20996 11179 SOD1 SOD1 SOD1 20 2.2 given by the inhibition of glial glutamate transport by mutant SOD1 and the consecutive disturbance of Ca 2 homeostasis by excitotoxic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136125 16026864 180244 20996 11179 SOD1 SOD1 SOD1-related 16 2.2 the importance of Ca 2 -permeable AMPA receptors in mutant SOD1-related ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136127 16026864 180245 20996 11179 SOD1 SOD1 SOD1 27 2.2 Ca 2 -permeable AMPA receptors and survival times of transgenic SOD1 mice were significantly increased following chronic treatment with AMPA receptor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136128 16026864 180246 20996 11179 SOD1 SOD1 SOD1 33 2.2 addition to glutamate receptors in mediating the toxicity of mutant SOD1 in motoneurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136129 16026864 180247 20996 11179 SOD1 SOD1 SOD1 17 2.2 -permeable AMPA receptors was further underlined by cross-breeding of transgenic SOD1 mice with mice that showed markedly reduced Ca 2 permeability 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136130 16026864 180247 8790 4572 GRIA2 GLUR2 GluR2 33 1.3 Ca 2 permeability of AMPA/kainate AMPA kainate receptors due to GluR2 overexpression 14 JUMiner_v2.2 1 0 0 2 4594 TotalCon:2<>4572|GRIA2|2891|Complete__4594|GRM2|2912|Complete__<>AvaiableGeneRif=2<>BEST:4594|GRM2|0.000802375888497567<>ScoreDetail__4594|GRM2|0.000802375888497567__4572|GRIA2|0.000640558482989497__ 0 0 0 0 0 136143 16026864 180263 20996 11179 SOD1 SOD1 SOD1 3 2.2 Aggregates containing mutant SOD1 have been found within the mitochondrial matrix 42 43 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136144 16026864 180264 20996 11179 SOD1 SOD1 SOD1 8 2.2 Most interestingly recent work provided evidence that mutant SOD1 might disrupt association of complex IV (cytochrome cytochrome c with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136146 16026864 180266 20996 11179 SOD1 SOD1 SOD1 9 2.2 This has been demonstrated for cultured motoneurons expressing mutant SOD1 49 and is in line with a study of motoneurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136148 16026864 180270 23910 12680 VEGFA VEGF VEGF 27 2.2 that eliminates the ability of vascular endothelial-cell growth factor (VEGF) VEGF to respond to tissue hypoxia 54 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136149 16026864 180271 20996 11179 SOD1 SOD1 SOD1 5 2.2 Cross-breeding these mice with the SOD1 mutants severely enhanced motoneuron degeneration 55 whereas treatment of SOD-transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136150 16026864 180271 20996 11179 SOD1 SOD SOD-transgenic 16 2.2 SOD1 mutants severely enhanced motoneuron degeneration 55 whereas treatment of SOD-transgenic mice with VEGF delayed progression of symptoms and prolonged survival 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136151 16026864 180271 23910 12680 VEGFA VEGF VEGF 19 2.2 enhanced motoneuron degeneration 55 whereas treatment of SOD-transgenic mice with VEGF delayed progression of symptoms and prolonged survival 56 and 57 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136152 16026864 180272 23910 12680 VEGFA VEGF VEGF 5 2.2 Although direct neurotrophic effects of VEGF might contribute to these phenomena motoneurons seem selectively vulnerable to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136164 16026864 180306 20996 11179 SOD1 SOD1 SOD1 9 2.2 Briefly mitochondrial respiration can be disturbed by mutations in SOD1 hypoxia Ca 2 overload or alterations in the mitochondrial genome 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136175 16026864 180337 20996 11179 SOD1 SOD1 SOD1 10 2.2 disturbance of mitochondrial respiration by mutant superoxide dismutase 1 (SOD1) SOD1 or hypoxia results in increased formation of reactive oxygen species 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136751 16043017 181169 20996 11179 SOD1 SOD1 SOD1 19 2.7 caused by a gain-of-function mutation in Cu Zn-superoxide dismutase (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136752 16043017 181170 20996 11179 SOD1 SOD SOD 14 1.9 proposed to explain the toxic gain of function of mutant SOD (mSOD) mSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136753 16043017 181170 20996 11179 SOD1 SOD mSOD 15 1.9 explain the toxic gain of function of mutant SOD (mSOD) mSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136754 16043017 181171 20996 11179 SOD1 SOD mSOD 3 1.9 One is that mSOD can directly promote reactive oxygen species and reactive nitrogen species 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136756 16043017 181176 20996 11179 SOD1 SOD1 SOD1 3 2.7 These proteins are SOD1 translationally controlled tumor protein (TCTP), TCTP ubiquitin carboxyl-terminal hydrolase-L1 (UCH-L1), 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136757 16043017 181176 22727 12022 TPT1 TCTP TCTP 8 2.5 These proteins are SOD1 translationally controlled tumor protein (TCTP), TCTP ubiquitin carboxyl-terminal hydrolase-L1 (UCH-L1), UCH-L1 and possibly B-crystallin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136758 16043017 181176 23620 12513 UCHL1 UCHL1 UCH-L1 12 2.2 translationally controlled tumor protein (TCTP), TCTP ubiquitin carboxyl-terminal hydrolase-L1 (UCH-L1), UCH-L1 and possibly B-crystallin 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136759 16043017 181177 23620 12513 UCHL1 UCHL1 UCH-L1 19 2.2 activity decline our current study suggests that oxidative modification of UCH-L1 TCTP SOD1 and possibly B-crystallin may play an important role 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136760 16043017 181177 22727 12022 TPT1 TCTP TCTP 20 2.5 decline our current study suggests that oxidative modification of UCH-L1 TCTP SOD1 and possibly B-crystallin may play an important role in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136761 16043017 181177 20996 11179 SOD1 SOD1 SOD1 21 2.7 our current study suggests that oxidative modification of UCH-L1 TCTP SOD1 and possibly B-crystallin may play an important role in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136768 16043017 181181 20996 11179 SOD1 SOD1 SOD1 28 2.7 caused by a gain-of-function mutation in Cu Zn-superoxide dismutase (SOD1) SOD1 3 and 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136769 16043017 181182 20996 11179 SOD1 SOD1 SOD1 0 2.7 SOD1 catalyzes the disproportionation of superoxide anion radical to hydrogen peroxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136770 16043017 181183 20996 11179 SOD1 SOD1 SOD1 8 2.7 Over 100 different missense substitutions in the 153-amino-acid SOD1 have been described in individuals and kindreds affected by SOD1-linked 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136771 16043017 181183 20996 11179 SOD1 SOD1 SOD1-linked 18 1.9 SOD1 have been described in individuals and kindreds affected by SOD1-linked FALS 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136772 16043017 181184 20996 11179 SOD1 SOD1 SOD1 7 2.7 One of the most common mutations of SOD1 is the substitution of glycine by alanine at residue 93 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136773 16043017 181185 20996 11179 SOD1 SOD SOD 15 1.9 proposed to explain the toxic gain of function of mutant SOD (mSOD) mSOD 6 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136774 16043017 181185 20996 11179 SOD1 SOD mSOD 16 1.9 explain the toxic gain of function of mutant SOD (mSOD) mSOD 6 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136775 16043017 181186 20996 11179 SOD1 SOD mSOD 3 1.9 One is that mSOD can directly promote reactive oxygen species and reactive nitrogen species 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136777 16043017 181190 20996 11179 SOD1 SOD mSOD 15 1.9 in tissues from ALS patients 23 24 and 25 and mSOD transgenic mice 22 and 26 reportedly are rich in mSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136778 16043017 181190 20996 11179 SOD1 SOD mSOD 25 1.9 mSOD transgenic mice 22 and 26 reportedly are rich in mSOD ubiquitin and neurofilament proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136780 16043017 181192 20996 11179 SOD1 SOD1 SOD1-related 11 1.9 oxidative modification of macromolecules was demonstrated in neuronal tissues of SOD1-related FALS patients and transgenic mice 30 31 and 32 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136781 16043017 181193 20996 11179 SOD1 SOD1 mSOD1 7 1.9 Enhanced susceptibility of exogenous oxidative stress in mSOD1 cell cultures was also observed in in vitro studies 33 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136782 16043017 181194 20996 11179 SOD1 SOD mSOD 10 1.9 Exogenous oxidative stress can even inhibit the rapid degradation of mSOD 36 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136784 16043017 181197 20996 11179 SOD1 SOD1 SOD1 31 2.7 higher capacity to generate free radicals 9 compared to wild-type SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136786 16043017 181200 20996 11179 SOD1 SOD1 SOD1 11 2.7 of the oxidatively modified proteins in G93A-SOD1 transgenic mice is SOD1 32 indicating that oxidation of SOD1 is likely important to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136787 16043017 181200 20996 11179 SOD1 SOD1 SOD1 18 2.7 G93A-SOD1 transgenic mice is SOD1 32 indicating that oxidation of SOD1 is likely important to the development of this model of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136790 16043017 181206 20996 11179 SOD1 SOD1 SOD1 5 2.7 Transgenic mice expressing the human SOD1 gene with a G93A mutation strain B6SJL/TgN B6SJL TgN (SOD1-G93A)-2Gur) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136796 16043017 181251 23620 12513 UCHL1 UCHL1 UCH-L1 4 2.2 Ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1) UCH-L1 assay 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136797 16043017 181252 23620 12513 UCHL1 UCHL1 UCH-L1 3 2.2 The activities of UCH-L1 in the spinal cord were measured by determining the rate 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136800 16043017 181255 23620 12513 UCHL1 UCHL1 UCH-L1 0 2.2 UCH-L1 activities of each individual were assayed by the change of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136801 16043017 181256 23620 12513 UCHL1 UCHL1 UCH-L1 2 2.2 The average UCH-L1 activities of six transgenic animals were compared to those of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136802 16043017 181269 20996 11179 SOD1 SOD1 SOD1 5 2.7 These proteins were identified as SOD1 translationally controlled tumor protein (TCTP), TCTP UCH-L1 and B-crystallin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136803 16043017 181269 22727 12022 TPT1 TCTP TCTP 10 2.5 proteins were identified as SOD1 translationally controlled tumor protein (TCTP), TCTP UCH-L1 and B-crystallin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136804 16043017 181269 23620 12513 UCHL1 UCHL1 UCH-L1 11 2.2 were identified as SOD1 translationally controlled tumor protein (TCTP), TCTP UCH-L1 and B-crystallin 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136805 16043017 181274 20996 11179 SOD1 SOD1 SOD1 10 2.7 We report here that the specific carbonyl levels of human SOD1 TCTP UCH-L1 and possibly B-crystallin are significantly increased in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136806 16043017 181274 22727 12022 TPT1 TCTP TCTP 11 2.5 report here that the specific carbonyl levels of human SOD1 TCTP UCH-L1 and possibly B-crystallin are significantly increased in the spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136807 16043017 181274 23620 12513 UCHL1 UCHL1 UCH-L1 12 2.2 here that the specific carbonyl levels of human SOD1 TCTP UCH-L1 and possibly B-crystallin are significantly increased in the spinal cord 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136808 16043017 181275 20996 11179 SOD1 SOD1 SOD1 4 2.7 Spots close to human SOD1 are modified SOD1 possibly phosphorylated SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136809 16043017 181275 20996 11179 SOD1 SOD1 SOD1 7 2.7 Spots close to human SOD1 are modified SOD1 possibly phosphorylated SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136810 16043017 181275 20996 11179 SOD1 SOD1 SOD1 10 2.7 Spots close to human SOD1 are modified SOD1 possibly phosphorylated SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136811 16043017 181281 23620 12513 UCHL1 UCHL1 UCH-L1 15 2.2 oxidative modification inactivated protein activity we compared the activity of UCH-L1 in the G93A-SOD1 transgenic mice to that in the control 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136812 16043017 181282 23620 12513 UCHL1 UCHL1 UCH-L1 20 2.2 of activity of oxidatively modified proteins 49 50 and 51 UCH-L1 activity was significantly decreased (29%) 29% in the G93A-SOD1 transgenic 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136813 16043017 181285 20996 11179 SOD1 SOD SOD 15 1.9 provide insight into the mechanisms of the neurotoxicity of mutant SOD in vivo 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136814 16043017 181286 20996 11179 SOD1 SOD1 SOD1 6 2.7 It is well established that mutant SOD1 enhances oxidative activity by acting as a peroxidase 9 11 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136815 16043017 181289 20996 11179 SOD1 SOD1 SOD1 21 2.7 carbonyl levels compared to those of the nontransgenic mice as SOD1 TCTP UCH-L1 and B-crystallin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136816 16043017 181289 22727 12022 TPT1 TCTP TCTP 22 2.5 levels compared to those of the nontransgenic mice as SOD1 TCTP UCH-L1 and B-crystallin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136817 16043017 181289 23620 12513 UCHL1 UCHL1 UCH-L1 23 2.2 compared to those of the nontransgenic mice as SOD1 TCTP UCH-L1 and B-crystallin 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136818 16043017 181290 20996 11179 SOD1 SOD1 SOD1 0 2.7 SOD1 previously was identified immunochemically as one of the oxidatively modified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136819 16043017 181291 20996 11179 SOD1 SOD1 SOD1 15 2.7 proteomics approach to confirm that the specific carbonyl level of SOD1 is increased in the spinal cords of G93A-SOD1 transgenic mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136820 16043017 181292 20996 11179 SOD1 SOD1 SOD1 10 2.7 Although G93A-SOD1 shows dismutation activity identical to that of wild-type SOD1 the activity of SOD1 in FALS patients with mutations is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136821 16043017 181292 20996 11179 SOD1 SOD1 SOD1 14 2.7 activity identical to that of wild-type SOD1 the activity of SOD1 in FALS patients with mutations is decreased 50% in motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136822 16043017 181293 20996 11179 SOD1 SOD1 SOD1 12 2.7 radical production in the G93A-SOD1 transgenic animals is induced by SOD1 mutation 32 alteration of tumor necrosis factor TNF- and TNF--modulating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136823 16043017 181293 22551 11892 TNF TNF TNF- 21 1.2 induced by SOD1 mutation 32 alteration of tumor necrosis factor TNF- and TNF--modulating cytokines 38 and 46 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136824 16043017 181293 22551 11892 TNF TNF TNF--modulating 24 1.2 SOD1 mutation 32 alteration of tumor necrosis factor TNF- and TNF--modulating cytokines 38 and 46 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136826 16043017 181294 20996 11179 SOD1 SOD1 SOD1 27 2.7 study is consistent with the notion that oxidative modification of SOD1 plays a role in the neurotoxicity of mutant SOD1 in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136827 16043017 181294 20996 11179 SOD1 SOD1 SOD1 36 2.7 of SOD1 plays a role in the neurotoxicity of mutant SOD1 in the disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136828 16043017 181295 22727 12022 TPT1 TCTP TCTP 12 2.5 modified protein in G93A-SOD1 transgenic mice identified by proteomics was TCTP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136829 16043017 181296 22727 12022 TPT1 TCTP TCTP 0 2.5 TCTP processes calcium-binding activity (reviewed reviewed in 55 and has a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136830 16043017 181297 22727 12022 TPT1 TCTP TCTP 2 2.5 Overexpression of TCTP stabilizes microtubules and alters cell morphology 57 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136831 16043017 181298 22727 12022 TPT1 TCTP TCTP 4 2.5 Other molecular interactions of TCTP include self-interaction 58 and the interaction with myeloid cell leukemia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136832 16043017 181299 22727 12022 TPT1 TCTP TCTP 0 2.5 TCTP levels are highly regulated in response to various stress conditions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136833 16043017 181300 22727 12022 TPT1 TCTP TCTP 20 2.5 characterization as an antiapoptotic protein 67 these observations suggest that TCTP may exert a cytoprotective function for cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136834 16043017 181301 22727 12022 TPT1 TCTP TCTP 5 2.5 The current study showed that TCTP was oxidatively modified in the spinal cord of G93A-SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136835 16043017 181301 22727 12022 TPT1 TCTP TCTP 28 2.5 the putative cytoprotective function and the calcium binding affinity of TCTP are impaired in G93A-SOD1 mice because oxidative modification alters the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136837 16043017 181302 22727 12022 TPT1 TCTP TCTP 21 2.5 lymphocytes from ALS patients 70 suggesting that oxidative modification of TCTP may also play an important role in neurotoxicity of G93A-SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136838 16043017 181303 23620 12513 UCHL1 UCHL1 UCH-L1 0 2.2 UCH-L1 belongs to a family of ubiquitin carboxyl-terminal hydrolases that play 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136839 16043017 181307 23620 12513 UCHL1 UCHL1 UCH-L1 2 2.2 Loss of UCH-L1 function causes neuroaxonal dystrophy 74 75 and 76 significant protein 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136840 16043017 181308 23620 12513 UCHL1 UCHL1 UCH-L1 2 2.2 Similarly decreased UCH-L1 activity by mutation also enhances protein aggregation in Escherichia coli 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136841 16043017 181309 23620 12513 UCHL1 UCHL1 UCH-L1 9 2.2 Therefore based on the prior literature oxidative inactivation of UCH-L1 presented in the current study possibly contributes to both the 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136843 16043017 181310 23620 12513 UCHL1 UCHL1 UCH-L1 14 2.2 notion and consistent with our finding ( Fig 4 that UCH-L1 activity is decreased in G93A-SOD1 mouse spinal cord the inclusions 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136845 16043017 181310 20996 11179 SOD1 SOD1 mSOD1 29 1.9 G93A-SOD1 mouse spinal cord the inclusions of human ALS and mSOD1 (including including G93A mice are excessively ubiquitinated 79 80 81 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136846 16043017 181312 9691 5232 HSPA1A HSP HSPs 0 1.2 HSPs are cellular constituents synthesized by living organisms under stress conditions 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136847 16043017 181313 9691 5232 HSPA1A HSP HSPs 16 1.2 to stabilize other proteins under stress conditions whereas the high-molecular-weight HSPs normally play roles in protein folding during biosynthesis 83 and 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136849 16043017 181320 22727 12022 TPT1 TCTP TCTP 10 2.5 remarkable feature of the oxidatively modified proteins (except except for TCTP in G93A-SOD1 transgenic mice is that they are involved in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136853 16043017 181322 20996 11179 SOD1 SOD1 SOD1 4 2.7 Aberrant accumulation of mutant SOD1 is demonstrated in Caenorhabditis elegans expressing human mutant SOD1 36 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136854 16043017 181322 20996 11179 SOD1 SOD1 SOD1 13 2.7 mutant SOD1 is demonstrated in Caenorhabditis elegans expressing human mutant SOD1 36 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136855 16043017 181323 20996 11179 SOD1 SOD1 SOD1 10 2.7 Based on our current observations the increased oxidative modification of SOD1 UCH-L1 and B-crystallin plays a significant role in the protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136856 16043017 181323 23620 12513 UCHL1 UCHL1 UCH-L1 11 2.2 on our current observations the increased oxidative modification of SOD1 UCH-L1 and B-crystallin plays a significant role in the protein aggregation 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136857 16043017 181324 22727 12022 TPT1 TCTP TCTP 23 2.5 involves oxidative modification of a Ca 2 regulating protein (TCTP) TCTP and proteins involved in inclusion formation (SOD1, SOD1 UCH-L1 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136858 16043017 181324 20996 11179 SOD1 SOD1 SOD1 30 2.7 protein (TCTP) TCTP and proteins involved in inclusion formation (SOD1, SOD1 UCH-L1 and B-crystallin suggesting a potential relationship between protein oxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136859 16043017 181324 23620 12513 UCHL1 UCHL1 UCH-L1 31 2.2 (TCTP) TCTP and proteins involved in inclusion formation (SOD1, SOD1 UCH-L1 and B-crystallin suggesting a potential relationship between protein oxidation protein 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136861 16043017 181325 22727 12022 TPT1 TCTP TCTP 19 2.5 proteins impairs protein stability ( B-crystallin Ca 2 binding (TCTP), TCTP protein degradation (UCH-L1), UCH-L1 and antioxidant capacity (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136862 16043017 181325 23620 12513 UCHL1 UCHL1 UCH-L1 22 2.2 ( B-crystallin Ca 2 binding (TCTP), TCTP protein degradation (UCH-L1), UCH-L1 and antioxidant capacity (SOD1) SOD1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136863 16043017 181325 20996 11179 SOD1 SOD1 SOD1 26 2.7 (TCTP), TCTP protein degradation (UCH-L1), UCH-L1 and antioxidant capacity (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136865 16043017 181340 23620 12513 UCHL1 UCHL1 UCH-L1 3 2.2 Fig 4._amp_#xa0 Activity of UCH-L1 in G93A-SOD1 transgenic mice as a percentage of the nontransgenic 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136866 16043017 181341 23620 12513 UCHL1 UCHL1 UCH-L1 3 2.2 The activity of UCH-L1 is significantly decreased in the spinal cord of G93A-SOD1 transgenic 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137130 16046141 181620 20996 11179 SOD1 SOD1 SOD1 17 2.2 the expression of several mutant Cu Zn superoxide dismutases (SOD1) SOD1 typical of familial ALS is mediated by Apaf1 a scaffold 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137132 16046141 181620 864 576 APAF1 APAF1 Apaf1 25 2.1 dismutases (SOD1) SOD1 typical of familial ALS is mediated by Apaf1 a scaffold protein involved in neural development 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137133 16046141 181621 20996 11179 SOD1 SOD1 SOD1s 14 1.7 of neuronal origin and modulating the expression of both mutant SOD1s and Apaf1 we show that the removal of Apaf1 prevents 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137134 16046141 181621 864 576 APAF1 APAF1 Apaf1 16 2.1 origin and modulating the expression of both mutant SOD1s and Apaf1 we show that the removal of Apaf1 prevents cells death 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137135 16046141 181621 864 576 APAF1 APAF1 Apaf1 23 2.1 mutant SOD1s and Apaf1 we show that the removal of Apaf1 prevents cells death 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137142 16046141 181629 20996 11179 SOD1 SOD1 SOD1 33 2.2 gene coding for the enzyme Cu Zn superoxide dismutase (SOD1) SOD1 ( Rosen et al. 1993 fALS-SOD1 mutations cause the appearance 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137145 16046141 181632 20996 11179 SOD1 SOD1 SOD1 17 2.2 paradigms (post-mortem post-mortem samples from patients mice transgenic for mutant SOD1 and cell cultures 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137146 16046141 181633 20996 11179 SOD1 SOD1 SOD1-mediated 13 1.7 often yielded conflicting results converging evidence indicates that the mutant SOD1-mediated cell death observed in ALS is apoptotic in nature (reviewed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137149 16046141 181634 1576 990 BCL2 Bcl2 Bcl2 36 1.5 Mu et al. 1996 and Vukosavic et al. 1999 and Bcl2 prevents death of cells expressing fALS-SOD1 ( Ghadge et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137151 16046141 181635 20996 11179 SOD1 SOD1 SOD1 15 2.2 significantly extend the lifespan of transgenic mice overexpressing a fALS-linked SOD1 mutant ( Li et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137152 16046141 181636 20996 11179 SOD1 SOD1 SOD1 48 2.2 role in the initiation of motor neuron death by mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137154 16046141 181638 20996 11179 SOD1 SOD1 SOD1 13 2.2 to be crucial targets of the toxic function of mutant SOD1 ( Mattiazzi et al. 2002 Liu et al. 2004 Pasinelli 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137156 16046141 181639 864 576 APAF1 APAF1 Apaf1 15 2.1 c becomes part of the apoptosome a complex in which Apaf1 serves as a scaffold protein also for the binding of 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137157 16046141 181641 864 576 APAF1 APAF1 Apaf1 10 2.1 In this study we have investigated on the role of Apaf1 and the apoptosome in the induction of death in cell 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137158 16046141 181642 864 576 APAF1 APAF1 Apaf1 6 2.1 Our data demonstrate that removal of Apaf1 prevents cell death and mitochondrial damage by intercepting activation of 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137159 16046141 181645 20996 11179 SOD1 SOD1 SOD1 12 2.2 coding for wt or G93A G37R G85R and I113T mutant SOD1 were described elsewhere ( Carr_amp_#xec et al. 1997 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137161 16046141 181647 864 576 APAF1 APAF1 Apaf1 0 2.1 Apaf1 expression plasmid was created by cloning of Apaf1 cDNA ( 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137162 16046141 181647 864 576 APAF1 APAF1 Apaf1 8 2.1 Apaf1 expression plasmid was created by cloning of Apaf1 cDNA ( Cecconi et al. 1998 under control of the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137166 16046141 181652 20996 11179 SOD1 SOD1 SOD1 11 2.2 lines transfected for the transient expression of human wild type SOD1 (named named wt or mutant fALS-SOD1 G93A G37R G85R and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137167 16046141 181653 864 576 APAF1 APAF1 Apaf1 3 2.1 Embryonic Telencefalic Naive Apaf1 (ETNA_amp_#x2212;/_amp_#x2212;) ETNA_amp_#x2212 _amp_#x2212 cell lines were obtained from e14 embryos 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137168 16046141 181653 14565 7896 NPAT E14 e14 10 0.3 Naive Apaf1 (ETNA_amp_#x2212;/_amp_#x2212;) ETNA_amp_#x2212 _amp_#x2212 cell lines were obtained from e14 embryos of Apaf1 knock-out mice as previously described ( Cozzolino 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137169 16046141 181653 864 576 APAF1 APAF1 Apaf1 13 2.1 ETNA_amp_#x2212 _amp_#x2212 cell lines were obtained from e14 embryos of Apaf1 knock-out mice as previously described ( Cozzolino et al. 2004 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137170 16046141 181654 5902 2903 DLG4 PSD95 PSD95 37 1.3 neural markers (NeuN, NeuN class III _amp_#x3b2 -tubulin choline acetyltransferase PSD95 and tau Cozzolino et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137171 16046141 181654 12369 6893 MAPT tau tau 39 0.3 (NeuN, NeuN class III _amp_#x3b2 -tubulin choline acetyltransferase PSD95 and tau Cozzolino et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137175 16046141 181674 480 8768 AIFM1 AIF AIF 4 0.6 For cytochrome c and AIF release experiments ETNA cells were harvested in hypotonic buffer (2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137176 16046141 181680 20996 11179 SOD1 SOD1 SOD1 1 2.2 Immunoreactive SOD1 was detected with a rabbit polyclonal antibody (Stratagene) Stratagene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137177 16046141 181681 864 576 APAF1 APAF1 Apaf1 0 2.1 Apaf1 was detected with a rat mAb anti-Apaf1 (clone clone 18H2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137182 16046141 181691 20996 11179 SOD1 SOD1 SOD1 2 2.2 Measurement of SOD1 activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137183 16046141 181694 20996 11179 SOD1 SOD1 SOD1 0 2.2 SOD1 activity was detected as the achromatic band on the violet-colored 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137185 16046141 181714 864 576 APAF1 APAF1 Apaf1 2 2.1 Overexpression of Apaf1 exacerbates apoptotic death induced by fALS-SOD1 in human neuroblastoma 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137186 16046141 181716 20996 11179 SOD1 SOD1 SOD1 14 2.2 1 A under this condition the total level of immunoreactive SOD1 is highly increased with respect to the parental line and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137187 16046141 181716 20996 11179 SOD1 SOD1 SOD1 33 2.2 line and 1 day after transfection all lines expressing mutant SOD1 show a remarkable decrease in mitochondrial metabolic activity as indicated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137188 16046141 181716 20996 11179 SOD1 SOD1 SOD1s 77 1.7 Materials and methods 48 h after transfection expression of mutant SOD1s induces activation of caspase-3 caspase-9 but not caspase-1 ( Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137189 16046141 181718 20996 11179 SOD1 SOD1 SOD1 5 2.2 Cell death induced by mutant SOD1 is prevented by treatment both with pan-caspase inhibitor z-VAD and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137190 16046141 181719 864 576 APAF1 APAF1 Apaf1 3 2.1 To analyze whether Apaf1 is involved in mutant SOD1-induced apoptosis we stably transfected SH-SY5Y 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137191 16046141 181719 20996 11179 SOD1 SOD1 SOD1-induced 8 1.7 To analyze whether Apaf1 is involved in mutant SOD1-induced apoptosis we stably transfected SH-SY5Y neuroblastoma cells with a plasmid 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137192 16046141 181719 864 576 APAF1 APAF1 Apaf1 21 2.1 stably transfected SH-SY5Y neuroblastoma cells with a plasmid coding for Apaf1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137193 16046141 181720 864 576 APAF1 APAF1 Apaf1 17 2.1 C05 C19 and C20 were chosen for equivalent expression of Apaf1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137194 16046141 181721 864 576 APAF1 APAF1 Apaf1 12 2.1 results and data from clone C05 (named named SH/Apaf1) SH Apaf1 are shown 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137195 16046141 181722 864 576 APAF1 APAF1 Apaf1 8 2.1 Western blotting with specific anti-Apaf1 antibodies shows that SH/Apaf1 SH Apaf1 neuroblastoma cells express high levels of Apaf1 ( Fig 2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137196 16046141 181722 864 576 APAF1 APAF1 Apaf1 15 2.1 that SH/Apaf1 SH Apaf1 neuroblastoma cells express high levels of Apaf1 ( Fig 2 A 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137197 16046141 181723 864 576 APAF1 APAF1 Apaf1 4 2.1 In this conditions no Apaf1 expression is detectable in total cell lysates from control cells 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137198 16046141 181723 864 576 APAF1 APAF1 Apaf1 19 2.1 total cell lysates from control cells although SH-SY5Y do express Apaf1 as assessed by us in immunoprecipitation experiments (not not shown 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137199 16046141 181724 864 576 APAF1 APAF1 Apaf1 7 2.1 Transient transfection of control SH cells or SH/Apaf1 SH Apaf1 cells with wtSOD1 or G93A-SOD1 mutant elicits high level comparable 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137200 16046141 181724 864 576 APAF1 APAF1 Apaf1 41 2.1 of caspase-3 is dramatically increased only in G93A-expressing SH/Apaf1 SH Apaf1 cells as compared to G93A-transfected SH cells ( Fig 2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137201 16046141 181725 864 576 APAF1 APAF1 Apaf1 23 2.1 20-fold increase of apoptotic nuclei is observed in SH/Apaf1 SH Apaf1 cells expressing the mutant SOD1 with respect to untransfected control 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137202 16046141 181725 20996 11179 SOD1 SOD1 SOD1 28 2.2 is observed in SH/Apaf1 SH Apaf1 cells expressing the mutant SOD1 with respect to untransfected control SH cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137203 16046141 181727 864 576 APAF1 APAF1 Apaf1 2 2.1 Deletion of Apaf1 prevents apoptotic death induced by fALS-SOD1 in mouse neuronal cells 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137204 16046141 181728 864 576 APAF1 APAF1 Apaf1 11 2.1 order to establish an experimental system where the role of Apaf1 in fALS-SOD1-induced cell death could be thoroughly studied embryonal cortical 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137205 16046141 181728 864 576 APAF1 APAF1 Apaf1 27 2.1 thoroughly studied embryonal cortical cells from a control mouse (Apaf1+/+) Apaf1 or a mouse knocked-out for Apaf1 (Apaf1_amp_#x2212;/_amp_#x2212;) Apaf1_amp_#x2212 _amp_#x2212 have 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137206 16046141 181728 864 576 APAF1 APAF1 Apaf1 33 2.1 a control mouse (Apaf1+/+) Apaf1 or a mouse knocked-out for Apaf1 (Apaf1_amp_#x2212;/_amp_#x2212;) Apaf1_amp_#x2212 _amp_#x2212 have been isolated and immortalized by the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137208 16046141 181730 864 576 APAF1 APAF1 Apaf1 5 2.1 ETNA_amp_#x2212;/_amp_#x2212; ETNA_amp_#x2212 _amp_#x2212 cells do not express Apaf1 and the absence of this adapter provides them with a 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137209 16046141 181731 864 576 APAF1 APAF1 Apaf1 4 2.1 We have observed that Apaf1 deletion also provides these cells with a complete resistance to 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137210 16046141 181734 864 576 APAF1 APAF1 Apaf1 9 2.1 Cytochrome c release induced by fALS-SOD1 is independent of Apaf1 expression 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137211 16046141 181736 20996 11179 SOD1 SOD1 SOD1 12 2.2 cytochrome c release in cells expressing either fALS-SOD1s or wild-type SOD1 ETNA cells were transfected with cDNA coding for GFP-SOD1s fusion 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137212 16046141 181737 20996 11179 SOD1 SOD1 SOD1s 15 1.7 tag does not affect the dismutase activity of the various SOD1s ( Fig 4 A GFP-G93A and GFP-A4V mutants are similar 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137213 16046141 181738 20996 11179 SOD1 SOD1 SOD1s 9 1.7 As shown in Fig 4 C overexpression of mutant SOD1s causes the appearance of large intracellular aggregates (not not visible 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137214 16046141 181738 20996 11179 SOD1 SOD1 SOD1 23 2.2 large intracellular aggregates (not not visible in cells overexpressing wild-type SOD1 in ETNA cells as in various other experimental paradigms ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137215 16046141 181739 864 576 APAF1 APAF1 Apaf1 31 2.1 expressing different fALS-SOD1s display cytochrome c release independently from the Apaf1 genotype ( Figs 4 B_amp_#x2013 D 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137216 16046141 181740 480 8768 AIFM1 AIF AIF 28 0.6 that other mitochondrial factors involved in apoptotic pathways such as AIF ( Fig 4 and Fig 5 and EndoG (not not 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137217 16046141 181740 20996 11179 SOD1 SOD1 SOD1s 48 1.7 not shown are not affected by the expression of mutant SOD1s in this system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137221 16046141 181743 864 576 APAF1 APAF1 Apaf1-deficient 6 1.1 As shown in Fig 6 A Apaf1-deficient ETNA cells are completely resistant to fALS-SOD1-induced mitochondrial impairment as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137222 16046141 181745 20996 11179 SOD1 SOD1 SOD1s 6 1.7 On the opposite cotransfection of mutant SOD1s with Apaf1 in ETNA_amp_#x2212;/_amp_#x2212; ETNA_amp_#x2212 _amp_#x2212 cells significantly restores the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137223 16046141 181745 864 576 APAF1 APAF1 Apaf1 8 2.1 On the opposite cotransfection of mutant SOD1s with Apaf1 in ETNA_amp_#x2212;/_amp_#x2212; ETNA_amp_#x2212 _amp_#x2212 cells significantly restores the toxic effect 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137224 16046141 181745 864 576 APAF1 APAF1 Apaf1 34 2.1 in these cells is exclusively due to the lack of Apaf1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137226 16046141 181750 20996 11179 SOD1 SOD1 SOD1 6 2.2 Again protein oxidation induced by mutant SOD1 in ETNA+/+ ETNA cells is significantly reduced in cells lacking 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137227 16046141 181750 864 576 APAF1 APAF1 Apaf1 16 2.1 in ETNA+/+ ETNA cells is significantly reduced in cells lacking Apaf1 ( Fig 6 C 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137231 16046141 181760 20996 11179 SOD1 SOD1 SOD1 20 2.2 has been suggested also by studies where targeting of mutant SOD1 specifically to the nucleus cytosol and in the mitochondrion matrix 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137232 16046141 181763 480 8768 AIFM1 AIF AIF 41 0.6 pore causing leakage of cytochrome c and apoptosis-inducing factor (AIF) AIF ( Friedlander 2003 were suggested to play a role in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137233 16046141 181764 20996 11179 SOD1 SOD1 SOD1 81 2.2 classic_amp_#x201d apoptosis is involved in the motor neuron death in SOD1 mutant mice and perhaps also in ALS patients 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137236 16046141 181765 864 576 APAF1 APAF1 Apaf1 37 2.1 further insight in this process by studying the contribution of Apaf1 to cell death induced by different mutants SOD1s 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137237 16046141 181765 20996 11179 SOD1 SOD1 SOD1s 45 1.7 contribution of Apaf1 to cell death induced by different mutants SOD1s 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137238 16046141 181766 20996 11179 SOD1 SOD1 SOD1 44 2.2 loops (G37R, G37R I113T thus representing every class of mutant SOD1 found in patients except those truncated at the C-term end 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137239 16046141 181767 20996 11179 SOD1 SOD1 SOD1s 14 1.7 of neuronal origin and modulating the expression of both mutant SOD1s and Apaf1 we have observed that indeed Apaf1 is a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137240 16046141 181767 864 576 APAF1 APAF1 Apaf1 16 2.1 origin and modulating the expression of both mutant SOD1s and Apaf1 we have observed that indeed Apaf1 is a key factor 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137241 16046141 181767 864 576 APAF1 APAF1 Apaf1 22 2.1 both mutant SOD1s and Apaf1 we have observed that indeed Apaf1 is a key factor in the noxious function of fALS-SOD1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137242 16046141 181767 864 576 APAF1 APAF1 Apaf1 36 2.1 factor in the noxious function of fALS-SOD1 while overexpression of Apaf1 exacerbates the induction of apoptosis ( Fig 2 its removal 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137243 16046141 181770 19941 10876 SIGLEC7 p75 p75 29 0.3 critical caspase substrate in the mitochondria and that cleavage of p75 by caspases is responsible for disruption of electron transport leading 1 JUMiner_v2.2 1 0 0 2 10876 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:10876|SIGLEC7|0.000827123217268406<>ScoreDetail__9527|PSIP1|0.000508016350763939__2557|CUX1|0.000810621883843148__10876|SIGLEC7|0.000827123217268406__11917|TNFRSF1B|0.000411889766749005__ 0 0 0 0 0 137245 16046141 181770 14254 7707 NDUFS1 NDUFS1 NDUFS1 8 0.0 Interestingly Ricci et al have recently shown that NDUFS1 the 75 kDa subunit of respiratory complex I is a 1 JUMiner_v2.2 1 1 LongSymbol 0 0 0 0 0 0 0 0 137247 16046141 181771 20996 11179 SOD1 SOD1 SOD1 36 2.2 direct consequence of the postulated pro-oxidant toxic function of mutant SOD1 ( Valentine 2002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137248 16046141 181772 20996 11179 SOD1 SOD1 SOD1 1 2.2 Mutant SOD1 may either exert some aberrant chemistry specifically inside (or or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137249 16046141 181773 20996 11179 SOD1 SOD1 SOD1 8 2.2 Indeed the intracellular localization of wild-type and mutant SOD1 has recently been questioned 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137250 16046141 181774 20996 11179 SOD1 SOD1 SOD1 13 2.2 previous studies reporting that a fraction of the normally cytosolic SOD1 protein is detected within the mitochondrion probably either at the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137251 16046141 181774 20996 11179 SOD1 SOD1 SOD1 66 2.2 al have reported that multiple disease-causing mutants but not wild-type SOD1 are recruited to mitochondria but only in affected tissues ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137252 16046141 181775 20996 11179 SOD1 SOD1 SOD1 13 2.2 of protein are successfully imported but nearly constant amounts of SOD1 mutants and covalently damaged adducts of them accumulate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137253 16046141 181776 20996 11179 SOD1 SOD1 SOD1 13 2.2 damage from action of spinal cord-specific factors that recruit mutant SOD1 to spinal mitochondria as the basis for their selective toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137255 16046141 181777 20996 11179 SOD1 SOD1 SOD1 20 2.2 to being in the mitochondrial outer membrane and intermembrane space SOD1 is also localized in the mitochondrial matrix 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137256 16046141 181778 20996 11179 SOD1 SOD1 SOD1 2 2.2 Furthermore aberrant SOD1 macromolecular aggregates are formed in the matrix of brain mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137257 16046141 181779 20996 11179 SOD1 SOD1 SOD1s 4 1.7 Aggregation of mitochondrial mutant SOD1s may also have a role in altering the functionality of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137258 16046141 181780 1576 990 BCL2 Bcl-2 Bcl-2 12 1.5 al have reported that both wt- and mutSOD1 bind to Bcl-2 an anti-apoptotic protein located on the cytoplasmic face of outer 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137259 16046141 181780 1576 990 BCL2 Bcl-2 Bcl-2 31 1.5 of outer mitochondria membranes and have suggested that entrapment of Bcl-2 by large mutSOD1 aggregates may deplete motor neurons of this 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137260 16046141 181782 20996 11179 SOD1 SOD1 SOD1 8 2.2 These results suggest a mechanism by which mutant SOD1 can disrupt the association of proteins involved in cell survival 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137262 16046141 181783 20996 11179 SOD1 SOD1 SOD1 24 2.2 causes altering mitochondria functionality or from abnormal aggregation of wild-type SOD1 together with mitochondria proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137264 16046141 181787 20996 11179 SOD1 SOD1 SOD1 5 2.2 (A) A Western blot analysis of SOD1 expression in SH-SY5Y cells untransfected or transiently transfected for 48 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137265 16046141 181787 20996 11179 SOD1 SOD1 SOD1 26 2.2 h with wtSOD1 and G93A G37R G85R and I113T mutant SOD1 20 _amp_#x3bc g of total cell lysates was loaded 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137267 16046141 181797 864 576 APAF1 APAF1 Apaf1 3 2.1 Fig 2._amp_#xa0 Overexpression of Apaf1 exacerbates apoptotic death induced by fALS-SOD1 in human neuroblastoma 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137268 16046141 181798 864 576 APAF1 APAF1 Apaf1 9 2.1 A Na_amp_#xef ve SH-SY5Y cells or SH-SY5Y cells stably overexpressing Apaf1 (SH/Apaf1) SH Apaf1 were transiently transfected with wtSOD1 or with 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137269 16046141 181798 864 576 APAF1 APAF1 Apaf1 10 2.1 SH-SY5Y cells or SH-SY5Y cells stably overexpressing Apaf1 (SH/Apaf1) SH Apaf1 were transiently transfected with wtSOD1 or with the G93A-SOD1 mutant 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137270 16046141 181799 20996 11179 SOD1 SOD1 SOD1 15 2.2 of total cell lysates was analyzed for the expression of SOD1 and Apaf1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137271 16046141 181799 864 576 APAF1 APAF1 Apaf1 17 2.1 cell lysates was analyzed for the expression of SOD1 and Apaf1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137272 16046141 181804 864 576 APAF1 APAF1 Apaf1 3 2.1 Fig 3._amp_#xa0 Deletion of Apaf1 prevents apoptotic death induced by fALS-SOD1 in mouse neuronal cells 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137273 16046141 181810 864 576 APAF1 APAF1 Apaf1 10 2.1 4._amp_#xa0 Cytochrome c release induced by fALS-SOD1 is independent of Apaf1 expression 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137274 16046141 181812 20996 11179 SOD1 SOD1 SOD1 3 2.2 After 24 h SOD1 activity was detected on 10% polyacrylamide gel by the NBT/riboflavin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137275 16046141 181818 480 8768 AIFM1 AIF AIF 28 0.6 mutants were assessed for the presence of cytochrome c and AIF by Western blot 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137276 16046141 181819 480 8768 AIFM1 AIF AIF 16 0.6 untransfected ETNA cells were used as a positive control for AIF and cytochrome c expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137277 16046141 181821 480 8768 AIFM1 AIF AIF 5 0.6 Fig 5._amp_#xa0 ETNA cells retain mitochondrial AIF upon fALS-SOD1 expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137278 16046141 181822 480 8768 AIFM1 AIF AIF 10 0.6 confocal immunofluorescence microscopy staining of cytochrome c (green) green and AIF (red) red in ETNA cells 48 h after transfection with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137280 16046141 181827 864 576 APAF1 APAF1 Apaf1 14 2.1 wtSOD1 or G93A G37R G85R and I113T-SOD1 mutants with (Apaf1) Apaf1 or without a plasmid coding for Apaf1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137281 16046141 181827 864 576 APAF1 APAF1 Apaf1 21 2.1 mutants with (Apaf1) Apaf1 or without a plasmid coding for Apaf1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137786 16050975 182086 20996 11179 SOD1 SOD1 SOD1 21 3.5 of familial ALS expressing mutant Cu Zn superoxide dismutase (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137788 16050975 182088 20996 11179 SOD1 SOD1 SOD1 5 3.5 Although the mechanisms whereby mutant SOD1 damages mitochondria remain to be fully understood the finding that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137789 16050975 182088 20996 11179 SOD1 SOD1 SOD1 20 3.5 be fully understood the finding that a portion of mutant SOD1 is localized in mitochondria where it forms aberrant aggregates and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137790 16050975 182089 20996 11179 SOD1 SOD1 SOD1 14 3.5 to devise models to better understand the effects of mutant SOD1 in mitochondria and the relative contribution of mitochondrial dysfunction to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137803 16050975 182118 20996 11179 SOD1 SOD1 SOD1 4 3.5 Familial ALS due to SOD1 mutations and transgenic mouse models 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137804 16050975 182119 20996 11179 SOD1 SOD1 SOD1 16 3.5 to mutations in the gene encoding superoxide dismutase 1 (SOD1; SOD1 Cu Zn dismutase MIM147450 ( Rosen et al. 1993 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137805 16050975 182121 20996 11179 SOD1 SOD1 SOD1 0 3.5 SOD1 is a ubiquitous metalloprotein that prevents damage by oxygen-mediated free 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137806 16050975 182122 20996 11179 SOD1 SOD1 SOD1 8 3.5 The symptoms and pathology of FALS patients with SOD1 mutations closely resemble those of patients with SALS and the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137807 16050975 182122 20996 11179 SOD1 SOD1 SOD1 31 3.5 and pathologic alterations in motor neurons from mice expressing mutant SOD1 are also strikingly similar to those found in SALS patients 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137808 16050975 182123 20996 11179 SOD1 SOD1 SOD1 5 3.5 Since the initial report of SOD1 mutations ( Rosen et al. 1993 more than 100 different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137809 16050975 182123 20996 11179 SOD1 SOD1 SOD1 21 3.5 al. 1993 more than 100 different mutated forms of the SOD1 gene most of which are missense mutations have been identified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137810 16050975 182124 20996 11179 SOD1 SOD1 SOD1 7 3.5 Because several pathogenic mutations do not affect SOD1 activity significantly ( Borchelt et al. 1994 a toxic _amp_#x2018 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137811 16050975 182125 20996 11179 SOD1 SOD1 SOD1 14 3.5 confirmed by several transgenic studies in which mice expressing mutant SOD1 develop motor neuron degeneration despite an overall increase in their 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137812 16050975 182125 20996 11179 SOD1 SOD1 SOD1 25 3.5 develop motor neuron degeneration despite an overall increase in their SOD1 activity ( Xu 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137813 16050975 182128 20996 11179 SOD1 SOD1 SOD1 1 3.5 Mutant SOD1 is expressed ubiquitously but the pathological process leading to the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137814 16050975 182129 20996 11179 SOD1 SOD1 SOD1 4 3.5 The tissue selectivity of SOD1 toxicity is a puzzling problem that has yet to be 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137815 16050975 182130 20996 11179 SOD1 SOD1 SOD1 6 3.5 While mouse models that express mutant SOD1 ubiquitously (similar similar to what happens in humans develop motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137817 16050975 182130 20996 11179 SOD1 SOD1 SOD1 24 3.5 develop motor neuron degeneration and ALS models that express mutant SOD1 exclusively either in the motor neurons or in astrocytes do 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137818 16050975 182131 20996 11179 SOD1 SOD1 SOD1 12 3.5 this view in chimeric mice that contain a mixture of SOD1 mutant and wild type cells motor neurons with wild type 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137819 16050975 182131 20996 11179 SOD1 SOD1 SOD1 23 3.5 mutant and wild type cells motor neurons with wild type SOD1 develop signs of degeneration whereas non-neuronal cells with wild type 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137820 16050975 182131 20996 11179 SOD1 SOD1 SOD1 46 3.5 to attenuate the degeneration of motor neurons with the mutant SOD1 gene ( Clement et al. 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137826 16050975 182152 20996 11179 SOD1 SOD1 SOD1 8 3.5 However thanks to the availability of the mutant SOD1 transgenic mice that have provided an excellent platform to investigate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137828 16050975 182154 20996 11179 SOD1 SOD1 SOD1 36 3.5 neuron degeneration in models of FALS caused by mutations in SOD1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137830 16050975 182156 20996 11179 SOD1 SOD1 SOD1 10 3.5 Mitochondrial involvement in models of ALS created by introduction of SOD1 mutants 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137831 16050975 182157 20996 11179 SOD1 SOD1 SOD1 9 3.5 A striking pathological feature observed in transgenic mice expressing SOD1 mutants G93A or G37R is the presence of membrane bound 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137832 16050975 182164 20996 11179 SOD1 SOD1 SOD1 13 3.5 evidence obtained in cellular models indicate that expression of mutant SOD1 is not only associated with mitochondrial morphological changes but also 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137833 16050975 182165 20996 11179 SOD1 SOD1 SOD1 21 3.5 observed in neuroblastoma cells transfected with the mutated form of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137834 16050975 182168 20996 11179 SOD1 SOD1 SOD1 48 3.5 found in cultured motor neuron-like cells expressing mutated forms of SOD1 ( Menzies et al. 2002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137835 16050975 182169 20996 11179 SOD1 SOD1 SOD1 13 3.5 reported that mitochondrial bioenergetics is impaired in the G93A mutant SOD1 mouse model of FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137836 16050975 182173 20996 11179 SOD1 SOD1 SOD1 10 3.5 Recently we have found that the bioenergetic failure in the SOD1 mutant mice causes an impairment of mitochondrial calcium loading capacity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137837 16050975 182175 20996 11179 SOD1 SOD1 SOD1 6 3.5 Impaired mitochondrial calcium loading capacity in SOD1 mutant mice may produce two consequences 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137839 16050975 182178 8790 4572 GRIA2 GLUR2 gluR2 13 1.3 supported by the observation that overexpression of the calcium impermeable gluR2 subunit in motor neurons improves life span and motor functions 14 JUMiner_v2.2 1 0 0 2 4572 TotalCon:2<>4572|GRIA2|2891|Complete__4594|GRM2|2912|Complete__<>AvaiableGeneRif=2<>BEST:4572|GRIA2|0.000464718227958937<>ScoreDetail__4594|GRM2|0.000250035085568459__4572|GRIA2|0.000464718227958937__ 0 0 0 0 0 137840 16050975 182181 20996 11179 SOD1 SOD1 hSOD1 10 1.7 Consistent with this view antioxidant agents extended survival of mutant hSOD1 transgenic mice ( Jung et al. 2001 and Wu et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137843 16050975 182186 20996 11179 SOD1 SOD1 SOD1 4 3.5 The expression of mutant SOD1 predisposes cultured neuronal cells to activation of apoptosis in response 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137844 16050975 182187 20996 11179 SOD1 SOD1 SOD1 15 3.5 3 are activated sequentially in differentiated neuroblastoma cells expressing mutant SOD1 in response to oxidative stress ( Pasinelli et al. 1998 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137845 16050975 182190 1576 990 BCL2 Bcl-2 Bcl-2 19 1.8 al. 2000 and the overexpression of the mitochondrial anti-apoptotic protein Bcl-2 ( Kostic et al. 1997 slow motor neuron degeneration and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137846 16050975 182190 20996 11179 SOD1 SOD1 SOD1 35 3.5 1997 slow motor neuron degeneration and extend the survival of SOD1 mutant mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137848 16050975 182192 20996 11179 SOD1 SOD1 SOD1 3 3.5 For example mutant SOD1 mice genetically lacking caspase 11 an upstream regulator of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137851 16050975 182195 480 8768 AIFM1 AIF AIF 23 0.6 pro-apoptotic factors such as cytochrome c apoptosis inducing factor (AIF), AIF and endoG from individual mitochondria perhaps in response to local 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137852 16050975 182195 6634 3346 ENDOG ENDOG endoG 25 0.1 such as cytochrome c apoptosis inducing factor (AIF), AIF and endoG from individual mitochondria perhaps in response to local calcium mediated 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137854 16050975 182202 20996 11179 SOD1 SOD1 SOD1 5 3.5 Mechanisms of mitochondrial dysfunction in SOD1 FALS mitochondrial localization of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137855 16050975 182202 20996 11179 SOD1 SOD1 SOD1 10 3.5 Mechanisms of mitochondrial dysfunction in SOD1 FALS mitochondrial localization of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137856 16050975 182203 20996 11179 SOD1 SOD1 SOD1 15 3.5 changes and the biochemical abnormalities observed in mice expressing mutant SOD1 are still the object of intense investigation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137857 16050975 182204 20996 11179 SOD1 SOD1 SOD1 10 3.5 Two fundamental questions remain to be answered how is mutant SOD1 causing mitochondrial degeneration and dysfunction and is mitochondrial dysfunction necessary 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137858 16050975 182204 20996 11179 SOD1 SOD1 SOD1-induced 28 1.7 necessary and/or and or sufficient for the development of mutant SOD1-induced motor neuron degeneration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137859 16050975 182205 20996 11179 SOD1 SOD1 SOD1 16 3.5 answering these questions is the finding that a portion of SOD1 (most most of which is cytosolic is actually localized in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137860 16050975 182206 20996 11179 SOD1 SOD1 SOD1 0 3.5 SOD1 enzymatic activity in rat liver mitochondria was first detected by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137861 16050975 182207 20996 11179 SOD1 SOD1 SOD1 4 3.5 Recently the existence of SOD1 in mitochondria of eukaryotic cells has been confirmed by several 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137862 16050975 182208 20996 11179 SOD1 SOD1 SOD1 7 3.5 By cell fractionation and mitochondrial purification techniques SOD1 was detected in the mitochondria of the yeast S cerevisiae 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137863 16050975 182209 20996 11179 SOD1 SOD1 SOD1 17 3.5 2001 and Higgins et al. 2002 have independently demonstrated that SOD1 localizes in the mitochondria of motor neurons in the spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137864 16050975 182210 20996 11179 SOD1 SOD1 SOD1 9 3.5 These investigators showed that both wild type and mutant SOD1 are localized in mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137865 16050975 182211 20996 11179 SOD1 SOD1 SOD1 11 3.5 addition Field and colleagues have showed that the retention of SOD1 inside yeast mitochondria is dependent upon the interaction with its 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137866 16050975 182211 3838 1613 CCS CCS CCS 24 0.9 mitochondria is dependent upon the interaction with its copper chaperone CCS since SOD1 mutants that are unable to interact with CCS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137867 16050975 182211 20996 11179 SOD1 SOD1 SOD1 26 3.5 dependent upon the interaction with its copper chaperone CCS since SOD1 mutants that are unable to interact with CCS _amp_#x2018 leak 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137868 16050975 182211 3838 1613 CCS CCS CCS 34 0.9 CCS since SOD1 mutants that are unable to interact with CCS _amp_#x2018 leak out_amp_#x2019 of mitochondria ( Field et al. 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137869 16050975 182212 20996 11179 SOD1 SOD1 SOD1 10 3.5 Based on mitochondrial fractionation experiments several groups have proposed that SOD1 concentrates mostly in the intermembrane space of mitochondria ( Okado-Matsumoto 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137870 16050975 182213 20996 11179 SOD1 SOD1 SOD1 9 3.5 Recent experiments suggest that in mice expressing transgenic human SOD1 a portion of mutant SOD1 may also localize in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137871 16050975 182213 20996 11179 SOD1 SOD1 SOD1 14 3.5 in mice expressing transgenic human SOD1 a portion of mutant SOD1 may also localize in the matrix space of mitochondria where 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137872 16050975 182213 20996 11179 SOD1 SOD1 SOD1 30 3.5 matrix space of mitochondria where it forms large aggregates containing SOD1 and possibly other mitochondrial matrix proteins ( Vijayvergiya and Manfredi 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137873 16050975 182214 20996 11179 SOD1 SOD1 SOD1 3 3.5 Although how mutant SOD1 damages mitochondria has not been unequivocally defined several non-mutually exclusive 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137874 16050975 182215 20996 11179 SOD1 SOD1 SOD1 6 3.5 Higgins and colleagues have observed that SOD1 and cytochrome c a resident protein of the intermembrane space 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137875 16050975 182215 20996 11179 SOD1 SOD1 SOD1 28 3.5 colocalize at the early stages of mitochondrial vacuolization in mutant SOD1 transgenic mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137876 16050975 182216 20996 11179 SOD1 SOD1 SOD1 6 3.5 They also observed large aggregates of SOD1 immunoreactive material within the vacuoles 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137877 16050975 182220 20996 11179 SOD1 SOD1 SOD1 11 3.5 and colleagues have recently reported that in transgenic mice mutant SOD1 but not wild type SOD1 associates preferentially with mitochondria of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137878 16050975 182220 20996 11179 SOD1 SOD1 SOD1 16 3.5 that in transgenic mice mutant SOD1 but not wild type SOD1 associates preferentially with mitochondria of the spinal cord 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137879 16050975 182221 20996 11179 SOD1 SOD1 SOD1 4 3.5 They proposed that mutant SOD1 progressively accumulates and aggregates on the outer membrane causing _amp_#x2018 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137880 16050975 182222 20996 11179 SOD1 SOD1 SOD1 40 3.5 of FALS it would suggest that mitochondrial localization of mutant SOD1 resulting in protein import impairment is an important contributor to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137881 16050975 182223 20996 11179 SOD1 SOD1 SOD1 23 3.5 mentioned above where both wild type and mutant transgenic human SOD1 were detected in the mitochondria of various tissues including brain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137882 16050975 182224 20996 11179 SOD1 SOD1 SOD1 10 3.5 Discrepancies in terms of the localization of the wild type SOD1 in these studies may be attributed to the differences in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137883 16050975 182224 20996 11179 SOD1 SOD1 SOD1 27 3.5 to the differences in the strategies for mitochondrial purification and SOD1 detection and will require further experiments to be reconciled 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137884 16050975 182225 20996 11179 SOD1 SOD1 SOD1 17 3.5 to clarify the specificity and the exact intramitochondrial localization of SOD1 there is general agreement that mutant SOD1 tends to form 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137885 16050975 182225 20996 11179 SOD1 SOD1 SOD1 24 3.5 intramitochondrial localization of SOD1 there is general agreement that mutant SOD1 tends to form aggregates in mitochondria with potential pathogenic effects 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137886 16050975 182227 20996 11179 SOD1 SOD1 SOD1 10 3.5 In particular it will be interesting to assess whether mutant SOD1 forms abnormal interactions with other mitochondrial proteins which may lead 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137887 16050975 182228 20996 11179 SOD1 SOD1 SOD1 13 3.5 such potentially harmful protein-protein interactions is the binding of mutant SOD1 with Bcl-2 ( Pasinelli et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137888 16050975 182228 1576 990 BCL2 Bcl-2 Bcl-2 15 1.8 harmful protein-protein interactions is the binding of mutant SOD1 with Bcl-2 ( Pasinelli et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137889 16050975 182229 20996 11179 SOD1 SOD1 SOD1 22 3.5 in protein import and energy metabolism may interact with mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137890 16050975 182231 20996 11179 SOD1 SOD1 SOD1 1 3.5 Because SOD1 is present both in the cytosol and in mitochondria it 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137891 16050975 182231 20996 11179 SOD1 SOD1 SOD1 27 3.5 mitochondrial dysfunction to a direct toxic effect of mitochondrial mutant SOD1 alone 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137892 16050975 182232 20996 11179 SOD1 SOD1 SOD1 16 3.5 mitochondrial dysfunction may arise as a consequence of cytosolic mutant SOD1 toxicity cannot be ruled out 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137893 16050975 182233 20996 11179 SOD1 SOD1 SOD1 4 3.5 For example mutant cytosolic SOD1 could promote aberrant production of reactive oxygen species ( Estevez 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137895 16050975 182238 20996 11179 SOD1 SOD1 SOD1 19 3.5 are prominent pathological features in the G93A and the G37R SOD1 transgenic mice other mouse models such as those transgenic for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137896 16050975 182240 20996 11179 SOD1 SOD1 SOD1 7 3.5 It remains to be tested whether some SOD1 mutants can affect mitochondrial functions without causing overt morphological changes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137897 16050975 182241 20996 11179 SOD1 SOD1 SOD1 9 3.5 Since most of the work on the bioenergetics of SOD1 mutant mitochondria has been done in the G93A model in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137898 16050975 182242 20996 11179 SOD1 SOD1 SOD1 34 3.5 function and protecting mitochondria from the pro-apoptotic effect of mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137899 16050975 182244 20996 11179 SOD1 SOD1 SOD1 31 3.5 of the mitochondrial apoptotic pathway extend the lifespan of mutant SOD1 transgenic mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137900 16050975 182247 20996 11179 SOD1 SOD1 SOD1 12 3.5 could be to generate cellular and animal models where mutant SOD1 is selectively localized in the mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137901 16050975 182248 20996 11179 SOD1 SOD1 SOD1 3 3.5 Mitochondrial targeting of SOD1 could be achieved by appending specific mitochondrial targeting signals on 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137902 16050975 182250 20996 11179 SOD1 SOD1 SOD1 7 3.5 Conversely the identification of protein domains in SOD1 crucial for its mitochondrial import could allow for the generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137903 16050975 182250 20996 11179 SOD1 SOD1 SOD1 26 3.5 the generation of models where the mitochondrial content of mutant SOD1 is drastically reduced or eliminated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137904 16050975 182251 20996 11179 SOD1 SOD1 SOD1 10 3.5 The comparison of these models with the ones where mutant SOD1 is expressed in both the cytosolic and mitochondrial compartments will 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137905 16050975 182251 20996 11179 SOD1 SOD1 SOD1 29 3.5 compartments will help us defining the role that mitochondrial mutant SOD1 plays in mitochondrial dysfunction and ultimately in the pathogenesis of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137906 16050975 182252 20996 11179 SOD1 SOD1 SOD1-related 9 1.7 Fig 1._amp_#xa0 Diagram of potential pathways of mitochondrial involvement in SOD1-related ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137908 16050975 182253 20996 11179 SOD1 SOD1 SOD1 1 3.5 Mutant SOD1 has been proposed to affect mitochondrial functions in several ways 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137909 16050975 182255 20996 11179 SOD1 SOD1 SOD1 1 3.5 Mutant SOD1 may affect mitochondria directly within the organelles or indirectly from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137910 16050975 182256 20996 11179 SOD1 SOD1 SOD1 3 3.5 Within mitochondria mutant SOD1 may interfere with the anti-apoptotic function of Bcl-2 ( Pasinelli 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137911 16050975 182256 1576 990 BCL2 Bcl-2 Bcl-2 11 1.8 mitochondria mutant SOD1 may interfere with the anti-apoptotic function of Bcl-2 ( Pasinelli et al. 2004 affect mitochondrial import by interfering 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131726 16188953 173827 166 118 ACO2 aconitase aconitase 28 1.6 2 O 2 release and by an increase in mitochondrial aconitase activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131729 16188953 173829 20996 11179 SOD1 SOD1 SOD1 14 2.2 cases are caused by mutations in superoxide dismutase 1 (SOD1), SOD1 which expressed in mice result in a phenotype resembling the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131730 16188953 173830 20996 11179 SOD1 SOD1 SOD1 1 2.2 Transgenic SOD1 mice represent the predominant model to study ALS pathogenesis and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131741 16188953 173835 20996 11179 SOD1 SOD1 SOD1 9 2.2 test for neuroprotection by PPX/SND PPX SND in vivo transgenic SOD1 mice were treated with both compounds 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131762 16188953 173896 20996 11179 SOD1 SOD SOD-catalase 11 2.2 PPX (300 300 microM malonate (Malo, Malo 10 mM the SOD-catalase mimic EUK-134 (Melov Melov et al. 2001 EUK (30 30 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131765 16188953 173904 20996 11179 SOD1 SOD SOD 8 2.2 The specificity for hydrogen peroxide was verified with SOD (300 300 mU/ml), mU ml which did not affect the 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131781 16188953 173954 17367 17348 PRPF3 RP18 RP18 6 1.0 Chromatography took place on a Kromasil RP18 column (2.1 2.1 mm i.d x 30 mm 5-microm particle 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131782 16188953 173960 166 118 ACO2 aconitase aconitase 1 1.6 Mitochondrial aconitase is reversibly inactivated by superoxide and has therefore been used 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131783 16188953 173965 166 118 ACO2 aconitase aconitase 14 1.6 against the 23 C-terminal amino acids of aconitase-2 (mitochondrial mitochondrial aconitase from rat (nanoTools; nanoTools Antik_amp_ouml rpertechnik Teningen Germany was used 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131807 16188953 173998 20996 11179 SOD1 SOD SOD-catalase-mimetic 25 2.2 and compartments obtained efficacies were compared with EUK-134 a potent SOD-catalase-mimetic (Jung Jung et al. 2001 Melov et al. 2001 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131821 16188953 174013 166 118 ACO2 aconitase aconitase 15 1.6 30 mg/kg) mg kg results in an increase in mitochondrial aconitase activity in vivo indicating a reduction of the superoxide steady-state 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131823 16188953 174014 166 118 ACO2 aconitase aconitase 30 1.6 12 h after the last treatment the increase in mitochondrial aconitase might result from total brain concentrations within the same order 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131826 16188953 174017 166 118 ACO2 aconitase aconitase 10 1.6 PPX causes a slight but not significant increase in total aconitase activity in 1-methyl-4-phenylpyridinium-treated SHSY-5Y cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131841 16188953 174036 166 118 ACO2 aconitase aconitase 34 1.6 specific endpoints such as modification of mitochondrial proteins or mitochondrial aconitase activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131876 16188953 174076 166 118 ACO2 aconitase aconitase 7 1.6 Activity (A) A and expression (B) B of mitochondrial aconitase after treatment of C57BL/6 C57BL 6 mice with PPX (2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131879 16188953 174079 20996 11179 SOD1 SOD1 SOD1 2 2.2 Treatment of SOD1(G93A) SOD1 G93A transgenic mice with PPX and SND 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131906 16188953 174110 20996 11179 SOD1 SOD SOD-catalase 28 2.2 SND and compared the obtained efficacy with EUK-134 a potent SOD-catalase mimetic (Melov Melov et al. 2001 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131931 16188953 174138 166 118 ACO2 aconitase aconitase 18 1.6 were isolated after PPX treatment of mice to determine mitochondrial aconitase activity an indicator for steady-state levels of superoxide (Tarpey Tarpey 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131933 16188953 174139 166 118 ACO2 aconitase aconitase 11 1.6 days (2 2 x 30 mg/kg) mg kg increased mitochondrial aconitase activity by 42% to 67 _amp_#177 16 mU/mg mU mg 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131934 16188953 174140 166 118 ACO2 aconitase aconitase 9 1.6 This was not due to altered expression of mitochondrial aconitase because protein levels were not affected by the PPX treatment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131936 16188953 174141 20996 11179 SOD1 SOD1 SOD1 10 2.2 Consequently we tested both compounds in mice expressing the G93A-mutant SOD1 a common and well described model of ALS where neuronal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131944 16188953 174151 20996 11179 SOD1 SOD1 SOD1 5 2.2 Additionally survival time in SND-treated SOD1 (G93A) G93A mice (132 132 _amp_#177 2 days mean _amp_#177 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132304 16194581 174740 14535 7873 NOS2A iNOS iNOS 20 2.2 activation genes such as the inducible nitric oxide synthase (iNOS), iNOS interleukin-1_amp_#x3b2 (IL-1_amp_#x3b2;), IL-1_amp_#x3b2 tumor necrosis factor-_amp_#x3b1 (TNF-_amp_#x3b1;), TNF-_amp_#x3b1 and nuclear 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132305 16194581 174740 22551 11892 TNF TNF TNF-A 26 1.2 synthase (iNOS), iNOS interleukin-1_amp_#x3b2 (IL-1_amp_#x3b2;), IL-1_amp_#x3b2 tumor necrosis factor-_amp_#x3b1 (TNF-_amp_#x3b1;), TNF-_amp_#x3b1 and nuclear factor-kappa B (NF-_amp_#x3ba;B) NF-_amp_#x3ba B 1 49 60 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132307 16194581 174759 926 620 APP APP APP 3 0.3 Amyloid precursor protein/presenilin-1 protein presenilin-1 (APP/PSl) APP PSl transgenic mice have been used as a murine model 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132308 16194581 174759 926 620 APP amyloid amyloid 23 1.0 for AD since these mutations facilitate the production of beta amyloid and consequently Alzheimer-like plaques in several regions of the brain 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 132309 16194581 174763 926 620 APP APP APP 15 0.3 of plaques was observed between the BB-supplemented and non-supplemented APP/PSl APP PSl mice even though behavioral deficits were prevented in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132310 16194581 174766 926 620 APP APP APP 13 0.3 formation and improved Y-maze performance seen in the BB-supplemented APP/PSl APP PSl mice versus the non-supplemented APP/PSl APP PSl mice might 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132311 16194581 174766 926 620 APP APP APP 18 0.3 the BB-supplemented APP/PSl APP PSl mice versus the non-supplemented APP/PSl APP PSl mice might be due to alterations in signaling pathways 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132312 16194581 174767 12337 6871 MAPK1 ERK ERK 7 2.3 The levels of extracellular signal regulated kinase (ERK) ERK and protein kinase C (PKC) PKC were elevated in the 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000534824703720569<>ScoreDetail__3393|EPHB2|0.000404600083710362__6871|MAPK1|0.000534824703720569__ 0 0 0 0 0 132313 16194581 174767 926 620 APP APP APP 18 0.3 kinase C (PKC) PKC were elevated in the BB-supplemented APP/PSl APP PSl mice as compared to those found in the non-supplemented 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132314 16194581 174768 12337 6871 MAPK1 ERK ERK 1 2.3 Both ERK and PKC kinases are important in mediating cognitive function especially 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000534824703720569<>ScoreDetail__3393|EPHB2|0.000404600083710362__6871|MAPK1|0.000534824703720569__ 0 0 0 0 0 132315 16194581 174772 12339 6877 MAPK3 ERK1 ERK1 10 1.8 After these tests the hippocampal expression of signaling markers including ERK1 and ERK2 as well as PKC-_amp_#x3b1 and PKC-_amp_#x3b3 were analyzed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132316 16194581 174772 12337 6871 MAPK1 ERK2 ERK2 10 2.3 After these tests the hippocampal expression of signaling markers including ERK1 and ERK2 as well as PKC-_amp_#x3b1 and PKC-_amp_#x3b3 were analyzed 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132317 16194581 174772 12337 6871 MAPK1 ERK2 ERK2 12 2.3 tests the hippocampal expression of signaling markers including ERK1 and ERK2 as well as PKC-_amp_#x3b1 and PKC-_amp_#x3b3 were analyzed by immunoblotting 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132318 16194581 174774 12339 6877 MAPK3 ERK1 ERK1 3 1.8 The expression of ERK1 and ERK2 positively correlated with inclined screen latency (measurement measurement 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132319 16194581 174774 12337 6871 MAPK1 ERK2 ERK2 3 2.3 The expression of ERK1 and ERK2 positively correlated with inclined screen latency (measurement measurement 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132320 16194581 174774 12337 6871 MAPK1 ERK2 ERK2 5 2.3 The expression of ERK1 and ERK2 positively correlated with inclined screen latency (measurement measurement of muscle 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132321 16194581 174781 12337 6871 MAPK1 ERK ERK 4 2.3 The localized expression of ERK and insulin-like growth factor 1 (IGF-1) IGF-1 and its receptor 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000534824703720569<>ScoreDetail__3393|EPHB2|0.000404600083710362__6871|MAPK1|0.000534824703720569__ 0 0 0 0 0 132322 16194581 174781 9939 5464 IGF1 IGF1 IGF-1 10 1.8 localized expression of ERK and insulin-like growth factor 1 (IGF-1) IGF-1 and its receptor (IGF-1R) IGF-1R was also assayed by immunohistochemistry 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132323 16194581 174781 9940 5465 IGF1R IGF1R IGF-1R 14 1.5 insulin-like growth factor 1 (IGF-1) IGF-1 and its receptor (IGF-1R) IGF-1R was also assayed by immunohistochemistry 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132324 16194581 174785 9939 5464 IGF1 IGF1 IGF-1 13 1.8 aged rats showed significant increases in the protein levels of IGF-1 IGF-1R and ERK and these increases were also inversely correlated 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132325 16194581 174785 9940 5465 IGF1R IGF1R IGF-1R 14 1.5 rats showed significant increases in the protein levels of IGF-1 IGF-1R and ERK and these increases were also inversely correlated with 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132326 16194581 174785 12337 6871 MAPK1 ERK ERK 16 2.3 significant increases in the protein levels of IGF-1 IGF-1R and ERK and these increases were also inversely correlated with the number 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000534824703720569<>ScoreDetail__3393|EPHB2|0.000404600083710362__6871|MAPK1|0.000534824703720569__ 0 0 0 0 0 132327 16194581 174786 9939 5464 IGF1 IGF1 IGF-1 19 1.8 and cognitive performance via concerted mechanisms involving neurogenesis neurotrophic factor IGF-1 and its receptor and MAP kinase signal transduction cascades 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 132328 16194581 174786 12337 6871 MAPK1 MAP MAP 24 2.3 mechanisms involving neurogenesis neurotrophic factor IGF-1 and its receptor and MAP kinase signal transduction cascades 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133171 16227974 175711 20996 11179 SOD1 SOD1 SOD1 28 1.4 the cytosolic form of the antioxidant protein superoxide dismutase ( SOD1 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133173 16227974 175713 20996 11179 SOD1 SOD1 SOD1 6 1.4 That said how disease-causing mutations in SOD1 lead to ALS remains controversial 2 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133177 16227974 175716 16634 14581 PINK1 PINK1 PINK1 29 0.6 alpha-synuclein parkin ubiquitin C-terminal hydrolase-1 DJ1 and PTEN-induced kinase-1 ( PINK1 (Refs Refs 2 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133178 16227974 175716 17590 9588 PTEN PTEN PTEN-induced 26 0.1 including those encoding alpha-synuclein parkin ubiquitin C-terminal hydrolase-1 DJ1 and PTEN-induced kinase-1 ( PINK1 (Refs Refs 2 4 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133181 16227974 175723 16634 14581 PINK1 PINK1 PINK1 1 0.6 Finally PINK1 has a mitochondrial-targeting sequence and in this subcellular location it 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133182 16227974 175727 926 620 APP amyloid amyloid 11 1.0 characteristic feature of Alzheimer's disease is the formation of extracellular amyloid plaques that contain cleavage products amyloid-beta (A A beta of 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 133183 16227974 175727 926 620 APP amyloid amyloid 22 1.0 plaques that contain cleavage products amyloid-beta (A A beta of amyloid precursor protein ( APP 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 133184 16227974 175727 926 620 APP APP APP 26 0.6 products amyloid-beta (A A beta of amyloid precursor protein ( APP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133185 16227974 175728 926 620 APP APP APP 11 0.6 forms of Alzheimer's disease have been linked to mutations in APP or in gene products that are involved in APP processing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133186 16227974 175728 926 620 APP APP APP 20 0.6 in APP or in gene products that are involved in APP processing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133188 16227974 175743 166 118 ACO2 aconitase aconitase 5 2.1 Studies with the mitochondrial protein aconitase have demonstrated that low levels of ROS caused mild oxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133191 16227974 175743 166 118 ACO2 aconitase aconitase 25 2.1 oxidation and stimulated degradation whereas higher levels of ROS caused aconitase to aggregate and become more resistant to proteasomal degradation 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133196 16227974 175760 20997 11180 SOD2 SOD2 Sod2 4 1.7 Superoxide dismutase-2 - Sod2 - mice which lack one copy of this mitochondrial antioxidant 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133200 16227974 175771 20997 11180 SOD2 SOD2 Sod2 17 1.7 protein peroxiredoxin-I (Ref Ref 32 or are heterozygous deleted for Sod2 (Ref Ref 33 have increased spontaneous tumour formation 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133204 16227974 175776 22671 11998 TP53 p53 p53 6 0.3 For example there is evidence that p53 Myc ataxia telangiectasia mutated ( ATM and Ras can all 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133205 16227974 175776 1271 795 ATM ATM ATM 12 2.2 there is evidence that p53 Myc ataxia telangiectasia mutated ( ATM and Ras can all alter intracellular ROS levels 31 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133207 16227974 175776 13925 7553 MYC MYC Myc 7 0.2 For example there is evidence that p53 Myc ataxia telangiectasia mutated ( ATM and Ras can all alter 5 JUMiner_v2.2 1 0 0 2 7553 TotalCon:2<>7553|MYC|4609|Complete__7869|NOL3|8996|Complete__<>AvaiableGeneRif=2<>BEST:7553|MYC|0.000534467067351009<>ScoreDetail__7553|MYC|0.000534467067351009__7869|NOL3|0.000504227436234179__ 0 0 0 0 0 133211 16227974 175784 5811 2859 DHCR24 seladin-1 seladin-1 5 1.3 Another group noted that inhibiting seladin-1 could also block Ras- or oxidant-induced senescence 42 (seladin-1 seladin-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133212 16227974 175784 5811 2859 DHCR24 seladin-1 seladin-1 14 1.3 seladin-1 could also block Ras- or oxidant-induced senescence 42 (seladin-1 seladin-1 had been previously discovered in the context of Alzheimer's disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133213 16227974 175785 5811 2859 DHCR24 seladin-1 seladin-1 4 1.3 Notably following hydrogen-peroxide treatment seladin-1 translocates to the nucleus where it seems to bind to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133214 16227974 175785 22671 11998 TP53 p53 p53 17 0.3 the nucleus where it seems to bind to and stabilize p53 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133217 16227974 175788 10826 6206 JUND JUND JunD 4 0.3 Recently the transcription factor JunD was shown to regulate the levels of tumour-secreted angiogenic growth 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133218 16227974 175794 19982 10886 SIRT2 SIR2 SIR-2 19 1.3 melanogaster and Caenorhabditis elegans overexpression of the NAD-dependent histone deacetylase SIR-2 results in an increased lifespan 48 49 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133219 16227974 175795 19982 10886 SIRT2 SIR2 SIR-2 5 1.3 The closest mammalian orthologue of SIR-2 is SIRT1 and it is presently not known whether overexpression 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133220 16227974 175795 19981 14929 SIRT1 SIRT1 SIRT1 7 0.3 The closest mammalian orthologue of SIR-2 is SIRT1 and it is presently not known whether overexpression of SIRT1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133221 16227974 175795 19981 14929 SIRT1 SIRT1 SIRT1 17 0.3 SIRT1 and it is presently not known whether overexpression of SIRT1 will extend mammalian lifespan 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133223 16227974 175797 19982 10886 SIRT2 SIR2 Sir2 3 1.3 For instance yeast Sir2 seems to be important in protecting cells from accumulation of 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133224 16227974 175797 19981 14929 SIRT1 SIRT1 SIRT1 20 0.3 cells from accumulation of oxidatively damaged proteins 50 and mammalian SIRT1 and SIRT3 might modulate mitochondrial activity 51 52 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133225 16227974 175797 19983 14931 SIRT3 SIRT3 SIRT3 20 0.3 cells from accumulation of oxidatively damaged proteins 50 and mammalian SIRT1 and SIRT3 might modulate mitochondrial activity 51 52 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133226 16227974 175797 19983 14931 SIRT3 SIRT3 SIRT3 22 0.3 accumulation of oxidatively damaged proteins 50 and mammalian SIRT1 and SIRT3 might modulate mitochondrial activity 51 52 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133227 16227974 175799 19981 14929 SIRT1 SIRT1 SIRT1 6 0.3 Recent studies have shown that overexpressing SIRT1 in mice seems to protect neurons from at least some 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133228 16227974 175800 19982 10886 SIRT2 SIR2 SIR-2 15 1.3 model of the neurodegenerative condition Huntington's disease upregulated expression of SIR-2 increased neuronal survival 54 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133229 16227974 175801 19982 10886 SIRT2 SIR2 SIR-2 32 1.3 has also been recently proposed to increase the activity of SIR-2 (Ref Ref 55 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133230 16227974 175803 19898 10840 SHC1 p66SHC p66SHC 6 3.2 Another known mammalian-longevity gene product is p66SHC the p66 isoform of the adaptor protein SHC (Src-homology-2-containing) Src-homology-2-containing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133231 16227974 175803 19898 10840 SHC1 p66 p66 8 2.9 Another known mammalian-longevity gene product is p66SHC the p66 isoform of the adaptor protein SHC (Src-homology-2-containing) Src-homology-2-containing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133232 16227974 175803 19898 10840 SHC1 SHC SHC 14 4.2 product is p66SHC the p66 isoform of the adaptor protein SHC (Src-homology-2-containing) Src-homology-2-containing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133233 16227974 175803 21242 11283 SRC SRC Src-homology-2-containing 15 0.2 p66SHC the p66 isoform of the adaptor protein SHC (Src-homology-2-containing) Src-homology-2-containing 5 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133234 16227974 175804 19898 10840 SHC1 SHC SHC 1 4.2 Normally SHC proteins serve as a molecular bridge linking various surface receptors 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133235 16227974 175805 19898 10840 SHC1 p66SHC p66SHC 2 3.2 Mice lacking p66SHC have a 30% increased lifespan 57 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133237 16227974 175807 19898 10840 SHC1 P66SHC p66Shc 2 3.2 Interestingly when p66Shc - -mice were bred with mice that had a predisposition 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133238 16227974 175808 19898 10840 SHC1 P66SHC p66Shc 16 3.2 vascular function that precede plaque formation were also absent in p66Shc - -animals 61 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133246 16227974 175822 166 118 ACO2 aconitase aconitase 45 2.1 the activity of a set of metabolic enzymes such as aconitase and components of mitochondrial complex I that contain Fe-S clusters 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133248 16227974 175823 12349 6881 MAPK8 JNK JNKs 17 0.3 cytosolic stress pathways (for for example Jun N-terminal kinases (JNKs) JNKs and p38 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133249 16227974 175823 12359 6876 MAPK14 p38 p38 19 0.3 pathways (for for example Jun N-terminal kinases (JNKs) JNKs and p38 1 JUMiner_v2.2 1 0 0 2 6878 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6878|MAPK4|0.000710908897024846<>ScoreDetail__1189|AHSA1|0.000464460479389566__6878|MAPK4|0.000710908897024846__6871|MAPK1|0.000556733255860255__6876|MAPK14|0.000545081115596972__ 0 0 0 0 0 133258 16227974 175834 19898 10840 SHC1 p66SHC p66SHC 14 3.2 out that drugs that augment sirtuins or those that inhibit p66SHC will only be effective in a discrete subset of age-related 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133259 16227974 175841 20997 11180 SOD2 SOD2 Sod2 0 1.7 Sod2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133261 16227974 175845 926 620 APP APP APP 1 0.6 alpha-synuclein APP ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133262 16227974 175845 1271 795 ATM ATM ATM 2 2.2 alpha-synuclein APP ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133263 16227974 175845 10826 6206 JUND JUND JunD 3 0.3 alpha-synuclein APP ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 SOD1 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133264 16227974 175845 16634 14581 PINK1 PINK1 PINK1 7 0.6 alpha-synuclein APP ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133265 16227974 175845 5811 2859 DHCR24 seladin-1 seladin-1 9 1.3 alpha-synuclein APP ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133266 16227974 175845 19981 14929 SIRT1 SIRT1 SIRT1 10 0.3 alpha-synuclein APP ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133267 16227974 175845 19983 14931 SIRT3 SIRT3 SIRT3 11 0.3 APP ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 SOD1 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133268 16227974 175845 20996 11179 SOD1 SOD1 SOD1 12 1.4 ATM JunD parkin peroxiredoxin I PINK1 Ras seladin-1 SIRT1 SIRT3 SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134147 16242643 176945 14535 7873 NOS2A iNOS iNOS 9 2.5 Furthermore malonate did not induce the expression of the iNOS caspase-3 -8 and -9 genes which have been shown to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134148 16242643 176946 1576 990 BCL2 Bcl-2 Bcl-2 8 6.2 In addition malonate-induced down-regulation of the antiapoptotic gene Bcl-2 was not prevented by minocycline controversially the mechanism previously proposed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134149 16242643 176951 14535 7873 NOS2A iNOS iNOS 29 2.5 expression of interleukin 1 beta inducible nitric oxide synthase (iNOS), iNOS caspase-3 and -1 ( Chen et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134151 16242643 176953 5854 21528 DIABLO SMAC SMAC 14 1.8 turn inhibits the release of the proapoptotic factors cytochrome c SMAC (DIABLO) DIABLO and apoptosis-inducing factor from the mitochondria ( Wang 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134152 16242643 176953 5854 21528 DIABLO DIABLO DIABLO 15 1.8 the release of the proapoptotic factors cytochrome c SMAC (DIABLO) DIABLO and apoptosis-inducing factor from the mitochondria ( Wang et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134154 16242643 176965 14535 7873 NOS2A iNOS iNOS 12 2.5 no modifications in the expression of the mRNA's encoding for iNOS caspase-3 -8 and -9 after malonate additions were found we 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134159 16242643 177037 8118 4141 GAPDH GAPDH GAPDH 18 0.3 (Cycle Cycle threshold method ( Livak and Schmittgen 2001 using GAPDH as internal control once demonstrated that the efficiency for the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134165 16242643 177078 14535 7873 NOS2A iNOS iNOS 0 2.5 iNOS caspase-3 -8 and -9 mRNA expression levels are not modulated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134166 16242643 177080 14535 7873 NOS2A iNOS iNOS 7 2.5 Among them the down-regulation of caspases and iNOS and the up-regulation of Bcl-2 have been documented recently ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134167 16242643 177080 1576 990 BCL2 Bcl-2 Bcl-2 12 6.2 the down-regulation of caspases and iNOS and the up-regulation of Bcl-2 have been documented recently ( Wang et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134168 16242643 177081 14535 7873 NOS2A iNOS iNOS 22 2.5 cell death we first analyzed the pattern of expression of iNOS caspase-3 -8 and -9 and the antiapoptotic gene Bcl-2 in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134169 16242643 177081 1576 990 BCL2 Bcl-2 Bcl-2 31 6.2 of iNOS caspase-3 -8 and -9 and the antiapoptotic gene Bcl-2 in malonate-treated cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134170 16242643 177082 14535 7873 NOS2A iNOS iNOS 28 2.5 in cell viability does not modify the expression of the iNOS caspase-3 -8 and -9 genes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134171 16242643 177083 1576 990 BCL2 Bcl-2 Bcl-2 12 6.2 mM malonate caused a significant down-regulation of the antiapoptotic gene Bcl-2 ( Fig 6 B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134172 16242643 177085 1576 990 BCL2 Bcl-2 Bcl-2 10 6.2 Therefore we studied whether minocycline would prevent the down-regulation of Bcl-2 gene expression induced by malonate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134173 16242643 177086 1576 990 BCL2 Bcl-2 Bcl-2 20 6.2 lack of protective effect failed to block the down-regulation of Bcl-2 caused by malonate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134175 16242643 177091 14535 7873 NOS2A iNOS iNOS 18 2.5 mRNA expression of caspase-3 -8 and -9 as well as iNOS it decreases the mRNA of the antiapoptotic protein Bcl-2 an 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134176 16242643 177091 1576 990 BCL2 Bcl-2 Bcl-2 27 6.2 as iNOS it decreases the mRNA of the antiapoptotic protein Bcl-2 an effect that was not abrogated by minocycline 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134188 16242643 177110 7333 11920 FAS FAS Fas 23 0.3 hydroperoxide phenylarsine oxide or non-oxidative (Ca/Pi, Ca Pi t-Bid Bid Fas mechanism ( Chu et al. 2005 Wang et al. 2003 2 JUMiner_v2.2 1 0 0 2 3594 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:3594|FASN|0.000535752139405238<>ScoreDetail__11920|FAS|0.000520118217391753__3594|FASN|0.000535752139405238__ 0 0 0 0 0 134192 16242643 177114 14535 7873 NOS2A iNOS iNOS 39 2.5 be modulated by minocycline after different neurotoxic stimuli such as iNOS and several members of the caspase family ( Chen et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134193 16242643 177115 14535 7873 NOS2A iNOS iNOS 12 2.5 no changes in the expression of the genes coding for iNOS caspase-3 -8 and -9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134194 16242643 177116 1576 990 BCL2 Bcl-2 Bcl-2 8 6.2 Conversely we did find a significant down-regulation of Bcl-2 expression after a 24-h malonate exposure 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134195 16242643 177117 1576 990 BCL2 Bcl-2 Bcl-2 8 6.2 It should be noted that the up-regulation of Bcl-2 gene expression has been recently proposed as a mechanism mediating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134196 16242643 177118 1576 990 BCL2 Bcl-2 Bcl-2 22 6.2 present work this drug failed to reverse the down-regulation of Bcl-2 induced by malonate treatment nor induced Bcl-2 expression by itself 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134197 16242643 177118 1576 990 BCL2 Bcl-2 Bcl-2 29 6.2 the down-regulation of Bcl-2 induced by malonate treatment nor induced Bcl-2 expression by itself 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134199 16242643 177149 14535 7873 NOS2A iNOS iNOS 5 2.5 Fig 6._amp_#xa0 Malonate does not affect iNOS caspase-3 -8 and -9 but significantly reduces Bcl-2 mRNA expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134200 16242643 177149 1576 990 BCL2 Bcl-2 Bcl-2 13 6.2 not affect iNOS caspase-3 -8 and -9 but significantly reduces Bcl-2 mRNA expression levels mRNA expression in malonate-treated cerebellar granular cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134201 16242643 177150 14535 7873 NOS2A iNOS iNOS 8 2.5 (A) A Lack of effects of malonate on the iNOS caspase-3 -8 and -9 mRNA expression levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134202 16242643 177151 1576 990 BCL2 Bcl-2 Bcl-2 5 6.2 (B) B Effect of malonate on Bcl-2 mRNA expression levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 134203 16242643 177152 1576 990 BCL2 Bcl-2 Bcl-2 6 6.2 Minocycline pre-treatment fails to avoid the Bcl-2 down-regulation induced by malonate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 129627 16406002 170413 7333 11920 FAS FAS FAS-independent 18 0.3 the activation of caspases and to DNA fragmentation through a FAS-independent and mitochondria-linked pro-apoptotic signal pathway 11 JUMiner_v2.2 1 0 0 2 3594 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:3594|FASN|0.000516190687117816<>ScoreDetail__11920|FAS|0.000483141590469407__3594|FASN|0.000516190687117816__ 0 0 0 0 0 129628 16406002 170415 10824 6204 JUN c-Jun c-Jun 10 1.3 In various cell lines reactive aldehyde-induced apoptosis was accompanied by c-Jun -N-terminal kinase and caspase-3 activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 129629 16406002 170416 926 620 APP amyloid amyloid 12 1.0 lipid aldehyde-mediated _amp_#x3b2 PKC activation induced an increase in intracellular amyloid production 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 129634 16406002 170443 523 381 AKR1B1 AKR1B1 AKR1B1 9 1.1 At a first glance compared to CR the enzyme AKR1B1 (previously previously named aldose reductase from the AKR superfamily exhibits 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 129636 16406002 170444 523 381 AKR1B1 AKR1B1 AKR1B1 17 1.1 another reactive lipid aldehyde HNE from ONE may indicate that AKR1B1 is the more important catalyst for ONE and GS-ONE reduction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 129643 16406002 170452 523 381 AKR1B1 AKR1B1 AKR1B1 7 1.1 HNE in turn is a substrate for AKR1B1 (carbonyl carbonyl reduction and/or and or ALDH (aldehyde aldehyde dehydrogenation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 129645 16406002 170458 523 381 AKR1B1 AKR1B1 AKR1B1 27 1.1 4-oxonon-2-enal GSH = reduced glutathione AR = aldose reductase (AKR1B1); AKR1B1 ALDH = aldehyde dehydrogenase CR = carbonyl reductase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113357 16624679 147569 20996 11179 SOD1 SOD1 SOD1 4 3.7 G93A Cu/Zn Cu Zn superoxide dismutase (SOD1), SOD1 a human mutant SOD1 associated with familial amyotrophic lateral sclerosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113358 16624679 147569 20996 11179 SOD1 SOD1 SOD1 8 3.7 Cu/Zn Cu Zn superoxide dismutase (SOD1), SOD1 a human mutant SOD1 associated with familial amyotrophic lateral sclerosis increased the toxicity of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113363 16624679 147583 20221 10990 SLC25A4 ANT ANT 35 0.0 mitochondrial ETC the F0F1-ATPase and the adenine nucleotide translocator (ANT) ANT ( Fig 1 1 JUMiner_v2.2 1 1 adenine nucleotide translocator 0 0 0 0 0 0 0 0 113369 16624679 147589 20996 11179 SOD1 SOD1 SOD1 11 3.7 have mutant forms of Cu/Zn Cu Zn superoxide dismutase (SOD1), SOD1 a free radical-scavenging enzyme that converts the superoxide anion radical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113370 16624679 147590 20996 11179 SOD1 SOD1 SOD1 7 3.7 Apparently the motor neuron toxicity of mutant SOD1 is due to a _amp_#x201c gain of function(s)_amp_#x201d; function s 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113371 16624679 147591 20996 11179 SOD1 SOD1 SOD1 14 3.7 oxidative chemistry and/or and or misfolding and aggregation of mutant SOD1 11 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113372 16624679 147592 20996 11179 SOD1 SOD1 SOD1 3 3.7 The identification of SOD1 mutations as a cause of ALS has served for creating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113374 16624679 147592 20996 11179 SOD1 SOD1 SOD1 24 3.7 experimental models of the disease expressing mutant forms of human SOD1 in laboratory animals and cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113376 16624679 147596 20996 11179 SOD1 SOD1 SOD1 17 3.7 conversion more in NSC-34 motoneuronal cells expressing mutant (G93A) G93A SOD1 than in those expressing wild-type (wt) wt SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113377 16624679 147596 20996 11179 SOD1 SOD1 SOD1 24 3.7 (G93A) G93A SOD1 than in those expressing wild-type (wt) wt SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113378 16624679 147603 20996 11179 SOD1 SOD1 SOD1 12 3.7 stably expressing wild-type (wt) wt or mutant (G93A) G93A human SOD1 were generated and checked for SOD1 expression as previously described 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113379 16624679 147603 20996 11179 SOD1 SOD1 SOD1 18 3.7 mutant (G93A) G93A human SOD1 were generated and checked for SOD1 expression as previously described 43 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113385 16624679 147644 20996 11179 SOD1 SOD1 SOD1 11 3.7 lines stably transfected with cDNAs of human wt/G93A wt G93A SOD1 were generated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113386 16624679 147645 20996 11179 SOD1 SOD1 SOD1 7 3.7 Western blotting indicated similar levels of murine SOD1 protein in all the lines wt or the G93A mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113387 16624679 147645 20996 11179 SOD1 SOD1 SOD1 22 3.7 lines wt or the G93A mutant form of the human SOD1 protein was expressed at comparable levels ( Fig 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113388 16624679 147663 20996 11179 SOD1 SOD1 SOD1 8 3.7 The greater susceptibility of cells transfected with G93A SOD1 to inhibition of complex I of the ETC persisted after 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113390 16624679 147679 20996 11179 SOD1 SOD1 SOD1 7 3.7 To see why the presence of G93A SOD1 increased the motor neuron cells_amp_#x2019 susceptibility to rotenone we considered 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113395 16624679 147692 20996 11179 SOD1 SOD1 SOD1 28 3.7 toxin for motor neurons of humans with mutant forms of SOD1 and for unraveling the toxicity of these mutant forms 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113405 16624679 147717 20996 11179 SOD1 SOD1 SOD1 13 3.7 in the toxic _amp_#x201c gain of function_amp_#x201d of mutant SOD1(s) SOD1 s 11 free radical scavengers were protective in several models 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113406 16624679 147718 20996 11179 SOD1 SOD1 SOD1 17 3.7 might affect the mitochondria is reinforced by the finding that SOD1 also localizes in the mitochondrial intermembrane space and matrix 39 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113407 16624679 147718 20996 11179 SOD1 SOD1 SOD1 35 3.7 space and matrix 39 48 and 51 and that mutant SOD1 forms aggregates in the matrix 51 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113411 16624679 147722 20221 10990 SLC25A4 ANT ANT 2 0.0 For example ANT changes its conformation after oxidative stress and this promotes opening 1 JUMiner_v2.2 1 1 adenine nucleotide translocator 0 0 0 0 0 0 0 0 113412 16624679 147724 1576 990 BCL2 Bcl-2 Bcl-2 1 1.3 Interestingly Bcl-2 which has protective activity against oxidative stress 24 and prevents 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113413 16624679 147724 20996 11179 SOD1 SOD1 SOD1 32 3.7 of mitochondrial membrane potential 45 and 49 was trapped by SOD1 aggregates in spinal cord mitochondria of transgenic SOD1 mice and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113414 16624679 147724 20996 11179 SOD1 SOD1 SOD1 40 3.7 trapped by SOD1 aggregates in spinal cord mitochondria of transgenic SOD1 mice and in spinal cord homogenates from human samples 40 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113415 16624679 147725 20996 11179 SOD1 SOD1 SOD1 26 3.7 factor for motor neurons of individuals carrying the mutant G93A SOD1 and might act in concert with other genetic defects associated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113417 16624679 147733 20221 10990 SLC25A4 ANT ANT 12 0.0 released into the cytosol via the adenine nucleotide translocator (ANT) ANT and the _amp_#x201c voltage-dependent_amp_#x201d anion channel (VDAC), VDAC which are 1 JUMiner_v2.2 1 1 adenine nucleotide translocator 0 0 0 0 0 0 0 0 113418 16624679 147734 23264 1158 TSPO PBR PBR 11 0.3 components of this complex are the peripheral benzodiazepine receptor (PBR), PBR creatine kinase (CK), CK hexokinase II (HK), HK cyclophilin D 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113419 16624679 147734 17080 9257 PPID Cyp-D Cyp-D 20 1.0 kinase (CK), CK hexokinase II (HK), HK cyclophilin D (Cyp-D) Cyp-D and Bax/Bcl-2-like Bax Bcl-2-like proteins (Bax, Bax Bak Bcl-2 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 17082 9259 PPIF 0 113420 16624679 147734 1576 990 BCL2 Bcl-2 Bcl-2-like 22 1.5 II (HK), HK cyclophilin D (Cyp-D) Cyp-D and Bax/Bcl-2-like Bax Bcl-2-like proteins (Bax, Bax Bak Bcl-2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113421 16624679 147734 1514 949 BAK1 BAK Bak 25 0.3 D (Cyp-D) Cyp-D and Bax/Bcl-2-like Bax Bcl-2-like proteins (Bax, Bax Bak Bcl-2 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113422 16624679 147734 1576 990 BCL2 Bcl-2 Bcl-2 26 1.3 (Cyp-D) Cyp-D and Bax/Bcl-2-like Bax Bcl-2-like proteins (Bax, Bax Bak Bcl-2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113424 16624679 147736 23632 12517 UCP1 UCP UCPs 2 0.3 Uncoupling proteins (UCPs) UCPs provide an alternative route for H to re-enter the matrix 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113425 16624679 147737 20996 11179 SOD1 SOD1 SOD1 0 3.7 SOD1 is present in the cytosol and in the mitochondrial intermembrane 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113426 16624679 147738 20996 11179 SOD1 SOD1 SOD1 4 3.7 Fig 2._amp_#xa0 Expression of human SOD1 in the NSC-34 cellular model of FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113427 16624679 147739 20996 11179 SOD1 SOD1 SOD1 23 3.7 lane 2 human wild-type (lane lane 3 or G93A mutant SOD1 (lane lane 4 was done using a polyclonal anti-human SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113428 16624679 147739 20996 11179 SOD1 SOD1 SOD1 32 3.7 SOD1 (lane lane 4 was done using a polyclonal anti-human SOD1 antibody that crossreacts with murine SOD1(mSOD1) SOD1 mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113429 16624679 147739 20996 11179 SOD1 SOD1 SOD1 38 3.7 a polyclonal anti-human SOD1 antibody that crossreacts with murine SOD1(mSOD1) SOD1 mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113430 16624679 147739 20996 11179 SOD1 SOD1 mSOD1 38 2.7 polyclonal anti-human SOD1 antibody that crossreacts with murine SOD1(mSOD1) SOD1 mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113431 16624679 147740 20996 11179 SOD1 SOD1 mSOD1 3 2.7 The positions of mSOD1 and human SOD1(hSOD1) SOD1 hSOD1 are indicated in SDS-PAGE they 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113432 16624679 147740 20996 11179 SOD1 SOD1 SOD1 6 3.7 The positions of mSOD1 and human SOD1(hSOD1) SOD1 hSOD1 are indicated in SDS-PAGE they can be resolved into 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113433 16624679 147740 20996 11179 SOD1 SOD1 hSOD1 6 2.7 The positions of mSOD1 and human SOD1(hSOD1) SOD1 hSOD1 are indicated in SDS-PAGE they can be resolved into two 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113434 16624679 147740 20996 11179 SOD1 SOD1 mSOD1 24 2.7 resolved into two bands due to the faster migration of mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103405 16681429 132323 20996 11179 SOD1 SOD SOD 12 1.9 activity of the following ADEs copper-zinc superoxide dismutase (CuZn CuZn SOD catalase (CAT), CAT glutathione peroxidase (GSH-Px) GSH-Px and glutathione reductase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103406 16681429 132323 3544 1516 CAT CAT CAT 14 1.0 following ADEs copper-zinc superoxide dismutase (CuZn CuZn SOD catalase (CAT), CAT glutathione peroxidase (GSH-Px) GSH-Px and glutathione reductase (GR) GR in 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 103409 16681429 132323 20996 11179 SOD1 SOD1 SOD1 39 3.4 - familial ALS patients with the Leu144Phe mutation in the SOD1 gene FALS (+/+)], asymptomatic carriers with the Leu144Phe mutation in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103410 16681429 132323 20996 11179 SOD1 SOD1 SOD1 51 3.4 FALS (+/+)], asymptomatic carriers with the Leu144Phe mutation in the SOD1 gene (+/-), - and control subjects (-/-) - - 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103411 16681429 132324 20996 11179 SOD1 SOD SOD 12 1.9 the in vitro effect of diethyldithiocarbamate (DDC) DDC on CuZn SOD activity in erythrocytes from FALS patients SALS patients and control 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103413 16681429 132326 20996 11179 SOD1 SOD1 SOD1 1 3.4 The SOD1 gene mutation decreased CuZn SOD and GSH-Px activity (two-way two-way 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103414 16681429 132326 20996 11179 SOD1 SOD SOD 6 1.9 The SOD1 gene mutation decreased CuZn SOD and GSH-Px activity (two-way two-way ANOVA significant mutation effect 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103415 16681429 132327 20996 11179 SOD1 SOD SOD 10 1.9 We noted that the disease also contributed to decreased CuZn SOD activity in SALS patients in comparison with the control group 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103416 16681429 132328 3544 1516 CAT CAT CAT 4 1.0 The disease also influenced CAT and GR activity 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 103418 16681429 132331 20996 11179 SOD1 SOD SOD 4 1.9 Finally DDC inhibited CuZn SOD activity in erythrocytes from control subjects FALS (Leu144Phe) Leu144Phe patients 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 106265 16764863 137583 1552 30000 BBS9 C18 C18 27 0.3 Injector Waters 1525 Binary Solvent Delivery System and Waters Nova-Pak C18 column 300_amp_#xa0 mm_amp_#xa0 _amp_#xd7 _amp_#xa0 3.9_amp_#xa0 mm at 37_amp_#xb0 C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 106267 16764863 137593 6438 3229 EGF EGF EGF-treated 9 0.3 Cells were plated on a previously established layer of EGF-treated astrocytes grown on either 15_amp_#xa0 mm Primaria-coated culture plates (Falcon, 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100182 16877542 128957 20996 11179 SOD1 ALS ALS 1 2.2 Abstract ALS is a fatal paralytic disorder characterized by a progressive loss 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100183 16877542 128958 20996 11179 SOD1 ALS ALS 20 2.2 species-producing enzyme during inflammation is activated in spinal cords of ALS patients and in spinal cords in a genetic animal model 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100184 16877542 128959 20996 11179 SOD1 ALS ALS 8 2.2 We demonstrate that inactivation of NADPH oxidase in ALS mice delays neurodegeneration and extends survival 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100185 16877542 128960 9939 5464 IGF1 IGF1 IGF1 16 2.0 products damage proteins such as insulin-like growth factor 1 (IGF1) IGF1 receptors which are located on motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100186 16877542 128961 9939 5464 IGF1 IGF1 IGF1 15 2.0 data indicate that such an oxidative modification hinders the IGF1/Akt IGF1 Akt survival pathway in motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100187 16877542 128961 543 391 AKT1 AKT Akt 15 0.3 indicate that such an oxidative modification hinders the IGF1/Akt IGF1 Akt survival pathway in motor neurons 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100188 16877542 128962 20996 11179 SOD1 ALS ALS 23 2.2 death and contribute to the selective motor neuronal degeneration in ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100189 16877542 128963 20996 11179 SOD1 ALS ALS 2 2.2 Keywords Akt ALS microglia oxidation non-cell autonomous 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100190 16877542 128963 543 391 AKT1 AKT Akt 1 0.2 Keywords Akt ALS microglia oxidation non-cell autonomous 5 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100191 16877542 128966 20996 11179 SOD1 SOD1 SOD1 1 2.2 Transgenic SOD1 G93A mice [C57BL/6J-TgN(SOD1-G93A)1Gur C57BL 6J-TgN SOD1-G93A 1Gur dl were crossed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100192 16877542 128969 20996 11179 SOD1 SOD1 SOD1 26 2.2 for details about the timeline of behavioral abnormalities in transgenic SOD1 G93A mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100193 16877542 128972 8118 4141 GAPDH GAPDH GAPDH 15 0.0 phox glial fibrillary acidic protein macrophage antigen complex 1 and GAPDH and PCR conditions are presented in Supporting Text 1 JUMiner_v2.2 1 1 gapdh; 0 0 0 0 0 0 0 0 100196 16877542 128999 20996 11179 SOD1 ALS ALS 29 2.2 60.5 _amp_#x000b1 10.2 years and 8.0 _amp_#x000b1 2.6 h respectively ALS group ( n = 6 60.5 _amp_#x000b1 4.2 years and 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100197 16877542 129000 20996 11179 SOD1 ALS ALS 2 2.2 For the ALS patients the mean duration of disease was 19.3 _amp_#x000b1 2.6 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100198 16877542 129006 9939 5464 IGF1 IGF1 IGF1 9 2.0 Phosphorylation of Akt and cell viability in response to IGF1 recombinant and to H 2 O 2 or activated BV2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100199 16877542 129006 543 391 AKT1 AKT Akt 2 0.0 Phosphorylation of Akt and cell viability in response to IGF1 recombinant and to 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100200 16877542 129014 20996 11179 SOD1 ALS ALS 9 2.2 NADPH Oxidase Is Up-Regulated in Inflamed Spinal Cords of ALS Mice 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100201 16877542 129015 20996 11179 SOD1 SOD1 SOD1 28 2.2 stages of the disease in transgenic mice expressing mutant human SOD1 with a substitution of glycine to alanine in position 93 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100202 16877542 129015 20996 11179 SOD1 SOD1 SOD1 39 2.2 a substitution of glycine to alanine in position 93 (SOD1 SOD1 G93A the most widely studied model of ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100203 16877542 129015 20996 11179 SOD1 ALS ALS 48 2.2 93 (SOD1 SOD1 G93A the most widely studied model of ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100204 16877542 129016 20996 11179 SOD1 ALS ALS 17 2.2 cord which carries the brunt of the pathology in this ALS model was determined by analyzing its catalytic subunit gp91 phox 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100205 16877542 129017 20996 11179 SOD1 SOD1 SOD1 18 2.2 whole-tissue extracts of spinal cord rose over time in transgenic SOD1 G93A mice ( Fig 1 A B D and E 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100206 16877542 129018 20996 11179 SOD1 SOD1 SOD1 32 2.2 in membrane fractions of spinal cord extracts from symptomatic transgenic SOD1 G93A mice ( Fig 1 C indicating that this cytosolic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100208 16877542 129020 20996 11179 SOD1 SOD1 SOD1 9 2.2 Histological evaluation of the spinal cord of symptomatic transgenic SOD1 G93A mice showed numerous gp91 phox -positive cells primarily in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100209 16877542 129023 20996 11179 SOD1 SOD1 SOD1 7 2.2 NADPH Oxidase Causes Protein Oxidation in Transgenic SOD1 G93A Mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100210 16877542 129024 20996 11179 SOD1 SOD1 SOD1 12 2.2 characterized the status of spinal cord NADPH oxidase in transgenic SOD1 G93A mice by probing for formation of ROS and evidence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100213 16877542 129026 20996 11179 SOD1 SOD1 SOD1 5 2.2 In contrast in symptomatic transgenic SOD1 G93A mice carrying the wild-type gp91 phox allele (SOD SOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100214 16877542 129026 20996 11179 SOD1 SOD SOD 14 2.2 SOD1 G93A mice carrying the wild-type gp91 phox allele (SOD SOD G93A /gp91 gp91 phox spinal cord ethidium fluorescence was intense 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100215 16877542 129027 20996 11179 SOD1 SOD1 SOD1 3 2.2 In symptomatic transgenic SOD1 G93A mice carrying the nonfunctional mutant allele (SOD SOD G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100216 16877542 129027 20996 11179 SOD1 SOD SOD 11 2.2 transgenic SOD1 G93A mice carrying the nonfunctional mutant allele (SOD SOD G93A /gp91 gp91 phox_amp_#x02212 ( 12 spinal cord ethidium fluorescence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100217 16877542 129029 20996 11179 SOD1 SOD1 SOD1 2 2.2 Symptomatic transgenic SOD1 G93A /gp91 gp91 phox mice but not age-matched SOD1 G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100218 16877542 129029 20996 11179 SOD1 SOD1 SOD1 10 2.2 transgenic SOD1 G93A /gp91 gp91 phox mice but not age-matched SOD1 G93A /gp91 gp91 phox_amp_#x02212 mice had increased levels of spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100219 16877542 129030 20996 11179 SOD1 SOD1 SOD1 15 2.2 for protein carbonyl adducts occurred in spinal cord sections from SOD1 G93A /gp91 gp91 phox mice at the level of cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100220 16877542 129031 20996 11179 SOD1 ALS ALS 9 2.2 NADPH Oxidase Induction and Neuronal Protein Carbonylation in Sporadic ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100221 16877542 129032 20996 11179 SOD1 SOD1 SOD1 13 2.2 to determine whether the NADPH oxidase alterations identified in transgenic SOD1 G93A mice were also present in human sporadic ALS the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100222 16877542 129032 20996 11179 SOD1 ALS ALS 22 2.2 transgenic SOD1 G93A mice were also present in human sporadic ALS the most common form of the disease ( 1 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100223 16877542 129033 20996 11179 SOD1 ALS ALS 45 2.2 was _amp_#x02248 3-fold higher and its immunoreactivity robust in sporadic ALS spinal cords ( Fig 2 E 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100224 16877542 129034 3901 1693 CD68 CD68 CD68 12 0.3 latter gp91 phox -positive cells colocalized with the microglial-associated antigen CD68 ( Fig 2 F and were identified in all of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100225 16877542 129034 20996 11179 SOD1 ALS ALS 26 2.2 2 F and were identified in all of the typical ALS loci of neurodegeneration including the anterior horn and the lateral 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100226 16877542 129035 20996 11179 SOD1 ALS ALS 22 2.2 protein carbonyl adducts in postmortem spinal cord sections from sporadic ALS cases which seemed to be mainly associated with large motor 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100227 16877542 129036 20996 11179 SOD1 ALS ALS 20 2.2 for protein carbonyl adducts per lumbar spinal cord section in ALS patients whereas no such immunoreactive motor neurons were seen in 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100228 16877542 129038 20996 11179 SOD1 SOD1 SOD1 10 2.2 Deletion of gp91 phox Mitigates the Disease Phenotype in Transgenic SOD1 G93A Mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100229 16877542 129039 20996 11179 SOD1 SOD1 SOD1 15 2.2 of NADPH oxidase activation on the disease phenotype in the SOD1 G93A mouse model of ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100230 16877542 129039 20996 11179 SOD1 ALS ALS 20 2.2 the disease phenotype in the SOD1 G93A mouse model of ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100231 16877542 129040 20996 11179 SOD1 SOD1 SOD1 1 2.2 Transgenic SOD1 G93A /gp91 gp91 phox_amp_#x02212 mice reached end-stage paralysis (defined defined 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100232 16877542 129040 20996 11179 SOD1 SOD1 SOD1 21 2.2 a loss of the righting reflex later than their transgenic SOD1 G93A /gp91 gp91 phox counterparts ( Fig 3 A which 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100233 16877542 129040 20996 11179 SOD1 SOD1 SOD1 39 2.2 3 A which resulted in a longer lifespan of transgenic SOD1 G93A /gp91 gp91 phox_amp_#x02212 mice (log-rank log-rank test = 15.3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100234 16877542 129042 20996 11179 SOD1 SOD1 SOD1 4 2.2 Compared with end-stage transgenic SOD1 G93A /gp91 gp91 phox mice age-matched transgenic SOD1 G93A /gp91 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100235 16877542 129042 20996 11179 SOD1 SOD1 SOD1 11 2.2 end-stage transgenic SOD1 G93A /gp91 gp91 phox mice age-matched transgenic SOD1 G93A /gp91 gp91 phox_amp_#x02212 mice had _amp_#x02248 50% more anterior 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100236 16877542 129043 20996 11179 SOD1 SOD1 SOD1 23 2.2 the glial cytokine IL-1_amp_#x003b2 did not differ between age-matched transgenic SOD1 G93A /gp91 gp91 phox mice and SOD1 G93A /gp91 gp91 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100237 16877542 129043 20996 11179 SOD1 SOD1 SOD1 29 2.2 between age-matched transgenic SOD1 G93A /gp91 gp91 phox mice and SOD1 G93A /gp91 gp91 phox_amp_#x02212 mice (Fig Fig 7 which is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100238 16877542 129044 20996 11179 SOD1 SOD1 SOD1 14 2.2 the deficit of gp91 phox were the levels of human SOD1 in transgenic SOD1 G93A mice (Fig Fig 7 or the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100239 16877542 129044 20996 11179 SOD1 SOD1 SOD1 17 2.2 gp91 phox were the levels of human SOD1 in transgenic SOD1 G93A mice (Fig Fig 7 or the size of muscle 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100240 16877542 129045 13956 23212 MYH14 myosin myosin 13 2.2 are mainly composed of fast-twitch fibers and by immunostaining for myosin heavy chain we did not observe any obvious alteration in 1 JUMiner_v2.2 1 0 0 2 7605 TotalCon:8<>23212|MYH14|79784|Complete__7599|MYO1E|4643|Complete__7600|MYO1F|4542|No_GeneRif__7603|MYO5B|4645|Complete__7604|MYO5C|55930|No_GeneRif__7605|MYO6|4646|Complete__7608|MYO9A|4649|No_GeneRif__7609|MYO9B|4650|Complete__<>AvaiableGeneRif=5<>BEST:7605|MYO6|0.000485207943838029<>ScoreDetail__7599|MYO1E|0.000437642233725961__7609|MYO9B|0.000474981955342383__7603|MYO5B|0.000320296404023615__23212|MYH14|0.000153049741165879__7605|MYO6|0.000485207943838029__ 0 0 0 0 0 100241 16877542 129047 9939 5464 IGF1 IGF1 IGF1 8 2.0 NADPH Oxidase Impairs the Insulin-Like Growth Factor 1 (IGF1)/Akt IGF1 Akt Pathway in Transgenic SOD1 G93A Mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100242 16877542 129047 20996 11179 SOD1 SOD1 SOD1 12 2.2 Insulin-Like Growth Factor 1 (IGF1)/Akt IGF1 Akt Pathway in Transgenic SOD1 G93A Mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100243 16877542 129047 543 391 AKT1 AKT Akt 8 0.3 NADPH Oxidase Impairs the Insulin-Like Growth Factor 1 (IGF1)/Akt IGF1 Akt Pathway in Transgenic SOD1 G93A Mice 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100244 16877542 129048 20996 11179 SOD1 ALS ALS 12 2.2 explored whether NADPH oxidase-mediated protein modifications might promote neurodegeneration in ALS by damaging essential surviving pathways for motor neurons such as 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100245 16877542 129048 9939 5464 IGF1 IGF1 IGF1 23 2.0 by damaging essential surviving pathways for motor neurons such as IGF1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100246 16877542 129049 9939 5464 IGF1 IGF1 IGF1 1 2.0 After IGF1 was immunoprecipitated from spinal cord extracts it was probed for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100247 16877542 129050 9939 5464 IGF1 IGF1 IGF1 7 2.0 This approach failed to reveal evidence of IGF1 oxidation in any of the studied mouse genotypes (data data 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100248 16877542 129051 9939 5464 IGF1 IGF1 IGF1 11 2.0 carbonyl adducts were evident in the _amp_#x003b1 -chain of the IGF1 tyrosine kinase cognate receptor in the spinal cord of symptomatic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100249 16877542 129051 20996 11179 SOD1 SOD1 SOD1 23 2.2 kinase cognate receptor in the spinal cord of symptomatic transgenic SOD1 G93A /gp91 gp91 phox mice ( Fig 4 A and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100250 16877542 129051 9939 5464 IGF1 IGF1 IGF1 43 2.0 B similar results were obtained for the _amp_#x003b2 -chain of IGF1 receptor (data data not shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100251 16877542 129052 9939 5464 IGF1 IGF1 IGF1 7 2.0 This finding might be quite significant because IGF1 receptors in mouse spinal cords were detected almost exclusively on 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100252 16877542 129053 9939 5464 IGF1 IGF1 IGF1 3 2.0 Contrasting with the IGF1 receptor findings oxidation indices in the intracellular serine/threonine serine threonine 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100253 16877542 129053 9939 5464 IGF1 IGF1 IGF1 16 2.0 in the intracellular serine/threonine serine threonine kinase Akt which transduces IGF1 receptor signaling ( 15 did not differ between symptomatic transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100254 16877542 129053 20996 11179 SOD1 SOD1 SOD1 28 2.2 receptor signaling ( 15 did not differ between symptomatic transgenic SOD1 G93A mice and their nontransgenic littermates 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100255 16877542 129053 543 391 AKT1 AKT Akt 13 0.0 findings oxidation indices in the intracellular serine/threonine serine threonine kinase Akt which transduces IGF1 receptor signaling ( 15 did not differ 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100256 16877542 129054 9939 5464 IGF1 IGF1 IGF1 6 2.0 These results suggest that the entire IGF1 molecular pathway is not oxidatively modified by inflammation in this 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100257 16877542 129054 20996 11179 SOD1 ALS ALS 17 2.2 molecular pathway is not oxidatively modified by inflammation in this ALS model 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100258 16877542 129056 9939 5464 IGF1 IGF1 IGF1 4 2.0 Next we compared selected IGF1 transduction events among the different mouse groups 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100259 16877542 129057 20996 11179 SOD1 SOD1 SOD1 2 2.2 Although mutant SOD1 is expressed in all cells markers of IGF1 transduction such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100260 16877542 129057 9939 5464 IGF1 IGF1 IGF1 10 2.0 Although mutant SOD1 is expressed in all cells markers of IGF1 transduction such as phospho-IGF1 receptor phospho-Akt (data data not shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100261 16877542 129057 20996 11179 SOD1 SOD1 SOD1 52 2.2 smaller glia-like cells in spinal cord sections of symptomatic transgenic SOD1 G93A mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100262 16877542 129058 20996 11179 SOD1 SOD1 SOD1 14 2.2 phospho-IGF1 receptor-immunoreactive cells in spinal cord sections from symptomatic transgenic SOD1 G93A /gp91 gp91 phox mice than from age-matched SOD1 G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100263 16877542 129058 20996 11179 SOD1 SOD1 SOD1 22 2.2 transgenic SOD1 G93A /gp91 gp91 phox mice than from age-matched SOD1 G93A /gp91 gp91 phox_amp_#x02212 mice ( Fig 4 C _amp_#x02013 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100264 16877542 129059 1494 936 BAD BAD BAD 39 0.3 ( Fig 4 H _amp_#x02013 J and smaller phospho-BAD total BAD ratios ( Fig 4 K and L in symptomatic transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100265 16877542 129059 20996 11179 SOD1 SOD1 SOD1 51 2.2 ratios ( Fig 4 K and L in symptomatic transgenic SOD1 G93A /gp91 gp91 phox mice compared with their age-matched SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100266 16877542 129059 20996 11179 SOD1 SOD1 SOD1 60 2.2 SOD1 G93A /gp91 gp91 phox mice compared with their age-matched SOD1 G93A /gp91 gp91 phox_amp_#x02212 counterparts 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100267 16877542 129059 543 391 AKT1 AKT Akt 5 0.0 There were also smaller phospho-Akt total Akt ratios ( Fig 4 F and G as well as 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100268 16877542 129059 543 391 AKT1 AKT Akt 27 0.0 fewer cells that were immunoreactive for a downstream target of Akt phospho-BAD ( Fig 4 H _amp_#x02013 J and smaller phospho-BAD 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100269 16877542 129060 9939 5464 IGF1 IGF1 IGF1 10 2.0 These data further support the idea that oxidative modification of IGF1 receptor in symptomatic transgenic SOD1 G93A /gp91 gp91 phox mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100270 16877542 129060 20996 11179 SOD1 SOD1 SOD1 15 2.2 idea that oxidative modification of IGF1 receptor in symptomatic transgenic SOD1 G93A /gp91 gp91 phox mice is associated with a range 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100271 16877542 129061 9939 5464 IGF1 IGF1 IGF1 4 2.0 Microglial-Derived ROS Recapitulate the IGF1/Akt IGF1 Akt Pathway Defect in Vitro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100273 16877542 129061 543 391 AKT1 AKT Akt 4 0.3 Microglial-Derived ROS Recapitulate the IGF1/Akt IGF1 Akt Pathway Defect in Vitro 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100274 16877542 129062 9939 5464 IGF1 IGF1 IGF1 10 2.0 To test the idea that NADPH oxidase-derived ROS could impair IGF1 pathway function an in vitro cell system using the neuron-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100276 16877542 129063 9939 5464 IGF1 IGF1 IGF1 10 2.0 were briefly incubated with 0.1_amp_#x02013 100 _amp_#x003bc M human recombinant IGF1 in the presence of overnight-preconditioned serum-free medium supplemented with or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100277 16877542 129063 9939 5464 IGF1 IGF1 IGF1 37 2.0 to provide a constant flux of H 2 O 2 IGF1 pathway responsiveness was monitored by Akt phosphorylation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100278 16877542 129063 543 391 AKT1 AKT Akt 43 0.0 H 2 O 2 IGF1 pathway responsiveness was monitored by Akt phosphorylation 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100279 16877542 129064 9939 5464 IGF1 IGF1 IGF1 2 2.0 Exposure to IGF1 caused a dose-dependent phosphorylation of Akt in SH-SY5Y cells ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100280 16877542 129064 543 391 AKT1 AKT Akt 8 0.0 Exposure to IGF1 caused a dose-dependent phosphorylation of Akt in SH-SY5Y cells ( Fig 5 A and B and 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100281 16877542 129065 9939 5464 IGF1 IGF1 IGF1 1 2.0 Conversely IGF1 barely increased Akt phosphorylation in the neuroblastoma cell lines that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100282 16877542 129065 543 391 AKT1 AKT Akt 4 0.0 Conversely IGF1 barely increased Akt phosphorylation in the neuroblastoma cell lines that were exposed to 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100284 16877542 129067 9939 5464 IGF1 IGF1 IGF1-mediated 27 1.5 of H 2 O 2 ( Fig 5 E attenuated IGF1-mediated Akt phosphorylation in the neuroblastoma cell line ( Fig 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100286 16877542 129067 543 391 AKT1 AKT Akt 28 0.2 H 2 O 2 ( Fig 5 E attenuated IGF1-mediated Akt phosphorylation in the neuroblastoma cell line ( Fig 5 C 5 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100287 16877542 129068 9939 5464 IGF1 IGF1 IGF1 13 2.0 to LPS-activated microglial-conditioned medium the Akt phosphorylation response to the IGF1 recombinant remained depressed and at 72 h a reduction of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100288 16877542 129068 9939 5464 IGF1 IGF1 IGF1 31 2.0 a reduction of cell viability indistinguishable from the condition without IGF1 was observed ( Fig 5 F 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100290 16877542 129068 543 391 AKT1 AKT Akt 8 0.0 Upon longer exposure to LPS-activated microglial-conditioned medium the Akt phosphorylation response to the IGF1 recombinant remained depressed and at 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100291 16877542 129069 9939 5464 IGF1 IGF1 IGF1-mediated 5 1.5 However both the alteration of IGF1-mediated Akt phosphorylation and the loss of cell viability mediated by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100292 16877542 129069 543 391 AKT1 AKT Akt 6 0.2 However both the alteration of IGF1-mediated Akt phosphorylation and the loss of cell viability mediated by LPS-activated 5 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100294 16877542 129072 20996 11179 SOD1 ALS ALS 6 2.2 Experimental evidence supports a model for ALS neurodegeneration in which nonneuronal cells such as microglia contribute to 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100296 16877542 129075 20996 11179 SOD1 SOD1 SOD1 3 2.2 Conversely in transgenic SOD1 G93A mice paralleling the worsening of the ALS phenotype there 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100297 16877542 129075 20996 11179 SOD1 ALS ALS 11 2.2 in transgenic SOD1 G93A mice paralleling the worsening of the ALS phenotype there was an intensification of spinal cord microgliosis accompanied 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100298 16877542 129076 20996 11179 SOD1 ALS ALS 30 2.2 of oxidatively damaging nearby macromolecules and cells homed within inflamed ALS tissues 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100299 16877542 129077 20996 11179 SOD1 SOD1 SOD1 20 2.2 were markedly elevated in spinal cord extracts of symptomatic transgenic SOD1 G93A mice for the most part in a NADPH oxidase-dependent 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100300 16877542 129078 20996 11179 SOD1 ALS ALS 19 2.2 was also found in postmortem spinal cords from human sporadic ALS cases ( Fig 2 supporting the conclusion that the occurrence 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100301 16877542 129078 20996 11179 SOD1 ALS ALS 40 2.2 occurrence of inflammation-mediated oxidative damage is not restricted to familial ALS caused by SOD1 mutations but is also a pathological hallmark 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100302 16877542 129078 20996 11179 SOD1 SOD1 SOD1 43 2.2 oxidative damage is not restricted to familial ALS caused by SOD1 mutations but is also a pathological hallmark of the prevalent 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100303 16877542 129078 20996 11179 SOD1 ALS ALS 58 2.2 a pathological hallmark of the prevalent nonfamilial sporadic form of ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100304 16877542 129079 20996 11179 SOD1 SOD1 SOD1 16 2.2 of the gp91 phox subunit of NADPH oxidase in transgenic SOD1 G93A mice eliminates the production of microglial-derived ROS ( Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100305 16877542 129079 20996 11179 SOD1 ALS ALS 39 2.2 M and importantly prolongs survival and retards neurodegeneration in this ALS model ( Fig 3 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100307 16877542 129080 20996 11179 SOD1 SOD1 SOD1 6 2.2 Deletion of gp91 phox in transgenic SOD1 G93A mice did not alter the spinal cord microglial response 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100308 16877542 129080 20996 11179 SOD1 SOD1 SOD1 22 2.2 the spinal cord microglial response or the expression of human SOD1 in transgenic SOD1 G93A mice (Fig Fig 7 which is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100309 16877542 129080 20996 11179 SOD1 SOD1 SOD1 25 2.2 microglial response or the expression of human SOD1 in transgenic SOD1 G93A mice (Fig Fig 7 which is a known determinant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100310 16877542 129080 20996 11179 SOD1 ALS ALS 40 2.2 which is a known determinant of disease severity in this ALS model ( 18 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100311 16877542 129081 20996 11179 SOD1 SOD1 SOD1 7 2.2 Consequently the attenuated phenotype seen in transgenic SOD1 G93A /gp91 gp91 phox_amp_#x02212 mice is attributable to the lack 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100312 16877542 129081 20996 11179 SOD1 SOD1 SOD1 34 2.2 either an impaired microglial response or expression of the human SOD1 G93A transgene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100313 16877542 129082 20996 11179 SOD1 ALS ALS 16 2.2 NADPH oxidase contributes to the degeneration of motor neurons in ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100314 16877542 129083 20996 11179 SOD1 ALS ALS 19 2.2 in the pathogenesis of chronic noninfectious pathological conditions such as ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100315 16877542 129084 20996 11179 SOD1 SOD1 SOD1 12 2.2 magnitude of benefit afforded by gp91 phox deletion in transgenic SOD1 G93A mice argues that targeting neuroinflammation by inhibiting just one 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100316 16877542 129084 20996 11179 SOD1 ALS ALS 41 2.2 not be sufficient to produce robust and lasting neuroprotection in ALS patients 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100318 16877542 129086 20996 11179 SOD1 ALS ALS 5 2.2 However the chronic nature of ALS suggests that neuroinflammation is likely protracted and not as strong 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100319 16877542 129087 20996 11179 SOD1 ALS ALS 29 2.2 oxidative stress with the selective demise of motor neurons in ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100320 16877542 129088 20996 11179 SOD1 ALS ALS 30 2.2 of those already compromised as motor neurons probably are in ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100322 16877542 129090 9939 5464 IGF1 IGF1 IGF1 9 2.0 Relevant to the latter scenario are our results for IGF1 a trophic factor that is known to promote motor neuron 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100323 16877542 129091 9939 5464 IGF1 IGF1 IGF1 9 2.0 In this study we indeed found that receptors for IGF1 were primarily expressed on motor neurons in mouse spinal cords 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100324 16877542 129091 9939 5464 IGF1 IGF1 IGF1 25 2.0 in mouse spinal cords (Fig Fig 8 and that the IGF1 signaling pathway was impaired by a NADPH oxidase-dependent mechanism in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100325 16877542 129091 20996 11179 SOD1 SOD1 SOD1 38 2.2 was impaired by a NADPH oxidase-dependent mechanism in symptomatic transgenic SOD1 G93A mice ( Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100326 16877542 129092 9939 5464 IGF1 IGF1 IGF1 1 2.0 Although IGF1 per se did not seem to be damaged by inflammation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100327 16877542 129092 9939 5464 IGF1 IGF1 IGF1 20 2.0 by inflammation NADPH oxidase did stimulate the oxidative modification of IGF1 receptors ( Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100328 16877542 129093 9939 5464 IGF1 IGF1 IGF1 5 2.0 The ligand-dependent kinase activation of IGF1 receptor relies on its arrangement into a heterotetrameric 2_amp_#x003b1;/2_amp_#x003b2;-chain 2_amp_#x003b1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100329 16877542 129094 9939 5464 IGF1 IGF1 IGF1 9 2.0 It may thus be predicted that oxidation of the IGF1 receptor main extracellular domains (i.e., i.e. the _amp_#x003b1 -chains could 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100330 16877542 129095 9939 5464 IGF1 IGF1 IGF1 28 2.0 molecular events that are normally elicited by ligation of the IGF1 receptor including autophosphorylation and Akt phosphorylation were indeed abated by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100331 16877542 129095 543 391 AKT1 AKT Akt 33 0.0 elicited by ligation of the IGF1 receptor including autophosphorylation and Akt phosphorylation were indeed abated by ROS in a microglial NADPH 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100333 16877542 129096 9939 5464 IGF1 IGF1 IGF1 11 2.0 data also show that microglial NADPH oxidase by impairing the IGF1 signaling pathway renders SH-SY5Y cells in our in vitro system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100335 16877542 129097 20996 11179 SOD1 SOD1 SOD1 33 2.2 to withstand the toxicity of etiologic agents such as mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100336 16877542 129098 9939 5464 IGF1 IGF1 IGF1 3 2.0 Muscle-specific expression of IGF1 stabilizes neuromuscular junctions reduces inflammation in the spinal cord and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100337 16877542 129098 20996 11179 SOD1 SOD1 SOD1 20 2.2 the spinal cord and enhances motor neuronal survival in transgenic SOD1 G93A mice ( 23 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100338 16877542 129099 9939 5464 IGF1 IGF1 IGF1 15 2.0 did not find any evidence that the rescue of the IGF1 pathway by abrogating NADPH oxidase was associated with muscle hypertrophy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100339 16877542 129100 20996 11179 SOD1 SOD1 SOD1 3 2.2 Nevertheless whether transgenic SOD1 G93A mice carrying the gp91 phox null mutation reach end-stage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100340 16877542 129101 20996 11179 SOD1 SOD1 SOD1 3 2.2 Injection of transgenic SOD1 G93A mice with an adeno-associated virus carrying an IGF1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100341 16877542 129101 9939 5464 IGF1 IGF1 IGF1 12 2.0 transgenic SOD1 G93A mice with an adeno-associated virus carrying an IGF1 gene prolongs survival in these animals ( 20 24 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100342 16877542 129102 9939 5464 IGF1 IGF1 IGF1 23 2.0 but instead may blunt the motor neuron survival response to IGF1 in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100343 16877542 129102 20996 11179 SOD1 ALS ALS 25 2.2 may blunt the motor neuron survival response to IGF1 in ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100344 16877542 129103 20996 11179 SOD1 ALS ALS 5 2.2 Perhaps the modest change in ALS progression that is seen in patients treated with human recombinant 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100345 16877542 129103 9939 5464 IGF1 IGF1 IGF1 16 2.0 progression that is seen in patients treated with human recombinant IGF1 ( 25 may be related to the issue raised above 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100346 16877542 129104 9939 5464 IGF1 IGF1 IGF1 10 2.0 It may thus be argued that optimal therapeutic response to IGF1 in diseases such as ALS may rely on a concomitant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100347 16877542 129104 20996 11179 SOD1 ALS ALS 15 2.2 that optimal therapeutic response to IGF1 in diseases such as ALS may rely on a concomitant administration of this trophic factor 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100348 16877542 129114 20996 11179 SOD1 SOD1 SOD1 12 2.2 oxidase stimulates carbonylation of spinal cord motor neurons in transgenic SOD1 G93A mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100349 16877542 129115 20996 11179 SOD1 SOD1 SOD1 29 2.2 E in 1-month-old (asymptomatic) asymptomatic to 4-month-old (end-stage) end-stage transgenic SOD1 (more more ... 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100350 16877542 129117 20996 11179 SOD1 ALS ALS 16 2.2 with motor neuron carbonylation in the spinal cord of sporadic ALS patients 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100351 16877542 129118 20996 11179 SOD1 ALS ALS 23 2.2 spinal cord extracts from six normal controls and six age-matched ALS patients 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100352 16877542 129121 20996 11179 SOD1 SOD1 SOD1 11 2.2 of gp91 phox increases lifespan and lessens neurodegeneration in transgenic SOD1 G93A mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100353 16877542 129122 20996 11179 SOD1 SOD1 SOD1 7 2.2 ( A Survival comparison of transgenic SOD1 G93A /gp91 gp91 phox mice (red) red (122.0 122.0 _amp_#x000b1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100354 16877542 129122 20996 11179 SOD1 SOD1 SOD1 22 2.2 (122.0 122.0 _amp_#x000b1 1.7 days n = 19 and transgenic SOD1 G93A /gp91 gp91 phox_amp_#x02212 littermates (more more ... 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100355 16877542 129124 9939 5464 IGF1 IGF1 IGF1 3 2.0 Modulation of the IGF1/Akt IGF1 Akt pathway by NADPH oxidase-derived ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100356 16877542 129124 543 391 AKT1 AKT Akt 3 0.3 Modulation of the IGF1/Akt IGF1 Akt pathway by NADPH oxidase-derived ROS 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100358 16877542 129125 9939 5464 IGF1 IGF1 IGF1 5 2.0 ( A Immunoprecipitation of IGF1 receptor _amp_#x003b1 -chain followed by OxyBlot (upper upper blot and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100359 16877542 129125 9939 5464 IGF1 IGF1 IGF1 18 2.0 by OxyBlot (upper upper blot and immunoblot for spinal cord IGF1 receptor _amp_#x003b1 -chain (lower lower blot 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100360 16877542 129128 9939 5464 IGF1 IGF1 IGF1 7 2.0 Glucose oxidase- and microglial-derived ROS impair the IGF1 Akt pathway in vitro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100362 16877542 129128 543 391 AKT1 AKT Akt 8 0.2 Glucose oxidase- and microglial-derived ROS impair the IGF1 Akt pathway in vitro 5 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100363 16877542 129129 9939 5464 IGF1 IGF1 IGF1-treated 13 1.5 upper blot and total Akt (lower lower blot immunoblots of IGF1-treated SH-SY5Y cells exposed or not exposed to 75 _amp_#x003bc M 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100364 16877542 129129 543 391 AKT1 AKT Akt 8 0.0 ( A Phospho-Akt (upper upper blot and total Akt (lower lower blot immunoblots of IGF1-treated SH-SY5Y cells exposed or 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 100365 16877542 129130 20996 11179 SOD1 SOD1 SOD1 4 2.2 ROS reactive oxygen species SOD1 superoxide dismutase 1 IGF1 insulin-like growth factor 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100366 16877542 129130 9939 5464 IGF1 IGF1 IGF1 8 2.0 ROS reactive oxygen species SOD1 superoxide dismutase 1 IGF1 insulin-like growth factor 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100368 16877542 129131 20996 11179 SOD1 ALS ALS 0 2.2 ALS is the most common adult-onset paralytic disease and is characterized 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100369 16877542 129133 20996 11179 SOD1 SOD1 SOD1 18 2.2 dominant mutations in the gene for superoxide dismutase 1 (SOD1) SOD1 cause familial ALS ( 2 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100370 16877542 129133 20996 11179 SOD1 ALS ALS 21 2.2 the gene for superoxide dismutase 1 (SOD1) SOD1 cause familial ALS ( 2 3 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100371 16877542 129134 20996 11179 SOD1 SOD1 SOD1 2 2.2 Overexpression of SOD1 mutants in rodents emulate clinical and pathological hallmarks of ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100372 16877542 129134 20996 11179 SOD1 ALS ALS 12 2.2 SOD1 mutants in rodents emulate clinical and pathological hallmarks of ALS through a toxic gain of function ( 4 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100373 16877542 129135 20996 11179 SOD1 SOD1 SOD1 18 2.2 mixture of neuronal and nonneuronal cells expressing wild-type or mutant SOD1 ( 5 investigation of these animals suggested that nonneuronal cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100374 16877542 129136 20996 11179 SOD1 SOD1 SOD1 10 2.2 Corroborating this hypothesis is the demonstration that reduction of mutant SOD1 selectively in microglia extended survival in transgenic SOD1 G37R mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100375 16877542 129136 20996 11179 SOD1 SOD1 SOD1 18 2.2 of mutant SOD1 selectively in microglia extended survival in transgenic SOD1 G37R mice ( 6 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100378 16877542 129141 20996 11179 SOD1 ALS ALS 15 2.2 we undertook the study of NADPH oxidase in both human ALS and one of its genetic models 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 100379 16877542 129142 20996 11179 SOD1 ALS ALS 15 2.2 and mouse postmortem tissues indicate that spinal cord microgliosis in ALS is accompanied with an up-regulation of NADPH oxidase 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136196081569571<>ScoreDetail__5468|IGFALS|0.000485776832861226__11179|SOD1|0.00136196081569571__ 0 0 0 0 0 101476 16895581 130040 20996 11179 SOD1 SOD1 SOD1 24 2.7 either wild-type or mutant Cu/Zn Cu Zn superoxide dismutase (SOD1) SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 94444 17014688 122445 20996 11179 SOD1 SOD1 SOD1 32 1.7 NSC-34 (2) 2 a genetic mouse model of ALS (SOD1(G93A)-transgenic SOD1 G93A -transgenic mice and (3) 3 a group of 31 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 94446 17014688 122447 20996 11179 SOD1 SOD1 SOD1 1 1.7 In SOD1(G93A)-transgenic SOD1 G93A -transgenic mice high-dose oral melatonin delayed disease progression and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87978 17099894 113909 20996 11179 SOD1 SOD1 mSOD1 7 1.4 The mechanisms of human mutant superoxide dismutase-1 (mSOD1) mSOD1 toxicity to motor neurons (MNs) MNs are unresolved 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87979 17099894 113911 22671 11998 TP53 p53 p53 24 0.3 prior to double-strand breaks occurring in nuclear and mitochondrial DNA p53 and p73 are activated in degenerating MNs but without nuclear 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87980 17099894 113911 1002 25361 ARHGAP24 p73 p73 26 0.1 double-strand breaks occurring in nuclear and mitochondrial DNA p53 and p73 are activated in degenerating MNs but without nuclear import 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87981 17099894 113912 1432 13509 AVEN AVEN Aven 25 0.6 within MNs with a blockade of apoptosis possibly mediated by Aven up-regulation 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87982 17099894 113913 20996 11179 SOD1 SOD1 mSOD1 10 1.4 swelling is associated with compromised Na K-ATPase activity and aggregation mSOD1 mouse MNs accumulate mitochondria from the axon terminals and generate 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87983 17099894 113914 20997 11180 SOD2 SOD2 SOD2 13 0.9 cytochrome c oxidase subunit-I and alpha-synuclein as well as nitrated SOD2 accumulate in mSOD1 mouse spinal cord 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87984 17099894 113914 20996 11179 SOD1 SOD1 mSOD1 16 1.4 subunit-I and alpha-synuclein as well as nitrated SOD2 accumulate in mSOD1 mouse spinal cord 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87985 17099894 113915 20996 11179 SOD1 SOD1 mSOD1 2 1.4 Mitochondria in mSOD1 mouse MNs accumulate NADPH diaphorase and inducible nitric oxide synthase 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87986 17099894 113915 14535 7873 NOS2A iNOS iNOS 13 3.2 MNs accumulate NADPH diaphorase and inducible nitric oxide synthase (iNOS)-like iNOS -like immunoreactivity and iNOS gene deletion extends significantly the life 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87987 17099894 113915 14535 7873 NOS2A iNOS iNOS 16 3.2 and inducible nitric oxide synthase (iNOS)-like iNOS -like immunoreactivity and iNOS gene deletion extends significantly the life span of G93A-mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87989 17099894 113917 14535 7873 NOS2A NOS NOS 31 2.7 of MN mitochondria with enhanced toxic potential from distal terminals NOS localization in MN mitochondria and peroxynitrite damage and early degeneration 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000755025876600122<>ScoreDetail__7873|NOS2A|0.000755025876600122__7872|NOS1|0.000525533963771572__ 0 0 0 0 0 87990 17099894 113918 20996 11179 SOD1 SOD1 mSOD1 23 1.4 as participants in the process of MN degeneration caused by mSOD1 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88106 17105868 114226 7333 11920 FAS FAS Fas 1 2.9 The Fas pathway and oxidative stress mediate neuronal death in stroke and 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88109 17105868 114229 7333 11920 FAS FAS Fas 3 2.9 The proapoptotic proteins Fas Fas-associated death domain caspase 8 and caspase 3 were also 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88110 17105868 114229 7333 11920 FAS FAS Fas-associated 4 2.1 The proapoptotic proteins Fas Fas-associated death domain caspase 8 and caspase 3 were also elevated 1 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88117 17105868 114240 1576 990 BCL2 Bcl-2 Bcl-2 9 1.3 The ratio of apoptotic cell death genes Bax to Bcl-2 is increased at both the mRNA and protein level in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88119 17105868 114241 1576 990 BCL2 Bcl-2 Bcl-2 18 1.3 spinal cord mitochondria but not liver mitochondria and binds to Bcl-2 (Pasinelli Pasinelli et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88120 17105868 114242 1576 990 BCL2 Bcl-2 Bcl-2 5 1.3 Altered expression and dysfunction of Bcl-2 may contribute to the activation of mitochondrial apoptosis machinery such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88123 17105868 114243 1576 990 BCL2 Bcl-2 Bcl-2 7 1.3 In support of this idea overexpression of Bcl-2 or the caspase inhibitory protein XIAP prolongs survival and improves 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88124 17105868 114243 24293 592 XIAP XIAP XIAP 13 1.1 this idea overexpression of Bcl-2 or the caspase inhibitory protein XIAP prolongs survival and improves motor performance in ALS mice expressing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88130 17105868 114253 20996 11179 SOD1 SOD1 SOD1 7 2.4 G93A transgenic mice carrying the G93A human SOD1 mutation were obtained from the Jackson Laboratory (Bar Bar Harbor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88131 17105868 114257 7333 11920 FAS FAS Fas 9 2.9 In experiments investigating oxidative stress and activation of the Fas pathway mice received Neu2000 (30 30 mg/kg/day), mg kg day 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88138 17105868 114294 7333 11920 FAS FAS Fas 6 2.9 The following primary antibodies were used Fas FADD (BD BD Bioscience Franklin Lakes NJ cleaved caspase 3 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88139 17105868 114294 6920 3573 FADD FADD FADD 7 1.4 The following primary antibodies were used Fas FADD (BD BD Bioscience Franklin Lakes NJ cleaved caspase 3 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88143 17105868 114328 20996 11179 SOD1 SOD1 SOD1 5 2.4 These mechanisms include mitochondrial dysfunction SOD1 mutations and activation of Ca -permeable ionotropic glutamate receptors which 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88148 17105868 114332 20996 11179 SOD1 SOD1 SOD1 29 2.4 and point mutations in the Cu Zn superoxide dismutase ( SOD1 gene the last of which are present in approximately 20% 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88150 17105868 114333 20996 11179 SOD1 SOD1 SOD1 10 2.4 Two findings in particular suggest a strong link between the SOD1 gene mutation and oxidative stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88152 17105868 114335 4772 26515 COQ10A Q10 Q10 17 0.9 (transgenic transgenic ALS mice administration of antioxidants such as coenzyme Q10 a component of the mitochondrial respiratory chain and creatine an 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88155 17105868 114341 20996 11179 SOD1 SOD1 SOD1 6 2.4 This raises the possibility that the SOD1 mutation not only enhances oxidative stress in lumbar motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88156 17105868 114342 20996 11179 SOD1 SOD1 SOD1 10 2.4 The latter effect may be attributable to interaction of mutant SOD1 and Bcl-2 causing mitochondrial dysfunction and subsequently increased sensitivity to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88157 17105868 114342 1576 990 BCL2 Bcl-2 Bcl-2 12 1.3 effect may be attributable to interaction of mutant SOD1 and Bcl-2 causing mitochondrial dysfunction and subsequently increased sensitivity to oxidative stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88160 17105868 114348 7333 11920 FAS FAS Fas 5 2.9 We found that expression of Fas and FADD were increased selectively in the ventral motor neurons 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88161 17105868 114348 6920 3573 FADD FADD FADD 7 1.4 We found that expression of Fas and FADD were increased selectively in the ventral motor neurons of G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88163 17105868 114349 7333 11920 FAS FAS Fas-signaling 7 1.8 In motor neurons of ALS mice the Fas-signaling pathway remained activated after complete blockade of oxidative stress by 1 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88164 17105868 114351 7333 11920 FAS FAS Fas 9 2.9 In support of this Li blocked activation of the Fas pathway during serum deprivation-induced apoptosis and attenuated motor neuron degeneration 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88165 17105868 114351 7333 11920 FAS FAS Fas 25 2.9 and attenuated motor neuron degeneration as well as activation of Fas caspase 8 and caspase 3 in the spinal cords of 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88167 17105868 114354 543 391 AKT1 AKT1 Akt-1 44 0.0 that result in activation of the serine/threonine serine threonine kinase Akt-1 and phospholipase C gamma (Chalecka-Franaszek Chalecka-Franaszek and Chuang 1999 ~0.425 11 JUMiner_v2.2 1 1 akt1; 0 0 0 0 0 0 0 0 88168 17105868 114357 14727 8023 NTF3 NT3 NT-3 10 1.3 neurotrophins nerve growth factor brain-derived neurotrophic factor neurotrophin 3 (NT-3), NT-3 and NT-4/5 NT-4 5 promote neuronal survival by preventing programmed 11 JUMiner_v2.2 1 0 0 2 8023 TotalCon:3<>8020|NT3|4877|Complete__11186|SORT1|6272|Complete__8023|NTF3|4908|Complete__<>AvaiableGeneRif=3<>BEST:8023|NTF3|0.000520781159670417<>ScoreDetail__8023|NTF3|0.000520781159670417__11186|SORT1|0.000261597488664109__8020|NT3|3.17087865047405e-05__ 0 0 0 0 0 88169 17105868 114357 14728 8024 NTF4 NT-4/5 NT-4/5 12 1.3 growth factor brain-derived neurotrophic factor neurotrophin 3 (NT-3), NT-3 and NT-4/5 NT-4 5 promote neuronal survival by preventing programmed cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88170 17105868 114357 14728 8024 NTF4 NT4 NT-4 12 1.3 factor brain-derived neurotrophic factor neurotrophin 3 (NT-3), NT-3 and NT-4/5 NT-4 5 promote neuronal survival by preventing programmed cell death or 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88171 17105868 114361 7333 11920 FAS FAS Fas 11 2.9 conclusion the present study suggests that oxidative stress and the Fas death pathway constitute two separate routes of the motor neuron 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88172 17105868 114363 7333 11920 FAS FAS Fas 1 2.9 The Fas pathway is slowly activated even in the blockade of oxidative 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88173 17105868 114365 7333 11920 FAS FAS Fas 7 2.9 Thus targeting both oxidative stress and the Fas apoptosis pathway with concurrent treatment with Neu2000 and Li may 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88176 17105868 114376 7333 11920 FAS FAS Fas 7 2.9 A Western blot analysis showing expression of Fas FADD and actin in lumbar segments from control or G93A 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88177 17105868 114376 6920 3573 FADD FADD FADD 8 1.4 A Western blot analysis showing expression of Fas FADD and actin in lumbar segments from control or G93A transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88178 17105868 114377 7333 11920 FAS FAS Fas 2 2.9 Levels of Fas (b) b and FADD (c) c were measured and scaled 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88179 17105868 114377 6920 3573 FADD FADD FADD 5 1.4 Levels of Fas (b) b and FADD (c) c were measured and scaled to actin mean _amp_#177 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88180 17105868 114379 6920 3573 FADD FADD FADD 4 1.4 Western blot analysis of FADD and Fas after immunoprecipitation with Fas antibody in the same 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88181 17105868 114379 7333 11920 FAS FAS Fas 6 2.9 Western blot analysis of FADD and Fas after immunoprecipitation with Fas antibody in the same samples shown 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88182 17105868 114379 7333 11920 FAS FAS Fas 10 2.9 Western blot analysis of FADD and Fas after immunoprecipitation with Fas antibody in the same samples shown above (d) d 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88183 17105868 114380 7333 11920 FAS FAS Fas 22 2.9 (b) b at 12 weeks of age after immuno-labeling with Fas antibody 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88184 17105868 114381 7333 11920 FAS FAS Fas 4 2.9 Note increased levels of Fas in the motor neurons (arrows) arrows from G93A mice 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88185 17105868 114383 3532 1509 CASP8 caspase-8 caspase-8 8 3.0 C Western blot analysis showing expression of cleaved caspase-8 cleaved caspase-3 and actin in lumbar segments from control or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88186 17105868 114395 6920 3573 FADD FADD FADD 5 1.4 C Western blot analysis of FADD after immunoprecipitation (IP) IP with Fas antibody cleaved caspase 8 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88187 17105868 114395 7333 11920 FAS FAS Fas 10 2.9 Western blot analysis of FADD after immunoprecipitation (IP) IP with Fas antibody cleaved caspase 8 cleaved caspase 3 and actin in 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88188 17105868 114403 7333 11920 FAS FAS Fas 5 2.9 F Western blot analysis of Fas FADD cleaved caspase 8 cleaved caspase 3 and actin in 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88189 17105868 114403 6920 3573 FADD FADD FADD 6 1.4 F Western blot analysis of Fas FADD cleaved caspase 8 cleaved caspase 3 and actin in lumbar 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88190 17105868 114423 7333 11920 FAS FAS Fas 2 2.9 Fas- and Fas ligand-mediated apoptosis plays a role in neuronal loss in animal 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88191 17105868 114424 7333 11920 FAS FAS Fas 4 2.9 We examined whether the Fas pathway would mediate apoptosis in ALS mice 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88193 17105868 114425 7333 11920 FAS FAS Fas 2 2.9 Expression of Fas and its cytoplasmic adaptor protein FADD and Fas-FADD interaction were 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88194 17105868 114425 6920 3573 FADD FADD FADD 8 1.4 Expression of Fas and its cytoplasmic adaptor protein FADD and Fas-FADD interaction were also increased in the lumbar spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88195 17105868 114426 7333 11920 FAS FAS Fas 3 2.9 Immunohistochemistry revealed that Fas expression was increased selectively in large spinal motor neurons of 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88196 17105868 114429 7333 11920 FAS FAS Fas 4 2.9 These findings suggest that Fas FADD caspase 8 and caspase 3 are activated in spinal 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88197 17105868 114429 6920 3573 FADD FADD FADD 5 1.4 These findings suggest that Fas FADD caspase 8 and caspase 3 are activated in spinal motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88199 17105868 114430 7333 11920 FAS FAS Fas-signaling 4 1.8 No activation of the Fas-signaling molecules in G93A mice was detectable at 16 weeks of 1 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88200 17105868 114440 7333 11920 FAS FAS Fas 9 2.9 We also investigated whether serum deprivation would activate the Fas apoptosis pathway and whether this activation was sensitive to Li 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88201 17105868 114441 6920 3573 FADD FADD FADD 2 1.4 Interaction of FADD with Fas cleaved caspase 8 and cleaved caspase 3 were 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88202 17105868 114441 7333 11920 FAS FAS Fas 4 2.9 Interaction of FADD with Fas cleaved caspase 8 and cleaved caspase 3 were all increased 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88204 17105868 114445 7333 11920 FAS FAS Fas 15 2.9 the diet slightly but statistically insignificantly attenuated the increase in Fas FADD and cleaved caspase 8 and caspase 3 in the 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88205 17105868 114445 6920 3573 FADD FADD FADD 16 1.4 diet slightly but statistically insignificantly attenuated the increase in Fas FADD and cleaved caspase 8 and caspase 3 in the lumbar 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88206 17105868 114446 7333 11920 FAS FAS Fas 12 2.9 noteworthy that daily administration of Li completely blocked activation of Fas and its downstream mediators in G93A mice 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88207 17105868 114447 7333 11920 FAS FAS Fas 18 2.9 Neu2000 can block both oxidative stress and activation of the Fas apoptosis pathway induced in the spinal cords of G93A mice 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 88210 17105868 114469 20996 11179 SOD1 SOD SOD 24 1.9 DIV days in vitro BSO DL -buthionine- S R -sulfoximine SOD superoxide dismutase LDH lactate dehydrogenase FADD Fas-associated death domain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88211 17105868 114469 6920 3573 FADD FADD FADD 30 1.4 -buthionine- S R -sulfoximine SOD superoxide dismutase LDH lactate dehydrogenase FADD Fas-associated death domain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88212 17105868 114469 7333 11920 FAS FAS Fas-associated 31 2.1 S R -sulfoximine SOD superoxide dismutase LDH lactate dehydrogenase FADD Fas-associated death domain 1 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000846066197386271<>ScoreDetail__11920|FAS|0.000846066197386271__3594|FASN|0.00060731585747676__ 0 0 0 0 0 79986 17127561 103313 7643 3769 FMO1 FMO1 FMO1 3 3.4 Increased incidence of FMO1 gene single nucleotide polymorphisms in sporadic amyotrophic lateral sclerosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 79988 17127561 103318 7643 3769 FMO1 FMO1 FMO1 2 3.4 The human FMO1 gene presents 20 single nucleotide polymorphisms (SNPs) SNPs located in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 79989 17127561 103319 7643 3769 FMO1 FMO1 FMO1 1 3.4 The FMO1 gene has also recently been found underexpressed in spinal cord 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 79991 17127561 103320 7643 3769 FMO1 FMO1 FMO1 18 3.4 allelic and genotypic frequency of two 3'UTR SNPs of the FMO1 gene in sporadic ALS patients compared to a healthy control 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 79993 17127561 103321 7643 3769 FMO1 FMO1 FMO1 29 3.4 controls (p_lt_0.01), p_lt_0.01 suggesting that specific allelic variants of the FMO1 gene might be associated to susceptibility to develop ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72472 17150307 92627 10824 6204 JUN AP-1 AP-1 8 2.8 In addition GSH depletion enhanced oxidative stress markers AP-1 transcriptional activation c-Jun c-Fos and HO-1 expression in NSC34 cells 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.000645032050978163<>ScoreDetail__3796|FOS|0.000618551383058785__3797|FOSB|0.000580266731819423__6205|JUNB|0.000545089770551059__6204|JUN|0.000645032050978163__6206|JUND|0.000507183782798545__ 0 0 0 0 0 72473 17150307 92627 10824 6204 JUN c-Jun c-Jun 11 2.8 addition GSH depletion enhanced oxidative stress markers AP-1 transcriptional activation c-Jun c-Fos and HO-1 expression in NSC34 cells analyzed by a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72474 17150307 92627 9462 5013 HMOX1 HO-1 HO-1 14 1.0 enhanced oxidative stress markers AP-1 transcriptional activation c-Jun c-Fos and HO-1 expression in NSC34 cells analyzed by a luciferase reporter western 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72475 17150307 92628 480 8768 AIFM1 AIF AIF 11 0.6 of GSH decreased mitochondrial function facilitated apoptosis inducing factor (AIF) AIF translocation cytochrome c release and caspase 3 activation and consequently 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72477 17150307 92629 480 8768 AIFM1 AIF AIF 28 0.6 the spinal cord and motor neuron cells is correlated with AIF translocation caspase 3 activation and motor neuron degeneration during ALS-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72482 17150307 92634 20996 11179 SOD1 SOD1 SOD1 4 3.2 Mutations of Cu Zn-superoxide dismutase (SOD1) SOD1 gene cause motor neuron degeneration and have linked to 2_amp_#x02013 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72490 17150307 92642 20996 11179 SOD1 SOD1 SOD1 13 3.2 culture model it has been shown that expression of mutant SOD1 gene decreased cellular levels of GSH suggesting the reduction in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72491 17150307 92642 20996 11179 SOD1 SOD1 SOD1-mediated 31 2.2 the reduction in GSH bioavailability may participate in the mutant SOD1-mediated motor neuron degeneration ( Lee et al. 2001 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72503 17150307 92690 4682 2197 COL1A1 collagen collagen 12 0.3 Methods Adhesion assay Twenty four-well plates were coated with fibronectin collagen or laminin overnight in 1_amp_#x000d7 phosphate buffer solution (PBS) PBS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72504 17150307 92699 9462 5013 HMOX1 HO-1 HO-1 10 1.0 The forward and reverse real-time PCR primers for amplification of HO-1 transcripts were 5_amp_#x02019 -CTCACTGGCAGGAAATCATCCC -3_amp_#x02019 and 5_amp_#x02019 -GAGAGGTCACCCAGGTAGCG respectively 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72505 17150307 92712 480 8768 AIFM1 AIF AIF 10 0.6 Western analysis was performed to analyze cytochrome c release and AIF translocation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72506 17150307 92714 480 8768 AIFM1 AIF AIF 24 0.6 incubated with specific antibodies overnight at 4 _amp_#x000b0 C (AIF, AIF cytochrome c and active caspase 3 antibodies were all at 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72515 17150307 92746 10824 6204 JUN AP-1 AP-1 3 2.8 EA treatment enhanced AP-1 transcriptional activation as detected by a luciferase reporter gene assay 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.000645032050978163<>ScoreDetail__3796|FOS|0.000618551383058785__3797|FOSB|0.000580266731819423__6205|JUNB|0.000545089770551059__6204|JUN|0.000645032050978163__6206|JUND|0.000507183782798545__ 0 0 0 0 0 72516 17150307 92746 10824 6204 JUN c-Jun c-Jun 18 2.8 detected by a luciferase reporter gene assay ( Figure 3A c-Jun ( Figure 3B and c-Fos expression (data data not shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72517 17150307 92747 9462 5013 HMOX1 HO-1 HO-1 5 1.0 Similarly GSH depletion also increased HO-1 expression as detected by quantitative real-time PCR reaction and western 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72518 17150307 92755 480 8768 AIFM1 AIF AIF 4 0.6 Results GSH depletion promoted AIF redistribution cytochrome c release caspase 3 activation and apoptotic cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72519 17150307 92756 480 8768 AIFM1 AIF AIF 12 0.6 nuclear fractionations coupled with western analysis showed an increase of AIF translocation to nucleus following GSH depletion in NSC34 cells ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72520 17150307 92757 480 8768 AIFM1 AIF AIF 6 0.6 Immunohistochemical staining confirmed the increase of AIF translocation to the nucleus from the mitochondria upon GSH depletion 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72526 17150307 92769 480 8768 AIFM1 AIF AIF 5 0.6 Decreased GSH was associated with AIF nuclear translocation caspase 3 activation and motor neuron cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72530 17150307 92778 480 8768 AIFM1 AIF AIF 8 0.6 Reduction in GSH was associated with redistribution of AIF from mitochondria to nuclei 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72537 17150307 92798 10824 6204 JUN c-Jun c-Jun 13 2.8 depletion increased the expression of the early oxidative stress markers c-Jun c-Fos (data data not shown and AP-1 activation ( Figure 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72538 17150307 92798 10824 6204 JUN AP-1 AP-1 19 2.8 oxidative stress markers c-Jun c-Fos (data data not shown and AP-1 activation ( Figure 3 and secondary oxidative stress markers such 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.000645032050978163<>ScoreDetail__3796|FOS|0.000618551383058785__3797|FOSB|0.000580266731819423__6205|JUNB|0.000545089770551059__6204|JUN|0.000645032050978163__6206|JUND|0.000507183782798545__ 0 0 0 0 0 72539 17150307 92798 9462 5013 HMOX1 HO-1 HO-1 32 1.0 ( Figure 3 and secondary oxidative stress markers such as HO-1 expression ( Figure 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72540 17150307 92803 480 8768 AIFM1 AIF AIF 13 0.6 cell death mechanisms potentially induced by GSH depletion we assessed AIF redistribution and found that there was an increase in AIF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72541 17150307 92803 480 8768 AIFM1 AIF AIF 23 0.6 AIF redistribution and found that there was an increase in AIF translocation from mitochondria to nuclei upon GSH depletion ( Figure 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72542 17150307 92804 480 8768 AIFM1 AIF AIF 0 0.6 AIF is a flavoprotein residing in mitochondrial intermembrane ( Cande et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72543 17150307 92805 480 8768 AIFM1 AIF AIF 2 0.6 Translocation of AIF initiates cell apoptosis by cleavage internucleosomal DNA to relative large 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72544 17150307 92806 480 8768 AIFM1 AIF AIF 0 0.6 AIF nuclear translocation has been observed in a variety of cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72545 17150307 92807 480 8768 AIFM1 AIF AIF 1 0.6 The AIF redistribution detected in EA treated cells and also observed in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72546 17150307 92808 480 8768 AIFM1 AIF AIF 13 0.6 coupled with increased oxidative stress by mutant G93A-SOD1 that facilitates AIF nuclear translocation may underlie some of the events linked to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72555 17150307 92817 20996 11179 SOD1 SOD SOD 11 2.2 significantly treatment of ALS-like transgenic mice with antioxidants such as SOD and catalase mimetics ( Jung et al. 2001 DMPO ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72561 17150307 92844 480 8768 AIFM1 AIF AIF 4 0.6 Figure 9 Redistribution of AIF and active caspase 3 in motor neuron cells of ALS-like 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72563 17150307 92846 480 8768 AIFM1 AIF AIF 0 0.6 AIF Apoptosis Inducing Factor ALS Amyotrophic Lateral Sclerosis BSO L-Buthionine Sulfoximine 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72565 17150307 92846 20996 11179 SOD1 SOD1 SOD1 41 3.2 Oxidized Glutathione MBM Monobromobimane PFA Paraformaldehyde ROS Reactive Oxygen Species SOD1 Cu Zn-Superoxide Dismutase TUNEL Terminal Deoxynucleotidyl Transferase-Mediated Nick End Labeling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74199 17174478 95170 20997 11180 SOD2 MnSOD MnSOD 4 1.9 Fig 1 The Human MnSOD active site 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74200 17174478 95171 20997 11180 SOD2 MnSOD MnSOD 4 1.9 In the wild type MnSOD structure (PDB PDB code 1N0J the His26 His74 His163 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74202 17174478 95173 14533 7872 NOS1 NOS NOS 4 2.7 Fig 2 Proposed holo -NOS 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74203 17174478 95174 14533 7872 NOS1 nNOS nNOS 5 2.7 a The modular structure of nNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74204 17174478 95175 14533 7872 NOS1 nNOS nNOS 8 2.7 This schematic representation shows the domain organization of nNOS indicated above the regions binding the substrate and cofactors below 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74205 17174478 95176 14533 7872 NOS1 NOS NOS 4 2.7 Fig 3 Proposed holo -NOS assembly and domain movements 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74206 17174478 95177 14533 7872 NOS1 NOS NOS 7 2.7 a Three possible models for dimeric holo -NOS dimeric NOSox and NOSred modules are represented by pairs of 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74208 17174478 95184 17886 9816 RAD50 RAD50 Rad50 5 0.6 b DNA binding straightens the Rad50 coiled coils which favors inter-complex tethering via Rad50 Zn-hooks with 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74209 17174478 95184 17886 9816 RAD50 RAD50 Rad50 13 0.6 straightens the Rad50 coiled coils which favors inter-complex tethering via Rad50 Zn-hooks with extended and parallel (more more ... 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74210 17174478 95185 24250 12791 WRN WRN WRN 2 3.5 Fig 6 WRN exonuclease structure and hexameric ring model 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74211 17174478 95186 24250 12791 WRN WRN WRN 1 3.5 a WRN protein is modular composed of an N-terminal exnuclease domain (blue), 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74212 17174478 95187 24250 12791 WRN WRN WRN 2 3.5 b The WRN exonuclease (more more ... 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74213 17174478 95188 6736 3435 ERCC3 XPB XPB 2 2.4 Fig 7 XPB conserved motifs and structural architecture 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74214 17174478 95189 6736 3435 ERCC3 XPB XPB 5 2.4 a Schematic alignment between Af XPB Af and human XPB Hs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74215 17174478 95189 6736 3435 ERCC3 XPB XPB 9 2.4 a Schematic alignment between Af XPB Af and human XPB Hs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74218 17174478 95192 6736 3435 ERCC3 XPB XPB 9 2.4 Fig 8 Proposed structure-based mechanism whereby damage verification by XPB promotes unwinding of damaged dsDNA for NER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74219 17174478 95192 14635 7965 NR1H2 NER NER 16 1.3 damage verification by XPB promotes unwinding of damaged dsDNA for NER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74220 17174478 95193 6736 3435 ERCC3 XPB XPB 5 2.4 a Schematic model shows how XPB DRD depicted in blue HD1 cyan RED motif red HD2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74224 17174478 95194 6736 3435 ERCC3 XPB XPB 1 2.4 Af XPB Archaeoglobus fulgidus XPB AH auto-inhibitory helix ATLD ataxiatelangiectasia-like disorder BER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74225 17174478 95194 6736 3435 ERCC3 XPB XPB 4 2.4 Af XPB Archaeoglobus fulgidus XPB AH auto-inhibitory helix ATLD ataxiatelangiectasia-like disorder BER base excision repair 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74230 17174478 95194 13444 7230 MRE11A MRE11 Mre11 74 2.3 helicase RNase D conserved domain MMR mismatch repair MRN Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 mtDNA mitochondrial DNA NER nucleotide excision repair NO 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74231 17174478 95194 17886 9816 RAD50 RAD50 Rad50 74 0.6 RNase D conserved domain MMR mismatch repair MRN Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 mtDNA mitochondrial DNA NER nucleotide excision repair NO nitric 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74232 17174478 95194 14453 22948 NLRP2 NBS1 Nbs1 74 1.3 D conserved domain MMR mismatch repair MRN Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 mtDNA mitochondrial DNA NER nucleotide excision repair NO nitric oxide 2 JUMiner_v2.2 1 0 0 2 7652 TotalCon:2<>7652|NBN|4683|Complete__22948|NLRP2|55655|Complete__<>AvaiableGeneRif=2<>BEST:7652|NBN|0.00139471313639611<>ScoreDetail__22948|NLRP2|0.000579150579150579__7652|NBN|0.00139471313639611__ 0 0 0 0 0 74233 17174478 95194 14635 7965 NR1H2 NER NER 78 1.3 mismatch repair MRN Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 mtDNA mitochondrial DNA NER nucleotide excision repair NO nitric oxide e i or nNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74234 17174478 95194 14533 7872 NOS1 nNOS nNOS 88 2.7 NER nucleotide excision repair NO nitric oxide e i or nNOS endothelial inducible or neuronal nitric oxide synthase NOSox NOS catalytic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74235 17174478 95194 14533 7872 NOS1 NOS NOS 97 2.7 or nNOS endothelial inducible or neuronal nitric oxide synthase NOSox NOS catalytic oxygenase module NOSred NOS reductase module NHEJ nonhomologous end 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74236 17174478 95194 14533 7872 NOS1 NOS NOS 102 2.7 neuronal nitric oxide synthase NOSox NOS catalytic oxygenase module NOSred NOS reductase module NHEJ nonhomologous end joining ROS reactive oxygen species 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74237 17174478 95194 20996 11179 SOD1 SOD SOD 113 3.4 reductase module NHEJ nonhomologous end joining ROS reactive oxygen species SOD superoxide dismutase SSBs single-strand breaks TC-NER transcription-coupled nucleotide excision repair 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74248 17174478 95198 20996 11179 SOD1 SOD SOD 15 3.4 rapidly scavenged in the cell by the superoxide dismutase (SOD) SOD enzymes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74249 17174478 95199 20996 11179 SOD1 SOD SOD 0 3.4 SOD enzymes catalyze the disproportionation of superoxide anion radicals to molecular 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74251 17174478 95200 20996 11179 SOD1 SOD SOD 4 3.4 The important role of SOD in the brain was highlighted by genetic inactivation of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74252 17174478 95200 20996 11179 SOD1 SOD SOD 18 3.4 was highlighted by genetic inactivation of the mitochondrial form of SOD manganese SOD (MnSOD), MnSOD in mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74253 17174478 95200 20996 11179 SOD1 SOD SOD 20 3.4 by genetic inactivation of the mitochondrial form of SOD manganese SOD (MnSOD), MnSOD in mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74254 17174478 95200 20997 11180 SOD2 MnSOD MnSOD 21 1.9 inactivation of the mitochondrial form of SOD manganese SOD (MnSOD), MnSOD in mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74255 17174478 95202 20996 11179 SOD1 SOD SOD 3 3.4 Treatment with an SOD mimetic MnTBAP rescued the MnSOD _amp_#x02212;/_amp_#x02212; _amp_#x02212 _amp_#x02212 mutant mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74256 17174478 95202 20997 11180 SOD2 MnSOD MnSOD 8 1.9 Treatment with an SOD mimetic MnTBAP rescued the MnSOD _amp_#x02212;/_amp_#x02212; _amp_#x02212 _amp_#x02212 mutant mice from this systemic pathology and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74257 17174478 95206 20997 11180 SOD2 MnSOD MnSOD 34 1.9 of ROS ( Melov et al. 1998 normally removed by MnSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74259 17174478 95207 20997 11180 SOD2 MnSOD MnSOD 3 1.9 To define how MnSOD controls ROS levels in the cell the molecular mechanism of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74260 17174478 95207 20997 11180 SOD2 MnSOD MnSOD 14 1.9 controls ROS levels in the cell the molecular mechanism of MnSOD has been extensively characterized through combined structural and biochemical studies 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74262 17174478 95208 20997 11180 SOD2 MnSOD MnSOD 5 1.9 The crystal structure of human MnSOD revealed that the enzyme forms a homotetramer ( Borgstahl et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74265 17174478 95226 20997 11180 SOD2 MnSOD MnSOD 18 1.9 suggests that maintenance of the correct hydrogen bond partners in MnSOD is essential for the highly tuned reactivity of the active 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74270 17174478 95232 20996 11179 SOD1 SOD1 SOD1 6 2.9 However mutations in the superoxide dismutase1 (SOD1) SOD1 gene give rise to approximately 20% of FALS cases ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74271 17174478 95232 622 443 ALS2 ALS2 ALS2 39 1.8 et al. 2002 while mutations in several other genes including ALS2 SETX or VAPB cause much rarer forms of FALS ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74272 17174478 95232 19760 445 SETX SETX SETX 40 0.3 al. 2002 while mutations in several other genes including ALS2 SETX or VAPB cause much rarer forms of FALS ( Kunst 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74273 17174478 95232 23868 12649 VAPB VAPB VAPB 42 0.3 while mutations in several other genes including ALS2 SETX or VAPB cause much rarer forms of FALS ( Kunst 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74274 17174478 95233 20996 11179 SOD1 SOD1 SOD1 0 2.9 SOD1 encodes a cytosolic copper zinc superoxide dismutase (Cu,Zn Cu Zn 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74275 17174478 95233 20996 11179 SOD1 SOD SOD 8 3.4 encodes a cytosolic copper zinc superoxide dismutase (Cu,Zn Cu Zn SOD which similar to the mitochondrial MnSOD is responsible for the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74276 17174478 95233 20997 11180 SOD2 MnSOD MnSOD 14 1.9 dismutase (Cu,Zn Cu Zn SOD which similar to the mitochondrial MnSOD is responsible for the disproportionation of harmful superoxide radicals to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74277 17174478 95234 20996 11179 SOD1 SOD SOD 5 3.4 Structural studies on human Cu Zn SOD have revealed that the enzyme is composed of two identical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74278 17174478 95236 20996 11179 SOD1 SOD1 SOD1 3 2.9 A multitude of SOD1 mutations have been identified in FALS patients ( Gaudette et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74279 17174478 95237 20996 11179 SOD1 SOD SOD 10 3.4 The mutations are dispersed throughout the 153 amino acid residue SOD polypeptide ( Deng et al. 1993 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74280 17174478 95239 20996 11179 SOD1 SOD SOD 13 3.4 data support the idea that toxicity of intracellular Cu Zn SOD aggregates may result from protein misfolding or impaired protein degradation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74282 17174478 95242 20996 11179 SOD1 SOD SOD 12 3.4 found in the cytoplasm are strongly immunoreactive to Cu Zn SOD antibodies and cannot be dissociated with strong detergents or reducing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74284 17174478 95244 20996 11179 SOD1 SOD SOD-mediated 6 2.9 One proposed mechanism of FALS mutant SOD-mediated toxicity is the coprecipitation of mutant Cu Zn SOD with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74285 17174478 95244 20996 11179 SOD1 SOD SOD 14 3.4 mutant SOD-mediated toxicity is the coprecipitation of mutant Cu Zn SOD with essential cellular components ( Bruijn et al. 1998 Johnston 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74286 17174478 95244 20996 11179 SOD1 SOD SOD 45 3.4 and this has been demonstrated with the copper chaperone for SOD (CCS)( CCS Kato et al. 2001 nitric oxide synthase (NOS) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74287 17174478 95244 3838 1613 CCS CCS CCS 46 1.2 has been demonstrated with the copper chaperone for SOD (CCS)( CCS Kato et al. 2001 nitric oxide synthase (NOS) NOS and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74288 17174478 95244 14533 7872 NOS1 NOS NOS 55 2.7 (CCS)( CCS Kato et al. 2001 nitric oxide synthase (NOS) NOS and phosphorylated neurofilaments ( Chou et al. 1996 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74289 17174478 95245 20996 11179 SOD1 SOD SOD 11 3.4 is not entirely clear how the many different Cu Zn SOD single-site mutations which are widely dispersed throughout the protein sequence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74290 17174478 95246 20996 11179 SOD1 SOD SOD 15 3.4 combined structural biochemical and biophysical characterizations of two FALS mutant SOD proteins ( DiDonato et al. 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74291 17174478 95247 20996 11179 SOD1 SOD SOD 11 3.4 two FALS proteins represent the two major structural classes of SOD mutations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74292 17174478 95253 926 620 APP amyloid amyloid-like 28 1.0 post-mortem studies of FALS patients and bind dyes that detect amyloid-like structure 11 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 74295 17174478 95277 14533 7872 NOS1 NOS NOS 23 2.7 at the synthesis level by the nitric oxide synthase (NOS) NOS enzymes 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74296 17174478 95278 14533 7872 NOS1 NOS NOS 1 2.7 The NOS enzymes produce NO through the conversion of arginine to citrulline 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74297 17174478 95279 14533 7872 NOS1 NOS NOS 5 2.7 In mammals there are three NOS isoforms which have been named after the activity or tissue 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74298 17174478 95280 14533 7872 NOS1 NOS NOS 1 2.7 These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74299 17174478 95280 14533 7872 NOS1 NOS NOS 5 2.7 These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74300 17174478 95280 14533 7872 NOS1 nNOS nNOS 6 2.7 These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74301 17174478 95280 14533 7872 NOS1 NOS NOS 8 2.7 These NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74302 17174478 95280 14538 7876 NOS3 eNOS eNOS 9 2.2 NOS isoforms are neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS are constitutively 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74303 17174478 95280 14533 7872 NOS1 NOS NOS 12 2.7 neuronal NOS (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS are constitutively expressed isozymes controlling 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74304 17174478 95280 14535 7873 NOS2A iNOS iNOS 13 2.7 (nNOS), nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS are constitutively expressed isozymes controlling basal NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74305 17174478 95280 14533 7872 NOS1 nNOS nNOS 14 2.7 nNOS endothelial NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS are constitutively expressed isozymes controlling basal NO levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74306 17174478 95280 14538 7876 NOS3 eNOS eNOS 16 2.2 NOS (eNOS) eNOS and inducible NOS (iNOS) iNOS nNOS and eNOS are constitutively expressed isozymes controlling basal NO levels and synthesizing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74307 17174478 95280 14535 7873 NOS2A iNOS iNOS 36 2.7 synthesizing NO in response to increases in intracellular calcium levels iNOS is expressed in response to specific cytokines growth factors or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74308 17174478 95281 14533 7872 NOS1 NOS NOS 1 2.7 Functional NOS isozymes are homodimers and each isozyme subunit contains an N-terminal 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74309 17174478 95284 14533 7872 NOS1 NOS NOS 16 2.7 two tetrahydrobiopterin cofactors and a zinc ion that stabilize the NOS dimer interface ( Crane et al. 1998 Raman et al. 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74312 17174478 95288 5353 2615 CYP2B6 P450 P450 10 1.9 NOSred belongs to a large protein family including NADPH-dependent cytochrome P450 reductase and sulfite reductase flavoprotein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74318 17174478 95294 14533 7872 NOS1 nNOS nNOS 11 2.7 biochemistry data elucidated from a fully assembled reductase dimer of nNOS ( Fig 2b c provided critical insights into this domain's 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74319 17174478 95295 14533 7872 NOS1 NOS NOS 16 2.7 regulatory element the C-terminal tail and phosphorylation function to regulate NOS activity which is exquisitely tuned to control NO production ( 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74321 17174478 95297 14538 7876 NOS3 eNOS eNOS 2 2.2 In addition eNOS and nNOS contain the 42_amp_#x02013 45-residue auto-inhibitory helix (AH) AH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74322 17174478 95297 14533 7872 NOS1 nNOS nNOS 4 2.7 In addition eNOS and nNOS contain the 42_amp_#x02013 45-residue auto-inhibitory helix (AH) AH within the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74324 17174478 95298 14538 7876 NOS3 eNOS eNOS 16 2.2 of a protruding _amp_#x003b2 -finger present in the CD of eNOS and nNOS plays an autoinhibitory role in the control of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74325 17174478 95298 14533 7872 NOS1 nNOS nNOS 18 2.7 protruding _amp_#x003b2 -finger present in the CD of eNOS and nNOS plays an autoinhibitory role in the control of NO by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74326 17174478 95299 14538 7876 NOS3 eNOS eNOS 3 2.2 The upregulation of eNOS and nNOS activity is controlled by phosphorylation of both the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74327 17174478 95299 14533 7872 NOS1 nNOS nNOS 5 2.7 The upregulation of eNOS and nNOS activity is controlled by phosphorylation of both the CT and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74328 17174478 95300 14533 7872 NOS1 NOS NOS 6 2.7 An experimentally determined structure of full-length NOS remains elusive perhaps due to the required flexibility of its 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74329 17174478 95301 14533 7872 NOS1 nNOS nNOS 19 2.7 dimer provided a template for a model of the holo -nNOS enzyme assembly ( Garcin et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74330 17174478 95302 14533 7872 NOS1 NOS NOS 1 2.7 The NOS model was built by connecting the dimeric NOSox modules and 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74331 17174478 95302 14533 7872 NOS1 NOS NOS-peptide 14 2.7 built by connecting the dimeric NOSox modules and a CaM NOS-peptide complex ( Aoyagi et al. 2003 to the NOSred structure 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74334 17174478 95308 14533 7872 NOS1 NOS NOS 5 2.7 The flexible hinge region in NOS would serve as the pivot point for this motion ( 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74335 17174478 95310 14533 7872 NOS1 NOS NOS 17 2.7 account for the slow rate of inter-module electron transfer in NOS 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74337 17174478 95311 14533 7872 NOS1 NOS NOS 2 2.7 The dimerization NOS would provide a means for fine-tuning this electron transfer mechanism 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74344 17174478 95321 14533 7872 NOS1 NOS NOS 28 2.7 Koedel and Pfister 1999 through the calcium-mediated activation of neuronal NOS ( Aoyagi et al. 2003 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74347 17174478 95324 14533 7872 NOS1 NOS NOS 17 2.7 accentuated by NO used in signaling and by stimulation of NOS by calcium burst during invasion 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74351 17174478 95331 14635 7965 NR1H2 NER NER 3 1.3 Nucleotide excision repair (NER) NER differs from BER by responding to DNA helix distorting damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74352 17174478 95332 14635 7965 NR1H2 NER NER 2 1.3 Evidence for NER in the brain also includes studies on cerebellar extracts ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74353 17174478 95332 14635 7965 NR1H2 NER NER 25 1.3 1998 and also a few rare hereditary diseases in known NER genes that cause marked neurological pathology which are discussed later 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74358 17174478 95369 13444 7230 MRE11A MRE11 Mre11 3 2.3 Double-Strand Breaks and Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74359 17174478 95369 17886 9816 RAD50 RAD50 Rad50 3 0.6 Double-Strand Breaks and Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74360 17174478 95369 14453 22948 NLRP2 NBS1 Nbs1 3 1.3 Double-Strand Breaks and Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 2 JUMiner_v2.2 1 0 0 2 7652 TotalCon:2<>7652|NBN|4683|Complete__22948|NLRP2|55655|Complete__<>AvaiableGeneRif=2<>BEST:7652|NBN|0.00139471313639611<>ScoreDetail__22948|NLRP2|0.000579150579150579__7652|NBN|0.00139471313639611__ 0 0 0 0 0 74361 17174478 95370 13444 7230 MRE11A MRE11 Mre11 1 2.3 The Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 (MRN) MRN protein complex plays a central role 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74362 17174478 95370 17886 9816 RAD50 RAD50 Rad50 1 0.6 The Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 (MRN) MRN protein complex plays a central role in 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74363 17174478 95370 14453 22948 NLRP2 NBS1 Nbs1 1 1.3 The Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 (MRN) MRN protein complex plays a central role in repairing 2 JUMiner_v2.2 1 0 0 2 7652 TotalCon:2<>7652|NBN|4683|Complete__22948|NLRP2|55655|Complete__<>AvaiableGeneRif=2<>BEST:7652|NBN|0.00139471313639611<>ScoreDetail__22948|NLRP2|0.000579150579150579__7652|NBN|0.00139471313639611__ 0 0 0 0 0 74364 17174478 95373 13444 7230 MRE11A MRE11 Mre11 3 2.3 Mutations in the Mre11 component give rise to ataxia-telangiectasia-like disorder (ATLD), ATLD with its 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74366 17174478 95374 14453 22948 NLRP2 NBS1 Nbs1 2 1.3 Mutations in Nbs1 cause Nijmegen Breakage syndrome which displays similar symptoms to ATLD 2 JUMiner_v2.2 1 0 0 2 7652 TotalCon:2<>7652|NBN|4683|Complete__22948|NLRP2|55655|Complete__<>AvaiableGeneRif=2<>BEST:7652|NBN|0.00139471313639611<>ScoreDetail__22948|NLRP2|0.000579150579150579__7652|NBN|0.00139471313639611__ 0 0 0 0 0 74368 17174478 95376 1271 795 ATM ATM ATM 23 0.9 processing events and to cell cycle checkpoint signaling through both ATM checkpoint kinase ( D'Amours and Jackson 2002 van den Bosch 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74369 17174478 95376 8983 4739 H2AFX H2AX H2AX 48 1.6 al. 2003 Assenmacher and Hopfner 2004 and global genome histone H2AX ( Paull et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74370 17174478 95384 17886 9816 RAD50 RAD50 Rad50 11 0.6 head of the complex possesses ATP-stimulated nuclease activity where the Rad50 ATPase controls the Mre11 nuclease 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74371 17174478 95384 13444 7230 MRE11A MRE11 Mre11 15 2.3 possesses ATP-stimulated nuclease activity where the Rad50 ATPase controls the Mre11 nuclease 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74372 17174478 95385 14453 22948 NLRP2 NBS1 Nbs1 0 1.3 Nbs1 also appears to be part of the head through its 2 JUMiner_v2.2 1 0 0 2 7652 TotalCon:2<>7652|NBN|4683|Complete__22948|NLRP2|55655|Complete__<>AvaiableGeneRif=2<>BEST:7652|NBN|0.00139471313639611<>ScoreDetail__22948|NLRP2|0.000579150579150579__7652|NBN|0.00139471313639611__ 0 0 0 0 0 74373 17174478 95385 13444 7230 MRE11A MRE11 Mre11 13 2.3 to be part of the head through its interactions with Mre11 ( Zhang et al. 2006 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74374 17174478 95386 17886 9816 RAD50 RAD50 Rad50 31 0.6 form an interlocked hook/Zinc/hook hook Zinc hook bridges joining two Rad50 coiled-coils ( Hopfner et al. 2002a 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74375 17174478 95394 13444 7230 MRE11A MRE11 Mre11 3 2.3 Double-Strand Breaks and Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74376 17174478 95394 17886 9816 RAD50 RAD50 Rad50 3 0.6 Double-Strand Breaks and Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74377 17174478 95394 14453 22948 NLRP2 NBS1 Nbs1 3 1.3 Double-Strand Breaks and Mre11/Rad50/Nbs1 Mre11 Rad50 Nbs1 2 JUMiner_v2.2 1 0 0 2 7652 TotalCon:2<>7652|NBN|4683|Complete__22948|NLRP2|55655|Complete__<>AvaiableGeneRif=2<>BEST:7652|NBN|0.00139471313639611<>ScoreDetail__22948|NLRP2|0.000579150579150579__7652|NBN|0.00139471313639611__ 0 0 0 0 0 74378 17174478 95395 24250 12791 WRN WRN WRN 6 3.5 Double-Strand Breaks Base Excision Repair and WRN 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74379 17174478 95396 24250 12791 WRN WRN WRN 3 3.5 Hereditary mutations in WRN are associated with Werner syndrome (WS), WS a rare autosomal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74380 17174478 95401 24250 12791 WRN WRN WRN 0 3.5 WRN encodes a 1 432-residue protein that contains a C-terminal nuclear-localization 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74381 17174478 95403 24250 12791 WRN WRN WRN 0 3.5 WRN belongs to the RecQ helicase family that is widely distributed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74382 17174478 95404 18160 9948 RECQL RecQ1 RecQ1 11 1.3 human genome also contains four other RecQ helicase family members RecQ1 BLM RecQ4L and RecQ5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74383 17174478 95404 1675 1058 BLM BLM BLM 13 1.6 genome also contains four other RecQ helicase family members RecQ1 BLM RecQ4L and RecQ5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74384 17174478 95404 18162 9950 RECQL5 RecQ5 RecQ5 17 1.3 four other RecQ helicase family members RecQ1 BLM RecQ4L and RecQ5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74385 17174478 95405 1675 1058 BLM BLM BLM 2 1.6 Mutations in BLM and RecQ4L cause Bloom syndrome and Rothmund-Thomson syndrome respectively ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74386 17174478 95407 24250 12791 WRN WRN WRN 0 3.5 WRN has been implicated to function in multiple DNA metabolism steps 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74387 17174478 95408 24250 12791 WRN WRN WRN 3 3.5 Biochemical characterization of WRN helicase has shown ATPase activity and unwinding of partial-duplex DNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74388 17174478 95410 24250 12791 WRN WRN WRN 5 3.5 Significantly a unique feature of WRN among all the human RecQ helicases is the addition of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74389 17174478 95412 24250 12791 WRN WRN WRN 0 3.5 WRN exonuclease functions on a variety of structured DNA substrates that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74390 17174478 95413 24250 12791 WRN WRN WRN 0 3.5 WRN 3_amp_#x02032 -5_amp_#x02032 exonuclease activity shows substrate specificity similar to that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74391 17174478 95413 24250 12791 WRN WRN WRN 17 3.5 similar to that for the helicase suggesting that the two WRN enzymatic activities may have coordinated functions on several classes of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74392 17174478 95414 24250 12791 WRN WRN WRN 0 3.5 WRN has been implicated in certain DNA repair events as WS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74393 17174478 95416 24250 12791 WRN WRN WRN 0 3.5 WRN links to BER include physical and functional interaction with pol_amp_#x003b2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74394 17174478 95416 18741 10289 RPA1 RPA RPA 27 0.6 pol_amp_#x003b4 ( Szekely et al. 2000 replication protein A (RPA)( RPA Brosh et al. 1999 flap endonuclease 1 (FEN-1) FEN-1 ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74395 17174478 95416 7490 3650 FEN1 FEN-1 FEN-1 36 1.9 (RPA)( RPA Brosh et al. 1999 flap endonuclease 1 (FEN-1) FEN-1 ( Brosh et al. 2001b PCNA ( Lebel et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74396 17174478 95416 16232 8729 PCNA PCNA PCNA 43 0.9 flap endonuclease 1 (FEN-1) FEN-1 ( Brosh et al. 2001b PCNA ( Lebel et al. 1999 and poly(ADP-ribose)polymerase poly ADP-ribose polymerase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74397 17174478 95416 16068 270 PARP1 PARP-1 PARP-1 53 3.4 et al. 1999 and poly(ADP-ribose)polymerase poly ADP-ribose polymerase 1 (PARP-1) PARP-1 ( von Kobbe et al. 2003a 1 JUMiner_v2.2 1 0 0 2 270 TotalCon:2<>23696|TIPARP|25976|Complete__270|PARP1|142|Complete__<>AvaiableGeneRif=2<>BEST:270|PARP1|0.000751389021936967<>ScoreDetail__23696|TIPARP|0__270|PARP1|0.000751389021936967__ 0 0 0 0 0 74399 17174478 95417 17892 9824 RAD52 RAD52 Rad52 21 0.6 with the MRN complex ( Cheng et al. 2004 and Rad52 ( Baynton et al. 2003 and by colocalization with Rad51 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74400 17174478 95417 17887 9817 RAD51 RAD51 Rad51 32 1.6 Rad52 ( Baynton et al. 2003 and by colocalization with Rad51 in camptothecin-treated cells ( Sakamoto et al. 2001 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74401 17174478 95418 24250 12791 WRN WRN WRN 13 3.5 to the NHEJ pathway is indicated by in interactions of WRN with the NHEJ-essential protein kinase DNA-PK ( Yannone et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74402 17174478 95418 17319 9413 PRKDC DNAPK DNA-PK 19 1.2 by in interactions of WRN with the NHEJ-essential protein kinase DNA-PK ( Yannone et al. 2001 Karmakar et al. 2002a Li 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74403 17174478 95419 24250 12791 WRN WRN WRN 0 3.5 WRN activity is regulated by holo _amp_#x02013 DNA-PK ( Yannone et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74404 17174478 95419 17319 9413 PRKDC DNAPK DNA-PK 6 1.2 WRN activity is regulated by holo _amp_#x02013 DNA-PK ( Yannone et al. 2001 Karmakar et al. 2002a WRN 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74405 17174478 95419 24250 12791 WRN WRN WRN 18 3.5 DNA-PK ( Yannone et al. 2001 Karmakar et al. 2002a WRN is an in vivo substrate of DNA-PK ( Yannone et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74406 17174478 95419 17319 9413 PRKDC DNAPK DNA-PK 25 1.2 et al. 2002a WRN is an in vivo substrate of DNA-PK ( Yannone et al. 2001 Karmakar et al. 2002a and 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74407 17174478 95419 17319 9413 PRKDC DNAPK DNA-PK 39 1.2 Yannone et al. 2001 Karmakar et al. 2002a and the DNA-PK subunit Ku70/80 Ku70 80 stimulates WRN exonuclease activity in vitro 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74408 17174478 95419 24334 4055 XRCC6 KU70 Ku70 41 1.6 2001 Karmakar et al. 2002a and the DNA-PK subunit Ku70/80 Ku70 80 stimulates WRN exonuclease activity in vitro ( Cooper et 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74409 17174478 95419 24250 12791 WRN WRN WRN 43 3.5 al. 2002a and the DNA-PK subunit Ku70/80 Ku70 80 stimulates WRN exonuclease activity in vitro ( Cooper et al. 2000 Li 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74410 17174478 95420 24250 12791 WRN WRN WRN 1 3.5 Furthermore WRN has been observed in an endogenous complex with the Ku70/80 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74411 17174478 95420 24334 4055 XRCC6 KU70 Ku70 11 1.6 has been observed in an endogenous complex with the Ku70/80 Ku70 80 subunit and poly(ADP-ribose) poly ADP-ribose polymerase-1 (PARP-1) PARP-1 ( 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74412 17174478 95420 16068 270 PARP1 PARP-1 PARP-1 16 3.4 Ku70/80 Ku70 80 subunit and poly(ADP-ribose) poly ADP-ribose polymerase-1 (PARP-1) PARP-1 ( Li et al. 2004 1 JUMiner_v2.2 1 0 0 2 270 TotalCon:2<>23696|TIPARP|25976|Complete__270|PARP1|142|Complete__<>AvaiableGeneRif=2<>BEST:270|PARP1|0.000751389021936967<>ScoreDetail__23696|TIPARP|0__270|PARP1|0.000751389021936967__ 0 0 0 0 0 74414 17174478 95421 16068 270 PARP1 PARP-1 PARP-1 1 3.4 Notably PARP-1 binds sites of SSBs and DSBs and is also implicated 1 JUMiner_v2.2 1 0 0 2 270 TotalCon:2<>23696|TIPARP|25976|Complete__270|PARP1|142|Complete__<>AvaiableGeneRif=2<>BEST:270|PARP1|0.000751389021936967<>ScoreDetail__23696|TIPARP|0__270|PARP1|0.000751389021936967__ 0 0 0 0 0 74416 17174478 95422 24250 12791 WRN WRN WRN 0 3.5 WRN has a modular composition ( Fig 6a and structural studies 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74417 17174478 95422 24250 12791 WRN WRN WRN 24 3.5 protein's domains and those of homologues are helping to define WRN mediated functions ( Killoran and Keck 2006 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74418 17174478 95423 24250 12791 WRN WRN WRN 3 3.5 The N-terminus of WRN contains the exonuclease domain the central core contains the helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74419 17174478 95424 24250 12791 WRN WRN WRN 8 3.5 Crystallographic and structure based mutational studies on the WRN exonuclease domain have revealed a high degree of structural and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74420 17174478 95425 24250 12791 WRN WRN WRN 5 3.5 These structural biochemistry studies on WRN exonuclease revealed a two metal ion mediated mechanism of nucleotide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74421 17174478 95426 24250 12791 WRN WRN WRN 7 3.5 The lanthanide Eu 3 ions inhibit the WRN exonuclease activity probably due to either a greater charge state 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74422 17174478 95427 24334 4055 XRCC6 KU70 Ku70 0 1.6 Ku70/80 Ku70 80 specifically stimulates this WRN exonuclease activity but inhibits the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74423 17174478 95427 24250 12791 WRN WRN WRN 4 3.5 Ku70/80 Ku70 80 specifically stimulates this WRN exonuclease activity but inhibits the Klenow fragment exonuclease its closest 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74424 17174478 95428 24250 12791 WRN WRN WRN 5 3.5 This also suggests that the WRN exonuclease domain may help impart functions mediated by WRN_amp_#x02013;Ku70/80 WRN_amp_#x02013 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74425 17174478 95428 24334 4055 XRCC6 KU70 Ku70 14 1.6 exonuclease domain may help impart functions mediated by WRN_amp_#x02013;Ku70/80 WRN_amp_#x02013 Ku70 80 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74426 17174478 95429 24250 12791 WRN WRN WRN 1 3.5 Additionally WRN exonuclease activity is required to fully compliment a Werner syndrome 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74427 17174478 95430 24250 12791 WRN WRN WRN 18 3.5 specific cellular pathway but the elevated microhomology-mediated repair observed in WRN exonuclease deficient cells is similar to the phenotypes associated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74428 17174478 95430 24250 12791 WRN WRN WRN 45 3.5 Melek et al. 1998 Verkaik et al. 2002 possibly linking WRN to this pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74429 17174478 95431 24250 12791 WRN WRN WRN 11 3.5 Werner syndrome cells have mild radiation sensitivity which rules out WRN as an essential DSB repair protein but WRN exonuclease may 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74430 17174478 95431 24250 12791 WRN WRN WRN 19 3.5 rules out WRN as an essential DSB repair protein but WRN exonuclease may nevertheless be used for resolution of a limited 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74431 17174478 95432 24250 12791 WRN WRN WRN 6 3.5 Double-Strand Breaks Base Excision Repair and WRN 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74432 17174478 95433 24250 12791 WRN WRN WRN 5 3.5 This substantial functional divergence between WRN exonuclease and its structural homologs such as Klenow fragment exonuclease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74433 17174478 95434 24250 12791 WRN WRN WRN 1 3.5 The WRN exonuclease domain construct that was defined by crystallography studies is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74434 17174478 95435 24250 12791 WRN WRN WRN 3 3.5 However a similar WRN exonuclease construct forms homo-hexamers upon interaction with DNA or PCNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74435 17174478 95435 16232 8729 PCNA PCNA PCNA 13 0.9 WRN exonuclease construct forms homo-hexamers upon interaction with DNA or PCNA ( Xue et al. 2002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74436 17174478 95436 24250 12791 WRN WRN WRN 3 3.5 Also a larger WRN N-terminal construct residues 1-333 and containing the exonuclease domain forms 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74437 17174478 95437 24250 12791 WRN WRN WRN 11 3.5 potentially affects substrate specificities and enzymatic activities of the full-length WRN protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74438 17174478 95438 24250 12791 WRN WRN WRN 4 3.5 The multimerization state of WRN homologues is still under debate ( Sharma et al. 2006 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74439 17174478 95438 1675 1058 BLM BLM BLM 20 1.6 debate ( Sharma et al. 2006 but the human homolog BLM has been observed to form hexameric and/or and or tetrameric 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74440 17174478 95439 24250 12791 WRN WRN WRN 1 3.5 A WRN exonuclease hexameric ring model ( Fig 6c has been built 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74442 17174478 95440 24250 12791 WRN WRN WRN 1 3.5 This WRN exonuclease ring contains a positively charged central cavity with the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74443 17174478 95442 24250 12791 WRN WRN WRN 7 3.5 Important insights into the molecular mechanisms of WRN have also been discovered from the structure of the conserved 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74444 17174478 95446 19764 12950 SF1 SF1 SF1 45 0.3 al. 2003 ( Fig 6e and this is similar to SF1 _amp_#x00026 2 helicases 1 JUMiner_v2.2 1 0 0 2 7983 TotalCon:2<>12950|SF1|7536|Complete__7983|NR5A1|2516|Complete__<>AvaiableGeneRif=2<>BEST:7983|NR5A1|0.000497518012617236<>ScoreDetail__12950|SF1|0.000292740046838407__7983|NR5A1|0.000497518012617236__ 0 0 0 0 0 74445 17174478 95450 24250 12791 WRN WRN WRN 1 3.5 In WRN a mutation in Motif I in mice induces a Werner 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74446 17174478 95451 19764 12950 SF1 SF1 SF1 23 0.3 still undefined but the lobes likely use strategies similar to SF1 _amp_#x00026 2 proteins 1 JUMiner_v2.2 1 0 0 2 7983 TotalCon:2<>12950|SF1|7536|Complete__7983|NR5A1|2516|Complete__<>AvaiableGeneRif=2<>BEST:7983|NR5A1|0.000497518012617236<>ScoreDetail__12950|SF1|0.000292740046838407__7983|NR5A1|0.000497518012617236__ 0 0 0 0 0 74447 17174478 95452 19764 12950 SF1 SF1 SF1 23 0.3 Wang et al. 2000 and regions of sequence similarity to SF1 indicates that WRN helicase may function a base-flipping mechanism proposed 1 JUMiner_v2.2 1 0 0 2 7983 TotalCon:2<>12950|SF1|7536|Complete__7983|NR5A1|2516|Complete__<>AvaiableGeneRif=2<>BEST:7983|NR5A1|0.000497518012617236<>ScoreDetail__12950|SF1|0.000292740046838407__7983|NR5A1|0.000497518012617236__ 0 0 0 0 0 74448 17174478 95452 24250 12791 WRN WRN WRN 26 3.5 2000 and regions of sequence similarity to SF1 indicates that WRN helicase may function a base-flipping mechanism proposed in SF1 despite 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74449 17174478 95452 19764 12950 SF1 SF1 SF1 35 0.3 that WRN helicase may function a base-flipping mechanism proposed in SF1 despite overall sequence similarity to SF2 helicases ( Bernstein et 1 JUMiner_v2.2 1 0 0 2 7983 TotalCon:2<>12950|SF1|7536|Complete__7983|NR5A1|2516|Complete__<>AvaiableGeneRif=2<>BEST:7983|NR5A1|0.000497518012617236<>ScoreDetail__12950|SF1|0.000292740046838407__7983|NR5A1|0.000497518012617236__ 0 0 0 0 0 74450 17174478 95452 19787 10780 SFRS1 SF2 SF2 41 0.3 base-flipping mechanism proposed in SF1 despite overall sequence similarity to SF2 helicases ( Bernstein et al. 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74451 17174478 95456 1675 1058 BLM BLM BLM 29 1.6 and are sufficient to cause Bloom syndrome when mutated in BLM ( Ellis et al. 1995 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74452 17174478 95457 24250 12791 WRN WRN WRN 32 3.5 a more recently determined NMR structure of this domain in WRN ( Hu et al. 2005 ( Fig 6g 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74453 17174478 95458 24250 12791 WRN WRN WRN 3 3.5 This domain in WRN binds several alternate DNA substructures including forks holding junctions 3_amp_#x02032 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74454 17174478 95459 24250 12791 WRN WRN WRN 2 3.5 Notably the WRN winged helix domain facilitates targeting of WRN to the nucleolus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74455 17174478 95459 24250 12791 WRN WRN WRN 9 3.5 Notably the WRN winged helix domain facilitates targeting of WRN to the nucleolus ( von Kobbe and Bohr 2002 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74456 17174478 95459 24250 12791 WRN WRN WRN 30 3.5 and interactions of several of the potential protein partners of WRN have also been specifically mapped to this winged helix domain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74457 17174478 95459 24250 12791 WRN WRN WRN 57 3.5 indicating the critical and versatile nature of this domain in WRN 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74458 17174478 95460 24250 12791 WRN WRN WRN 5 3.5 The remaining C-terminal domain of WRN is the HRDC ( H elicase R Nase D C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74459 17174478 95463 24250 12791 WRN WRN WRN 1 3.5 In WRN the HRDC domain preferentially binds to forked duplex DNA and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74460 17174478 95464 24250 12791 WRN WRN WRN 13 3.5 this domain is utilized in replication and recombination functions of WRN 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74461 17174478 95465 24250 12791 WRN WRN WRN 5 3.5 Significantly the interactions with the WRN C-terminus containing the winged helix and HRDC domains have been 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74462 17174478 95465 24250 12791 WRN WRN WRN 22 3.5 HRDC domains have been indicated to regulate the activity of WRN or of the partner protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74463 17174478 95466 24250 12791 WRN WRN WRN 1 3.5 The WRN exonuclease domain activity is regulated through the interaction of its 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74464 17174478 95466 22671 11998 TP53 p53 p53 14 0.6 activity is regulated through the interaction of its C-terminus with p53 ( Blander et al. 1999 Ku70/80 Ku70 80 ( Cooper 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74465 17174478 95466 24334 4055 XRCC6 KU70 Ku70 21 1.6 its C-terminus with p53 ( Blander et al. 1999 Ku70/80 Ku70 80 ( Cooper et al. 2000 Li and Comai 2000 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74466 17174478 95466 16068 270 PARP1 PARP-1 PARP-1 44 3.4 2000 Brosh et al. 2001a Karmakar et al. 2002b and PARP-1 ( von Kobbe et al. 2004 1 JUMiner_v2.2 1 0 0 2 270 TotalCon:2<>23696|TIPARP|25976|Complete__270|PARP1|142|Complete__<>AvaiableGeneRif=2<>BEST:270|PARP1|0.000751389021936967<>ScoreDetail__23696|TIPARP|0__270|PARP1|0.000751389021936967__ 0 0 0 0 0 74467 17174478 95467 24250 12791 WRN WRN WRN 1 3.5 While WRN helicase activity is regulated by C-terminal interactions that include TRF2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74468 17174478 95467 21997 11729 TERF2 TRF2 TRF2 11 1.6 WRN helicase activity is regulated by C-terminal interactions that include TRF2 ( Opresko et al. 2002 Rad52 ( Baynton et al. 1 JUMiner_v2.2 1 0 0 2 11729 TotalCon:2<>11589|TBPL1|9519|Complete__11729|TERF2|7014|Complete__<>AvaiableGeneRif=2<>BEST:11729|TERF2|0.000743775101669656<>ScoreDetail__11729|TERF2|0.000743775101669656__11589|TBPL1|0.000207784019259429__ 0 0 0 0 0 74469 17174478 95467 17892 9824 RAD52 RAD52 Rad52 18 0.6 C-terminal interactions that include TRF2 ( Opresko et al. 2002 Rad52 ( Baynton et al. 2003 and PARP-1 ( von Kobbe 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74470 17174478 95467 16068 270 PARP1 PARP-1 PARP-1 26 3.4 et al. 2002 Rad52 ( Baynton et al. 2003 and PARP-1 ( von Kobbe et al. 2004 1 JUMiner_v2.2 1 0 0 2 270 TotalCon:2<>23696|TIPARP|25976|Complete__270|PARP1|142|Complete__<>AvaiableGeneRif=2<>BEST:270|PARP1|0.000751389021936967<>ScoreDetail__23696|TIPARP|0__270|PARP1|0.000751389021936967__ 0 0 0 0 0 74471 17174478 95468 24250 12791 WRN WRN WRN 3 3.5 An example of WRN stimulation of partner proteins includes the FEN-1 partner protein whose 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74472 17174478 95468 7490 3650 FEN1 FEN-1 FEN-1 10 1.9 An example of WRN stimulation of partner proteins includes the FEN-1 partner protein whose structures with DNA and PCNA have been 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74473 17174478 95468 16232 8729 PCNA PCNA PCNA 18 0.9 includes the FEN-1 partner protein whose structures with DNA and PCNA have been defined ( Hosfield et al. 1998 Chapados et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74474 17174478 95469 24250 12791 WRN WRN WRN 0 3.5 WRN interaction that was mapped to the winged helix domain stimulates 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74475 17174478 95469 7490 3650 FEN1 FEN-1 FEN-1 11 1.9 interaction that was mapped to the winged helix domain stimulates FEN-1 nucleolytic activity by more than 80-fold ( Brosh et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74476 17174478 95470 24250 12791 WRN WRN WRN 15 3.5 interesting to define how these interactions are able to regulate WRN catalytic activities how key DNA and/or and or protein interactions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74477 17174478 95470 24250 12791 WRN WRN WRN 31 3.5 or protein interactions may potentially allow for controlled handoffs during WRN mediated pathway progression and how the breakdown of this pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74478 17174478 95470 24250 12791 WRN WRN WRN 48 3.5 breakdown of this pathway progression in the absence of functioning WRN gives rise to the disease phenotype 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74479 17174478 95471 14635 7965 NR1H2 NER NER 0 1.3 NER and the XPB helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74480 17174478 95471 6736 3435 ERCC3 XPB XPB 3 2.4 NER and the XPB helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74481 17174478 95472 14635 7965 NR1H2 NER NER 0 1.3 NER functions to restore short segments of nucleotides containing DNA helix 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74482 17174478 95474 14635 7965 NR1H2 NER NER 28 1.3 generated by ionizing radiation can produce DNA lesions that require NER for repair ( Satoh et al. 1993 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74483 17174478 95475 14635 7965 NR1H2 NER NER 0 1.3 NER is a particularly versatile DNA repair system that is capable 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74484 17174478 95476 14635 7965 NR1H2 NER NER 3 1.3 Hereditary mutations in NER genes clearly demonstrate that the inherited DNA repair potential has 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74485 17174478 95477 14635 7965 NR1H2 NER NER 6 1.3 Moreover much of our understanding of NER has been derived from studies on cells from individuals with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74486 17174478 95477 14635 7965 NR1H2 NER NER 17 1.3 has been derived from studies on cells from individuals with NER defects that present clinical phenotypes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74489 17174478 95483 6736 3435 ERCC3 XPB XPB 12 2.4 gene that is associated with all three disorders is the XPB helicase ( Weeda et al. 1997 which is part of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74490 17174478 95483 6736 3435 ERCC3 TFIIH TFIIH 28 2.7 al. 1997 which is part of the general transcription factor TFIIH complex ( Schaeffer et al. 1993 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74491 17174478 95484 6736 3435 ERCC3 XPB XPB 1 2.4 The XPB ATPase and helicase activities are essential for promoter DNA melting 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74492 17174478 95485 6736 3435 ERCC3 XPB XPB 6 2.4 In addition to these transcriptional functions XPB also plays a role in NER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74493 17174478 95485 14635 7965 NR1H2 NER NER 12 1.3 to these transcriptional functions XPB also plays a role in NER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74494 17174478 95486 6736 3435 ERCC3 XPB XPB 8 2.4 Recent developments in structural and biochemical characterization of XPB helicase have begun to address some of the key questions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74495 17174478 95486 6736 3435 ERCC3 XPB XPB 25 2.4 of the key questions on the underlying mechanisms of how XPB and TFIIH function in both transcription and NER ( Coin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74496 17174478 95486 6736 3435 ERCC3 TFIIH TFIIH 27 2.7 key questions on the underlying mechanisms of how XPB and TFIIH function in both transcription and NER ( Coin et al. 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74497 17174478 95486 14635 7965 NR1H2 NER NER 33 1.3 of how XPB and TFIIH function in both transcription and NER ( Coin et al. 2004 Coin et al. 2006 Fan 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74498 17174478 95487 6736 3435 ERCC3 XPB XPB 12 2.4 studies have been conducted on a homolog of the human XPB the archea Archaeoglobus fulgidus XPB ( Af XPB ( Fan 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74499 17174478 95487 6736 3435 ERCC3 XPB XPB 17 2.4 a homolog of the human XPB the archea Archaeoglobus fulgidus XPB ( Af XPB ( Fan et al. 2006a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74500 17174478 95487 6736 3435 ERCC3 XPB XPB 20 2.4 the human XPB the archea Archaeoglobus fulgidus XPB ( Af XPB ( Fan et al. 2006a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74501 17174478 95488 6736 3435 ERCC3 XPB XPB 1 2.4 Af XPB shares 42% amino acid sequence similarity with the central region 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74502 17174478 95488 6736 3435 ERCC3 XPB XPB 14 2.4 amino acid sequence similarity with the central region of human XPB suggesting that the core XPB structure is conserved 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74503 17174478 95488 6736 3435 ERCC3 XPB XPB 19 2.4 the central region of human XPB suggesting that the core XPB structure is conserved 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74504 17174478 95489 6736 3435 ERCC3 XPB XPB 7 2.4 As indicated by sequence comparison the Af XPB structure contains two RecA-like helicase domains (HD1 HD1 and HD2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74505 17174478 95489 17887 9817 RAD51 RECA RecA-like 11 1.6 indicated by sequence comparison the Af XPB structure contains two RecA-like helicase domains (HD1 HD1 and HD2 that belong to helicase 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74507 17174478 95490 6736 3435 ERCC3 XPB XPB 6 2.4 However several other functional regions in XPB were discovered that were not predicted either through sequence analysis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74509 17174478 95492 6736 3435 ERCC3 XPB XPB 4 2.4 This domain in Af XPB has been demonstrated to interact with some types of damaged 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74510 17174478 95493 6736 3435 ERCC3 XPB XPB 0 2.4 XPB DRD differs from the MutS domain by lacking a critical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74511 17174478 95494 6736 3435 ERCC3 XPB XPB 2 2.4 Instead Af XPB DRD likely recognizes distortions in the DNA typically caused by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74512 17174478 95494 14635 7965 NR1H2 NER NER 17 1.3 in the DNA typically caused by the broad spectrum of NER lesions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74513 17174478 95495 14635 7965 NR1H2 NER NER 18 1.3 is located and linked to initiation of DNA unwinding during NER steps by XPB/TFIIH XPB TFIIH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74514 17174478 95495 6736 3435 ERCC3 XPB XPB 21 2.4 to initiation of DNA unwinding during NER steps by XPB/TFIIH XPB TFIIH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74515 17174478 95495 6736 3435 ERCC3 TFIIH TFIIH 21 2.7 initiation of DNA unwinding during NER steps by XPB/TFIIH XPB TFIIH 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74516 17174478 95496 6736 3435 ERCC3 XPB XPB-family 6 2.4 Also present is a highly conserved XPB-family specific RED amino acid motif located in domain HD1 ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74519 17174478 95497 6736 3435 ERCC3 XPB XPB 5 2.4 Mutational analysis suggests that this XPB RED motif has a critical role in DNA unwinding function 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74524 17174478 95501 14635 7965 NR1H2 NER NER 0 1.3 NER and the XPB helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74525 17174478 95501 6736 3435 ERCC3 XPB XPB 3 2.4 NER and the XPB helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74526 17174478 95503 6736 3435 ERCC3 XPB XPB 1 2.4 Af XPB seems to follow this general trend 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74528 17174478 95504 6736 3435 ERCC3 XPB XPB 16 2.4 helicase domains HD1 and HD2 observed in the full-length Af XPB is different than the _amp_#x0201c closed_amp_#x0201d conformation observed in crystal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74529 17174478 95506 6736 3435 ERCC3 XPB XPB 13 2.4 also lead to a proposed mechanism for the involvement of XPB in the unwinding of duplex DNA at sites of DNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74530 17174478 95507 6736 3435 ERCC3 XPB XPB 1 2.4 When XPB is recruited to DNA the DRD domain is proposed to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74531 17174478 95508 6736 3435 ERCC3 XPB XPB 16 2.4 helicase domain HD2 via a rotation of ~170_amp_#x000b0 and allows XPB to wrap around the DNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74532 17174478 95509 6736 3435 ERCC3 XPB XPB 13 2.4 such a conformational change may result from interaction of the XPB C-terminus (including including ThM and HD2 domains with 3'-overhanging DNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74537 17174478 95512 6736 3435 ERCC3 XPB XPB 19 2.4 _amp_#x0201c wedge_amp_#x0201d to unzip the DNA when ATP hydrolysis drives XPB to move along the duplex DNA during NER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74538 17174478 95512 14635 7965 NR1H2 NER NER 27 1.3 hydrolysis drives XPB to move along the duplex DNA during NER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74540 17174478 95513 6736 3435 ERCC3 XPB XPB 8 2.4 However it is noticed that DNA melting by XPB during transcription initiation is possibly mediated through an unconventional helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74541 17174478 95513 6736 3435 ERCC3 XPB XPB 28 2.4 unconventional helicase mechanism ( Kim et al. 2000 in which XPB functions as a molecular _amp_#x0201c wrench_amp_#x0201d rotating downstream DNA relative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74542 17174478 95514 6736 3435 ERCC3 XPB XPB 7 2.4 Therefore the conformation observed in the Af XPB structure may represent a _amp_#x0201c transcriptional mode_amp_#x0201d of XPB tuned 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74543 17174478 95514 6736 3435 ERCC3 XPB XPB 15 2.4 Af XPB structure may represent a _amp_#x0201c transcriptional mode_amp_#x0201d of XPB tuned for this action whereas the domain reorientation described above 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74544 17174478 95514 14635 7965 NR1H2 NER NER-specific 27 0.3 for this action whereas the domain reorientation described above is NER-specific and only occurs upon the interactions of the DRD with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74545 17174478 95515 6736 3435 ERCC3 XPB XPB 8 2.4 If these mechanisms are true the conformation of XPB will decide whether TFIIH functions as a transcription factor or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74546 17174478 95515 6736 3435 ERCC3 TFIIH TFIIH 12 2.7 mechanisms are true the conformation of XPB will decide whether TFIIH functions as a transcription factor or a DNA repair factor 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74547 17174478 95516 6736 3435 ERCC3 XPB XPB 3 2.4 In other words XPB acts as a master key helping TFIIH switch pathway selection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74548 17174478 95516 6736 3435 ERCC3 TFIIH TFIIH 10 2.7 In other words XPB acts as a master key helping TFIIH switch pathway selection for transcription or DNA repair whenever it 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74549 17174478 95517 14635 7965 NR1H2 NER NER 0 1.3 NER and the XPB helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74550 17174478 95517 6736 3435 ERCC3 XPB XPB 3 2.4 NER and the XPB helicase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74551 17174478 95518 6736 3435 ERCC3 XPB XPB 3 2.4 Defining the Af XPB structural biochemistry has uncovered some unexpected structural motifs and functions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74552 17174478 95518 6736 3435 ERCC3 XPB XPB 15 2.4 biochemistry has uncovered some unexpected structural motifs and functions for XPB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74553 17174478 95519 6736 3435 ERCC3 XPB XPB 2 2.4 However Af XPB only correlates to the central region of human XPB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74554 17174478 95519 6736 3435 ERCC3 XPB XPB 11 2.4 Af XPB only correlates to the central region of human XPB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74555 17174478 95520 6736 3435 ERCC3 XPB XPB 12 2.4 exclusively occur in the N- and C-terminal extensions of human XPB suggesting that mutation to the conserved XPB central region is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74556 17174478 95520 6736 3435 ERCC3 XPB XPB 19 2.4 extensions of human XPB suggesting that mutation to the conserved XPB central region is lethal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74557 17174478 95521 6736 3435 ERCC3 XPB XPB 1 2.4 Af XPB reflects the basic structure and function of XPB helicases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74558 17174478 95521 6736 3435 ERCC3 XPB XPB 9 2.4 Af XPB reflects the basic structure and function of XPB helicases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74559 17174478 95522 6736 3435 ERCC3 XPB XPB 6 2.4 However the extensions to the human XPB are likely to contribute to a greater level of complexity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74560 17174478 95523 6736 3435 ERCC3 XPB XPB 10 2.4 Phosphorylation of residue S751 at the C-terminal extension of human XPB was reported to regulate TFIIH activity in NER reactions ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74561 17174478 95523 6736 3435 ERCC3 TFIIH TFIIH 15 2.7 the C-terminal extension of human XPB was reported to regulate TFIIH activity in NER reactions ( Coin et al. 2004 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74562 17174478 95523 14635 7965 NR1H2 NER NER 18 1.3 of human XPB was reported to regulate TFIIH activity in NER reactions ( Coin et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74563 17174478 95524 6736 3435 ERCC3 XPB XPB 6 2.4 The physical and functional interactions between XPB and other proteins within and outside of the TFIIH complex 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74564 17174478 95524 6736 3435 ERCC3 TFIIH TFIIH 15 2.7 between XPB and other proteins within and outside of the TFIIH complex have been investigated recently ( Jawhari et al. 2002 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74565 17174478 95525 6736 3435 ERCC3 TFIIH TFIIH 11 2.7 occur in the extensions and have profound effects on the TFIIH activities in transcription or DNA repair 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74566 17174478 95526 6736 3435 ERCC3 XPB XPB 13 2.4 that future studies will similarly uncover new functions for human XPB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74567 17174478 95527 6736 3435 ERCC3 TFIIH TFIIH 23 2.7 features highlighted above will fit into the ring-structure of human TFIIH complex ( Chang and Kornberg 2000 Schultz et al. 2000 1 JUMiner_v2.2 1 0 0 2 3435 TotalCon:5<>3435|ERCC3|2071|Complete__4656|GTF2H2|2966|Complete__4657|GTF2H3|2967|Complete__4655|GTF2H1|2965|Complete__4658|GTF2H4|2968|Complete__<>AvaiableGeneRif=5<>BEST:3435|ERCC3|0.00287469287469287<>ScoreDetail__4656|GTF2H2|0.0025974025974026__4658|GTF2H4|0.00176390773405699__4657|GTF2H3|0__3435|ERCC3|0.00287469287469287__4655|GTF2H1|0.00230055658627087__ 0 0 0 0 0 74569 17174478 95534 14533 7872 NOS1 NOS NOS 11 2.7 significant example is the fine control of activities of the NOS holo-enzyme suggested to occur through either promoting or inhibiting a 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74570 17174478 95537 17887 9817 RAD51 RAD51 Rad51 9 1.6 A significant example of protein interface mimicry occurs in Rad51 filament formation which is central to HRR steps 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74571 17174478 95538 17887 9817 RAD51 RAD51 Rad51 14 1.6 that filament formation occurs by the sequential binding of adjacent Rad51 monomers mimicking a BRC repeat 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74572 17174478 95539 1755 1101 BRCA2 BRCA2 BRCA2 8 0.8 This BRC repeat is normally found in the BRCA2 partner that mediates critical functions of Rad51 ( Pellegrini et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74573 17174478 95539 17887 9817 RAD51 RAD51 Rad51 15 1.6 found in the BRCA2 partner that mediates critical functions of Rad51 ( Pellegrini et al. 2002 Shin et al. 2003 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74575 17174478 95547 24250 12791 WRN WRN WRN 6 3.5 This includes MRN complex or the WRN RecQ helicase which may prove to be suitable targets for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74576 17174478 95548 14533 7872 NOS1 NOS NOS 1 2.7 The NOS isoforms also have multiple functions that may be targets for 11 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000765840848201864<>ScoreDetail__7873|NOS2A|0.000583943663295171__7872|NOS1|0.000765840848201864__ 0 0 0 0 0 74867 17191135 96093 122 80 ABP1 ABP ABP 8 0.3 Specifically any dietary components that inhibit inappropriate inflammation ABP oligomerization and consequent increased apoptosis are of particular interest with 1 JUMiner_v2.2 1 0 0 2 10839 TotalCon:2<>80|ABP1|26|Complete__10839|SHBG|6462|Complete__<>AvaiableGeneRif=2<>BEST:10839|SHBG|0.00042022616685875<>ScoreDetail__80|ABP1|0.000281036389679619__10839|SHBG|0.00042022616685875__ 0 0 0 0 0 74868 17191135 96096 926 620 APP amyloid amyloid 21 1.3 as a novel nutritional approach to reduce oxidative damage and amyloid pathology in AD 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 74873 17191135 96107 7975 3951 FXN FRDA FRDA 17 1.5 amyotrophic lateral scelrosis (ALS) ALS and Friedreich_amp_#8217 s ataxia (FRDA) FRDA belong to the so-called _amp_#8220 protein conformational diseases_amp_#8221 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74877 17191135 96113 9462 5013 HMOX1 HO-1 HO-1 2 6.5 Heme oxygenase-1 (HO-1), HO-1 also referred to as Hsp32 belongs to the Hsps family 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74878 17191135 96114 1681 1062 BLVRA BVR BVR 8 0.9 This latter is then reduced by biliverdin reductase (BVR) BVR into bilirubin (BR), BR a linear tetrapyrrole with antioxidant properties 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74880 17191135 96116 9462 5013 HMOX1 HO-1 HO-1 12 6.5 1 ( A Cellular stress response and the interplay between HO-1 and TRXr 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74881 17191135 96118 9691 5232 HSPA1A HSP Hsp 0 1.9 Hsp response is also involved in cellular homeostasis during various physiological 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74882 17191135 96120 14345 7782 NFE2L2 NRF2 Nrf2 11 2.1 activation (via via acetylation of the redox sensitive transcription factor Nrf2 and its consequent binding to the antioxidant responsive element (ARE) 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74883 17191135 96120 9462 5013 HMOX1 HO-1 HO-1 27 6.5 antioxidant responsive element (ARE) ARE in the HO gene up-regulates HO-1 and TRXr thus counteracting nitrosative stress and NO-mediated neurotoxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74884 17191135 96121 1493 14078 BACH2 BACH2 Bach-2 12 0.3 same figure are described the respective roles of protein factors Bach-2 (positive) positive and Keap (negative) negative in the Nrf2 activation 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74885 17191135 96121 14345 7782 NFE2L2 NRF2 Nrf2 19 2.1 factors Bach-2 (positive) positive and Keap (negative) negative in the Nrf2 activation as well as the redox cycling between Bilirubin and 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74886 17191135 96121 1681 1062 BLVRA BVR BVR 34 0.9 the redox cycling between Bilirubin and biliverdin through the enzyme BVR 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74887 17191135 96122 9462 5013 HMOX1 HO-1 HO-1 3 6.5 OxS oxidative stress HO-1 heme oxygenase TRXr thioredoxin reductase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74888 17191135 96123 23454 12435 TXN TRX TRX 0 2.5 TRX Thioredoxin SH (reduced reduced form S-S oxidized form 1 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 74889 17191135 96124 9462 5013 HMOX1 HO-1 HO-1 5 6.5 ( B Regulation of HO-1 gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74890 17191135 96125 14345 7782 NFE2L2 NRF2 Nrf2 5 2.1 Nuclear factor-erythroid 2-related factor 2 (Nrf2) Nrf2 is a transcription factor responsible for the induction of several 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74891 17191135 96125 9462 5013 HMOX1 HO-1 HO-1 24 6.5 of several genes related to the cellular stress response including HO-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74892 17191135 96126 14345 7782 NFE2L2 NRF2 Nrf2 3 2.1 Under normal conditions Nrf2 is sequestered in the cytoplasm by an actin-binding protein Kelch-like 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74893 17191135 96126 10983 23177 KEAP1 KEAP1 Keap1 18 0.3 by an actin-binding protein Kelch-like ECH associating protein 1 (Keap1), Keap1 but upon exposure of cells to oxidative stress Nrf2 dissociates 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74894 17191135 96126 14345 7782 NFE2L2 NRF2 Nrf2 27 2.1 (Keap1), Keap1 but upon exposure of cells to oxidative stress Nrf2 dissociates from Keap1 translocates to the nucleus binds to antioxidant 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74895 17191135 96126 10983 23177 KEAP1 KEAP1 Keap1 30 0.3 upon exposure of cells to oxidative stress Nrf2 dissociates from Keap1 translocates to the nucleus binds to antioxidant responsive elements (AREs), 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74896 17191135 96126 9462 5013 HMOX1 HO-1 HO-1 43 6.5 nucleus binds to antioxidant responsive elements (AREs), AREs and activates HO-1 gene This review will emphasize the role of free radicals 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74897 17191135 96127 9462 5013 HMOX1 HO-1 HO-1 14 6.5 role played by members of the vitagene system such as HO-1 and Thioredoxin (Fig Fig 1 A in modulating the onset 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74899 17191135 96139 20997 11180 SOD2 Mn-SOD Mn-SOD 14 1.9 genes such as heme oxygenase thioredoxin and detoxificant enzymes (Mn-SOD, Mn-SOD glutathione S-transferase NADPH quinone reductase cytokine immunoreceptors and growth factors 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74902 17191135 96140 9462 5013 HMOX1 HO-1 HO-1 29 6.5 the following findings (a) a NO and NO-related species induce HO-1 expression and increase heme oxygenase activity in human glioblastoma cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74904 17191135 96141 9462 5013 HMOX1 HO-1 HO-1 14 6.5 and RNS can be directly involved in the modulation of HO-1 expression in eukaryotes is based on the evidence that different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74905 17191135 96141 9462 5013 HMOX1 HO-1 HO-1 30 6.5 on the evidence that different NO-releasing agents can markedly increase HO-1 and Hsp70 in a variety of tissues including brain cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74906 17191135 96141 9691 5232 HSPA1A HSP70 Hsp70 32 3.5 evidence that different NO-releasing agents can markedly increase HO-1 and Hsp70 in a variety of tissues including brain cells 19 20 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74908 17191135 96142 9905 5438 IFNG IFNG IFN-G 10 0.8 glial cells treatment with lipopolysaccaride (LPS) LPS and interferon-G (IFN-G) IFN-G promotes a rapid increase in both iNOS expression and nitrite 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74909 17191135 96142 14535 7873 NOS2A iNOS iNOS 17 3.2 and interferon-G (IFN-G) IFN-G promotes a rapid increase in both iNOS expression and nitrite levels followed by enhancement of Hsp70 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74910 17191135 96142 9691 5232 HSPA1A HSP70 Hsp70 26 3.5 both iNOS expression and nitrite levels followed by enhancement of Hsp70 3 20 whereas the modulation of HO-1 mRNA expression by 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74911 17191135 96142 9462 5013 HMOX1 HO-1 HO-1 36 6.5 by enhancement of Hsp70 3 20 whereas the modulation of HO-1 mRNA expression by iNOS-derived NO following stimulation with LPS has 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74912 17191135 96142 14535 7873 NOS2A iNOS iNOS-derived 40 2.7 3 20 whereas the modulation of HO-1 mRNA expression by iNOS-derived NO following stimulation with LPS has also been reported in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74914 17191135 96143 14535 7873 NOS2A iNOS iNOS 5 3.2 Moreover the early increase in iNOS protein levels observed in endothelial cells exposed to low oxygen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74915 17191135 96143 9462 5013 HMOX1 HO-1 HO-1 23 6.5 to low oxygen tension seems to precede the stimulation of HO-1 expression and activity an effect that appears to be finely 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74916 17191135 96144 9462 5013 HMOX1 HO-1 HO-1 25 6.5 molecule which by triggering expression of cytoprotective genes such as HO-1 and Hsp70 may lead to adaptation and resistance of brain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74917 17191135 96144 9691 5232 HSPA1A HSP70 Hsp70 27 3.5 by triggering expression of cytoprotective genes such as HO-1 and Hsp70 may lead to adaptation and resistance of brain cells to 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74918 17191135 96145 9462 5013 HMOX1 HO-1 HO-1 20 6.5 sites within the promoter and distal enhancer regions of the HO-1 gene such as Fos/Jun Fos Jun activator protein-1 (AP-1)], AP-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74919 17191135 96145 7683 3796 FOS FOS Fos 24 1.8 distal enhancer regions of the HO-1 gene such as Fos/Jun Fos Jun activator protein-1 (AP-1)], AP-1 nuclear factor-kB (NFkB) NFkB and 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74920 17191135 96145 10824 6204 JUN AP-1 AP-1 27 1.6 HO-1 gene such as Fos/Jun Fos Jun activator protein-1 (AP-1)], AP-1 nuclear factor-kB (NFkB) NFkB and the more recently identified Nrf2 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.00077545260429419<>ScoreDetail__3796|FOS|0.000631914674627876__3797|FOSB|0.000554782843078888__6205|JUNB|0.00063223039517478__6204|JUN|0.00077545260429419__6206|JUND|0.00070916977257676__ 0 0 0 0 0 74921 17191135 96145 14352 7794 NFKB1 NFKB NFkB 30 0.6 Fos/Jun Fos Jun activator protein-1 (AP-1)], AP-1 nuclear factor-kB (NFkB) NFkB and the more recently identified Nrf2 proteins 24 -26 (Fig 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74922 17191135 96145 14345 7782 NFE2L2 NRF2 Nrf2 36 2.1 AP-1 nuclear factor-kB (NFkB) NFkB and the more recently identified Nrf2 proteins 24 -26 (Fig Fig 1 B contain cysteine residues 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74923 17191135 96147 9462 5013 HMOX1 HO-1 HO-1 22 6.5 and complex IV inhibition an effect associated with up-regulation of HO-1 and nuclear translocation of the transcription factor Nrf-2 27 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74924 17191135 96147 14345 7782 NFE2L2 NRF2 Nrf-2 30 1.6 up-regulation of HO-1 and nuclear translocation of the transcription factor Nrf-2 27 1 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74925 17191135 96156 9726 5269 HSPE1 HSP10 Hsp10 7 1.9 Some of the known Hsps include ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74926 17191135 96156 9708 5247 HSPB2 HSP27 Hsp27 8 1.9 Some of the known Hsps include ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or 2 JUMiner_v2.2 1 0 0 2 5246 TotalCon:2<>5246|HSPB1|3315|Complete__5247|HSPB2|3316|Complete__<>AvaiableGeneRif=2<>BEST:5246|HSPB1|0.000908602424758586<>ScoreDetail__5246|HSPB1|0.000908602424758586__5247|HSPB2|0.000783297072361479__ 0 0 0 0 0 74927 17191135 96156 9462 5013 HMOX1 HO-1 HO-1 11 6.5 the known Hsps include ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74928 17191135 96156 19730 1546 SERPINH1 HSP47 Hsp47 12 1.3 known Hsps include ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 Hsp100 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74929 17191135 96156 9718 5261 HSPD1 HSP60 Hsp60 13 1.9 Hsps include ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 Hsp100 105 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74930 17191135 96156 9700 5241 HSPA8 HSC70 Hsc70 14 1.9 include ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 Hsp100 105 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74931 17191135 96156 9691 5232 HSPA1A HSP70 Hsp70 15 3.5 ubiquitin Hsp10 Hsp27 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 Hsp100 105 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74932 17191135 96156 9691 5232 HSPA1A HSP72 Hsp72 17 2.9 Hsp32 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 Hsp100 105 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74933 17191135 96156 9676 5253 HSP90AA1 Hsp90 Hsp90 18 3.4 (or or HO-1 Hsp47 Hsp60 Hsc70 Hsp70 (or or Hsp72 Hsp90 and Hsp100/105 Hsp100 105 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74934 17191135 96159 9700 5241 HSPA8 HSC70 Hsc70 5 1.9 Included in this family are Hsc70 (heat heat shock cognate the constitutive form Hsp70 (the the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74935 17191135 96159 9691 5232 HSPA1A HSP70 Hsp70 12 3.5 family are Hsc70 (heat heat shock cognate the constitutive form Hsp70 (the the inducible form also referred to as Hsp72 GRP75 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74936 17191135 96159 9691 5232 HSPA1A HSP72 Hsp72 20 2.9 form Hsp70 (the the inducible form also referred to as Hsp72 GRP75 (a a constitutively expressed glucose-regulated protein found in the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74937 17191135 96159 9701 5244 HSPA9 GRP75 GRP75 21 1.9 Hsp70 (the the inducible form also referred to as Hsp72 GRP75 (a a constitutively expressed glucose-regulated protein found in the endoplasmic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74938 17191135 96160 9691 5232 HSPA1A HSP70 Hsp70 9 3.5 After a variety of central nervous system (CNS) CNS insults Hsp70 is synthesized at high levels and is present in cytosol 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74943 17191135 96164 9691 5232 HSPA1A HSP70 Hsp70 5 3.5 After heat shock synthesis of Hsp70 may increase to become the most abundant protein in the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74944 17191135 96165 9691 5232 HSPA1A HSP70 Hsp70 2 3.5 Once synthesized Hsp70 binds to denaturated proteins in an ATP-dependent manner 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74945 17191135 96168 9691 5232 HSPA1A HSP70 Hsp70 18 3.5 cytokine-induced nitrosative stress is associated with an increased synthesis of Hsp70 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74946 17191135 96169 9691 5232 HSPA1A HSP70 Hsp70 2 3.5 Increase in Hsp70 protein expression was also found after treatment of cells with 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74947 17191135 96169 9691 5232 HSPA1A HSP70 Hsp70 28 3.5 (SNP), SNP thus suggesting a role for NO in inducing Hsp70 proteins 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74948 17191135 96171 9691 5232 HSPA1A HSP72 Hsp72 2 2.9 Induction of Hsp72 under stress conditions is often accompanied by the induction of 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74949 17191135 96172 9462 5013 HMOX1 HO-1 HO-1 28 6.5 toxicity by acting at three different levels (i) i inducing HO-1 and Hsp72 proteins (ii) ii decreasing the neuronal 3-nitrotyrosine levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74950 17191135 96172 9691 5232 HSPA1A HSP72 Hsp72 30 2.9 acting at three different levels (i) i inducing HO-1 and Hsp72 proteins (ii) ii decreasing the neuronal 3-nitrotyrosine levels and therefore 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74951 17191135 96172 14535 7873 NOS2A NOS NOS 41 2.7 (ii) ii decreasing the neuronal 3-nitrotyrosine levels and therefore inducible NOS activity and (iii) iii by the well known direct free 1 JUMiner_v2.2 1 0 0 2 7873 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7873|NOS2A|0.000591049358800701<>ScoreDetail__7873|NOS2A|0.000591049358800701__7872|NOS1|0.000524055369725158__ 0 0 0 0 0 74952 17191135 96175 9691 5232 HSPA1A HSP70 Hsp70 6 3.5 During translocation this proteins interact with Hsp70 ATP-dependent binding and the release of Hsp70 provide the major 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74953 17191135 96175 9691 5232 HSPA1A HSP70 Hsp70 13 3.5 proteins interact with Hsp70 ATP-dependent binding and the release of Hsp70 provide the major driving force for complete transport of polypeptides 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74954 17191135 96176 9691 5232 HSPA1A HSP70 Hsp70 8 3.5 Although most imported polypeptides are released from soluble Hsp70 however a subset of aggregation-sensitive polypeptides must be transferred from 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74955 17191135 96176 9691 5232 HSPA1A HSP70 Hsp70 19 3.5 however a subset of aggregation-sensitive polypeptides must be transferred from Hsp70 to Hsp60 for folding 40 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74956 17191135 96176 9718 5261 HSPD1 HSP60 Hsp60 21 1.9 subset of aggregation-sensitive polypeptides must be transferred from Hsp70 to Hsp60 for folding 40 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74957 17191135 96177 9691 5232 HSPA1A HSP70 Hsp70 12 3.5 the close functional interaction between this chaperonin system and the Hsp70 system it is likely that up-regulation of Hsp60 may be 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74958 17191135 96177 9718 5261 HSPD1 HSP60 Hsp60 20 1.9 and the Hsp70 system it is likely that up-regulation of Hsp60 may be a fundamental site targeted by LAC action with 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74960 17191135 96178 9462 5013 HMOX1 HO-1 HO-1 15 6.5 heme oxygenase (HO) HO isoforms were described an inducible isoform HO-1 and a constitutive isoform HO-2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74961 17191135 96178 9463 5014 HMOX2 HO-2 HO-2 20 1.9 were described an inducible isoform HO-1 and a constitutive isoform HO-2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74962 17191135 96183 9462 5013 HMOX1 HO-1 HO-1 11 6.5 from the identity between the active centers of the enzyme HO-1 and HO-2 broadly differ in cell and tissue regulation and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74963 17191135 96183 9463 5014 HMOX2 HO-2 HO-2 11 1.9 from the identity between the active centers of the enzyme HO-1 and HO-2 broadly differ in cell and tissue regulation and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74964 17191135 96183 9463 5014 HMOX2 HO-2 HO-2 13 1.9 identity between the active centers of the enzyme HO-1 and HO-2 broadly differ in cell and tissue regulation and distribution 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74968 17191135 96185 9462 5013 HMOX1 HO-1 HO-1 5 6.5 Furthermore in cultured human cells HO-1 expression can be repressed by hypoxia or by the treatment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74969 17191135 96186 9463 5014 HMOX2 HO-2 HO-2 3 1.9 On the contrary HO-2 the constitutive form is responsive to developmental factors adrenal glucocorticoids 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74970 17191135 96187 9462 5013 HMOX1 HO-1 HO-1 1 6.5 Although HO-1 and HO-2 catalyze the same reaction they play different roles 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74971 17191135 96187 9463 5014 HMOX2 HO-2 HO-2 1 1.9 Although HO-1 and HO-2 catalyze the same reaction they play different roles 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74972 17191135 96187 9463 5014 HMOX2 HO-2 HO-2 3 1.9 Although HO-1 and HO-2 catalyze the same reaction they play different roles in protecting 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74973 17191135 96188 9462 5013 HMOX1 HO-1 HO-1 5 6.5 The current hypothesis suggests that HO-1 induction is one of the earlier cellular responses to tissue 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74974 17191135 96189 9463 5014 HMOX2 HO-2 HO-2 3 1.9 On the contrary HO-2 constitutively expressed is primarily involved in maintaining cell heme homeostasis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74975 17191135 96191 9462 5013 HMOX1 HO-1 HO-1 3 6.5 The induction of HO-1 is regulated principally by two upstream enhancers E1 and E2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74976 17191135 96192 12203 6776 MAF MAF Maf 22 0.5 called ARE that also conform to the sequence of the Maf recognition element (MARE) MARE 53 with a consensus sequence (GCnnnGTA) 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74977 17191135 96193 14345 7782 NFE2L2 NRF2 Nrf2 12 2.1 evidence to suggest that heterodimers of NF-E2-related factors 2 (Nrf2) Nrf2 and one or another of the small Maf proteins (i.e 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74978 17191135 96193 12203 6776 MAF MAF Maf 20 0.5 2 (Nrf2) Nrf2 and one or another of the small Maf proteins (i.e i.e MafK MafF and MafG are directly involved 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74979 17191135 96193 12211 6782 MAFK MAFK MafK 23 0.3 one or another of the small Maf proteins (i.e i.e MafK MafF and MafG are directly involved in induction of HO-1 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74980 17191135 96193 12209 6780 MAFF MAFF MafF 24 0.3 or another of the small Maf proteins (i.e i.e MafK MafF and MafG are directly involved in induction of HO-1 gene 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74981 17191135 96193 9462 5013 HMOX1 HO-1 HO-1 33 6.5 MafK MafF and MafG are directly involved in induction of HO-1 gene through these MAREs 53 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74982 17191135 96193 12210 6781 MAFG MAFG MafG 26 0.1 of the small Maf proteins (i.e i.e MafK MafF and MafG are directly involved in induction of HO-1 gene through these 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74983 17191135 96194 14345 7782 NFE2L2 NRF2 Nrf2 5 2.1 A possible model centered on Nrf2 activity suggests that the heme protein Bach1 works as a 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74984 17191135 96194 1778 20473 BRIP1 BACH1 Bach1 12 2.4 model centered on Nrf2 activity suggests that the heme protein Bach1 works as a transcriptional repressor (Fig Fig 1 A B 2 JUMiner_v2.2 1 0 0 2 935 TotalCon:2<>935|BACH1|571|Complete__20473|BRIP1|83990|Complete__<>AvaiableGeneRif=2<>BEST:935|BACH1|0.00105162003880115<>ScoreDetail__935|BACH1|0.00105162003880115__20473|BRIP1|0.000321758489038601__ 0 0 0 0 0 74985 17191135 96195 9462 5013 HMOX1 HO-1 HO-1 3 6.5 Hence regulation of HO-1 gene expression by Bach1 and heme occurs through antagonism between 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74986 17191135 96195 1778 20473 BRIP1 BACH1 Bach1 7 2.4 Hence regulation of HO-1 gene expression by Bach1 and heme occurs through antagonism between transcription activators and the 2 JUMiner_v2.2 1 0 0 2 935 TotalCon:2<>935|BACH1|571|Complete__20473|BRIP1|83990|Complete__<>AvaiableGeneRif=2<>BEST:935|BACH1|0.00105162003880115<>ScoreDetail__935|BACH1|0.00105162003880115__20473|BRIP1|0.000321758489038601__ 0 0 0 0 0 74987 17191135 96195 1778 20473 BRIP1 BACH1 Bach1 19 2.4 heme occurs through antagonism between transcription activators and the repressor Bach1 2 JUMiner_v2.2 1 0 0 2 935 TotalCon:2<>935|BACH1|571|Complete__20473|BRIP1|83990|Complete__<>AvaiableGeneRif=2<>BEST:935|BACH1|0.00105162003880115<>ScoreDetail__935|BACH1|0.00105162003880115__20473|BRIP1|0.000321758489038601__ 0 0 0 0 0 74988 17191135 96196 9462 5013 HMOX1 HO-1 HO-1 6 6.5 Under normal physiological conditions expression of HO-1 is repressed by Bach1/Maf Bach1 Maf complex while increased levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74989 17191135 96196 1778 20473 BRIP1 BACH1 Bach1 10 2.4 normal physiological conditions expression of HO-1 is repressed by Bach1/Maf Bach1 Maf complex while increased levels of heme displace Bach1 from 2 JUMiner_v2.2 1 0 0 2 935 TotalCon:2<>935|BACH1|571|Complete__20473|BRIP1|83990|Complete__<>AvaiableGeneRif=2<>BEST:935|BACH1|0.00105162003880115<>ScoreDetail__935|BACH1|0.00105162003880115__20473|BRIP1|0.000321758489038601__ 0 0 0 0 0 74990 17191135 96196 12203 6776 MAF MAF Maf 10 0.5 physiological conditions expression of HO-1 is repressed by Bach1/Maf Bach1 Maf complex while increased levels of heme displace Bach1 from the 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74991 17191135 96196 1778 20473 BRIP1 BACH1 Bach1 18 2.4 Bach1/Maf Bach1 Maf complex while increased levels of heme displace Bach1 from the enhancers and allow activators such as heterodimer of 2 JUMiner_v2.2 1 0 0 2 935 TotalCon:2<>935|BACH1|571|Complete__20473|BRIP1|83990|Complete__<>AvaiableGeneRif=2<>BEST:935|BACH1|0.00105162003880115<>ScoreDetail__935|BACH1|0.00105162003880115__20473|BRIP1|0.000321758489038601__ 0 0 0 0 0 74992 17191135 96196 12203 6776 MAF MAF Maf 29 0.5 from the enhancers and allow activators such as heterodimer of Maf with NF-E2 related activators (Nrf2), Nrf2 to interact with the 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74993 17191135 96196 14345 7782 NFE2L2 NF-E2 NF-E2 31 1.6 enhancers and allow activators such as heterodimer of Maf with NF-E2 related activators (Nrf2), Nrf2 to interact with the transcriptional promotion 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 14343 7780 NFE2 0 74994 17191135 96196 14345 7782 NFE2L2 NRF2 Nrf2 34 2.1 such as heterodimer of Maf with NF-E2 related activators (Nrf2), Nrf2 to interact with the transcriptional promotion of HO-1 33 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 74995 17191135 96196 9462 5013 HMOX1 HO-1 HO-1 42 6.5 activators (Nrf2), Nrf2 to interact with the transcriptional promotion of HO-1 33 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74996 17191135 96197 1681 1062 BLVRA BVR BVR 7 0.9 Heme oxygenase activity is regulated also by BVR because this latter reduces biliverdin (BV), BV the inhibitory product 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74997 17191135 96198 1681 1062 BLVRA BVR BVR 4 0.9 The molecular mass of BVR ranges between 41-42 KDa (human) human and 33-34 KDa (rat), 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74998 17191135 96199 1681 1062 BLVRA BVR BVR 2 0.9 Until now BVR was considered a noninducible protein but recent data showed that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75000 17191135 96200 1681 1062 BLVRA BVR BVR 4 0.9 In the rat brain BVR is co-expressed in cells that display HO-1 and/or and or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75001 17191135 96200 9462 5013 HMOX1 HO-1 HO-1 11 6.5 the rat brain BVR is co-expressed in cells that display HO-1 and/or and or HO-2 under normal conditions as well as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75002 17191135 96200 9463 5014 HMOX2 HO-2 HO-2 13 1.9 is co-expressed in cells that display HO-1 and/or and or HO-2 under normal conditions as well as in regions and cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75003 17191135 96200 9462 5013 HMOX1 HO-1 HO-1 33 6.5 cell types that have the potential to express heat shock-inducible HO-1 protein 57 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75004 17191135 96201 1681 1062 BLVRA BVR BVR 4 0.9 Further evidence demonstrated that BVR exhibited developmental changes with the activity increasing after birth and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75005 17191135 96202 1681 1062 BLVRA BVR BVR 9 0.9 Immunohistochemical analysis revealed age-related pattern of the expression of BVR in select rat brain areas such as the cortex substantia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75006 17191135 96203 9463 5014 HMOX2 HO-2 HO-2 16 1.9 abundant in reticuloendothelial organs such as liver and spleen whereas HO-2 is localized in specific organs such as brain kidney and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75007 17191135 96204 9463 5014 HMOX2 HO-2 HO-2 16 1.9 high HO activity under basal conditions mostly accounted for by HO-2 the latter being expressed in neuronal populations in forebrain hippocampus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75008 17191135 96206 9462 5013 HMOX1 HO-1 HO-1 7 6.5 This finding indicates that the activation of HO-1 and the following formation of CO can be induced by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75009 17191135 96207 4928 2355 CRH CRH CRH 14 0.3 within the parvicellular part of the paraventricular nucleus release both CRH and AVP the neuropeptides that initiate the endocrine response to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75010 17191135 96207 14455 16400 NLRP3 AVP AVP 16 0.3 parvicellular part of the paraventricular nucleus release both CRH and AVP the neuropeptides that initiate the endocrine response to a stressor 1 JUMiner_v2.2 1 0 0 2 894 TotalCon:3<>894|AVP|551|Complete__16400|NLRP3|114548|Complete__5432|IFNAR1|3454|Complete__<>AvaiableGeneRif=3<>BEST:894|AVP|0.000600449511871541<>ScoreDetail__5432|IFNAR1|0.000466924620201651__16400|NLRP3|0.00046775182975843__894|AVP|0.000600449511871541__ 0 0 0 0 0 75011 17191135 96207 16975 9201 POMC ACTH ACTH 32 1.0 endocrine response to a stressor stimulating the release of pituitary ACTH 44 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75012 17191135 96209 9027 4817 HARS2 HO3 HO-3 13 0.8 Maines and her group described a third HO isoform called HO-3 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75013 17191135 96211 9027 4817 HARS2 HO3 HO-3 13 0.8 paper Scapagnini et al investigated the regional brain expression of HO-3 and they found that this isoform is expressed mainly in 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75014 17191135 96212 9027 4817 HARS2 HO3 HO-3 3 0.8 The regulation of HO-3 gene expression and its synthesis is poorly understood and its 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75015 17191135 96213 23454 12435 TXN TRX Trx 5 2.5 The thioredoxin system The thioredoxin (Trx) Trx system (Trx Trx and Trx reductase has received a considerable 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75016 17191135 96213 23454 12435 TXN TRX Trx 7 2.5 The thioredoxin system The thioredoxin (Trx) Trx system (Trx Trx and Trx reductase has received a considerable attention in the 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75017 17191135 96213 23454 12435 TXN TRX Trx 9 2.5 thioredoxin system The thioredoxin (Trx) Trx system (Trx Trx and Trx reductase has received a considerable attention in the last years 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75018 17191135 96214 23454 12435 TXN TRX Trx 0 2.5 Trx is a ubiquitous thiol oxidoreductase system that regulates cellular redox 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75019 17191135 96215 23454 12435 TXN TRX Trx 19 2.5 a hydrogen donor for ribonucleotide reductase required for DNA synthesis Trx plays an essential role in cell function by limiting oxidative 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75020 17191135 96216 23454 12435 TXN TRX Trx 20 2.5 of many processes is provided by an interaction between the Trx and GSH systems 62 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75021 17191135 96217 23454 12435 TXN TRX Trx 2 2.5 In fact Trx and GSH systems are involved in a variety of redox-dependent 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75022 17191135 96220 23454 12435 TXN TRX Trx 1 2.5 The Trx system rather may play a critical role in the redox 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75023 17191135 96221 23454 12435 TXN TRX Trx 16 2.5 reduced form by TrxR and NADPH collectively known as the Trx system 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75024 17191135 96222 23454 12435 TXN TRX Trx 0 2.5 Trx reductase belongs to the flavoprotein family of pyridine nucleotide disulfide 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75027 17191135 96226 23454 12435 TXN TRX Trx 18 2.5 the catalytic activity of mammalian TrxR toward reduction of oxidized Trx and various antioxidant molecules such as lipoic acid ascorbic acid 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75028 17191135 96234 23454 12435 TXN TRX Trx 0 2.5 Trx which behaves as a soluble protein after disruption of cells 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75029 17191135 96234 23454 12435 TXN TRX1 Trx-1 18 3.0 of cells exists as one of the cytoplasmic proteins (Trx-1) Trx-1 and a mitochondrial (Trx-2) Trx-2 isoform 60 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75030 17191135 96234 23455 17772 TXN2 TRX2 Trx-2 22 1.3 of the cytoplasmic proteins (Trx-1) Trx-1 and a mitochondrial (Trx-2) Trx-2 isoform 60 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75031 17191135 96235 23454 12435 TXN TRX1 Trx-1 10 3.0 A growing number of studies report a striking association between Trx-1 up-regulation in the CNS and neuron survival following various injuries 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75032 17191135 96236 23454 12435 TXN TRX1 Trx-1 0 3.0 Trx-1 and TrxR the most extensively studied eukaryotic thioredoxin proteins were 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75033 17191135 96237 23454 12435 TXN TRX1 Trx-1 0 3.0 Trx-1 has been then found widely expressed in rat brain especially 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75034 17191135 96238 23454 12435 TXN TRX1 Trx-1 3 3.0 Immunohistochemical analysis of Trx-1 in human brain showed positive Trx1-like staining in white matter 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75035 17191135 96239 23454 12435 TXN TRX Trx 4 2.5 The promoter of the Trx gene contains a series of stress-responsive elements various transcription factor 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75036 17191135 96239 21038 11205 SP1 SP1 SP1 19 0.6 of stress-responsive elements various transcription factor binding sites such as SP1 GCF and WT-ZFP conferring constitutive expression inducible expression elements such 1 JUMiner_v2.2 1 0 0 2 11205 TotalCon:3<>11205|SP1|6667|Complete__26780|DAND5|199699|No_GeneRif__9514|PSG1|5669|Complete__<>AvaiableGeneRif=2<>BEST:11205|SP1|0.000794334123436801<>ScoreDetail__9514|PSG1|0.000307536098880178__11205|SP1|0.000794334123436801__ 0 0 0 0 0 75037 17191135 96239 2057 1317 C2orf3 GCF GCF 20 0.3 stress-responsive elements various transcription factor binding sites such as SP1 GCF and WT-ZFP conferring constitutive expression inducible expression elements such as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75038 17191135 96239 10824 6204 JUN AP-1 AP-1 31 1.6 and WT-ZFP conferring constitutive expression inducible expression elements such as AP-1 AP-2 NF-kB Oct-1 PEA-3 Myb and the antioxidant-responsive element (ARE) 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.00077545260429419<>ScoreDetail__3796|FOS|0.000631914674627876__3797|FOSB|0.000554782843078888__6205|JUNB|0.00063223039517478__6204|JUN|0.00077545260429419__6206|JUND|0.00070916977257676__ 0 0 0 0 0 75039 17191135 96239 22027 11742 TFAP2A AP-2 AP-2 32 1.6 WT-ZFP conferring constitutive expression inducible expression elements such as AP-1 AP-2 NF-kB Oct-1 PEA-3 Myb and the antioxidant-responsive element (ARE) ARE 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75040 17191135 96239 14352 7794 NFKB1 NF-kB NF-kB 33 0.6 conferring constitutive expression inducible expression elements such as AP-1 AP-2 NF-kB Oct-1 PEA-3 Myb and the antioxidant-responsive element (ARE) ARE 71 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75041 17191135 96239 20185 10963 SLC22A1 OCT1 Oct-1 34 0.3 constitutive expression inducible expression elements such as AP-1 AP-2 NF-kB Oct-1 PEA-3 Myb and the antioxidant-responsive element (ARE) ARE 71 11 JUMiner_v2.2 1 0 0 2 9212 TotalCon:2<>9212|POU2F1|5451|Complete__10963|SLC22A1|6580|Complete__<>AvaiableGeneRif=2<>BEST:9212|POU2F1|0.000801597851717757<>ScoreDetail__10963|SLC22A1|0.000501457087467555__9212|POU2F1|0.000801597851717757__ 0 0 0 0 0 75042 17191135 96239 6818 3493 ETV4 PEA3 PEA-3 35 0.3 expression inducible expression elements such as AP-1 AP-2 NF-kB Oct-1 PEA-3 Myb and the antioxidant-responsive element (ARE) ARE 71 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75043 17191135 96239 13916 7545 MYB MYB Myb 36 0.3 inducible expression elements such as AP-1 AP-2 NF-kB Oct-1 PEA-3 Myb and the antioxidant-responsive element (ARE) ARE 71 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75044 17191135 96240 23454 12435 TXN TRX1 Trx-1 1 3.0 ARE-mediated Trx-1 induction involves the transcription factor Nfr2 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75045 17191135 96241 23454 12435 TXN TRX Trx 6 2.5 Moreover it has been reported that Trx is constitutively present as a surface-associated sulfhydryl protein in plasma 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75046 17191135 96242 23454 12435 TXN TRX Trx 14 2.5 UV irradiation and hydrogen peroxide have been shown to induce Trx expression and secretion as a redox-sensitive molecule with cytokine-like and 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75047 17191135 96243 23454 12435 TXN TRX Trx 31 2.5 and hemin has been reported to cause the translocation of Trx from the cytoplasm to the nucleus where it regulates the 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75048 17191135 96243 10824 6204 JUN AP-1 AP-1 54 1.6 DNA binding activity of critical transcription factors such as the AP-1 family members NF-kB Jun Fos p53 CREB PEBP2/CBF, PEBP2 CBF 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.00077545260429419<>ScoreDetail__3796|FOS|0.000631914674627876__3797|FOSB|0.000554782843078888__6205|JUNB|0.00063223039517478__6204|JUN|0.00077545260429419__6206|JUND|0.00070916977257676__ 0 0 0 0 0 75049 17191135 96243 14352 7794 NFKB1 NF-kB NF-kB 57 0.6 of critical transcription factors such as the AP-1 family members NF-kB Jun Fos p53 CREB PEBP2/CBF, PEBP2 CBF Myb all involved 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75050 17191135 96243 7683 3796 FOS FOS Fos 59 1.8 transcription factors such as the AP-1 family members NF-kB Jun Fos p53 CREB PEBP2/CBF, PEBP2 CBF Myb all involved in fundamental 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75051 17191135 96243 22671 11998 TP53 p53 p53 60 0.6 factors such as the AP-1 family members NF-kB Jun Fos p53 CREB PEBP2/CBF, PEBP2 CBF Myb all involved in fundamental processes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75052 17191135 96243 4911 2345 CREB1 CREB CREB 61 1.9 such as the AP-1 family members NF-kB Jun Fos p53 CREB PEBP2/CBF, PEBP2 CBF Myb all involved in fundamental processes such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75053 17191135 96243 13916 7545 MYB MYB Myb 63 0.1 family members NF-kB Jun Fos p53 CREB PEBP2/CBF, PEBP2 CBF Myb all involved in fundamental processes such as gene expression cell 6 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75054 17191135 96244 23454 12435 TXN TRX Trx 3 2.5 Plasma levels of Trx in normal individuals vary between 10 and 80 ng/ml; ng 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75055 17191135 96245 23454 12435 TXN TRX1 Trx-1 6 3.0 Of note several studies reported increased Trx-1 expression in many human primary cancers and tumor cell lines 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75056 17191135 96246 23454 12435 TXN TRX Trx 1 2.5 Elevated Trx levels may contribute to increased cancer cell proliferation and resistance 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75057 17191135 96247 23454 12435 TXN TRX1 Trx-1 4 3.0 Recent work suggests that Trx-1 play a key role in NGF signaling pathways 74 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75058 17191135 96247 14373 7808 NGF NGF NGF 10 0.6 Recent work suggests that Trx-1 play a key role in NGF signaling pathways 74 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75059 17191135 96248 14373 7808 NGF NGF NGF 0 0.6 NGF a neurotrophic factor regulating development maintenance and function of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75060 17191135 96248 23454 12435 TXN TRX1 Trx-1 17 3.0 and function of the CNS has been shown to activate Trx-1 expression via cyclic AMP (cAMP)-response cAMP -response elements (CREs) CREs 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75061 17191135 96248 23454 12435 TXN TRX1 Trx-1 28 3.0 AMP (cAMP)-response cAMP -response elements (CREs) CREs present in the Trx-1 gene promoter and also to induce nuclear translocation of Trx1 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75062 17191135 96248 23454 12435 TXN TRX1 Trx1 38 2.5 Trx-1 gene promoter and also to induce nuclear translocation of Trx1 75 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75063 17191135 96249 23454 12435 TXN TRX Trx 17 2.5 to regulate the function of proteins through thiol-disulfide exchange reactions Trx may also have beneficial effects during oxidative stress by transcriptionally 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75064 17191135 96249 9462 5013 HMOX1 HO-1 HO-1 29 6.5 also have beneficial effects during oxidative stress by transcriptionally upregulating HO-1 with important cytoprotective pleiotropic effects deriving from heme degradation biliverdin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75065 17191135 96251 23454 12435 TXN TRX Trx 9 2.5 Besides the role as a source of reducing equivalents Trx by itself acts as antioxidant or ROS scavenger 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75067 17191135 96252 23454 12435 TXN TRX Trx 2 2.5 In fact Trx eliminates singlet oxygen hydroxyl radical and hydrogen peroxide 78 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75068 17191135 96253 23454 12435 TXN TRX Trx 8 2.5 Another family of proteins acting in conjunction with Trx is the peroxide scavenger Peroxiredoxin (Prx) Prx 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75069 17191135 96253 17269 16753 PRDX6 PRX Prx 14 0.3 in conjunction with Trx is the peroxide scavenger Peroxiredoxin (Prx) Prx 2 JUMiner_v2.2 1 0 0 2 16753 TotalCon:2<>13797|PRX|57716|Complete__16753|PRDX6|9588|Complete__<>AvaiableGeneRif=2<>BEST:16753|PRDX6|0.000904407642412684<>ScoreDetail__16753|PRDX6|0.000904407642412684__13797|PRX|0.00074121081355502__ 0 0 0 0 0 75070 17191135 96254 23454 12435 TXN TRX Trx 23 2.5 antioxidant enzymes most of which use the reducing activity of Trx or other electron donors to catalyze the reduction of peroxides 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75071 17191135 96255 17269 16753 PRDX6 PRX Prx 8 0.3 A number of studies have shown that several Prx isoforms can be induced in brain in response to various 2 JUMiner_v2.2 1 0 0 2 16753 TotalCon:2<>13797|PRX|57716|Complete__16753|PRDX6|9588|Complete__<>AvaiableGeneRif=2<>BEST:16753|PRDX6|0.000904407642412684<>ScoreDetail__16753|PRDX6|0.000904407642412684__13797|PRX|0.00074121081355502__ 0 0 0 0 0 75072 17191135 96256 23454 12435 TXN TRX Trx 3 2.5 As for cytosolic Trx (Trx-1), Trx-1 the induction of Prx-1 appears to involve the 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75073 17191135 96256 23454 12435 TXN TRX1 Trx-1 4 3.0 As for cytosolic Trx (Trx-1), Trx-1 the induction of Prx-1 appears to involve the transcription factor 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75074 17191135 96256 17263 9352 PRDX1 PRX1 Prx-1 8 0.3 As for cytosolic Trx (Trx-1), Trx-1 the induction of Prx-1 appears to involve the transcription factor Nrf2 11 JUMiner_v2.2 1 0 0 2 9142 TotalCon:2<>9352|PRDX1|5052|Complete__9142|PRRX1|5396|Complete__<>AvaiableGeneRif=2<>BEST:9142|PRRX1|0.000865361317195306<>ScoreDetail__9352|PRDX1|0.000802147728292869__9142|PRRX1|0.000865361317195306__ 0 0 0 0 0 75075 17191135 96256 14345 7782 NFE2L2 NRF2 Nrf2 15 2.1 the induction of Prx-1 appears to involve the transcription factor Nrf2 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 75076 17191135 96257 17269 16753 PRDX6 PRX Prx 7 0.3 Recent studies have revealed aberrant patterns of Prx expression in the CNS of patients affected by neurodegenerative disorders 2 JUMiner_v2.2 1 0 0 2 16753 TotalCon:2<>13797|PRX|57716|Complete__16753|PRDX6|9588|Complete__<>AvaiableGeneRif=2<>BEST:16753|PRDX6|0.000904407642412684<>ScoreDetail__16753|PRDX6|0.000904407642412684__13797|PRX|0.00074121081355502__ 0 0 0 0 0 75077 17191135 96258 23454 12435 TXN TRX Trx 4 2.5 A second slightly larger Trx isoform (Trx-2), Trx-2 is also present in mammalian cells where 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75078 17191135 96258 23455 17772 TXN2 TRX2 Trx-2 6 1.3 A second slightly larger Trx isoform (Trx-2), Trx-2 is also present in mammalian cells where exhibits characteristics consistent 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75079 17191135 96259 23455 17772 TXN2 TRX2 Trx-2 0 1.3 Trx-2 inactivation studies in DT-40 chicken cells suggest that this mitochondrial 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75080 17191135 96259 23454 12435 TXN TRX Trx 11 2.5 inactivation studies in DT-40 chicken cells suggest that this mitochondrial Trx isoenzyme is essential for cell survival 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75081 17191135 96260 23455 17772 TXN2 TRX2 Trx-2 4 1.3 The homozygous disruption of Trx-2 generates a lethal embryonic phenotype in mice 81 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75082 17191135 96261 23455 17772 TXN2 TRX2 Trx-2 3 1.3 In support of Trx-2 protective function(s) function s against oxidative stress transfection of Trx2 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75083 17191135 96261 23455 17772 TXN2 TRX2 Trx2 11 1.3 Trx-2 protective function(s) function s against oxidative stress transfection of Trx2 reduced the sensitivity of human osteosarcoma and embryo kidney cells 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75085 17191135 96262 23455 17772 TXN2 TRX2 Trx2 2 1.3 Mitochondrial isoform Trx2 is abundant and widely distributed in rat brain 83 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75086 17191135 96263 23455 17772 TXN2 TRX2 Trx-2 6 1.3 Brain regions showing highest expression of Trx-2 at the RNA and protein levels include the olfactory bulb 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75087 17191135 96264 23455 17772 TXN2 TRX2 Trx2 4 1.3 The expression pattern of Trx2 appears to be associated with brain regions producing high levels 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75089 17191135 96266 926 620 APP amyloid amyloid 7 1.3 It is characterized pathologically by deposition of amyloid B-peptide (AB) AB in senile (neuritic) neuritic plaques and the 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 75091 17191135 96269 9691 5232 HSPA1A HSP70 Hsp70 54 3.5 from the cellular machinery and recruitment of chaperone pairs including Hsp70 and Hsp27 endowed with anti-apoptotic properties 85 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75092 17191135 96269 9708 5247 HSPB2 HSP27 Hsp27 56 1.9 cellular machinery and recruitment of chaperone pairs including Hsp70 and Hsp27 endowed with anti-apoptotic properties 85 2 JUMiner_v2.2 1 0 0 2 5246 TotalCon:2<>5246|HSPB1|3315|Complete__5247|HSPB2|3316|Complete__<>AvaiableGeneRif=2<>BEST:5246|HSPB1|0.000908602424758586<>ScoreDetail__5246|HSPB1|0.000908602424758586__5247|HSPB2|0.000783297072361479__ 0 0 0 0 0 75093 17191135 96270 12369 6893 MAPT tau tau 3 1.8 Binding of phosphorylated tau to Hsp70 implies that the complex may be a substrate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75094 17191135 96270 9691 5232 HSPA1A HSP70 Hsp70 5 3.5 Binding of phosphorylated tau to Hsp70 implies that the complex may be a substrate for the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75096 17191135 96270 21493 11427 STUB1 CHIP CHIP 25 1.6 carboxyl terminus of heat-shock cognate (Hsc)70-interacting Hsc 70-interacting protein (CHIP) CHIP 86 -88 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75097 17191135 96272 9691 5232 HSPA1A HSP70 Hsp70 2 3.5 Together with Hsp70 CHIP can regulate tau ubiquitination and degradation in a cell 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75098 17191135 96272 21493 11427 STUB1 CHIP CHIP 3 1.6 Together with Hsp70 CHIP can regulate tau ubiquitination and degradation in a cell culture 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75099 17191135 96272 12369 6893 MAPT tau tau 6 1.8 Together with Hsp70 CHIP can regulate tau ubiquitination and degradation in a cell culture system 87 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75100 17191135 96273 21493 11427 STUB1 CHIP CHIP 3 1.6 Increased levels of CHIP and Hsp70 has ben detected in AD compared with normal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75101 17191135 96273 9691 5232 HSPA1A HSP70 Hsp70 5 3.5 Increased levels of CHIP and Hsp70 has ben detected in AD compared with normal controls 86 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75102 17191135 96274 21493 11427 STUB1 CHIP CHIP 7 1.6 In a JNPL3 mouse brain tauopathy model CHIP was widely distributed but weakly expressed in spinal cord which 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75103 17191135 96274 12369 6893 MAPT tau tau 24 1.8 in spinal cord which was the most prominent region for tau inclusions and neuronal loss 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75104 17191135 96275 21493 11427 STUB1 CHIP CHIP 3 1.6 Protein levels of CHIP in cerebellar regions (a a brain region highly resistant to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75105 17191135 96276 21493 11427 STUB1 CHIP CHIP 6 1.6 These findings suggest that increases in CHIP may protect against the formation of neurofibrillary tangles the major 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75106 17191135 96278 926 620 APP amyloid amyloid 26 1.3 intracellular immunoreactive deposits as well as the formation of intracellular amyloid 89 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 75107 17191135 96279 9691 5232 HSPA1A HSP70 Hsp70 16 3.5 specifically coimmunoprecipitate with AB has identified chaperone proteins such as Hsp70 and alpha B-crystallin-related small Hsp (Hsp16) Hsp16 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75108 17191135 96279 9691 5232 HSPA1A HSP Hsp 21 1.9 identified chaperone proteins such as Hsp70 and alpha B-crystallin-related small Hsp (Hsp16) Hsp16 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75109 17191135 96281 9462 5013 HMOX1 HO-1 HO-1 4 6.5 Recently the involvement of HO-1 in the antidegenerative mechanisms operating in AD has received considerable 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75110 17191135 96281 926 620 APP amyloid amyloid 23 1.3 received considerable attention as it has been demonstrated that the amyloid precursor protein (APP) APP decreases HO activity thus reducing the 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 75111 17191135 96281 926 620 APP APP APP 26 0.3 it has been demonstrated that the amyloid precursor protein (APP) APP decreases HO activity thus reducing the intracellular levels of bilirubin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75112 17191135 96282 9462 5013 HMOX1 HO-1 HO-1 0 6.5 HO-1 induction which occurs together with the induction of other stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75113 17191135 96283 9462 5013 HMOX1 HO-1 HO-1 6 6.5 Significant increases in the levels of HO-1 have been observed in AD brains in association with neurofibrillary 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75114 17191135 96283 9462 5013 HMOX1 HO-1 HO-1 20 6.5 in AD brains in association with neurofibrillary tangles and also HO-1 mRNA was found increased in AD neocortex and cerebral vessels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75115 17191135 96284 9462 5013 HMOX1 HO-1 HO-1 0 6.5 HO-1 increase was not only in association with neurofibrillary tangles but 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75116 17191135 96285 9462 5013 HMOX1 HO-1 HO-1 9 6.5 In addition Takeda et al explored the relationship between HO-1 and tau protein this latter being the major component of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75117 17191135 96285 12369 6893 MAPT tau tau 11 1.8 addition Takeda et al explored the relationship between HO-1 and tau protein this latter being the major component of intraneuronal neurofibrillary 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75118 17191135 96286 9462 5013 HMOX1 HO-1 HO-1 5 6.5 In transfected neuroblastoma cells overexpressing HO-1 the activity of this enzyme was increased and conversely the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75119 17191135 96286 12369 6893 MAPT tau tau 18 1.8 of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense HO-1 or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75120 17191135 96286 9462 5013 HMOX1 HO-1 HO-1 27 6.5 of tau protein was significantly decreased when compared with antisense HO-1 or vector transfected cells 93 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75121 17191135 96287 12369 6893 MAPT tau tau 3 1.8 The suppression of tau protein expression was almost completely counteracted by zinc-deuteroporphyrin a specific 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75122 17191135 96288 9462 5013 HMOX1 HO-1 HO-1 14 6.5 (extracellular extracellular signal-regulated kinases were also decreased in cells overexpressing HO-1 although no changes in the expression of total ERKs were 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75123 17191135 96288 12337 6871 MAPK1 ERK ERKs 4 0.0 The activated forms of ERKs (extracellular extracellular signal-regulated kinases were also decreased in cells overexpressing 13 JUMiner_v2.2 1 1 UserEdit 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000741317599596616<>ScoreDetail__3393|EPHB2|0.000491692575393669__6871|MAPK1|0.000741317599596616__ 1 1 6697 3393 EPHB2 1 extracellular signal-regulated kinase 75124 17191135 96288 12337 6871 MAPK1 ERK ERKs 23 0.0 overexpressing HO-1 although no changes in the expression of total ERKs were observed 93 13 JUMiner_v2.2 1 1 UserEdit 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000741317599596616<>ScoreDetail__3393|EPHB2|0.000491692575393669__6871|MAPK1|0.000741317599596616__ 1 1 6697 3393 EPHB2 1 extracellular signal-regulated kinase 75125 17191135 96290 23454 12435 TXN TRX Trx 10 2.5 Among the very few studies available on the expression of Trx cycle enzymes in neurodegenerative processes one report indicated increased Trx1 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75126 17191135 96290 23454 12435 TXN TRX1 Trx1 20 2.5 Trx cycle enzymes in neurodegenerative processes one report indicated increased Trx1 protein and RNA levels in the grey and white matter 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75127 17191135 96291 9462 5013 HMOX1 HO-1 HO-1 26 6.5 AD patients of a significant increase in the expression of HO-1 and TRXr whereas this latter was not increased in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75128 17191135 96294 9462 5013 HMOX1 HO-1 HO-1 13 6.5 lymphocytes showed an increased expression of inducible nitric oxide synthase HO-1 Hsp72 Hsp60 and TrxR 96 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75129 17191135 96294 9691 5232 HSPA1A HSP72 Hsp72 14 2.9 showed an increased expression of inducible nitric oxide synthase HO-1 Hsp72 Hsp60 and TrxR 96 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75130 17191135 96294 9718 5261 HSPD1 HSP60 Hsp60 15 1.9 an increased expression of inducible nitric oxide synthase HO-1 Hsp72 Hsp60 and TrxR 96 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75131 17191135 96295 23454 12435 TXN TRX Trx 13 2.5 that treatments of primary rat hippocampal cell cultures with exogenous Trx enhanced their survival against B-amyloid cytotoxicity 97 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75132 17191135 96296 23454 12435 TXN TRX Trx 6 2.5 Thus it has been suggested that Trx might play a protective role in AD and Trx-1 deficit 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75133 17191135 96296 23454 12435 TXN TRX1 Trx-1 15 3.0 that Trx might play a protective role in AD and Trx-1 deficit might eventually contribute to increased oxidative stress and subsequent 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75134 17191135 96297 23454 12435 TXN TRX1 Trx-1 4 3.0 In contrast to low Trx-1 protein levels TrxR activity was significantly elevated in the amygdala 11 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>7132|MLL|4297|Complete__12435|TXN|7295|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.000910069932883855<>ScoreDetail__12435|TXN|0.000910069932883855__7132|MLL|0.000511425008070683__ 0 0 0 0 0 75135 17191135 96298 20996 11179 SOD1 SOD1 SOD1 17 1.9 antioxidant enzymatic activities such as GPx GSSG reductase CAT and SOD1 were also found elevated in several regions of AD brain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75136 17191135 96298 3544 1516 CAT CAT CAT 15 0.1 other main antioxidant enzymatic activities such as GPx GSSG reductase CAT and SOD1 were also found elevated in several regions of 6 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 75137 17191135 96300 23454 12435 TXN TRX Trx 8 2.5 It is likely that the expression of the Trx cycle enzymes must be tightly regulated in order to maintain 2 JUMiner_v2.2 1 0 0 2 12435 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:12435|TXN|0.00116607298420909<>ScoreDetail__12435|TXN|0.00116607298420909__25507|VAC14|0.000609444422600558__ 0 0 0 0 0 75138 17191135 96302 9462 5013 HMOX1 HO-1 HO-1 5 6.5 The protective role played by HO-1 in AD in fact raises new possibilities regarding the use 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75139 17191135 96302 9462 5013 HMOX1 HO-1 HO-1 24 6.5 the use of natural substances which are able to increase HO-1 levels as potential drugs for the treatment of AD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75142 17191135 96306 9462 5013 HMOX1 HO-1 HO-1 9 6.5 In addition curcumin has been shown to significantly increase HO-1 in astrocytes and vascular endothelial cells 100 101 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75143 17191135 96307 9462 5013 HMOX1 HO-1 HO-1 4 6.5 This latter effect on HO-1 can explain at least in part the strong antioxidant properties 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75148 17191135 96322 9691 5232 HSPA1A HSP72 hsp72 40 2.9 modulates specific genes in the rat CNS such as the hsp72 gene the gene for the isoform of 14-3-3 protein and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75150 17191135 96324 9718 5261 HSPD1 HSP60 Hsp60 14 1.9 for the first time that acetylcarnitine induces heme oxygenase-1 and Hsp60 heat-shock proteins with a mechanism involving activation and nuclear translocation 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75151 17191135 96324 14345 7782 NFE2L2 NRF2 Nrf2 29 2.1 mechanism involving activation and nuclear translocation of the transcription factor Nrf2 27 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.00155191154741079<>ScoreDetail__7782|NFE2L2|0.00155191154741079__4071|GABPA|0.000525009545628102__ 0 0 0 0 0 75152 17191135 96326 9462 5013 HMOX1 HO-1 HO-1 29 6.5 modulate ARE-mediated expression of stress-inducible genes 107 -124 such as HO-1 G-glutamylcysteine synthetase Mn-SOD and glutathione S-transferase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75153 17191135 96326 20997 11180 SOD2 Mn-SOD Mn-SOD 32 1.9 of stress-inducible genes 107 -124 such as HO-1 G-glutamylcysteine synthetase Mn-SOD and glutathione S-transferase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75159 17191135 96339 926 620 APP amyloid amyloid 12 1.3 s quality control system becomes overwhelmed conformational changes occur to amyloid polypeptide intermediates generating stable oligomers with an anti-parallel crossed B-pleated 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 75160 17191135 96341 926 620 APP amyloid amyloid 8 1.3 Although it is clear why mutant proteins form amyloid it is harder to rationalize why a wild-type protein adopts 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 75161 17191135 96342 926 620 APP amyloid amyloid 11 1.3 discrepancy suggests that another event likely triggers misfolding in sporadic amyloid disease 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 75165 17191135 96354 9462 5013 HMOX1 HO-1 HO-1 13 6.5 phenolic compounds such as curcumin and ferulic acid can induce HO-1 and TRXr and thus reduce AD strongly indicates the therapeutic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75282 17192933 96379 10463 6018 IL6 IL-6 IL-6 13 1.3 secreted higher levels of nitric oxide interleukin (IL)-1beta, IL -1beta IL-6 and IL-12p70 and lower levels of vascular endothelial growth factor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75283 17192933 96380 10437 5992 IL1B IL1BETA IL-1beta 36 0.3 species scavenger vascular endothelial growth factor and neutralizing antibodies to IL-1beta IL-6 and IL-12 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75284 17192933 96380 10463 6018 IL6 IL-6 IL-6 37 1.3 scavenger vascular endothelial growth factor and neutralizing antibodies to IL-1beta IL-6 and IL-12 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 67819 17317654 85964 78 61 ABCD1 adrenoleukodystrophy adrenoleukodystrophy 2 0.5 The X-linked adrenoleukodystrophy (X-ALD) X-ALD and oxidative stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70473 17368952 89802 20996 11179 SOD1 SOD1 SOD1 39 5.5 oxidation of proteins and mutation of Cu Zn-superoxide dismutase (SOD1) SOD1 in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70475 17368952 89803 20996 11179 SOD1 SOD1 mSOD1 8 2.7 Transgenic mice overexpressing the mutant Cu Zn-superoxide dismutase (mSOD1) mSOD1 gene from humans with familial ALS wild-type mice overexpressing the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70477 17368952 89803 20996 11179 SOD1 SOD1 SOD1 21 5.5 humans with familial ALS wild-type mice overexpressing the normal human SOD1 gene and normal mice without gene overexpression were used 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70478 17368952 89805 20996 11179 SOD1 SOD1 mSOD1 10 2.7 Neurons containing nitrated and oxidized proteins were visualized only in mSOD1 mice in the motor cortex the cerebellar cortex and nucleus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70479 17368952 89806 20996 11179 SOD1 SOD1 SOD1 4 5.5 This correlates mutation of SOD1 to nitration and oxidation of neurons in the movement regions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70480 17368952 89807 20996 11179 SOD1 SOD1 mSOD1 28 2.7 the brain sections of both motor and sensory cortex in mSOD1 mice than in the corresponding regions of control mice (P=0.005 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70481 17368952 89807 20996 11179 SOD1 SOD1 SOD1 49 5.5 _amp_#x3c 0.001 further correlating nitration and oxidation of proteins to SOD1 mutation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70482 17368952 89808 20996 11179 SOD1 SOD1 mSOD1 17 2.7 in the motor cortex than in the sensory cortex in mSOD1 mice (P=0.002 P=0.002 and 0.02 respectively indicating enhanced susceptibility of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70484 17368952 89809 20996 11179 SOD1 SOD1 SOD1 22 5.5 in the brain tissues and in cerebrospinal fluid of mutant SOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70485 17368952 89810 20996 11179 SOD1 SOD1 SOD1 8 5.5 Our in vivo evidence correlates mutation of the SOD1 gene to increased nitric oxide nitration and oxidation of proteins 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70490 17368952 89816 20996 11179 SOD1 SOD1 SOD1 9 5.5 The discovery of mutation of the Cu Zn-superoxide dismutase (SOD1) SOD1 gene in familial ALS patients ( Deng et al 1993 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70493 17368952 89817 20996 11179 SOD1 SOD1 mSOD1 7 2.7 To explore how mutant Cu Zn-superoxide dismutase (mSOD1) mSOD1 causes ALS a transgenic mouse model was established by introducing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70495 17368952 89817 20996 11179 SOD1 SOD1 SOD1 26 5.5 a human mutant (Gly Gly 93_amp_#x2192 Ala G93A of the SOD1 gene into the mouse ( Gurney et al. 1994 these 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70497 17368952 89818 20996 11179 SOD1 SOD1 SOD1 5 5.5 Since then over 100 different SOD1 mutants have been identified in ALS families and a number 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70499 17368952 89819 20996 11179 SOD1 SOD1 mSOD1 10 2.7 A gain of function hypothesis currently explains the neurotoxicity of mSOD1 by two mechanisms 1 mSOD1 directly promotes generation of reactive 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70500 17368952 89819 20996 11179 SOD1 SOD1 mSOD1 15 2.7 currently explains the neurotoxicity of mSOD1 by two mechanisms 1 mSOD1 directly promotes generation of reactive species and causes oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70501 17368952 89819 20996 11179 SOD1 SOD1 mSOD1 31 2.7 species and causes oxidative damage to major cellular components 2 mSOD1 aggregation with itself and other important proteins leads to toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70502 17368952 89820 20996 11179 SOD1 SOD SOD 2 1.9 Superoxide dismutase (SOD) SOD is a major antioxidative defense enzyme converting superoxide anion (O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70503 17368952 89823 20996 11179 SOD1 SOD1 mSOD1 1 2.7 Using mSOD1 transgenic models we previously demonstrated in vivo that mutation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70504 17368952 89823 20996 11179 SOD1 SOD1 SOD1 12 5.5 transgenic models we previously demonstrated in vivo that mutation of SOD1 elevates levels of H 2 O 2 _amp_#xb7 OH and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70505 17368952 89823 20996 11179 SOD1 SOD1 SOD1 46 5.5 protein oxidation 8-hydroxy-2-deoxyguanosine_amp_#x2014 a marker of DNA oxidation compared with SOD1 and normal control (Nc) Nc mice ( Liu et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70507 17368952 89825 20996 11179 SOD1 SOD1 SOD1 6 5.5 These results directly correlate mutation of SOD1 to generation of ROS and resulting oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70514 17368952 89828 20996 11179 SOD1 SOD SOD 19 1.9 NO to form ONOO _amp_#x2212 which in turn reacts with SOD to form a nitronium-like intermediate that can nitrate tyrosine thereby 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70515 17368952 89829 20996 11179 SOD1 SOD1 SOD1 0 5.5 SOD1 mutation can disrupt the active-site pocket in the SOD1 dimer 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70516 17368952 89829 20996 11179 SOD1 SOD1 SOD1 9 5.5 SOD1 mutation can disrupt the active-site pocket in the SOD1 dimer to allow greater access of ONOO _amp_#x2212 to the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70520 17368952 89833 14533 7872 NOS1 NOS NOS 7 1.2 Expression of inducible _amp_#xb7 nitric oxide synthase (NOS) NOS increases during the development of ALS in the G93A transgenic 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000763760294552083<>ScoreDetail__7873|NOS2A|0.00067699618071966__7872|NOS1|0.000763760294552083__ 0 0 0 0 0 70522 17368952 89833 20996 11179 SOD1 SOD1 SOD1 22 5.5 of ALS in the G93A transgenic mice compared with normal SOD1 mice and Nc mice ( Almer et al. 1999 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70523 17368952 89834 20996 11179 SOD1 SOD1 mSOD1 9 2.7 On the other hand a transgenic cell line expressing mSOD1 releases less ONOO _amp_#x2212 than those expressing normal SOD1 ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70524 17368952 89834 20996 11179 SOD1 SOD1 SOD1 18 5.5 expressing mSOD1 releases less ONOO _amp_#x2212 than those expressing normal SOD1 ( Cookson et al. 2002 and pharmacological inhibition or genetic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70525 17368952 89834 14533 7872 NOS1 NOS NOS 33 1.2 al. 2002 and pharmacological inhibition or genetic manipulation of neuronal NOS does not alter the course of ALS ( Facchinetti et 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000763760294552083<>ScoreDetail__7873|NOS2A|0.00067699618071966__7872|NOS1|0.000763760294552083__ 0 0 0 0 0 70529 17368952 89839 20996 11179 SOD1 SOD1 SOD1 0 5.5 SOD1 and NOS were colocalized at the foci of NF accumulation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70530 17368952 89839 14533 7872 NOS1 NOS NOS 2 1.2 SOD1 and NOS were colocalized at the foci of NF accumulation in motor 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000763760294552083<>ScoreDetail__7873|NOS2A|0.00067699618071966__7872|NOS1|0.000763760294552083__ 0 0 0 0 0 70531 17368952 89839 14282 7739 NEFL NFL NFL 44 0.6 of ONOO _amp_#x2212 at the light subunit of neurofilament (NFL) NFL 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70532 17368952 89840 14282 7739 NEFL NFL NFL 0 0.6 NFL is rich in tyrosine and therefore is a vulnerable site 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70535 17368952 89844 20996 11179 SOD1 SOD1 SOD1 14 5.5 correlation between nitration and oxidation of proteins and mutation of SOD1 in this disease the present study using the G93A transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70536 17368952 89844 20996 11179 SOD1 SOD1 mSOD1 46 2.7 brain regions particularly between motor and sensory cortex in the mSOD1 mice and controls 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70538 17368952 89845 20996 11179 SOD1 SOD1 SOD1 22 5.5 further support for the correlation between RNS and mutation of SOD1 in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70540 17368952 89850 20996 11179 SOD1 SOD1 mSOD1 18 2.7 (Bar Bar Harbor ME USA were used mice overexpressing the mSOD1 gene (G93A) G93A from humans with familial ALS B6SJL-TgN(SOD1-G93A)1Gur, B6SJL-TgN 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70542 17368952 89850 20996 11179 SOD1 SOD1 SOD1 31 5.5 familial ALS B6SJL-TgN(SOD1-G93A)1Gur, B6SJL-TgN SOD1-G93A 1Gur mice overexpressing normal human SOD1 gene B6SJL-TgN(SOD1)2Gur, B6SJL-TgN SOD1 2Gur and Nc mice (B6SJLF1) B6SJLF1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70543 17368952 89850 20996 11179 SOD1 SOD1 SOD1 33 5.5 SOD1-G93A 1Gur mice overexpressing normal human SOD1 gene B6SJL-TgN(SOD1)2Gur, B6SJL-TgN SOD1 2Gur and Nc mice (B6SJLF1) B6SJLF1 without gene overexpression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70545 17368952 89851 20996 11179 SOD1 SOD1 mSOD1 26 2.7 in brain tissues the onset of ALS symptoms of the mSOD1 mice that we used was delayed due to a small 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70546 17368952 89852 20996 11179 SOD1 SOD1 mSOD1 1 2.7 Therefore mSOD1 SOD1 and Nc mice were used at 6_amp_#x2013 6.5 months 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70547 17368952 89852 20996 11179 SOD1 SOD1 SOD1 2 5.5 Therefore mSOD1 SOD1 and Nc mice were used at 6_amp_#x2013 6.5 months of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70548 17368952 89853 20996 11179 SOD1 SOD1 mSOD1 1 2.7 The mSOD1 mice used for the immunohistochemical staining of oxidized or nitrated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70549 17368952 89853 20996 11179 SOD1 SOD1 mSOD1 36 2.7 by 4_amp_#x2013 5 months therefore 3 month_amp_#xb1 1 week old mSOD1 mice and age matched SOD1 and Nc mice were used 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70550 17368952 89853 20996 11179 SOD1 SOD1 SOD1 41 5.5 3 month_amp_#xb1 1 week old mSOD1 mice and age matched SOD1 and Nc mice were used while paralysis was developing in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70551 17368952 89855 14282 7739 NEFL NF68 NF-68 8 0.6 Neurons were immunohistochemically stained with an antibody to NF-68 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70556 17368952 89902 14533 7872 NOS1 NOS NOS 31 1.2 using a NO-selective electrode ( Liu et al. 2000 measuring NOS immuno-reactivity as an indicator of possible _amp_#xb7 NO synthesis by 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000763760294552083<>ScoreDetail__7873|NOS2A|0.00067699618071966__7872|NOS1|0.000763760294552083__ 0 0 0 0 0 70557 17368952 89917 20996 11179 SOD1 SOD1 mSOD1 8 2.7 3-NY- and DNP-positive neurons were only observed in mSOD1 mice in the movement-related brain regions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70558 17368952 89919 20996 11179 SOD1 SOD1 mSOD1 14 2.7 of double immunofluorescence-stained 3-NY- and DNP-positive neurons in cross-sections of mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70559 17368952 89919 20996 11179 SOD1 SOD1 SOD1 15 5.5 double immunofluorescence-stained 3-NY- and DNP-positive neurons in cross-sections of mSOD1 SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70560 17368952 89920 14282 7739 NEFL NF68 NF-68 26 0.6 axons and large dendrites (white white arrow were immuno-stained for NF-68 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70561 17368952 89922 20996 11179 SOD1 SOD1 SOD1 9 5.5 There are no 3-NY-positive neurons in Nc (A) A and SOD1 (D) D mice but large neurons were 3-NY-positive in mSOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70562 17368952 89922 20996 11179 SOD1 SOD1 mSOD1 18 2.7 SOD1 (D) D mice but large neurons were 3-NY-positive in mSOD1 mice (G, G red arrowhead 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70563 17368952 89923 14282 7739 NEFL NF68 NF-68 4 0.6 Since staining was for NF-68 (green) green and 3-NY (red), red yellow fluorescence appeared in 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70564 17368952 89924 20996 11179 SOD1 SOD1 mSOD1 10 2.7 This demonstrates that more 3-NY-positive neurons were present in the mSOD1 mice compared with the Nc (A) A and SOD1 (D) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70565 17368952 89924 20996 11179 SOD1 SOD1 SOD1 18 5.5 the mSOD1 mice compared with the Nc (A) A and SOD1 (D) D mouse 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70566 17368952 89925 20996 11179 SOD1 SOD1 mSOD1 7 2.7 Similarly 3-NY-positive neurons appeared only in the mSOD1 mice (H) H in the motor cortex (B, B E 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70567 17368952 89925 20996 11179 SOD1 SOD1 mSOD1 21 2.7 motor cortex (B, B E and H and in the mSOD1 mice (I) I in the cortex of the cerebellum (C, 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70568 17368952 89925 20996 11179 SOD1 SOD1 SOD1 42 5.5 and I except a few 3-NY-positive neurons were observed in SOD1 mice (F) F 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70569 17368952 89926 20996 11179 SOD1 SOD1 mSOD1 21 2.7 the brain (J, J K and L red arrowhead of mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70570 17368952 89928 20996 11179 SOD1 SOD1 mSOD1 14 2.7 higher in motor cortex than in sensory cortex of the mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70571 17368952 89931 20996 11179 SOD1 SOD1 mSOD1 11 2.7 the motor cortex significantly more neurons were nitrated in the mSOD1 mice (48.8_amp_#xb1;5.6%, 48.8_amp_#xb1 5.6% S.D. than in the Nc (8.7_amp_#xb1;2.2, 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70572 17368952 89931 20996 11179 SOD1 SOD1 SOD1 22 5.5 S.D. than in the Nc (8.7_amp_#xb1;2.2, 8.7_amp_#xb1 2.2 S.D. and SOD1 (9.5_amp_#xb1;0.4, 9.5_amp_#xb1 0.4 S.D. mice ( P _amp_#x3c 0.001 Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70573 17368952 89932 20996 11179 SOD1 SOD1 mSOD1 15 2.7 number of 3-NY-positive neurons was also significantly higher in the mSOD1 mice (19.6_amp_#xb1;3.3%, 19.6_amp_#xb1 3.3% S.D. than in Nc (9.3_amp_#xb1;3.7%, 9.3_amp_#xb1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70574 17368952 89932 20996 11179 SOD1 SOD1 SOD1 25 5.5 3.3% S.D. than in Nc (9.3_amp_#xb1;3.7%, 9.3_amp_#xb1 3.7% S.D. and SOD1 (9.6_amp_#xb1;0.6%, 9.6_amp_#xb1 0.6% S.D. mice ( P =0.008 Fig 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70575 17368952 89932 20996 11179 SOD1 SOD1 SOD1 44 5.5 B but the number was not different between Nc and SOD1 mice in either region 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70576 17368952 89933 20996 11179 SOD1 SOD1 mSOD1 19 2.7 cortex was significantly higher than in the sensory cortex in mSOD1 mice ( P =0.002 Fig 2 C demonstrating that neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70577 17368952 89933 20996 11179 SOD1 SOD1 mSOD1 47 2.7 to nitration than neurons in the sensory cortex in the mSOD1 mice or more ONOO _amp_#x2212 was produced in the motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70578 17368952 89934 20996 11179 SOD1 SOD1 mSOD1 15 2.7 oxidation in motor cortex than in sensory cortex of the mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70579 17368952 89937 20996 11179 SOD1 SOD1 SOD1 21 5.5 and only a few DNP-positive neurons (1.38_amp_#xb1;0.39) 1.38_amp_#xb1 0.39 in SOD1 mice significantly more DNP-positive neurons appeared in the motor cortex 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70580 17368952 89937 20996 11179 SOD1 SOD1 mSOD1 34 2.7 more DNP-positive neurons appeared in the motor cortex in the mSOD1 mice (31.3_amp_#xb1;9.5%, 31.3_amp_#xb1 9.5% S.D. than in the Nc and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70581 17368952 89937 20996 11179 SOD1 SOD1 SOD1 43 5.5 mice (31.3_amp_#xb1;9.5%, 31.3_amp_#xb1 9.5% S.D. than in the Nc and SOD1 mice ( P =0.005 Fig 3 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70582 17368952 89938 20996 11179 SOD1 SOD1 SOD1 20 5.5 and only a few DNP-positive neurons (0.79_amp_#xb1;0.7) 0.79_amp_#xb1 0.7 in SOD1 mice while significantly more DNP-positive neurons (11.4_amp_#xb1;0.7%, 11.4_amp_#xb1 0.7% S.D. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70583 17368952 89938 20996 11179 SOD1 SOD1 mSOD1 35 2.7 (11.4_amp_#xb1;0.7%, 11.4_amp_#xb1 0.7% S.D. appeared in the sensory cortex of mSOD1 mice than in the controls ( P _amp_#x3c 0.001 Fig 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70584 17368952 89939 20996 11179 SOD1 SOD1 mSOD1 41 2.7 the motor cortex than in the sensory cortex in the mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70585 17368952 89940 20996 11179 SOD1 SOD1 mSOD1 6 2.7 Protein-bound nitrotyrosine is significantly higher in mSOD1 mice than in controls as measured by HPLC 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70586 17368952 89942 20996 11179 SOD1 SOD1 mSOD1 8 2.7 We demonstrated that the levels of 3-NY in mSOD1 mice are significantly higher than in SOD1 mice ( P 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70587 17368952 89942 20996 11179 SOD1 SOD1 SOD1 15 5.5 of 3-NY in mSOD1 mice are significantly higher than in SOD1 mice ( P =0.00003 and Nc mice ( P =0.00005 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70588 17368952 89942 20996 11179 SOD1 SOD1 SOD1 30 5.5 and Nc mice ( P =0.00005 but not different between SOD1 and Nc mice ( P =0.4 Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70589 17368952 89943 20996 11179 SOD1 SOD1 mSOD1 5 2.7 The level of 3-NY in mSOD1 mice is about 2.5-fold higher than its level in SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70590 17368952 89943 20996 11179 SOD1 SOD1 SOD1 15 5.5 mSOD1 mice is about 2.5-fold higher than its level in SOD1 and Nc mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70591 17368952 89944 20996 11179 SOD1 SOD1 SOD1 11 5.5 clearly correlates elevated protein nitration to the mutation of the SOD1 enzyme 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70592 17368952 89945 20996 11179 SOD1 SOD1 mSOD1 7 2.7 Significantly higher levels of _amp_#xb7 NO in mSOD1 mice than in the controls 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70593 17368952 89948 20996 11179 SOD1 SOD1 mSOD1 9 2.7 We found a significantly higher citrulline level in the mSOD1 mice than in the SOD1 mice ( P =0.02 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70594 17368952 89948 20996 11179 SOD1 SOD1 SOD1 14 5.5 higher citrulline level in the mSOD1 mice than in the SOD1 mice ( P =0.02 and Nc mice ( P =0.03 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70595 17368952 89950 20996 11179 SOD1 SOD1 mSOD1 6 2.7 The elevation of _amp_#xb7 NO in mSOD1 mice and the failure of normal SOD1 gene overexpressed in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70596 17368952 89950 20996 11179 SOD1 SOD1 SOD1 13 5.5 _amp_#xb7 NO in mSOD1 mice and the failure of normal SOD1 gene overexpressed in the mouse to increase levels of _amp_#xb7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70598 17368952 89952 20996 11179 SOD1 SOD1 mSOD1 29 2.7 work revealed that 3-NY- and DNP-positive neurons were observed in mSOD1 mice in all movement-related brain regions that we examined (the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70599 17368952 89953 20996 11179 SOD1 SOD1 SOD1 4 5.5 This correlates mutation of SOD1 to nitration and oxidation of proteins in neurons in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70600 17368952 89954 20996 11179 SOD1 SOD1 mSOD1 28 2.7 the brain sections of both motor and sensory cortex in mSOD1 mice than in the corresponding regions of control mice ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70601 17368952 89954 20996 11179 SOD1 SOD1 SOD1 56 5.5 A B further correlating nitration and oxidation of proteins to SOD1 mutation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70602 17368952 89955 20996 11179 SOD1 SOD1 mSOD1 22 2.7 were significantly higher in both motor and sensory cortex in mSOD1 mice than in controls the motor cortex had significantly higher 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70603 17368952 89955 20996 11179 SOD1 SOD1 mSOD1 57 2.7 Fig 3 C neurons than did the sensory cortex in mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70604 17368952 89956 20996 11179 SOD1 SOD1 mSOD1 31 2.7 cortex than in neurons in the sensory cortex of the mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70606 17368952 89958 20996 11179 SOD1 SOD1 SOD1 6 5.5 Our comparisons strongly correlate mutation of SOD1 to nitration and oxidation of proteins in the movement brain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70607 17368952 89959 20996 11179 SOD1 SOD1 mSOD1 30 2.7 3-NY were significantly ( 2.5-fold higher in the brains of mSOD1 mice than in controls ( Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70608 17368952 89960 20996 11179 SOD1 SOD1 mSOD1 28 2.7 Figs 2 demonstrated significantly higher levels of protein nitration in mSOD1 mice compared with the controls 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70610 17368952 89961 20996 11179 SOD1 SOD1 SOD1 58 5.5 analysis ( Casoni et al. 2005 confirms the correlation between SOD1 mutation and protein nitration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70612 17368952 89963 20996 11179 SOD1 SOD1 mSOD1 33 2.7 that the levels of _amp_#xb7 NO are significantly higher in mSOD1 transgenic mice than in their controls no difference was found 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70613 17368952 89963 20996 11179 SOD1 SOD1 SOD1 45 5.5 mice than in their controls no difference was found between SOD1 and Nc control groups ( Fig 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70615 17368952 89964 20996 11179 SOD1 SOD1 SOD1 14 5.5 NO is associated with ALS because overexpression of the normal SOD1 gene in the mouse did not increase levels of citrulline 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70619 17368952 89967 14533 7872 NOS1 NOS NOS 5 1.2 Recent progress indicates that neuronal NOS is involved in a motoneuron-specific programmed cell death pathway ( 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000763760294552083<>ScoreDetail__7873|NOS2A|0.00067699618071966__7872|NOS1|0.000763760294552083__ 0 0 0 0 0 70620 17368952 89967 14533 7872 NOS1 NOS NOS 28 1.2 et al 2004 and Holasek et al 2005 and inducible NOS and _amp_#xb7 NO act as inflammatory markers in ALS ( 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000763760294552083<>ScoreDetail__7873|NOS2A|0.00067699618071966__7872|NOS1|0.000763760294552083__ 0 0 0 0 0 70626 17368952 89970 20996 11179 SOD1 SOD1 SOD1 51 5.5 et al. 1990 and in the extracellular fluid in G93A SOD1 mice ( Alexander et al. 2000 but the glutamate concentration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70629 17368952 89971 20996 11179 SOD1 SOD1 mSOD1 13 2.7 that neither glutamate nor aspartate concentrations were significantly increased in mSOD1 mice compared with age-matched controls ( Fig 5 A consistent 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70631 17368952 89977 20996 11179 SOD1 SOD1 mSOD1 11 2.7 summary using double immunohistochemical staining of brain sections from the mSOD1 mice and the controls this work reveals that 1 3-NY- 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70632 17368952 89977 20996 11179 SOD1 SOD1 mSOD1 29 2.7 that 1 3-NY- and DNP-positive neurons were observed only in mSOD1 mice 2 nitration and oxidation of proteins were significantly higher 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70633 17368952 89977 20996 11179 SOD1 SOD1 mSOD1 42 2.7 nitration and oxidation of proteins were significantly higher in the mSOD1 mice than in the controls 3 the number of 3-NY- 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70634 17368952 89977 20996 11179 SOD1 SOD1 mSOD1 67 2.7 significantly higher in motor cortex than in sensory cortex in mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70635 17368952 89978 20996 11179 SOD1 SOD1 SOD1 5 5.5 These results correlate mutation of SOD1 to nitration and oxidation of proteins in neurons in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70636 17368952 89978 20996 11179 SOD1 SOD1 mSOD1 39 2.7 the motor cortex than of proteins in sensory cortex in mSOD1 mice 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70638 17368952 89980 20996 11179 SOD1 SOD1 mSOD1 29 2.7 the microdialysates and protein-bound nitrotyrosine in the brain tissue in mSOD1 SOD1 and Nc mice were measured 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70639 17368952 89980 20996 11179 SOD1 SOD1 SOD1 30 5.5 microdialysates and protein-bound nitrotyrosine in the brain tissue in mSOD1 SOD1 and Nc mice were measured 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70640 17368952 89981 20996 11179 SOD1 SOD1 mSOD1 15 2.7 both _amp_#xb7 NO and protein-bound 3-NY are significantly higher in mSOD1 mice than in control mice further supporting that RNS and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54389 17496232 67628 12339 6877 MAPK3 ERK1 ERK1 34 2.7 to dual activation of proliferating and proapoptotic cascades like ERK1/2 ERK1 2 or p38 MAPK 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54390 17496232 67628 12337 6871 MAPK1 p38 p38 36 2.2 of proliferating and proapoptotic cascades like ERK1/2 ERK1 2 or p38 MAPK 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54391 17496232 67628 12337 6871 MAPK1 MAPK MAPK 37 2.2 proliferating and proapoptotic cascades like ERK1/2 ERK1 2 or p38 MAPK 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54392 17496232 67638 14533 7872 NOS1 nNOS nNOS 7 3.7 Transcriptional increase of neuronal nitric oxide synthase (nNOS) nNOS determines extensive binding to complex I and IV and contributes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54393 17496232 67639 14533 7872 NOS1 nNOS nNOS 10 3.7 3 3' 5-triiodothyronine (T T 3 levels there is increased nNOS transcription translation and translocation into mitochondria resulting in high mitochondrial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54394 17496232 67639 14533 7872 NOS1 NOS NOS 21 2.7 transcription translation and translocation into mitochondria resulting in high mitochondrial NOS (mtNOS) mtNOS activity and increased nitric oxide (NO), NO ONOO 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54395 17496232 67641 20997 11180 SOD2 MnSOD MnSOD 3 1.9 MW molecular weight MnSOD manganese superoxide dismutase 2D two dimensional 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54396 17496232 67644 12339 6877 MAPK3 ERK1 ERK1 13 2.7 low NO and H 2 O 2 levels activate ERK1/2, ERK1 2 resulting in cyclin D 1 -increased expression and proliferation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54397 17496232 67645 12337 6871 MAPK1 p38 p38 15 2.2 higher NO ONOO and H 2 O 2 levels activate p38 MAPK which regulates cyclin D 1 expression negatively resulting in 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54398 17496232 67645 12337 6871 MAPK1 MAPK MAPK 16 2.2 NO ONOO and H 2 O 2 levels activate p38 MAPK which regulates cyclin D 1 expression negatively resulting in cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54399 17496232 67646 12337 6871 MAPK1 MAPK MAPKs 8 2.2 Representative Western blot of cyclin D 1 and MAPKs in tumoral cells (P07) P07 and in lysates of postnatal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54401 17496232 67648 22671 11998 TP53 p53 p53 21 1.6 programmed cell death via apoptotic protease-activating factor-1 and activation of p53 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54402 17496232 67649 22671 11998 TP53 p53 p53 8 1.6 Increased NO and ONOO result in DNA damage p53 accumulation increased Bax/Bcl-2, Bax Bcl-2 cytochrome c (cyt cyt c 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54403 17496232 67649 1576 990 BCL2 Bcl-2 Bcl-2 11 1.3 ONOO result in DNA damage p53 accumulation increased Bax/Bcl-2, Bax Bcl-2 cytochrome c (cyt cyt c release and caspase activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54405 17496232 67656 4829 2294 COX8A COX COX 25 0.9 as resulting from its high-affinity binding to cytochrome oxidase (COX), COX the final electron acceptor ( 19 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54406 17496232 67657 14533 7872 NOS1 NOS NOS 16 2.7 and O 2 is catalyzed by nitric oxide synthases (NOS) NOS ( 92 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54407 17496232 67658 14533 7872 NOS1 NOS NOS 6 2.7 There exist three canonical isoforms neuronal (NOS NOS I or nNOS inducible (NOS NOS II and endothelial (NOS 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54408 17496232 67658 14533 7872 NOS1 nNOS nNOS 9 3.7 There exist three canonical isoforms neuronal (NOS NOS I or nNOS inducible (NOS NOS II and endothelial (NOS NOS III and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54409 17496232 67658 14533 7872 NOS1 NOS NOS 11 2.7 canonical isoforms neuronal (NOS NOS I or nNOS inducible (NOS NOS II and endothelial (NOS NOS III and a significant number 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54410 17496232 67658 14533 7872 NOS1 NOS NOS 15 2.7 I or nNOS inducible (NOS NOS II and endothelial (NOS NOS III and a significant number of spliced and posttranslationally modified 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54411 17496232 67659 14533 7872 NOS1 NOS NOS 8 2.7 In addition new isoforms or mitochondrial variants of NOS (mtNOS) mtNOS were recently described in rat liver ( 60 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54412 17496232 67659 4829 2294 COX8A COX COX 38 0.9 ( 119 mtNOS is bound to mitochondrial PDZ domains of COX ( 57 103 and to complex I ( 57 thus 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54413 17496232 67660 14533 7872 NOS1 NOS NOS 14 2.7 as extreme hypoxia mitochondrial NO could come either from stimulated NOS ( 116 142 or from the reduction of nitrite by 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54414 17496232 67660 4829 2294 COX8A COX COX 27 0.9 ( 116 142 or from the reduction of nitrite by COX ( 39 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54415 17496232 67661 14533 7872 NOS1 NOS NOS 0 2.7 NOS I and III ( 45 82 are constitutively expressed in 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54416 17496232 67662 5902 2903 DLG4 PSD95 PSD95 15 1.3 in cell membrane (caveolin) caveolin and in synaptic vesicles (PSD95) PSD95 in skeletal and cardiac muscles (dystrophin) dystrophin and to heat 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54417 17496232 67662 5927 2928 DMD dystrophin dystrophin 21 1.0 synaptic vesicles (PSD95) PSD95 in skeletal and cardiac muscles (dystrophin) dystrophin and to heat shock protein (HSP) HSP 90 or 70 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54418 17496232 67662 9691 5232 HSPA1A HSP HSP 27 0.9 cardiac muscles (dystrophin) dystrophin and to heat shock protein (HSP) HSP 90 or 70 chaperones ( 79 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54419 17496232 67663 5927 2928 DMD dystrophin dystrophin 23 1.0 decreased (caveolin-NOS) caveolin-NOS enzyme activity 2 modified subcellular traffic (dystrophin dystrophin impedes NOS I traffic to mitochondria ( 76 and 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54420 17496232 67663 14533 7872 NOS1 NOS NOS 25 2.7 caveolin-NOS enzyme activity 2 modified subcellular traffic (dystrophin dystrophin impedes NOS I traffic to mitochondria ( 76 and 3 participation in 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54421 17496232 67664 14533 7872 NOS1 NOS NOS 1 2.7 Constitutive NOS are activated by Ca pulses after activation of cell surface 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54422 17496232 67664 14533 7872 NOS1 NOS NOS 20 2.7 surface receptors by effectors like bradykinin or acetylcholine (endothelial endothelial NOS III or excitatory amino acids like glutamate (neuronal neuronal synaptic 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54423 17496232 67664 14533 7872 NOS1 NOS NOS 30 2.7 III or excitatory amino acids like glutamate (neuronal neuronal synaptic NOS I ( 45 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54424 17496232 67665 14533 7872 NOS1 NOS NOS 0 2.7 NOS I and III are characterized by fast and transient responses 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54425 17496232 67666 14533 7872 NOS1 NOS NOS 2 2.7 In contrast NOS II is not constitutive and does not depend on Ca 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54426 17496232 67666 14533 7872 NOS1 NOS NOS 14 2.7 is not constitutive and does not depend on Ca concentration NOS II gene expression is modulated by inflammatory mediators like cytokines 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54427 17496232 67666 22551 11892 TNF TNF-alpha TNF-alpha 25 0.8 II gene expression is modulated by inflammatory mediators like cytokines TNF-alpha IFN-gamma and LPS that activate transcription factors like NF-kappaB or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54428 17496232 67666 9905 5438 IFNG IFN-gamma IFN-gamma 27 0.8 gene expression is modulated by inflammatory mediators like cytokines TNF-alpha IFN-gamma and LPS that activate transcription factors like NF-kappaB or AP-1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54430 17496232 67666 7683 3796 FOS AP-1 AP-1 39 1.0 IFN-gamma and LPS that activate transcription factors like NF-kappaB or AP-1 ( 59 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.000678857475341454<>ScoreDetail__3796|FOS|0.000549948240165631__3797|FOSB|0.000366854496168705__6205|JUNB|0.000444690368035598__6204|JUN|0.000678857475341454__6206|JUND|0.00064045242526041__ 0 0 0 0 0 54431 17496232 67666 14352 7794 NFKB1 NF-kappaB NF-kappaB 36 0.0 cytokines TNF-alpha IFN-gamma and LPS that activate transcription factors like NF-kappaB or AP-1 ( 59 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54432 17496232 67668 14533 7872 NOS1 NOS NOS 4 2.7 The activities of classic NOS isoforms are able to sustain NO cytosolic concentrations large enough 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54433 17496232 67671 14533 7872 NOS1 NOS NOS 7 2.7 Therefore mitochondrial NO coming from classic cytosolic NOS results in a considerably lower concentration ~20-100 nM ( 18 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54434 17496232 67671 14533 7872 NOS1 NOS NOS 31 2.7 however it may increase by fivefold after induction of inducible NOS in endotoxemia ( 14 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54435 17496232 67674 14533 7872 NOS1 NOS NOS 11 2.7 is noteworthy that changes in the expression and activities of NOS isoforms particularly of intra-mtNOS will be followed by significant variations 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54436 17496232 67676 4829 2294 COX8A COX COX 37 0.9 ( 25 NO reversibly binds to Cu B center of COX and consequently inhibits electron transfer to O 2 and mitochondrial 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54437 17496232 67678 4829 2294 COX8A COX COX 27 0.9 concentrations 50-100 nM NO inhibits by half the activity of COX ( 108 110 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54438 17496232 67690 4829 2294 COX8A COX COX 21 0.9 represents a simple competition between NO and O 2 for COX the formation of the complex between COX and NO was 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54439 17496232 67690 4829 2294 COX8A COX COX 28 0.9 O 2 for COX the formation of the complex between COX and NO was followed by the authors after addition of 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54440 17496232 67692 4829 2294 COX8A COX COX 7 0.9 The time scale for the inhibition of COX by NO is given by k NOon x NO at 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54441 17496232 67693 4829 2294 COX8A COX COX 5 0.9 Therefore the fast inhibition of COX by NO is completely compatible with a direct competition between 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54442 17496232 67693 4829 2294 COX8A COX COX 21 0.9 with a direct competition between NO and O 2 for COX at the steady state and in the presence of NO 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54443 17496232 67693 4829 2294 COX8A COX COX 50 0.9 Eq 2 which describes a simple linear competitive inhibition of COX by NO with an inhibition constant ( K i given 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54444 17496232 67698 4829 2294 COX8A COX COX 6 0.9 These calculations are useful for isolated COX although they should be modified to include additional NO effects 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54445 17496232 67699 4829 2294 COX8A COX COX 3 0.9 Accordingly NO inhibits COX and increases the reduction levels of the components of the 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54446 17496232 67699 4829 2294 COX8A COX COX 26 0.9 chain including ubiquinol and ubisemiquinone on the substrate side of COX and reacts directly with ubiquinol to produce nitroxyl anion (NO 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 54447 17496232 67705 20997 11180 SOD2 MnSOD MnSOD 8 1.9 In the presence of mitochondrial manganese superoxide dismutase (MnSOD), MnSOD most of O 2 is dismutated to H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54448 17496232 67713 20997 11180 SOD2 MnSOD MnSOD 22 1.9 dismutates to H 2 O 2 a reaction catalized by MnSOD ( reactions 4 and 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54449 17496232 67714 20997 11180 SOD2 MnSOD MnSOD 37 1.9 in mitochondrial metabolism will depend on NO concentration and on MnSOD level 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54450 17496232 67715 20996 11179 SOD1 SOD SOD 26 2.2 20-fold NO utilization in contrast addition of superoxide dismutase (SOD) SOD decreases NO utilization and prolongs its mean life and increases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54451 17496232 67716 20997 11180 SOD2 MnSOD MnSOD 24 1.9 decays by reaction 4 and 2 depending on NO and MnSOD concentrations mitochondrial utilization of NO involves the formation of H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54452 17496232 67720 14533 7872 NOS1 NOS NOS 10 2.7 Our underlying proposal is that grading expression and activities of NOS isoforms and the concentration of matrix NO modulate H 2 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54453 17496232 67721 20997 11180 SOD2 MnSOD MnSOD 11 1.9 As described in cell transformation ( 71 concomitant changes in MnSOD have two effects to increase cytosolic H 2 O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54454 17496232 67728 20997 11180 SOD2 MnSOD MnSOD 21 1.9 Cu ZnSOD whereas in mitochondria the reaction is catalyzed by MnSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54455 17496232 67729 23454 12435 TXN TRX Trx 21 1.0 (GPx; GPx reactions 6 and 7 and thioredoxin peroxidase (Trx; Trx reaction 8 are preferentially distributed in cytosol and peroxisomes 2 JUMiner_v2.2 1 0 0 2 25507 TotalCon:2<>12435|TXN|7295|Complete__25507|VAC14|55697|Complete__<>AvaiableGeneRif=2<>BEST:25507|VAC14|0.00089464196473192<>ScoreDetail__12435|TXN|0.000763442133862406__25507|VAC14|0.00089464196473192__ 0 0 0 0 0 54456 17496232 67740 14533 7872 NOS1 NOS NOS 33 2.7 process including the concentration and activities of mtNOS cytosolic classic NOS isoforms MnSOD catalase and peroxidases 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54457 17496232 67740 20997 11180 SOD2 MnSOD MnSOD 35 1.9 the concentration and activities of mtNOS cytosolic classic NOS isoforms MnSOD catalase and peroxidases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54459 17496232 67750 14551 7889 NOX1 NOX1 Nox1 8 0.3 ( 7 showed that transfection of oxidase Nox1 to NIH/3T3 NIH 3T3 fibroblasts which increases cell H 2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54460 17496232 67755 12337 6871 MAPK1 MAPK MAPKs 17 2.2 and H 2 O 2 are confluent on modulation of MAPKs and cyclin D 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54461 17496232 67756 12337 6871 MAPK1 MAPK MAPKs 0 2.2 MAPKs including SAPK/JNK, SAPK JNK p38 MAPK and ERK are believed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54462 17496232 67756 12354 6886 MAPK9 SAPK SAPK 2 2.2 MAPKs including SAPK/JNK, SAPK JNK p38 MAPK and ERK are believed to be redox-dependent 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54463 17496232 67756 12349 6881 MAPK8 JNK JNK 2 2.7 MAPKs including SAPK/JNK, SAPK JNK p38 MAPK and ERK are believed to be redox-dependent biomolecules 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54464 17496232 67756 12337 6871 MAPK1 p38 p38 3 2.2 MAPKs including SAPK/JNK, SAPK JNK p38 MAPK and ERK are believed to be redox-dependent biomolecules that 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54465 17496232 67756 12337 6871 MAPK1 MAPK MAPK 4 2.2 MAPKs including SAPK/JNK, SAPK JNK p38 MAPK and ERK are believed to be redox-dependent biomolecules that modulate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54466 17496232 67756 12337 6871 MAPK1 ERK ERK 6 2.2 MAPKs including SAPK/JNK, SAPK JNK p38 MAPK and ERK are believed to be redox-dependent biomolecules that modulate cell proliferation 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00240555376170488<>ScoreDetail__3393|EPHB2|0.00075331458417035__6871|MAPK1|0.00240555376170488__ 0 0 0 0 0 54467 17496232 67757 12337 6871 MAPK1 ERK ERKs 0 2.2 ERKs stimulate cell proliferation and induction of active cyclin D 1 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00240555376170488<>ScoreDetail__3393|EPHB2|0.00075331458417035__6871|MAPK1|0.00240555376170488__ 0 0 0 0 0 54468 17496232 67757 7683 3796 FOS AP-1 AP-1 18 1.0 cyclin D 1 by different mechanisms including the enhancement of AP-1 activity 1 JUMiner_v2.2 1 0 0 2 6204 TotalCon:5<>3796|FOS|2353|Complete__3797|FOSB|2354|Complete__6204|JUN|3725|Complete__6205|JUNB|3726|Complete__6206|JUND|3727|Complete__<>AvaiableGeneRif=5<>BEST:6204|JUN|0.000678857475341454<>ScoreDetail__3796|FOS|0.000549948240165631__3797|FOSB|0.000366854496168705__6205|JUNB|0.000444690368035598__6204|JUN|0.000678857475341454__6206|JUND|0.00064045242526041__ 0 0 0 0 0 54469 17496232 67758 12337 6871 MAPK1 ERK ERKs 19 2.2 moderate elevation of intracellular Ca and leads to activation of ERKs and potentiates cell division functionally blocking Ca or inhibiting calmodulin 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00240555376170488<>ScoreDetail__3393|EPHB2|0.00075331458417035__6871|MAPK1|0.00240555376170488__ 0 0 0 0 0 54470 17496232 67758 12337 6871 MAPK1 MAPK MAPK 31 2.2 potentiates cell division functionally blocking Ca or inhibiting calmodulin or MAPK activities prevents ERK activation and antagonizes the mitogenic effect of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54471 17496232 67758 12337 6871 MAPK1 ERK ERK 34 2.2 functionally blocking Ca or inhibiting calmodulin or MAPK activities prevents ERK activation and antagonizes the mitogenic effect of NO ( 90 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00240555376170488<>ScoreDetail__3393|EPHB2|0.00075331458417035__6871|MAPK1|0.00240555376170488__ 0 0 0 0 0 54472 17496232 67759 12337 6871 MAPK1 p38 p38 4 2.2 On the other hand p38 SAPK transcriptionally downregulates cyclin D 1 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54473 17496232 67759 12354 6886 MAPK9 SAPK SAPK 5 2.2 On the other hand p38 SAPK transcriptionally downregulates cyclin D 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54474 17496232 67761 12337 6871 MAPK1 p38 p38 20 2.2 cyclin D 1 activity and expression the former by activating p38 pathway ( 37 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54475 17496232 67763 12337 6871 MAPK1 p38 p38 21 2.2 8 who reported a temporal inverse correlation between activation of p38 MAPK and cyclin D 1 content during liver development or 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54476 17496232 67763 12337 6871 MAPK1 MAPK MAPK 22 2.2 who reported a temporal inverse correlation between activation of p38 MAPK and cyclin D 1 content during liver development or liver 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54477 17496232 67764 12337 6871 MAPK1 p38 p38 3 2.2 Similarly NO activates p38 MAPK and suppresses proliferation through the activation of JAK2-STAT5 and 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54478 17496232 67764 12337 6871 MAPK1 MAPK MAPK 4 2.2 Similarly NO activates p38 MAPK and suppresses proliferation through the activation of JAK2-STAT5 and cyclin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54479 17496232 67764 4037 1773 CDK4 CDK4 cdk4 17 0.3 through the activation of JAK2-STAT5 and cyclin D 1 /cdk4 cdk4 ( 70 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54480 17496232 67765 12337 6871 MAPK1 p38 p38 25 2.2 signal pathways involving both production of NO and activation of p38 MAPK pathway ( 93 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54481 17496232 67765 12337 6871 MAPK1 MAPK MAPK 26 2.2 pathways involving both production of NO and activation of p38 MAPK pathway ( 93 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54482 17496232 67766 12337 6871 MAPK1 MAPK MAPKs 27 2.2 57 attempted to connect oxidative stress and NO levels to MAPKs D cyclins and cell proliferation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54483 17496232 67769 23515 29884 UBASH3B p70 p70 31 0.3 O 2 acts as a messenger in growth factor-induced p70(S6k) p70 S6k signaling pathway in mouse epidermal cells which plays an 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54484 17496232 67769 19050 10436 RPS6KB1 S6K S6k 31 0.3 2 acts as a messenger in growth factor-induced p70(S6k) p70 S6k signaling pathway in mouse epidermal cells which plays an important 4 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54485 17496232 67770 12339 6877 MAPK3 ERK1 ERK1 7 2.7 Finally our group ( 2 observed ERK1/2 ERK1 2 activation in brain mitochondria by very low concentrations of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54486 17496232 67771 12337 6871 MAPK1 MAPK MAPK 18 2.2 redox effect on the protein or actions on ERK-MEK (MAPK MAPK kinase interactions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54487 17496232 67772 12337 6871 MAPK1 MAPK MAPK 9 2.2 In this way it was proposed that duration of MAPK activation determines whether a stimulus produces proliferation or differentiation ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54488 17496232 67773 12339 6877 MAPK3 ERK1 ERK1 20 2.7 factor induced only a transient activation of MEK and ERK1/2 ERK1 2 and 50% increase in cell proliferation whereas prolonged stimulation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54490 17496232 67774 12339 6877 MAPK3 ERK1 ERK1 6 2.7 The findings gain significance considering that ERK1/2 ERK1 2 are activated by ROS ( 134 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54492 17496232 67775 4059 1784 CDKN1A p21 p21 24 0.6 and to resulting changes in cell cycle regulators such as p21 p27 cyclins and retinoblastoma protein 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.000737768827857011<>ScoreDetail__1784|CDKN1A|0.000737768827857011__11616|TCEAL1|0.000535823637477036__ 0 0 0 0 0 54493 17496232 67775 17526 9567 PSMD9 p27 p27 25 0.3 to resulting changes in cell cycle regulators such as p21 p27 cyclins and retinoblastoma protein 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>9567|PSMD9|5715|Complete__11328|SSSCA1|10534|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 54495 17496232 67777 12337 6871 MAPK1 p38 p38 4 2.2 For instance activation of p38 MAPK and cell cycle arrest may finally progress to apoptosis 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54496 17496232 67777 12337 6871 MAPK1 MAPK MAPK 5 2.2 For instance activation of p38 MAPK and cell cycle arrest may finally progress to apoptosis in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54497 17496232 67777 12337 6871 MAPK1 p38 p38 24 2.2 apoptosis in the presence of NO which may activate the p38 MAPK pathway 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54498 17496232 67777 12337 6871 MAPK1 MAPK MAPK 25 2.2 in the presence of NO which may activate the p38 MAPK pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54499 17496232 67778 12337 6871 MAPK1 p38 p38 3 2.2 In accord the p38 inhibitor SB-203580 blocks proapoptotic effects of NO in SH-SY5Y neurons 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54500 17496232 67779 12337 6871 MAPK1 p38 p38 5 2.2 The activating NO effects and p38 MAPK signaling probably result in Bax translocation to mitochondria a 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54501 17496232 67779 12337 6871 MAPK1 MAPK MAPK 6 2.2 The activating NO effects and p38 MAPK signaling probably result in Bax translocation to mitochondria a well-known 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54502 17496232 67780 12337 6871 MAPK1 p38 p38 21 2.2 microM H 2 O 2 causes a rapid activation of p38 MAPK cascade with phosphorylation of MKK3/6 MKK3 6 and p38 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54503 17496232 67780 12337 6871 MAPK1 MAPK MAPK 22 2.2 H 2 O 2 causes a rapid activation of p38 MAPK cascade with phosphorylation of MKK3/6 MKK3 6 and p38 MAPK 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54504 17496232 67780 12301 6843 MAP2K3 MKK3 MKK3 27 2.2 rapid activation of p38 MAPK cascade with phosphorylation of MKK3/6 MKK3 6 and p38 MAPK and activating transcription factors (ATF)-1 ATF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54505 17496232 67780 12337 6871 MAPK1 p38 p38 29 2.2 p38 MAPK cascade with phosphorylation of MKK3/6 MKK3 6 and p38 MAPK and activating transcription factors (ATF)-1 ATF -1 (cAMP cAMP 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54506 17496232 67780 12337 6871 MAPK1 MAPK MAPK 30 2.2 MAPK cascade with phosphorylation of MKK3/6 MKK3 6 and p38 MAPK and activating transcription factors (ATF)-1 ATF -1 (cAMP cAMP response 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54508 17496232 67780 1239 784 ATF2 ATF2 ATF-2 41 1.2 factors (ATF)-1 ATF -1 (cAMP cAMP response element-binding protein and ATF-2 11 JUMiner_v2.2 1 0 0 2 4232 TotalCon:2<>784|ATF2|1386|Complete__4232|GDNF|2668|Complete__<>AvaiableGeneRif=2<>BEST:4232|GDNF|0.000572391363054633<>ScoreDetail__784|ATF2|0.000531512277655335__4232|GDNF|0.000572391363054633__ 0 0 0 0 0 54509 17496232 67781 12337 6871 MAPK1 p38 p38 32 2.2 and were cancelled by N -acetylcysteine or SB-203580 a specific p38 MAPK inhibitor 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54510 17496232 67781 12337 6871 MAPK1 MAPK MAPK 33 2.2 were cancelled by N -acetylcysteine or SB-203580 a specific p38 MAPK inhibitor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54511 17496232 67783 12349 6881 MAPK8 JNK JNK 15 2.7 that H 2 O 2 -induced cellular injury depends on JNK activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54512 17496232 67784 12337 6871 MAPK1 p38 p38 4 2.2 In this case also p38 and ERK were activated by H 2 O 2 however 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54513 17496232 67784 12337 6871 MAPK1 ERK ERK 6 2.2 In this case also p38 and ERK were activated by H 2 O 2 however only JNK-related 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00240555376170488<>ScoreDetail__3393|EPHB2|0.00075331458417035__6871|MAPK1|0.00240555376170488__ 0 0 0 0 0 54514 17496232 67784 12349 6881 MAPK8 JNK JNK-related 17 2.7 ERK were activated by H 2 O 2 however only JNK-related injuring effects were inhibited by the MEK inhibitor PD-98059 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54515 17496232 67785 12349 6881 MAPK8 JNK JNK 1 2.7 Moreover JNK phosphorylation of p53 is important for the stabilization of proapoptotic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54516 17496232 67785 22671 11998 TP53 p53 p53 4 1.6 Moreover JNK phosphorylation of p53 is important for the stabilization of proapoptotic p53 protein ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54517 17496232 67785 22671 11998 TP53 p53 p53 12 1.6 phosphorylation of p53 is important for the stabilization of proapoptotic p53 protein ( 28 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54518 17496232 67786 12337 6871 MAPK1 p38 p38 3 2.2 Early activation of p38 MAPK and ERK does not seem to be dependent on 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54519 17496232 67786 12337 6871 MAPK1 MAPK MAPK 4 2.2 Early activation of p38 MAPK and ERK does not seem to be dependent on cytotoxic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54520 17496232 67786 12337 6871 MAPK1 ERK ERK 6 2.2 Early activation of p38 MAPK and ERK does not seem to be dependent on cytotoxic factors like 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00240555376170488<>ScoreDetail__3393|EPHB2|0.00075331458417035__6871|MAPK1|0.00240555376170488__ 0 0 0 0 0 54521 17496232 67787 12337 6871 MAPK1 p38 p38 12 2.2 suggest that physiological H 2 O 2 -dependent activation of p38 MAPK may proceed many steps before a significant Ca release 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54522 17496232 67787 12337 6871 MAPK1 MAPK MAPK 13 2.2 that physiological H 2 O 2 -dependent activation of p38 MAPK may proceed many steps before a significant Ca release from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54523 17496232 67787 12354 6886 MAPK9 SAPK SAPK 36 2.2 stores and that Ca -dependent tyrosine kinase-induced activation of SAPK/JNK SAPK JNK reflects the progression of cell injury ( 73 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54524 17496232 67787 12349 6881 MAPK8 JNK JNK 36 2.7 and that Ca -dependent tyrosine kinase-induced activation of SAPK/JNK SAPK JNK reflects the progression of cell injury ( 73 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54525 17496232 67789 20997 11180 SOD2 MnSOD MnSOD 6 1.9 The main mitochondrial antioxidant defense is MnSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54526 17496232 67790 20996 11179 SOD1 SOD SOD 3 2.2 At the same SOD level the production of ONOO (and and concurrent nitration at 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54527 17496232 67791 20996 11179 SOD1 SOD SOD 5 2.2 Dismutation of O 2 by SOD proceeds with an order of magnitude lower than formation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54528 17496232 67793 9691 5232 HSPA1A HSP HSPs 12 0.9 effects include S -nitrosylation and inhibition of caspases increase of HSPs and Bcl-2 and activation of Akt/PKB, Akt PKB which induces 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54529 17496232 67793 1576 990 BCL2 Bcl-2 Bcl-2 14 1.3 S -nitrosylation and inhibition of caspases increase of HSPs and Bcl-2 and activation of Akt/PKB, Akt PKB which induces cytoprotective gene 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54530 17496232 67793 543 391 AKT1 AKT Akt 18 0.5 caspases increase of HSPs and Bcl-2 and activation of Akt/PKB, Akt PKB which induces cytoprotective gene expression through NF-kappaB activation ( 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54531 17496232 67793 543 391 AKT1 PKB PKB 18 0.5 increase of HSPs and Bcl-2 and activation of Akt/PKB, Akt PKB which induces cytoprotective gene expression through NF-kappaB activation ( 85 1 JUMiner_v2.2 1 0 0 2 9612 TotalCon:2<>391|AKT1|207|Complete__9612|PTK2B|2185|Complete__<>AvaiableGeneRif=2<>BEST:9612|PTK2B|0.000881513888667124<>ScoreDetail__391|AKT1|0.000774375994099823__9612|PTK2B|0.000881513888667124__ 0 0 0 0 0 54532 17496232 67793 14352 7794 NFKB1 NF-kappaB NF-kappaB 25 0.0 of Akt/PKB, Akt PKB which induces cytoprotective gene expression through NF-kappaB activation ( 85 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54533 17496232 67796 1576 990 BCL2 Bcl-2 Bcl-2 14 1.3 hand proapoptotic effects of NO include inhibition of NF-kappaB decreased Bcl-2 expression ( 87 -89 118 and increased p53 expression both 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54534 17496232 67796 22671 11998 TP53 p53 p53 25 1.6 NF-kappaB decreased Bcl-2 expression ( 87 -89 118 and increased p53 expression both by NO-mediated inhibition of proteasome degradation and by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54535 17496232 67796 14352 7794 NFKB1 NF-kappaB NF-kappaB 11 0.0 the other hand proapoptotic effects of NO include inhibition of NF-kappaB decreased Bcl-2 expression ( 87 -89 118 and increased p53 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54539 17496232 67817 14533 7872 NOS1 nNOS nNOS 10 3.7 levels of 3 3' 5-triiodothyronine (T T 3 in hypothyroidism nNOS mRNA increased by threefold and nNOS translocation to mitochondria was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54540 17496232 67817 14533 7872 NOS1 nNOS nNOS 16 3.7 T 3 in hypothyroidism nNOS mRNA increased by threefold and nNOS translocation to mitochondria was favored with concomitant increase of mtNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54541 17496232 67818 14533 7872 NOS1 nNOS nNOS 4 3.7 Two effects emerged from nNOS confinement 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54542 17496232 67819 14533 7872 NOS1 NOS NOS 14 2.7 consumption was more sensitive to L -arginine and to the NOS inhibitor N -monomethyl-L -arginine indicating the modulation of O 2 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54543 17496232 67821 12337 6871 MAPK1 MAPK MAPK 7 2.2 Mitochondrial redox contribution to the activation of MAPK cascades was also confirmed in the hypothyroid model 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54544 17496232 67822 12337 6871 MAPK1 p38 p38 22 2.2 2 O 2 and peroxynitrite with the concomitant activation of p38 MAPK and the inactivation of ERK1/2 ERK1 2 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54545 17496232 67822 12337 6871 MAPK1 MAPK MAPK 23 2.2 O 2 and peroxynitrite with the concomitant activation of p38 MAPK and the inactivation of ERK1/2 ERK1 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54546 17496232 67822 12339 6877 MAPK3 ERK1 ERK1 28 2.7 concomitant activation of p38 MAPK and the inactivation of ERK1/2 ERK1 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54547 17496232 67823 12337 6871 MAPK1 MAPK MAPK 4 2.2 As shown before this MAPK pattern is consistent with cell cycle arrest and inhibition of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54548 17496232 67824 14533 7872 NOS1 NOS NOS 5 2.7 A similar effect of a NOS inhibitor N -nitro-L -arginine methyl ester ( L -NAME or 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54549 17496232 67824 12337 6871 MAPK1 MAPK MAPK 33 2.2 hypothyroid cell signaling back to control status indicates that differential MAPK activation and cyclin D 1 expression should not depend on 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54550 17496232 67827 14533 7872 NOS1 nNOS nNOS 25 3.7 of complex I inhibition by NO-ONOO overproduced by increased translocated nNOS (mtNOS) mtNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54551 17496232 67828 14533 7872 NOS1 nNOS nNOS 9 3.7 It is interesting that lack of T 3 stimulates nNOS gene expression suggesting the existence of a tonic gene inhibition 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54552 17496232 67832 12337 6871 MAPK1 ERK ERK 28 2.2 cell types and its expression is positively regulated by the ERK pathway and antagonized by stress-activated p38 MAPK cascade ( 84 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.00240555376170488<>ScoreDetail__3393|EPHB2|0.00075331458417035__6871|MAPK1|0.00240555376170488__ 0 0 0 0 0 54553 17496232 67832 12337 6871 MAPK1 p38 p38 34 2.2 positively regulated by the ERK pathway and antagonized by stress-activated p38 MAPK cascade ( 84 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54554 17496232 67832 12337 6871 MAPK1 MAPK MAPK 35 2.2 regulated by the ERK pathway and antagonized by stress-activated p38 MAPK cascade ( 84 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54555 17496232 67833 12337 6871 MAPK1 p38 p38 11 2.2 liver development cyclin D 1 content is inversely related to p38 MAPK activity which in turn may be regulated by ROS 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54556 17496232 67833 12337 6871 MAPK1 MAPK MAPK 12 2.2 development cyclin D 1 content is inversely related to p38 MAPK activity which in turn may be regulated by ROS ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54558 17496232 67834 16916 9175 POLD1 CDC2 cdc2 28 1.3 by inhibition of cyclin D 1 or by inhibition of cdc2 (cyclin cyclin E and A pathways ( 104 14 JUMiner_v2.2 1 0 0 2 1722 TotalCon:2<>1722|CDC2|983|Complete__9175|POLD1|5424|Complete__<>AvaiableGeneRif=2<>BEST:1722|CDC2|0.000829301768266925<>ScoreDetail__9175|POLD1|0.000356567747872096__1722|CDC2|0.000829301768266925__ 0 0 0 0 0 54559 17496232 67836 12337 6871 MAPK1 MAPK MAPK 15 2.2 observed that modulation of mtNOS and subsequent redox changes regulate MAPK cascades and cell cycle regulatory proteins in the sequence of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54560 17496232 67837 12339 6877 MAPK3 ERK1 ERK1 37 2.7 and high cyclin D 1 expression associated with high ERK1/2 ERK1 2 and low p38 MAPK activities 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54561 17496232 67837 12337 6871 MAPK1 p38 p38 40 2.2 1 expression associated with high ERK1/2 ERK1 2 and low p38 MAPK activities 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54562 17496232 67837 12337 6871 MAPK1 MAPK MAPK 41 2.2 expression associated with high ERK1/2 ERK1 2 and low p38 MAPK activities 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54563 17496232 67841 14533 7872 NOS1 NOS NOS 15 2.7 2 O 2 levels by controlled treatment with scavengers or NOS inhibitors like N -acetylcysteine glutathione or L -NAME increased proliferation 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54564 17496232 67842 12337 6871 MAPK1 MAPK MAPK 9 2.2 Moreover isolated hepatocyte proliferation rate may be modulated by MAPK inhibitors or stimulators like U-0126 (MEK MEK inhibitor SB-202190 (p38 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54565 17496232 67842 12337 6871 MAPK1 p38 p38 18 2.2 inhibitors or stimulators like U-0126 (MEK MEK inhibitor SB-202190 (p38 p38 inhibitor or anisomycin (p38 p38 activator suggesting that hepatocyte proliferation 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54566 17496232 67842 12337 6871 MAPK1 p38 p38 22 2.2 (MEK MEK inhibitor SB-202190 (p38 p38 inhibitor or anisomycin (p38 p38 activator suggesting that hepatocyte proliferation signaling is related to a 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54567 17496232 67851 1576 990 BCL2 Bcl-2 Bcl-2 14 1.3 that cleave specific aspartate residues in other regulatory proteins like Bcl-2 Bax and MEKK (for for review see Ref 83 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54568 17496232 67851 12306 6848 MAP3K1 MEKK MEKK 17 2.2 aspartate residues in other regulatory proteins like Bcl-2 Bax and MEKK (for for review see Ref 83 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54569 17496232 67852 22551 11892 TNF TNF-alpha TNF-alpha 9 0.8 In the extrinsic pathway binding of membrane ligands like TNF-alpha and Fas to membrane receptors triggers the activation of caspases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54570 17496232 67852 7333 11920 FAS FAS Fas 12 0.6 the extrinsic pathway binding of membrane ligands like TNF-alpha and Fas to membrane receptors triggers the activation of caspases and the 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000675502669018839<>ScoreDetail__11920|FAS|0.000675502669018839__3594|FASN|0.000565222966869989__ 0 0 0 0 0 54571 17496232 67856 22671 11998 TP53 p53 p53 3 1.6 For instance proapoptotic p53 protein induces gene transcription of redox-related genes encoding proteins that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54572 17496232 67862 12349 6881 MAPK8 JNK JNK 13 2.7 NO induces apoptotic cell death with the activation of JNK/SAPK JNK SAPK and p38 MAPK and caspase 3 or inactivation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54573 17496232 67862 12354 6886 MAPK9 SAPK SAPK 13 2.2 induces apoptotic cell death with the activation of JNK/SAPK JNK SAPK and p38 MAPK and caspase 3 or inactivation of NF-kappaB. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54574 17496232 67862 12337 6871 MAPK1 p38 p38 15 2.2 cell death with the activation of JNK/SAPK JNK SAPK and p38 MAPK and caspase 3 or inactivation of NF-kappaB. 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54575 17496232 67862 12337 6871 MAPK1 MAPK MAPK 16 2.2 death with the activation of JNK/SAPK JNK SAPK and p38 MAPK and caspase 3 or inactivation of NF-kappaB. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54576 17496232 67863 14533 7872 NOS1 NOS NOS 5 2.7 In this way increased inducible NOS expression and NO production act as a negative regulatory feedback 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54577 17496232 67863 14352 7794 NFKB1 NF-kappaB NF-kappaB 18 0.0 NO production act as a negative regulatory feedback modulator of NF-kappaB activity ( 102 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54578 17496232 67864 14352 7794 NFKB1 NF-kappaB NF-kappaB 5 0.0 The stimulation or inhibition of NF-kappaB may be related to proliferative or apoptotic effects 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54579 17496232 67865 14352 7794 NFKB1 NF-kappaB NF-kappaB 0 0.0 NF-kappaB is activated by several agents including cytokines oxidant free radicals 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54580 17496232 67866 14352 7794 NFKB1 NF-kappaB NF-kappaB 3 0.0 Inappropriate activation of NF-kappaB has been linked to inflammatory events associated with autoimmune arthritis 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54581 17496232 67867 14352 7794 NFKB1 NF-kappaB NF-kappaB 7 0.0 In contrast complete and persistent inhibition of NF-kappaB has been linked directly to apoptosis inappropriate immune cell development 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54582 17496232 67868 1576 990 BCL2 Bcl-2 Bcl-2 15 1.3 gene is associated with embryo lethality many antiapoptotic pathways like Bcl-2 are induced by NF-kappaB. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54583 17496232 67868 14352 7794 NFKB1 NF-kappaB NF-kappaB 3 0.0 Disruption of the NF-kappaB gene is associated with embryo lethality many antiapoptotic pathways like 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54584 17496232 67869 14352 7794 NFKB1 NF-kappaB NF-kappaB 14 0.0 have been developed in cancer treatment including inhibition of the NF-kappaB pathway ( 144 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 54585 17496232 67871 22671 11998 TP53 p53 p53 24 1.6 the result of DNA damage which induces the accumulation of p53 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54586 17496232 67872 22671 11998 TP53 p53 p53 1 1.6 NO-mediated p53 accumulation induces cell cycle arrest by p21 upregulation or apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54587 17496232 67872 4059 1784 CDKN1A p21 p21 8 0.6 NO-mediated p53 accumulation induces cell cycle arrest by p21 upregulation or apoptosis by increase in Bax/Bcl-xL, Bax Bcl-xL cytochrome 1 JUMiner_v2.2 1 0 0 2 1784 TotalCon:2<>1784|CDKN1A|1026|Complete__11616|TCEAL1|9338|Complete__<>AvaiableGeneRif=2<>BEST:1784|CDKN1A|0.000737768827857011<>ScoreDetail__1784|CDKN1A|0.000737768827857011__11616|TCEAL1|0.000535823637477036__ 0 0 0 0 0 54588 17496232 67875 9691 5232 HSPA1A HSP70 Hsp70 26 0.9 antiapoptotic genes like that of heme oxygenase ( 127 and Hsp70 which protects hepatocytes from apoptosis induced by oxidative and nitrative 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54589 17496232 67878 9038 4827 HBB hemoglobin hemoglobin 8 1.0 Likewise in sickle cell anemia the sickle cell hemoglobin is deficient in the intramolecular and intermolecular transfer of NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54592 17496232 67880 20996 11179 SOD1 SOD1 SOD1 56 2.7 and 10-20% of cases are due to mutations in the SOD1 gene ( 122 123 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54593 17496232 67881 20996 11179 SOD1 SOD1 SOD1 2 2.7 Considering that SOD1 mutations lead to an increase of the denitrosylase activity of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54594 17496232 67881 8118 4141 GAPDH GAPDH GAPDH 35 0.3 of proteins that are regulated by this mechanism (like like GAPDH and that increased denitrosylase activity is a toxic gain of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54595 17496232 67881 20996 11179 SOD1 SOD1 SOD1 48 2.7 increased denitrosylase activity is a toxic gain of function of SOD1 mutants 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54596 17496232 67882 14533 7872 NOS1 NOS NOS 17 2.7 the mitochondrial field we previously reported the existence of defective NOS and mtNOS in mitochondria from tumor cells ( 58 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000854898005194548<>ScoreDetail__7873|NOS2A|0.00073791189877161__7872|NOS1|0.000854898005194548__ 0 0 0 0 0 54597 17496232 67883 12339 6877 MAPK3 ERK1 ERK1 18 2.7 O 2 yields high proliferation rate and activation of ERK1/2, ERK1 2 a pattern resembling that shown in embryonic development ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54598 17496232 67884 12337 6871 MAPK1 p38 p38 2 2.2 Because proapoptotic p38 or JNK1/2 JNK1 2 did not become phosphorylated we surmise 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:4<>1189|AHSA1|10598|Complete__6876|MAPK14|1432|Complete__6871|MAPK1|5594|Complete__6878|MAPK4|5596|Complete__<>AvaiableGeneRif=4<>BEST:6871|MAPK1|0.00253048487028415<>ScoreDetail__1189|AHSA1|0.000481695568400771__6878|MAPK4|0.00107349298100743__6871|MAPK1|0.00253048487028415__6876|MAPK14|0.00201587005614602__ 0 0 0 0 0 54599 17496232 67884 12349 6881 MAPK8 JNK1 JNK1 4 2.7 Because proapoptotic p38 or JNK1/2 JNK1 2 did not become phosphorylated we surmise the results are 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54600 17496232 67891 12337 6871 MAPK1 MAPK MAPKs 36 2.2 setting H 2 O 2 ss with differential activation of MAPKs Akt and cyclin D In this sense very low NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54601 17496232 67891 543 391 AKT1 AKT Akt 37 0.5 H 2 O 2 ss with differential activation of MAPKs Akt and cyclin D In this sense very low NO inhibits 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54602 17496232 67891 4829 2294 COX8A COX COX 48 0.9 and cyclin D In this sense very low NO inhibits COX and determines low H 2 O 2 yield 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>2294|COX8A|1351|No_GeneRif__2267|COX5A|9377|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 59585 17584954 75212 20996 11179 SOD1 SOD1 Sod1 23 2.7 with muscle atrophy in aging in mice lacking CuZn-SOD ( Sod1 and in the neurodegenerative disease amyotrophic lateral sclerosis (ALS) ALS 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59588 17584954 75214 20996 11179 SOD1 SOD1 Sod1 1 2.7 In Sod1 mice muscle mitochondrial ROS production is increased >100% in 20-mo 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59603 17584954 75229 20996 11179 SOD1 SOD1 Sod1 18 2.7 is a knockout mouse lacking a major antioxidant enzyme CuZn-SOD Sod1 mice ( 67 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59604 17584954 75230 20996 11179 SOD1 SOD1 Sod1 8 2.7 In a recent study we reported that the Sod1 mice show a dramatic age-related loss of skeletal muscle mass 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59605 17584954 75231 20996 11179 SOD1 SOD1 Sod1 6 2.7 By 20 mo of age the Sod1 mice have lost nearly 50% of their hindlimb muscle mass 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59606 17584954 75234 20996 11179 SOD1 SOD1 Sod1 1 2.7 The Sod1 mice are also characterized by very high levels of oxidative 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59614 17584954 75245 20996 11179 SOD1 SOD1 Sod1 12 2.7 that occurs in the three conditions we studied (aging, aging Sod1 mice and ALS is largely the result of loss of 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59619 17584954 75249 20996 11179 SOD1 SOD1 Sod1 1 2.7 The Sod1 mice used in this study were generated by Dr Charles 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59620 17584954 75250 20996 11179 SOD1 SOD1 Sod1 9 2.7 The mice were maintained in the heterozygous state ( Sod1 and backcrossed with C57Bl/6J C57Bl 6J females (Jackson Jackson Laboratory 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59630 17584954 75291 20996 11179 SOD1 SOD1 Sod1 33 2.7 associated with significant loss of muscle mass age-related muscle atrophy Sod1 mice (a a mouse model of accelerated sarcopenia and two 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59633 17584954 75292 20996 11179 SOD1 SOD1 Sod1 25 2.7 of muscle atrophy is lowest higher in muscle from the Sod1 mice and increased nearly 10-fold in G93A ALS mutant mice 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59637 17584954 75293 20996 11179 SOD1 SOD1 Sod1 39 2.7 production and atrophy were higher in 20-mo-old than in 5-mo-old Sod1 mice and ROS generation was higher in the G93A compared 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59641 17584954 75296 20996 11179 SOD1 SOD1 Sod1 33 2.7 to denervation (caused caused by breakdown of neuromuscular junctions in Sod1 mice ( 25 57 70 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59642 17584954 75299 20996 11179 SOD1 SOD1 Sod1 9 2.7 Thus one common characteristic of the three models (aging, aging Sod1 mice and ALS mutant mice is alterations in innervation of 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59661 17584954 75325 14352 7794 NFKB1 NF-kappaB NF-kappaB 0 0.0 NF-kappaB is known to play a role in muscle atrophy ( 1 JUMiner_v2.2 1 1 nf-kappab; 0 0 0 0 0 0 0 0 59664 17584954 75327 7405 16731 FBXO32 ATROGIN1 Atrogin-1 16 1.5 lead to upregulation of the expression of ubiquitin ligase Atrogin-1/MAFbx Atrogin-1 MAFbx ( 53 and could therefore contribute to atrophy through 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59665 17584954 75327 7405 16731 FBXO32 MAFbx MAFbx 16 1.5 to upregulation of the expression of ubiquitin ligase Atrogin-1/MAFbx Atrogin-1 MAFbx ( 53 and could therefore contribute to atrophy through increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59667 17584954 75329 20996 11179 SOD1 SOD1 Sod1 11 2.7 on our experiments in young and old wild-type mice the Sod1 model and the ALS mouse models we cannot be certain 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59670 17584954 75329 20996 11179 SOD1 SOD1 Sod1 37 2.7 generation precedes or follows changes in innervation especially in the Sod1 mice and in the case of aging in which the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59696 17584954 75352 20996 11179 SOD1 SOD1 Sod1 27 2.7 2 O 2 release was in fact lower in old Sod1 and late-stage G93A ALS skeletal muscle mitochondria conditions that are 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59707 17584954 75369 20996 11179 SOD1 SOD1 Sod1 8 2.7 Increased ROS generation in skeletal muscle mitochondria from Sod1 mice 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59708 17584954 75370 20996 11179 SOD1 SOD1 Sod1 12 2.7 of gastrocnemius muscle isolated from female wild-type (WT) WT and Sod1 mice at 5 and 20 mo of age 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59709 17584954 75371 20996 11179 SOD1 SOD1 Sod1 23 2.7 substrate in isolated muscle mitochondria from 8 WT and 8 Sod1 mice at 20 mo of age * P _lt_ 0.05 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59710 17584954 75372 20996 11179 SOD1 SOD1 Sod1 13 2.7 open bars represent 5-mo-old WT light shaded bars represent 5-mo-old Sod1 dark shaded bars represent 20-mo-old WT and solid bars represent 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59711 17584954 75372 20996 11179 SOD1 SOD1 Sod1 26 2.7 shaded bars represent 20-mo-old WT and solid bars represent 20-mo-old Sod1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59714 17584954 75374 20996 11179 SOD1 SOD1 Sod1 25 2.7 in mitochondria from 5-mo-old WT ( n = 21 and Sod1 mice ( n = 10 and 20-mo-old WT ( n 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59715 17584954 75374 20996 11179 SOD1 SOD1 Sod1 40 2.7 10 and 20-mo-old WT ( n = 16 and old Sod1 mice ( n = 16 values in D are means 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59717 17584954 75374 20996 11179 SOD1 SOD1 Sod1 82 2.7 in H 2 O 2 release in muscle mitochondria from Sod1 mice compared with mitochondria from age-matched WT mice (ANOVA ANOVA 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59751 17584954 75425 20996 11179 SOD1 SOD1 Sod1 8 2.7 Skeletal muscle mitochondrial ROS production is increased in Sod1 null mice and is associated with the degree of muscle 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59752 17584954 75426 20996 11179 SOD1 SOD1 Sod1 7 2.7 In agreement with our previous report on Sod1 mice ( 57 the gastrocnemius mass was significantly decreased in 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59753 17584954 75426 20996 11179 SOD1 SOD1 Sod1 27 2.7 both young (5 5 mo and older (20 20 mo Sod1 mice compared with the age-matched wild-type mice ( Fig 2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59754 17584954 75430 20996 11179 SOD1 SOD1 Sod1 19 2.7 was decreased ~36% in mitochondria isolated from muscle of 20-mo-old Sod1 mice compared with mitochondria from muscle of age-matched wild-type mice 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59756 17584954 75431 20996 11179 SOD1 SOD1 Sod1 11 2.7 1 ROS production was increased over 30% in mitochondria from Sod1 mice at as early as 5 mo of age compared 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59758 17584954 75432 20996 11179 SOD1 SOD1 Sod1 10 2.7 By 20 mo of age ROS production in mitochondria from Sod1 mice was threefold higher than in the age-matched wild-type mice 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59760 17584954 75433 20996 11179 SOD1 SOD1 Sod1 29 2.7 2 _amp_#183 min _amp_#183 mg protein in mitochondria from 5-mo-old Sod1 compared with 19.77 _amp_#177 1.78 pmol H 2 O 2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59761 17584954 75434 20996 11179 SOD1 SOD1 Sod1 2 2.7 In 20-mo-old Sod1 mice the increase in ROS generation with the substrates glutamate 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59765 17584954 75437 20996 11179 SOD1 SOD1 Sod1 22 2.7 the substrate succinate was significantly lower in mitochondria from the Sod1 mice compared with wild-type controls especially in mitochondria from the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59766 17584954 75437 20996 11179 SOD1 SOD1 Sod1 34 2.7 compared with wild-type controls especially in mitochondria from the 20-mo-old Sod1 mice ( Fig 2 D 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59771 17584954 75445 20996 11179 SOD1 SOD1 Sod1 43 2.7 the G93A mutants and in the 20-mo-old (late late stage Sod1 mice 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59774 17584954 75448 20996 11179 SOD1 SOD1 Sod1 28 2.7 the mitochondria from wild-type mice much higher than in the Sod1 mice or in old wild-type mice which had relatively less 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59778 17584954 75451 20996 11179 SOD1 SOD1 Sod1 8 2.7 As we had observed in mitochondria from the Sod1 mice ROS production with succinate as a substrate was lower 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59780 17584954 75451 20996 11179 SOD1 SOD1 Sod1 42 2.7 an even greater decrease than had been observed in the Sod1 mice approaching levels close to that measured in state 1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59790 17584954 75460 20996 11179 SOD1 SOD1 Sod1 22 2.7 muscle mitochondria isolated from young and old wild-type mice 20-mo-old Sod1 mice and the two ALS mouse models is illustrated in 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49054 17634371 61544 14373 7808 NGF NGF NGF 3 1.2 Nerve growth factor (NGF) NGF can induce apoptosis by signaling through the p75 neurotrophin receptor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49055 17634371 61544 22562 11917 TNFRSF1B p75 p75 11 2.1 factor (NGF) NGF can induce apoptosis by signaling through the p75 neurotrophin receptor (p75 p75 in several nerve cell populations 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49056 17634371 61544 22562 11917 TNFRSF1B p75 p75 14 2.1 induce apoptosis by signaling through the p75 neurotrophin receptor (p75 p75 in several nerve cell populations 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49057 17634371 61545 22562 11917 TNFRSF1B p75 p75 5 2.1 Cultured embryonic motor neurons expressing p75 are not vulnerable to NGF unless they are exposed to 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49058 17634371 61545 14373 7808 NGF NGF NGF 10 1.2 Cultured embryonic motor neurons expressing p75 are not vulnerable to NGF unless they are exposed to an exogenous flux of nitric 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49059 17634371 61546 22562 11917 TNFRSF1B p75 p75 7 2.1 In the present study we show that p75 -mediated apoptosis in motor neurons involved neutral sphingomyelinase activation increased 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49060 17634371 61547 14373 7808 NGF NGF NGF-induced 16 1.2 prevented neuronal loss further evidencing the role of mitochondria in NGF-induced apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49062 17634371 61548 20996 11179 SOD1 SOD1 SOD1 12 1.7 amyotrophic lateral sclerosis (ALS)-linked ALS -linked superoxide dismutase 1 (SOD1 SOD1 mutation NGF induced apoptosis even in the absence of an 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49063 17634371 61548 14373 7808 NGF NGF NGF 15 1.2 sclerosis (ALS)-linked ALS -linked superoxide dismutase 1 (SOD1 SOD1 mutation NGF induced apoptosis even in the absence of an external source 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49064 17634371 61549 20996 11179 SOD1 SOD1 SOD1 4 1.7 The increased susceptibility of SOD1 motor neurons to NGF was associated to decreased nuclear factor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49065 17634371 61549 14373 7808 NGF NGF NGF 8 1.2 The increased susceptibility of SOD1 motor neurons to NGF was associated to decreased nuclear factor erythroid 2-related factor 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49066 17634371 61549 14345 7782 NFE2L2 NRF2 Nrf2 19 3.1 associated to decreased nuclear factor erythroid 2-related factor 2 (Nrf2) Nrf2 expression and downregulation of the enzymes involved in glutathione biosynthesis 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49067 17634371 61550 20996 11179 SOD1 SOD1 SOD1 13 1.7 of glutathione in nontransgenic motor neurons reproduced the effect of SOD1 expression increasing their sensitivity to NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49068 17634371 61550 14373 7808 NGF NGF NGF 19 1.2 reproduced the effect of SOD1 expression increasing their sensitivity to NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49069 17634371 61551 14345 7782 NFE2L2 NRF2 Nrf2 6 3.1 In contrast rising antioxidant defenses by Nrf2 activation prevented NGF-induced apoptosis 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49070 17634371 61551 14373 7808 NGF NGF NGF-induced 9 1.2 In contrast rising antioxidant defenses by Nrf2 activation prevented NGF-induced apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49071 17634371 61552 22562 11917 TNFRSF1B p75 p75 5 2.1 Together our data indicate that p75 -mediated motor neuron apoptosis involves ceramide-dependent increased mitochondrial superoxide production 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49073 17634371 61553 20996 11179 SOD1 SOD1 SOD1 10 1.7 This apoptotic pathway is facilitated by the expression of ALS-linked SOD1 mutations and critically modulated by Nrf2 activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49074 17634371 61553 14345 7782 NFE2L2 NRF2 Nrf2 16 3.1 the expression of ALS-linked SOD1 mutations and critically modulated by Nrf2 activity 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49075 17634371 61554 14345 7782 NFE2L2 NRF2 Nrf2 11 3.1 words amyotrophic lateral sclerosis mitochondria motor neurons nerve growth factor Nrf2 p75 superoxide 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49076 17634371 61554 22562 11917 TNFRSF1B p75 p75 12 2.1 amyotrophic lateral sclerosis mitochondria motor neurons nerve growth factor Nrf2 p75 superoxide 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49077 17634371 61555 14373 7808 NGF NGF NGF 3 1.2 Nerve growth factor (NGF) NGF has a key role on the development and function of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49078 17634371 61556 14373 7808 NGF NGF NGF 8 1.2 In addition to promoting neuronal differentiation and survival NGF can induce apoptosis of neurons during development and may also 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49079 17634371 61557 14373 7808 NGF NGF NGF 0 1.2 NGF exerts its actions through two nonhomologous transmembrane receptors the tyrosine 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49080 17634371 61557 14738 8031 NTRK1 TRKA TrkA 13 1.9 actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49081 17634371 61557 22562 11917 TNFRSF1B p75 p75 16 2.1 nonhomologous transmembrane receptors the tyrosine kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a member of the 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49082 17634371 61557 22562 11917 TNFRSF1B p75 p75 19 2.1 tyrosine kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a member of the tumor necrosis factor receptor 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49083 17634371 61557 22562 11917 TNFRSF1B p75 p75 21 2.1 kinase receptor TrkA and the p75 neurotrophin receptor (p75 p75 p75 is a member of the tumor necrosis factor receptor superfamily 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49084 17634371 61558 14373 7808 NGF NGF NGF 10 1.2 Adult motor neurons had been thought to be unresponsive to NGF because they lack both TrkA and p75 receptors (Henderson Henderson 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49085 17634371 61558 14738 8031 NTRK1 TRKA TrkA 15 1.9 thought to be unresponsive to NGF because they lack both TrkA and p75 receptors (Henderson Henderson et al. 1993 Yan et 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49086 17634371 61558 22562 11917 TNFRSF1B p75 p75 17 2.1 be unresponsive to NGF because they lack both TrkA and p75 receptors (Henderson Henderson et al. 1993 Yan et al. 1993 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49087 17634371 61559 22562 11917 TNFRSF1B p75 p75 6 2.1 However adult motor neurons can reexpress p75 after nerve injury (Koliatsos Koliatsos et al. 1991 Rende et 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49089 17634371 61560 22562 11917 TNFRSF1B p75 p75 2 2.1 Induction of p75 renders motor neurons vulnerable to NGF-induced apoptosis p75 has been 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49090 17634371 61560 14373 7808 NGF NGF NGF-induced 8 1.2 Induction of p75 renders motor neurons vulnerable to NGF-induced apoptosis p75 has been implicated in motor neuron death occurring 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49091 17634371 61560 22562 11917 TNFRSF1B p75 p75 10 2.1 Induction of p75 renders motor neurons vulnerable to NGF-induced apoptosis p75 has been implicated in motor neuron death occurring in transgenic 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49092 17634371 61560 20996 11179 SOD1 SOD1 SOD1 27 1.7 occurring in transgenic mice overexpressing mutant Cu-Zn superoxide dismutase (SOD1) SOD1 (Lowry Lowry et al. 2001b Copray et al. 2003 Kust 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49093 17634371 61561 22562 11917 TNFRSF1B p75 p75 5 2.1 Pure motor neuron cultures expressing p75 are sensitive to NGF-induced apoptosis only when physiological concentrations of 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49094 17634371 61561 14373 7808 NGF NGF NGF-induced 9 1.2 Pure motor neuron cultures expressing p75 are sensitive to NGF-induced apoptosis only when physiological concentrations of exogenous nitric oxide ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49095 17634371 61562 22562 11917 TNFRSF1B p75 p75 10 2.1 These motor neurons also become immunoreactive for nitrotyrosine suggesting that p75 activation may be inducing a source of superoxide that converts 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49096 17634371 61563 22562 11917 TNFRSF1B p75 p75 6 2.1 Astrocytes can protect motor neurons against p75 -induced apoptosis by the activation of the transcription factor nuclear 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49097 17634371 61563 14345 7782 NFE2L2 NRF2 Nrf2 22 3.1 the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), Nrf2 which increases antioxidant defenses (Vargas Vargas et al. 2006 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49098 17634371 61564 22562 11917 TNFRSF1B p75 p75 6 2.1 Thus the signaling pathway induced by p75 and its final outcome differs depending on the cell type 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49099 17634371 61565 10824 6204 JUN c-Jun c-Jun 13 1.3 is not completely elucidated but is associated with activation of c-Jun N-terminal kinase (JNK), JNK release of cytochrome c from mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49100 17634371 61565 12349 6881 MAPK8 JNK JNK 16 0.6 but is associated with activation of c-Jun N-terminal kinase (JNK), JNK release of cytochrome c from mitochondria and subsequent activation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49101 17634371 61566 22562 11917 TNFRSF1B p75 p75 8 2.1 Ceramide production may also be a mediator of p75 -induced apoptosis (Dobrowsky Dobrowsky et al. 1994 Casaccia-Bonnefil et al. 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49104 17634371 61569 22562 11917 TNFRSF1B p75 p75 5 2.1 We have previously shown that p75 -induced motor neuron death involves increased production of ROS and 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49107 17634371 61570 22562 11917 TNFRSF1B p75 p75 10 2.1 However the source of the increased ROS production induced by p75 activation in motor neurons is currently unknown 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49109 17634371 61571 22562 11917 TNFRSF1B p75 p75 11 2.1 the present study we investigated the apoptotic pathway mediated by p75 in motor neurons and the impact of ALS-linked SOD1 expression 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49111 17634371 61571 20996 11179 SOD1 SOD1 SOD1 20 1.7 by p75 in motor neurons and the impact of ALS-linked SOD1 expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49112 17634371 61572 20486 11121 SMPD2 nSMase nSMase 8 1.9 We show that this pathway involved neutral sphingomyelinase (nSMase) nSMase activation and increased mitochondrial superoxide production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49114 17634371 61573 20996 11179 SOD1 SOD1 SOD1 4 1.7 Motor neurons overexpressing ALS-linked SOD1 mutation showed greater susceptibility to the p75 -activated apoptotic pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49115 17634371 61573 22562 11917 TNFRSF1B p75 p75 11 2.1 neurons overexpressing ALS-linked SOD1 mutation showed greater susceptibility to the p75 -activated apoptotic pathway which was associated to decreased Nrf2 expression 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49116 17634371 61573 14345 7782 NFE2L2 NRF2 Nrf2 20 3.1 the p75 -activated apoptotic pathway which was associated to decreased Nrf2 expression and the consequent reduction in antioxidant defenses 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49117 17634371 61576 14373 7808 NGF NGF NGF 1 1.2 Mouse NGF (2.5S) 2.5S was obtained from Harlan (Madison, Madison WI recombinant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49118 17634371 61576 7333 11920 FAS FAS Fas 12 0.3 was obtained from Harlan (Madison, Madison WI recombinant human soluble Fas ligand and tert -butylhydroquinone (tBHQ) tBHQ from Alexis (San San 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49120 17634371 61577 14373 7808 NGF NGF NGF 3 1.2 Blocking antibodies to NGF and p75 were from Chemicon (Temecula, Temecula CA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49121 17634371 61577 22562 11917 TNFRSF1B p75 p75 5 2.1 Blocking antibodies to NGF and p75 were from Chemicon (Temecula, Temecula CA 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49122 17634371 61582 22562 11917 TNFRSF1B p75 p75 28 2.1 gradient centrifugation and immunopanning with the monoclonal antibody IgG192 against p75 as described previously (Henderson Henderson et al. 1995 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49123 17634371 61583 20996 11179 SOD1 SOD1 SOD1 1 1.7 Transgenic SOD1 and nontransgenic motor neurons were prepared in the same way 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49124 17634371 61584 20996 11179 SOD1 SOD1 SOD1 2 1.7 Sprague Dawley SOD1 L26H rats were kindly provided by Dr David S Howland 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49126 17634371 61587 8240 4232 GDNF GDNF GDNF 14 1.2 by the addition of glial cell line-derived neurotrophic factor (GDNF) GDNF (1 1 ng/ml; ng ml Sigma to the culture media 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49127 17634371 61588 8240 4232 GDNF GDNF GDNF 10 1.2 neuron death induced by trophic factor deprivation (NONE; NONE without GDNF was determined in all experiments as a control and never 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49128 17634371 61590 20996 11179 SOD1 SOD1 SOD1 7 1.7 As a control the expression of human SOD1 was determined in the spinal cord of E15 embryos and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49130 17634371 61592 20996 11179 SOD1 SOD1 SOD1 10 1.7 Anti-SOD1 antibodies were developed in rabbit using recombinant pure human SOD1 as immunogen (kindly kindly provided by Dr M Marin University 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49131 17634371 61595 14373 7808 NGF NGF NGF 2 1.2 Treatments with NGF and inhibitors were performed 3 h after motor neuron plating 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49132 17634371 61597 7333 11920 FAS FAS Fas 1 0.3 Soluble Fas ligand was added in the presence of enhancer antibody (1 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49133 17634371 61598 22562 11917 TNFRSF1B p75 p75 6 2.1 Treatment with antisense oligonucleotides to downregulate p75 expression in motor neurons was performed as described previously (Pehar 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49134 17634371 61601 22562 11917 TNFRSF1B p75 p75 10 2.1 To determine the efficiency of uptake cultures were incubated with p75 antisense oligonucleotides with a 5' 56-FAM fluorescent label 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49135 17634371 61605 22562 11917 TNFRSF1B p75 p75 5 2.1 Sequences used were as follows p75 antisense 5'-ACCTGCCCTCCTCATTGCA-3' and p75 missense 5'-CTCCCACTCGTCATTCGAC-3' (Florez-McClure Florez-McClure et al. 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49136 17634371 61605 22562 11917 TNFRSF1B p75 p75 9 2.1 Sequences used were as follows p75 antisense 5'-ACCTGCCCTCCTCATTGCA-3' and p75 missense 5'-CTCCCACTCGTCATTCGAC-3' (Florez-McClure Florez-McClure et al. 2004 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49137 17634371 61606 22562 11917 TNFRSF1B p75 p75 12 2.1 sequence has previously been shown to be effective at inhibiting p75 -induced apoptosis in motor neurons both in vivo and in 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49138 17634371 61609 14345 7782 NFE2L2 NRF2 Nrf2 9 3.1 PCR primers specific to each gene are as follows Nrf2 5'-TTCCTCTGCTGCCATTAGTCAGTC-3' and 5'-GCTCTTCCATTTCCGAGTCACTG-3' (242 242 bp glutamate-cysteine ligase modifier subunit 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49139 17634371 61609 8205 4312 GCLM GCLM GCLM 19 3.0 and 5'-GCTCTTCCATTTCCGAGTCACTG-3' (242 242 bp glutamate-cysteine ligase modifier subunit (GCLM), GCLM 5'-AATCTTGCCTCCTGCTGTGTGATG-3' and 5'-GGCTTCAATGTCAGGGATGCTTTC-3' (153 153 bp glutamate-cysteine ligase catalytic subunit 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49140 17634371 61609 8204 4311 GCLC GCLC GCLC 29 2.5 and 5'-GGCTTCAATGTCAGGGATGCTTTC-3' (153 153 bp glutamate-cysteine ligase catalytic subunit (GCLC), GCLC 5'-ATGAAAGTGGCACAGGAGCGAG-3' and 5'-AAACACGCCTTCCTTCCCATTG-3' (186 186 bp neuronal nitric oxide synthase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49141 17634371 61609 14533 7872 NOS1 nNOS nNOS 39 3.7 and 5'-AAACACGCCTTCCTTCCCATTG-3' (186 186 bp neuronal nitric oxide synthase (nNOS), nNOS 5'-CCACACCAACGGGAATCAGGAG-3' and 5'-TCCTCCAGCACCTCCACCATTG-3' (405 405 bp actin 5'-CATGAAGATCCTGACCGAGCGTG-3' and 5'-TCTGCTGGAAGGTGGACAGTGAGG-3' 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49142 17634371 61609 22562 11917 TNFRSF1B p75 p75 51 2.1 (405 405 bp actin 5'-CATGAAGATCCTGACCGAGCGTG-3' and 5'-TCTGCTGGAAGGTGGACAGTGAGG-3' (497 497 bp p75 primers were from Promega (Madison, Madison WI 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49143 17634371 61620 3628 25079 CCDC34 L15 L15 17 0.6 mito-HE for 15 min and after washing incubated in supplemented L15 (Pehar Pehar et al. 2004 without phenol red 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>25079|CCDC34|91057|No_GeneRif__5748|IGKV1D-16|28901|No_GeneRif__<>AvaiableGeneRif=0<> 0 0 0 0 0 49144 17634371 61623 14373 7808 NGF NGF NGF 10 1.2 mito-HE incubation cells were treated with 100 ng/ml ng ml NGF and then imaged every 15 min 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49145 17634371 61627 8240 4232 GDNF GDNF GDNF 9 1.2 To test monochlorobimane fluorescence emission motor neurons maintained with GDNF (1 1 ng/ml) ng ml were treated with buthionine-sulfoximine (BSO) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49146 17634371 61631 20996 11179 SOD1 SOD1 SOD1 2 1.7 Nontransgenic and SOD1 motor neuron cultures were maintained for 16 h in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49147 17634371 61631 8240 4232 GDNF GDNF GDNF 15 1.2 cultures were maintained for 16 h in the presence of GDNF (1 1 ng/ml) ng ml and then treated with NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49148 17634371 61631 14373 7808 NGF NGF NGF 22 1.2 GDNF (1 1 ng/ml) ng ml and then treated with NGF (100 100 ng/ml) ng ml in the presence or absence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49149 17634371 61639 22562 11917 TNFRSF1B p75 p75 17 2.1 as a central component of the apoptotic pathway mediated by p75 in other cell types we examined its role in p75 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49150 17634371 61639 22562 11917 TNFRSF1B p75 p75 27 2.1 p75 in other cell types we examined its role in p75 -mediated motor neuron apoptosis 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49151 17634371 61640 14373 7808 NGF NGF NGF 10 1.2 Consistent with our previous results (Pehar Pehar et al. 2004 NGF reduced motor neuron survival by 40% only in the presence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49152 17634371 61641 14373 7808 NGF NGF NGF-induced 3 1.2 The extent of NGF-induced reduction in motor neuron survival was similar to that induced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49153 17634371 61642 14373 7808 NGF NGF NGF-induced 0 1.2 NGF-induced motor neuron death was blocked by manumycin A (10 10 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49154 17634371 61642 20486 11121 SMPD2 nSMase nSMase 22 1.9 M and GW4869 (100 100 n M specific inhibitors of nSMase (Arenz Arenz et al. 2001 Luberto et al. 2002 ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49155 17634371 61644 20486 11121 SMPD2 nSMase nSMase 9 1.9 These results indicate the involvement of ceramide production by nSMase activation in p75 -mediated motor neuron apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49156 17634371 61644 22562 11917 TNFRSF1B p75 p75 12 2.1 indicate the involvement of ceramide production by nSMase activation in p75 -mediated motor neuron apoptosis 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49157 17634371 61645 22562 11917 TNFRSF1B p75 p75 2 2.1 Reexpression of p75 under pathological conditions renders motor neurons vulnerable to NGF (Ferri 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49158 17634371 61645 14373 7808 NGF NGF NGF 11 1.2 of p75 under pathological conditions renders motor neurons vulnerable to NGF (Ferri Ferri et al. 1998 Wiese et al. 1999 Lowry 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49159 17634371 61646 14373 7808 NGF NGF NGF 8 1.2 In the present study we show that the NGF/p75 NGF p75 -mediated motor neuron apoptosis involved increased production of mitochondrial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49160 17634371 61646 22562 11917 TNFRSF1B p75 p75 8 2.1 In the present study we show that the NGF/p75 NGF p75 -mediated motor neuron apoptosis involved increased production of mitochondrial superoxide 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49162 17634371 61647 20996 11179 SOD1 SOD1 SOD1 2 1.7 Moreover ALS-linked SOD1 overexpression increases motor neuron vulnerability to NGF-mediated apoptosis by reducing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49163 17634371 61647 14373 7808 NGF NGF NGF-mediated 9 1.2 Moreover ALS-linked SOD1 overexpression increases motor neuron vulnerability to NGF-mediated apoptosis by reducing antioxidant defenses 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49164 17634371 61648 20996 11179 SOD1 SOD1 SOD1 11 1.7 effect could be explained not only by the expression of SOD1 with aberrant redox properties (Beckman Beckman et al. 2001 but 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49165 17634371 61648 14345 7782 NFE2L2 NRF2 Nrf2 25 3.1 properties (Beckman Beckman et al. 2001 but also by reduced Nrf2 expression which leads to a downregulation of the key enzymes 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49166 17634371 61649 14345 7782 NFE2L2 NRF2 Nrf2 5 3.1 In accordance pharmacological activation of Nrf2 prevented NGF/p75 NGF p75 -induced motor neuron apoptosis suggesting a 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49167 17634371 61649 14373 7808 NGF NGF NGF 7 1.2 In accordance pharmacological activation of Nrf2 prevented NGF/p75 NGF p75 -induced motor neuron apoptosis suggesting a potential target to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49168 17634371 61649 22562 11917 TNFRSF1B p75 p75 7 2.1 In accordance pharmacological activation of Nrf2 prevented NGF/p75 NGF p75 -induced motor neuron apoptosis suggesting a potential target to counteract 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49169 17634371 61649 22562 11917 TNFRSF1B p75 p75 18 2.1 -induced motor neuron apoptosis suggesting a potential target to counteract p75 -mediated motor neuron death occurring in pathological conditions 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49170 17634371 61650 22562 11917 TNFRSF1B p75 p75 0 2.1 p75 induces cell death by activating different signaling pathways depending on 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49171 17634371 61651 7333 11920 FAS FAS Fas 11 0.3 observed for other apoptotic stimuli including trophic factor deprivation and Fas (Est_amp_eacute;vez Est_amp_eacute vez et al 1998 Raoul et al. 2002 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49172 17634371 61651 22562 11917 TNFRSF1B p75 p75 24 2.1 et al 1998 Raoul et al. 2002 the mechanism of p75 -induced apoptosis in motor neurons involves downstream production of nitric 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49173 17634371 61652 22562 11917 TNFRSF1B p75 p75 8 2.1 In the present study we found that the p75 apoptotic pathway in motor neurons involved increased ceramide production and 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49174 17634371 61652 22562 11917 TNFRSF1B p75 p75 51 2.1 Hertel 1998 Brann et al. 2002 Bhakar et al. 2003 p75 -induced ceramide generation in motor neurons was mediated by activation 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49175 17634371 61653 22562 11917 TNFRSF1B p75 p75 2 2.1 A similar p75 -mediated apoptotic pathway was described previously in hippocampal neurons involving 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49176 17634371 61653 20486 11121 SMPD2 nSMase nSMase 13 1.9 -mediated apoptotic pathway was described previously in hippocampal neurons involving nSMase activation increased ceramide generation and subsequent JNK activation (Brann Brann 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49177 17634371 61653 12349 6881 MAPK8 JNK JNK 20 0.6 hippocampal neurons involving nSMase activation increased ceramide generation and subsequent JNK activation (Brann Brann et al. 2002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49178 17634371 61654 22562 11917 TNFRSF1B p75 p75 2 2.1 However in p75 -expressing NIH-3T3 and PC12 cell lines the acid isoform of 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49179 17634371 61654 22562 11917 TNFRSF1B p75 p75 22 2.1 of SMase has been implicated in ceramide production induced by p75 signaling (Dobrowsky Dobrowsky and Carter 1998 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49180 17634371 61655 22562 11917 TNFRSF1B p75 p75 4 2.1 Thus it seems that p75 is able to activate different SMases depending on the cell 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49182 17634371 61656 20996 11179 SOD1 SOD1 SOD1 8 1.7 Interestingly the spinal cord of ALS patients and SOD1 mice exhibit a remarkable increase in ceramides and cholesterol esters 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49183 17634371 61657 14373 7808 NGF NGF NGF 1 1.2 Therefore NGF signaling through p75 and the subsequent increase in ceramide production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49184 17634371 61657 22562 11917 TNFRSF1B p75 p75 4 2.1 Therefore NGF signaling through p75 and the subsequent increase in ceramide production may also modulate 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49185 17634371 61658 22562 11917 TNFRSF1B p75 p75 7 2.1 In motor neurons ceramide generation induced by p75 signaling increased superoxide production by mitochondria as evidenced by oxidation 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49186 17634371 61659 14373 7808 NGF NGF NGF 15 1.2 an important source of superoxide in motor neurons exposed to NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49187 17634371 61662 14373 7808 NGF NGF NGF 16 1.2 and peroxynitrite scavengers completely prevent motor neuron death induced by NGF through p75 (Pehar Pehar et al. 2004 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49188 17634371 61662 22562 11917 TNFRSF1B p75 p75 18 2.1 scavengers completely prevent motor neuron death induced by NGF through p75 (Pehar Pehar et al. 2004 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49189 17634371 61663 14373 7808 NGF NGF NGF-mediated 23 1.2 (mitoCP) mitoCP supports a role for mitochondrial oxidative damage in NGF-mediated apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49190 17634371 61665 14373 7808 NGF NGF NGF 31 1.2 prevent mitochondrial oxidative damage and neuronal death induced by NGF/p75 NGF p75 -signaling in vivo 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49191 17634371 61665 22562 11917 TNFRSF1B p75 p75 31 2.1 mitochondrial oxidative damage and neuronal death induced by NGF/p75 NGF p75 -signaling in vivo 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49193 17634371 61666 20996 11179 SOD1 SOD1 SOD1 9 1.7 It was previously shown that motor neurons overexpressing ALS-linked SOD1 mutations (G37R, G37R G85R or G93A display increased susceptibility to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49194 17634371 61666 7333 11920 FAS FAS Fas 21 0.3 G37R G85R or G93A display increased susceptibility to activation of Fas apoptotic pathway but not to trophic factor deprivation or excitotoxic 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49195 17634371 61667 20996 11179 SOD1 SOD1 SOD1 5 1.7 We show here that transgenic SOD1 motor neurons also show increased susceptibility to p75 -mediated apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49196 17634371 61667 22562 11917 TNFRSF1B p75 p75 13 2.1 that transgenic SOD1 motor neurons also show increased susceptibility to p75 -mediated apoptosis 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49197 17634371 61668 20996 11179 SOD1 SOD1 SOD1 6 1.7 In contrast to nontransgenic motor neurons SOD1 motor neurons are sensitive to NGF-mediated apoptosis in the absence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49198 17634371 61668 14373 7808 NGF NGF NGF-mediated 12 1.2 to nontransgenic motor neurons SOD1 motor neurons are sensitive to NGF-mediated apoptosis in the absence of exogenous nitric oxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49199 17634371 61669 14373 7808 NGF NGF NGF-induced 10 1.2 Although an external source of nitric oxide is not required NGF-induced apoptosis in SOD1 transgenic motor neurons requires endogenous production of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49200 17634371 61669 20996 11179 SOD1 SOD1 SOD1 13 1.7 source of nitric oxide is not required NGF-induced apoptosis in SOD1 transgenic motor neurons requires endogenous production of nitric oxide by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49201 17634371 61669 14533 7872 NOS1 nNOS nNOS 24 3.7 transgenic motor neurons requires endogenous production of nitric oxide by nNOS because apoptosis is prevented by nNOS inhibitors 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49202 17634371 61669 14533 7872 NOS1 nNOS nNOS 30 3.7 of nitric oxide by nNOS because apoptosis is prevented by nNOS inhibitors 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49203 17634371 61670 20996 11179 SOD1 SOD1 SOD1 13 1.7 the execution of a similar apoptotic pathway in nontransgenic and SOD1 motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49204 17634371 61671 20996 11179 SOD1 SOD1 SOD1 4 1.7 The increased susceptibility of SOD1 motor neurons to NGF-induced apoptosis was not mediated by increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49205 17634371 61671 14373 7808 NGF NGF NGF-induced 8 1.2 The increased susceptibility of SOD1 motor neurons to NGF-induced apoptosis was not mediated by increased expression of p75 or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49206 17634371 61671 22562 11917 TNFRSF1B p75 p75 17 2.1 to NGF-induced apoptosis was not mediated by increased expression of p75 or nNOS mRNA 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49207 17634371 61671 14533 7872 NOS1 nNOS nNOS 19 3.7 apoptosis was not mediated by increased expression of p75 or nNOS mRNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49208 17634371 61672 14533 7872 NOS1 NOS NOS 12 2.7 nitric oxide production may still result from activation of endogenous NOS enzymatic activity 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000594372057189296<>ScoreDetail__7873|NOS2A|0.000542681145488186__7872|NOS1|0.000594372057189296__ 0 0 0 0 0 49209 17634371 61673 7333 11920 FAS FAS Fas 6 0.3 Nevertheless for other apoptotic stimuli including Fas (Raoul Raoul et al. 2002 and trophic factor deprivation (Est_amp_eacute;vez 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49210 17634371 61673 14533 7872 NOS1 nNOS nNOS 21 3.7 and trophic factor deprivation (Est_amp_eacute;vez Est_amp_eacute vez et al. 1998 nNOS regulation in motor neurons occurs at the transcriptional level 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49211 17634371 61674 14373 7808 NGF NGF NGF-mediated 15 1.2 nitric oxide production was counteracted by endogenous antioxidant defenses and NGF-mediated apoptosis only proceeds in the presence of an exogenous source 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49212 17634371 61675 20996 11179 SOD1 SOD1 SOD1 4 1.7 The expression of mutant SOD1 leads to decreased antioxidant defenses thereby potentiating the detrimental stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49213 17634371 61676 22562 11917 TNFRSF1B p75 p75 9 2.1 Together our results suggest a critical modulation of the p75 -apoptotic pathway in motor neurons that is specifically regulated by 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49214 17634371 61677 14373 7808 NGF NGF NGF-mediated 0 1.2 NGF-mediated apoptosis will be executed only in the presence of surrounding 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49216 17634371 61680 8204 4311 GCLC GCLC GCLC 14 2.5 step in GSH biosynthesis and both subunits of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49217 17634371 61680 8205 4312 GCLM GCLM GCLM 16 3.0 GSH biosynthesis and both subunits of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription factor and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49218 17634371 61680 14345 7782 NFE2L2 NRF2 Nrf2 21 3.1 of the enzyme GCLC and GCLM are transcriptionally regulated by Nrf2 a redox-sensitive transcription factor and member of the Cap'n'Collar/basic-leucine Cap'n'Collar 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49220 17634371 61681 20996 11179 SOD1 SOD1 SOD1 5 1.7 Compared with nontransgenic motor neurons SOD1 motor neurons showed reduced Nrf2 mRNA expression which correlated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49221 17634371 61681 14345 7782 NFE2L2 NRF2 Nrf2 10 3.1 Compared with nontransgenic motor neurons SOD1 motor neurons showed reduced Nrf2 mRNA expression which correlated with a decreased transcription of GCLC 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49222 17634371 61681 8204 4311 GCLC GCLC GCLC 20 2.5 Nrf2 mRNA expression which correlated with a decreased transcription of GCLC and GCLM 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49223 17634371 61681 8205 4312 GCLM GCLM GCLM 22 3.0 expression which correlated with a decreased transcription of GCLC and GCLM 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49224 17634371 61682 14345 7782 NFE2L2 NRF2 Nrf2 4 3.1 A similar reduction in Nrf2 expression was previously observed in a motor neuron-like NSC34 cell 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49225 17634371 61682 20996 11179 SOD1 SOD1 SOD1 20 1.7 a motor neuron-like NSC34 cell line transfected with a mutant SOD1 expression vector and in motor neurons from SOD1-associated familial ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49226 17634371 61682 20996 11179 SOD1 SOD1 SOD1-associated 28 1.7 a mutant SOD1 expression vector and in motor neurons from SOD1-associated familial ALS cases (Kirby Kirby et al. 2005 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49228 17634371 61683 14345 7782 NFE2L2 NRF2 Nrf2 3 3.1 This reduction in Nrf2 expression could explain the increased susceptibility of SOD1 motor neurons 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49229 17634371 61683 20996 11179 SOD1 SOD1 SOD1 11 1.7 reduction in Nrf2 expression could explain the increased susceptibility of SOD1 motor neurons not only to NGF but also to Fas-mediated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49230 17634371 61683 14373 7808 NGF NGF NGF 17 1.2 the increased susceptibility of SOD1 motor neurons not only to NGF but also to Fas-mediated apoptosis which also involves ROS and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49232 17634371 61683 14345 7782 NFE2L2 NRF2 Nrf2 46 3.1 has been established to strongly activate gene expression mediated by Nrf2 and to subsequently increase GSH content by induction of GCL 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49233 17634371 61683 14345 7782 NFE2L2 NRF2 Nrf2 64 3.1 induction of GCL tBHQ causes increased GCL expression only when Nrf2 is present but it does not in Nrf2 knock-out cells 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49234 17634371 61683 14345 7782 NFE2L2 NRF2 Nrf2 72 3.1 only when Nrf2 is present but it does not in Nrf2 knock-out cells (Lee Lee et al. 2003 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49238 17634371 61684 14345 7782 NFE2L2 NRF2 Nrf2 4 3.1 Accordingly pharmacological activation of Nrf2 by tBHQ treatment completely prevented NGF- and Fas-mediated motor neuron 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49239 17634371 61684 14373 7808 NGF NGF NGF- 10 1.2 Accordingly pharmacological activation of Nrf2 by tBHQ treatment completely prevented NGF- and Fas-mediated motor neuron apoptosis in nontransgenic and SOD1 motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49240 17634371 61684 20996 11179 SOD1 SOD1 SOD1 19 1.7 prevented NGF- and Fas-mediated motor neuron apoptosis in nontransgenic and SOD1 motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49241 17634371 61685 14345 7782 NFE2L2 NRF2 Nrf2 1 3.1 Thus Nrf2 manipulation may be a target in the prevention of motor 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49242 17634371 61685 22562 11917 TNFRSF1B p75 p75 20 2.1 of motor neuron death occurring in neuropathological conditions involving either p75 - or Fas-apoptotic signaling 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49243 17634371 61685 7333 11920 FAS FAS Fas-apoptotic 23 0.3 death occurring in neuropathological conditions involving either p75 - or Fas-apoptotic signaling 1 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49244 17634371 61687 14373 7808 NGF NGF NGF-induced 0 1.2 NGF-induced apoptosis in motor neurons involves nSMase activation and triggers cytochrome 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49245 17634371 61687 20486 11121 SMPD2 nSMase nSMase 6 1.9 NGF-induced apoptosis in motor neurons involves nSMase activation and triggers cytochrome c release from mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49246 17634371 61688 8240 4232 GDNF GDNF GDNF 8 1.2 A Pure motor neuron cultures maintained with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49247 17634371 61688 14373 7808 NGF NGF NGF 14 1.2 with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 100 ng/ml) ng ml plus 10 micro M DETA-NONOate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49248 17634371 61689 14373 7808 NGF NGF NGF 7 1.2 SMase inhibitors were added 1 h before NGF and DETA-NONOate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49249 17634371 61691 8240 4232 GDNF GDNF GDNF 12 1.2 represent the SD of trophic factor deprivation (NONE; NONE without GDNF as a control for maximum cell death observed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49250 17634371 61692 8240 4232 GDNF GDNF GDNF 6 1.2 Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49251 17634371 61692 8240 4232 GDNF GDNF GDNF 17 1.2 mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49252 17634371 61693 8240 4232 GDNF GDNF GDNF 13 1.2 microphotographs showing cytochrome c immunoreactivity in motor neurons maintained with GDNF (control) control or exposed to NGF plus DETA-NONOate (NGF+NO) NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49253 17634371 61693 14373 7808 NGF NGF NGF 18 1.2 motor neurons maintained with GDNF (control) control or exposed to NGF plus DETA-NONOate (NGF+NO) NGF NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49254 17634371 61693 14373 7808 NGF NGF NGF 21 1.2 GDNF (control) control or exposed to NGF plus DETA-NONOate (NGF+NO) NGF NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49255 17634371 61694 14373 7808 NGF NGF NGF 4 1.2 In the absence of NGF motor neurons showed a punctuate (mitochondrial) mitochondrial labeling of cytochrome 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49256 17634371 61694 14373 7808 NGF NGF NGF 22 1.2 labeling of cytochrome c whereas 12 h after treatment with NGF NO motor neurons showed a diffuse cytoplasmic labeling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49257 17634371 61695 14373 7808 NGF NGF NGF 14 1.2 100 n M GW prevented cytochrome c release induced by NGF NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49258 17634371 61696 8240 4232 GDNF GDNF GDNF 4 1.2 Motor neurons maintained with GDNF (1 1 ng/ml) ng ml were exposed to vehicle (Ctrl), 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49259 17634371 61696 14373 7808 NGF NGF NGF 12 1.2 1 ng/ml) ng ml were exposed to vehicle (Ctrl), Ctrl NGF (100 100 ng/ml), ng ml DETA-NONOate (10 10 micro M 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49261 17634371 61700 14373 7808 NGF NGF NGF 0 1.2 NGF increases superoxide production by mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49262 17634371 61702 14373 7808 NGF NGF NGF 19 1.2 0.1 micro M mito-HE and after washing were exposed to NGF (100 100 ng/ml) ng ml 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49263 17634371 61703 14373 7808 NGF NGF NGF 14 1.2 fluorescence emission of mito-HE ( exc 405 nm immediately after NGF addition ( t = 0 min and 40 min later 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49264 17634371 61704 8240 4232 GDNF GDNF GDNF 12 1.2 did not change after 40 min in cultures maintained with GDNF in the absence of NGF (data data not shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49265 17634371 61704 14373 7808 NGF NGF NGF 17 1.2 min in cultures maintained with GDNF in the absence of NGF (data data not shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49266 17634371 61705 14373 7808 NGF NGF NGF 7 1.2 The increased mito-HE fluorescence emission induced by NGF was not observed in cultures preincubated for 24 h with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49267 17634371 61705 22562 11917 TNFRSF1B p75 p75 22 2.1 cultures preincubated for 24 h with antisense oligonucleotides to downregulate p75 expression or GW4869 (100 100 n M 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49268 17634371 61706 14373 7808 NGF NGF NGF 10 1.2 Preincubation with missense oligonucleotides did not prevent the effect of NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49269 17634371 61707 8240 4232 GDNF GDNF GDNF 7 1.2 B Motor neuron cultures maintained with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49270 17634371 61707 14373 7808 NGF NGF NGF 13 1.2 with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 100 ng/ml) ng ml plus DETA-NONOate (10 10 micro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49271 17634371 61707 14373 7808 NGF NGF NGF 22 1.2 ng/ml) ng ml plus DETA-NONOate (10 10 micro M (NGF+NO) NGF NO in the presence of vehicle (white white bar or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49272 17634371 61708 8240 4232 GDNF GDNF GDNF 7 1.2 The dashed lines represent the SD of GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49273 17634371 61709 8240 4232 GDNF GDNF GDNF 6 1.2 Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49274 17634371 61709 14373 7808 NGF NGF NGF 17 1.2 mean _amp_#177 SD * p _lt_ 0.05 significantly different from NGF NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49275 17634371 61711 20996 11179 SOD1 SOD1 SOD1 3 1.7 Motor neurons overexpressing SOD1 show increase susceptibility to NGF-induced apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49276 17634371 61711 14373 7808 NGF NGF NGF-induced 8 1.2 Motor neurons overexpressing SOD1 show increase susceptibility to NGF-induced apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49277 17634371 61712 20996 11179 SOD1 SOD1 SOD1 6 1.7 A Motor neurons isolated from SOD1 or nontransgenic (Non-Tg) Non-Tg E15 embryos were maintained in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49278 17634371 61712 8240 4232 GDNF GDNF GDNF 18 1.2 (Non-Tg) Non-Tg E15 embryos were maintained in the presence of GDNF (1 1 ng/ml) ng ml and exposed to increasing concentrations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49279 17634371 61712 14373 7808 NGF NGF NGF 27 1.2 1 ng/ml) ng ml and exposed to increasing concentrations of NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49280 17634371 61713 14373 7808 NGF NGF NGF 11 1.2 gray bars represent motor neuron survival in cultures exposed to NGF (100 100 ng/ml) ng ml in the presence of DETA-NONOate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49281 17634371 61714 8240 4232 GDNF GDNF GDNF 8 1.2 Data are expressed as percentage of its respective GDNF condition (mean mean _amp_#177 SD * p _lt_ 0.05 significantly 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49282 17634371 61714 8240 4232 GDNF GDNF GDNF 20 1.2 mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49283 17634371 61715 20996 11179 SOD1 SOD1 SOD1 2 1.7 B SOD1 transgenic motor neurons were exposed to NGF in the presence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49284 17634371 61715 14373 7808 NGF NGF NGF 9 1.2 B SOD1 transgenic motor neurons were exposed to NGF in the presence of vehicle GW4869 (100 100 n M 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49285 17634371 61716 8240 4232 GDNF GDNF GDNF 7 1.2 The dashed lines represent the SD of GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49286 17634371 61717 8240 4232 GDNF GDNF GDNF 6 1.2 Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49287 17634371 61717 14373 7808 NGF NGF NGF 17 1.2 mean _amp_#177 SD * p _lt_ 0.05 significantly different from NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49288 17634371 61718 20996 11179 SOD1 SOD1 SOD1 9 1.7 C Fluorescence microphotographs showing cytochrome c immunoreactivity in SOD1 motor neurons maintained with GDNF and exposed to vehicle (control) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49289 17634371 61718 8240 4232 GDNF GDNF GDNF 14 1.2 showing cytochrome c immunoreactivity in SOD1 motor neurons maintained with GDNF and exposed to vehicle (control) control or NGF (100 100 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49290 17634371 61718 14373 7808 NGF NGF NGF 21 1.2 maintained with GDNF and exposed to vehicle (control) control or NGF (100 100 ng/ml) ng ml 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49291 17634371 61719 14373 7808 NGF NGF NGF 4 1.2 In the absence of NGF motor neurons showed a punctuate labeling of cytochrome c and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49292 17634371 61719 14373 7808 NGF NGF NGF 21 1.2 labeling of cytochrome c and 12 h after treatment with NGF a diffuse labeling was observed in affected motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49293 17634371 61720 20996 11179 SOD1 SOD1 SOD1 15 1.7 the fluorescence emission of mito-HE ( exc 405 nm in SOD1 motor neurons immediately after NGF addition ( t = 0 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49294 17634371 61720 14373 7808 NGF NGF NGF 20 1.2 ( exc 405 nm in SOD1 motor neurons immediately after NGF addition ( t = 0 min and 40 min later 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49295 17634371 61722 20996 11179 SOD1 SOD1 SOD1 2 1.7 E SOD1 transgenic motor neurons were exposed to NGF in the presence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49296 17634371 61722 14373 7808 NGF NGF NGF 9 1.2 E SOD1 transgenic motor neurons were exposed to NGF in the presence of vehicle mitoQ (10 10 p M 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49298 17634371 61724 8240 4232 GDNF GDNF GDNF 7 1.2 The dashed lines represent the SD of GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49299 17634371 61725 8240 4232 GDNF GDNF GDNF 6 1.2 Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49300 17634371 61725 14373 7808 NGF NGF NGF 17 1.2 mean _amp_#177 SD * p _lt_ 0.05 significantly different from NGF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49301 17634371 61726 20996 11179 SOD1 SOD1 SOD1 10 1.7 F Western blot showing the expression of human mutant SOD1 (hSOD1) hSOD1 in the spinal cord and isolated motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49302 17634371 61726 20996 11179 SOD1 SOD1 hSOD1 11 1.7 Western blot showing the expression of human mutant SOD1 (hSOD1) hSOD1 in the spinal cord and isolated motor neurons from transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49304 17634371 61727 20996 11179 SOD1 SOD1 SOD1 4 1.7 Only the endogenous rat SOD1 (rSOD1) rSOD1 was detected in either the spinal cord or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49305 17634371 61729 20996 11179 SOD1 SOD1 SOD1 4 1.7 Reduced antioxidant defenses in SOD1 motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49306 17634371 61730 20996 11179 SOD1 SOD1 SOD1 0 1.7 SOD1 and nontransgenic (Non-Tg) Non-Tg motor neuron cultures were maintained with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49307 17634371 61730 8240 4232 GDNF GDNF GDNF 10 1.2 and nontransgenic (Non-Tg) Non-Tg motor neuron cultures were maintained with GDNF (1 1 ng/ml) ng ml for 24 h and the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49308 17634371 61730 14345 7782 NFE2L2 NRF2 Nrf2 21 3.1 ng ml for 24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49309 17634371 61730 8204 4311 GCLC GCLC GCLC 22 2.5 ml for 24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49310 17634371 61730 8205 4312 GCLM GCLM GCLM 24 3.0 24 h and the expression level of Nrf2 GCLC and GCLM mRNA was determined by relative quantitative RT-PCR as described in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49311 17634371 61732 14373 7808 NGF NGF NGF-induced 3 1.2 Glutathione levels modulate NGF-induced motor neuron apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49312 17634371 61733 14373 7808 NGF NGF NGF 23 1.2 10 n M and 24 h later were exposed to NGF (100 100 ng/ml) ng ml 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49313 17634371 61734 14373 7808 NGF NGF NGF 8 1.2 Motor neuron survival was determined 48 h after NGF treatment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49314 17634371 61735 14373 7808 NGF NGF NGF 0 1.2 NGF did not affect motor neuron survival in cultures preincubated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49315 17634371 61738 8240 4232 GDNF GDNF GDNF 6 1.2 Data are expressed as percentage of GDNF (mean mean _amp_#177 SD *p _lt_ 0.05 significantly different from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49316 17634371 61738 8240 4232 GDNF GDNF GDNF 16 1.2 (mean mean _amp_#177 SD *p _lt_ 0.05 significantly different from GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49317 17634371 61739 8240 4232 GDNF GDNF GDNF 11 1.2 top panel shows monochlorobimane fluorescence emission from cultures maintained with GDNF (1 1 ng/ml) ng ml and treated for 24 h 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49318 17634371 61740 14373 7808 NGF NGF NGF 37 1.2 vehicle (control) control tBHQ prevented motor neuron death induced by NGF (100 100 ng/ml) ng ml plus DETA-NONOate (10 10 micro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49319 17634371 61740 14373 7808 NGF NGF NGF 46 1.2 100 ng/ml) ng ml plus DETA-NONOate (10 10 micro M NGF NO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49320 17634371 61741 8240 4232 GDNF GDNF GDNF 6 1.2 Data are expressed as percentage of GDNF (mean mean _amp_#177 SD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49321 17634371 61742 8240 4232 GDNF GDNF GDNF 15 1.2 SD of NONE * p _lt_ 0.05 significantly different from GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49322 17634371 61744 14345 7782 NFE2L2 NRF2 Nrf2 1 3.1 Increased Nrf2 activation prevents SOD1 motor neuron death induced by NGF or 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49323 17634371 61744 20996 11179 SOD1 SOD1 SOD1 4 1.7 Increased Nrf2 activation prevents SOD1 motor neuron death induced by NGF or sFasL 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49324 17634371 61744 14373 7808 NGF NGF NGF 10 1.2 Increased Nrf2 activation prevents SOD1 motor neuron death induced by NGF or sFasL 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49325 17634371 61745 20996 11179 SOD1 SOD1 SOD1 2 1.7 A SOD1 motor neuron cultures maintained with GDNF (1 1 ng/ml) ng 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49326 17634371 61745 8240 4232 GDNF GDNF GDNF 8 1.2 A SOD1 motor neuron cultures maintained with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49327 17634371 61745 14373 7808 NGF NGF NGF 14 1.2 with GDNF (1 1 ng/ml) ng ml were exposed to NGF (100 100 ng/ml) ng ml in the presence of vehicle 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49328 17634371 61748 8240 4232 GDNF GDNF GDNF 6 1.2 Data are expressed as percentage of GDNF (mean mean _amp_#177 SD * p _lt_ 0.05 significantly different 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49329 17634371 61748 8240 4232 GDNF GDNF GDNF 17 1.2 mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49330 17634371 61749 20996 11179 SOD1 SOD1 SOD1 2 1.7 B SOD1 or nontransgenic (Non-Tg) Non-Tg motor neuron cultures were maintained in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49331 17634371 61749 8240 4232 GDNF GDNF GDNF 15 1.2 Non-Tg motor neuron cultures were maintained in the presence of GDNF (1 1 ng/ml) ng ml and exposed to increasing concentrations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49332 17634371 61750 8240 4232 GDNF GDNF GDNF 8 1.2 Data are expressed as percentage of its respective GDNF condition (mean mean _amp_#177 SD * p _lt_ 0.05 significantly 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49333 17634371 61750 8240 4232 GDNF GDNF GDNF 20 1.2 mean _amp_#177 SD * p _lt_ 0.05 significantly different from GDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49334 17634371 61751 20486 11121 SMPD2 nSMase nSMase 4 1.9 Immunofluorescence studies revealed that nSMase activation was followed by cytochrome c release from mitochondria ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49335 17634371 61752 14373 7808 NGF NGF NGF 4 1.2 In the absence of NGF motor neurons showed a punctate pattern of cytochrome c immunoreactivity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49336 17634371 61753 14373 7808 NGF NGF NGF 0 1.2 NGF (100 100 ng/ml) ng ml or DETA-NONOate (10 10 micro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49337 17634371 61754 14373 7808 NGF NGF NGF 6 1.2 In contrast after 12 h of NGF treatment in the presence of DETA-NONOate ~27% of motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49338 17634371 61755 14373 7808 NGF NGF NGF 5 1.2 Cytochrome c release induced by NGF in the presence of nitric oxide was prevented by the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49339 17634371 61755 20486 11121 SMPD2 nSMase nSMase 19 1.9 of nitric oxide was prevented by the addition of the nSMase inhibitor GW4869 ( Fig 1 C indicating that cytochrome c 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49342 17634371 61757 14373 7808 NGF NGF NGF-mediated 12 1.2 tested for the potential involvement of mitochondrial ROS production in NGF-mediated motor neuron death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49344 17634371 61762 14373 7808 NGF NGF NGF 0 1.2 NGF (100 100 ng/ml) ng ml treatment induced a 1.7 _amp_#177 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49345 17634371 61763 22562 11917 TNFRSF1B p75 p75 11 2.1 increase in mito-HE fluorescence emission was prevented by downregulation of p75 expression by antisense treatment or preincubation of motor neurons with 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49346 17634371 61763 20486 11121 SMPD2 nSMase nSMase 23 1.9 by antisense treatment or preincubation of motor neurons with the nSMase inhibitor GW4869 (100 100 n M ( Fig 2 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49347 17634371 61763 22562 11917 TNFRSF1B p75 p75 42 2.1 Fig 2 A suggesting that increased production by mitochondria follows p75 and nSMase activation 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49348 17634371 61763 20486 11121 SMPD2 nSMase nSMase 44 1.9 A suggesting that increased production by mitochondria follows p75 and nSMase activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49349 17634371 61764 14373 7808 NGF NGF NGF-induced 25 1.2 Kelso et al. 2001 Dhanasekaran et al. 2005 also blocked NGF-induced motor neuron death ( Fig 2 B strengthening the role 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49350 17634371 61764 22562 11917 TNFRSF1B p75 p75 43 2.1 B strengthening the role of ROS production by mitochondria in p75 -mediated motor neuron apoptosis 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49352 17634371 61765 20996 11179 SOD1 SOD1 SOD1 6 1.7 In contrast to nontransgenic motor neurons SOD1 -expressing motor neurons were sensitive to NGF-induced apoptosis in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49353 17634371 61765 14373 7808 NGF NGF NGF-induced 13 1.2 nontransgenic motor neurons SOD1 -expressing motor neurons were sensitive to NGF-induced apoptosis in the absence of the nitric oxide donor DETA-NONOate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49354 17634371 61765 14373 7808 NGF NGF NGF 30 1.2 donor DETA-NONOate even at concentrations of 10 ng/ml ng ml NGF ( Fig 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49355 17634371 61766 20996 11179 SOD1 SOD1 SOD1 3 1.7 The expression of SOD1 in transgenic motor neurons under our culture conditions was confirmed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49356 17634371 61766 20996 11179 SOD1 SOD1 SOD1 27 1.7 and found to be significantly higher than the endogenous rat SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49357 17634371 61767 14373 7808 NGF NGF NGF-induced 16 1.2 10 micro M which renders nontransgenic motor neurons sensitive to NGF-induced apoptosis did not further decrease the survival of SOD1 -expressing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49358 17634371 61767 20996 11179 SOD1 SOD1 SOD1 25 1.7 to NGF-induced apoptosis did not further decrease the survival of SOD1 -expressing motor neurons ( Fig 3 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49359 17634371 61768 14373 7808 NGF NGF NGF-induced 0 1.2 NGF-induced apoptosis in SOD1 -expressing motor neurons was prevented by blocking 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49360 17634371 61768 20996 11179 SOD1 SOD1 SOD1 3 1.7 NGF-induced apoptosis in SOD1 -expressing motor neurons was prevented by blocking antibodies to p75 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49361 17634371 61768 22562 11917 TNFRSF1B p75 p75 13 2.1 SOD1 -expressing motor neurons was prevented by blocking antibodies to p75 (93 93 _amp_#177 6% of control 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49362 17634371 61769 22562 11917 TNFRSF1B p75 p75 4 2.1 The effectiveness of the p75 blocking antibodies to prevent signaling through p75 in motor neuron 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49363 17634371 61769 22562 11917 TNFRSF1B p75 p75 11 2.1 effectiveness of the p75 blocking antibodies to prevent signaling through p75 in motor neuron cultures has been previously established (Pehar Pehar 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49364 17634371 61770 22562 11917 TNFRSF1B p75 p75 1 2.1 Moreover p75 -mediated apoptosis in SOD1 motor neurons was prevented by nSMase 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49365 17634371 61770 20996 11179 SOD1 SOD1 SOD1 5 1.7 Moreover p75 -mediated apoptosis in SOD1 motor neurons was prevented by nSMase inhibitors ( Fig 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49366 17634371 61770 20486 11121 SMPD2 nSMase nSMase 11 1.9 p75 -mediated apoptosis in SOD1 motor neurons was prevented by nSMase inhibitors ( Fig 3 B and involved mitochondrial production and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49367 17634371 61771 14373 7808 NGF NGF NGF-induced 18 1.2 p M and mitoCP (1 1 n M also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49368 17634371 61771 20996 11179 SOD1 SOD1 SOD1 21 1.7 mitoCP (1 1 n M also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49369 17634371 61772 14373 7808 NGF NGF NGF 11 1.2 an exogenous source of nitric oxide is not required for NGF to induce SOD1 motor neuron death N -nitro-L -arginine methyl 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49370 17634371 61772 20996 11179 SOD1 SOD1 SOD1 14 1.7 of nitric oxide is not required for NGF to induce SOD1 motor neuron death N -nitro-L -arginine methyl ester (NAME) NAME 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49371 17634371 61772 14533 7872 NOS1 NOS NOS 34 2.7 (1 1 m M a general nitric oxide synthase (NOS) NOS inhibitor and 1-(2-trifluoromethylphenyl)imidazole 1- 2-trifluoromethylphenyl imidazole (TRIM) TRIM (10 10 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000594372057189296<>ScoreDetail__7873|NOS2A|0.000542681145488186__7872|NOS1|0.000594372057189296__ 0 0 0 0 0 49373 17634371 61772 14533 7872 NOS1 NOS NOS 51 2.7 micro M a specific inhibitor of the neuronal isoform of NOS prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 1 JUMiner_v2.2 1 0 0 2 7872 TotalCon:2<>7872|NOS1|4842|Complete__7873|NOS2A|4843|Complete__<>AvaiableGeneRif=2<>BEST:7872|NOS1|0.000594372057189296<>ScoreDetail__7873|NOS2A|0.000542681145488186__7872|NOS1|0.000594372057189296__ 0 0 0 0 0 49374 17634371 61772 14373 7808 NGF NGF NGF-induced 53 1.2 a specific inhibitor of the neuronal isoform of NOS prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49375 17634371 61772 20996 11179 SOD1 SOD1 SOD1 56 1.7 of the neuronal isoform of NOS prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 3 E 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49376 17634371 61773 14373 7808 NGF NGF NGF 9 1.2 These results indicate that the apoptotic pathway induced by NGF in SOD1 motor neurons required endogenous nitric oxide production by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49377 17634371 61773 20996 11179 SOD1 SOD1 SOD1 11 1.7 results indicate that the apoptotic pathway induced by NGF in SOD1 motor neurons required endogenous nitric oxide production by nNOS activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49378 17634371 61773 14533 7872 NOS1 nNOS nNOS 20 3.7 in SOD1 motor neurons required endogenous nitric oxide production by nNOS activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49379 17634371 61774 20996 11179 SOD1 SOD1 SOD1 4 1.7 The increased sensitivity of SOD1 motor neurons to NGF could not be explained by differential 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49380 17634371 61774 14373 7808 NGF NGF NGF 8 1.2 The increased sensitivity of SOD1 motor neurons to NGF could not be explained by differential expression of p75 or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49381 17634371 61774 22562 11917 TNFRSF1B p75 p75 17 2.1 to NGF could not be explained by differential expression of p75 or nNOS 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49382 17634371 61774 14533 7872 NOS1 nNOS nNOS 19 3.7 could not be explained by differential expression of p75 or nNOS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49383 17634371 61775 22562 11917 TNFRSF1B p75 p75 6 2.1 No significant difference was observed in p75 and nNOS mRNA expression levels between nontransgenic and SOD1 motor 1 JUMiner_v2.2 1 0 0 2 11917 TotalCon:4<>9527|PSIP1|11168|Complete__11917|TNFRSF1B|7133|Complete__2557|CUX1|1523|Complete__10876|SIGLEC7|27036|Complete__<>AvaiableGeneRif=4<>BEST:11917|TNFRSF1B|0.000518448422006252<>ScoreDetail__9527|PSIP1|0.000404865105671193__2557|CUX1|0.000483424676559512__10876|SIGLEC7|0.000320875225376646__11917|TNFRSF1B|0.000518448422006252__ 0 0 0 0 0 49384 17634371 61775 14533 7872 NOS1 nNOS nNOS 8 3.7 No significant difference was observed in p75 and nNOS mRNA expression levels between nontransgenic and SOD1 motor neurons as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49385 17634371 61775 20996 11179 SOD1 SOD1 SOD1 15 1.7 in p75 and nNOS mRNA expression levels between nontransgenic and SOD1 motor neurons as determined by RT-PCR (data data not shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49386 17634371 61776 14345 7782 NFE2L2 NRF2 Nrf2 11 3.1 a ~30% decrease in the expression of the transcription factor Nrf2 was observed in SOD1 motor neurons compared with nontransgenic ones 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49387 17634371 61776 20996 11179 SOD1 SOD1 SOD1 15 1.7 the expression of the transcription factor Nrf2 was observed in SOD1 motor neurons compared with nontransgenic ones ( Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49388 17634371 61777 14345 7782 NFE2L2 NRF2 Nrf2 3 3.1 The decrease in Nrf2 expression correlated with a decrease in the expression of Nrf2 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49389 17634371 61777 14345 7782 NFE2L2 NRF2 Nrf2 13 3.1 Nrf2 expression correlated with a decrease in the expression of Nrf2 regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49390 17634371 61777 8204 4311 GCLC GCLC GCLC 23 2.5 regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) GSH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49391 17634371 61777 8205 4312 GCLM GCLM GCLM 25 3.0 including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) GSH biosynthesis ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49392 17634371 61777 8205 4312 GCLM GCL GCL 22 0.2 Nrf2 regulated genes including both subunits of glutamate-cysteine ligase (GCL), GCL GCLC and GCLM the rate-limiting enzyme in reduced glutathione (GSH) 5 JUMiner_v2.2 1 1 UserEdit 0 2 23843 TotalCon:3<>15990|GCA|25801|Complete__19717|GMCL1L|64396|No_GeneRif__23843|GMCL1|64395|Complete__<>AvaiableGeneRif=2<>BEST:23843|GMCL1|0.000291833863150763<>ScoreDetail__23843|GMCL1|0.000291833863150763__15990|GCA|0.000132177999706271__ 1 1 8190 15990 GCA 0 49393 17634371 61778 14373 7808 NGF NGF NGF 22 1.2 n M increased the sensitivity of nontransgenic motor neurons to NGF ( Fig 5 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49394 17634371 61779 14373 7808 NGF NGF NGF-induced 10 1.2 Nontransgenic motor neurons previously exposed to BSO were sensitive to NGF-induced apoptosis even in the absence of DETA-NONOate ( Fig 5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49395 17634371 61781 14345 7782 NFE2L2 NRF2 Nrf2 7 3.1 In contrast tBHQ treatment a well known Nrf2 activator in neurons (Johnson Johnson et al. 2002 completely prevented 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49396 17634371 61781 14373 7808 NGF NGF NGF 23 1.2 et al. 2002 completely prevented motor neuron death induced by NGF in the presence of NO ( Fig 5 B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49397 17634371 61783 14345 7782 NFE2L2 NRF2 Nrf2 0 3.1 Nrf2 activation by tBHQ also prevented NGF-induced apoptosis in SOD1 motor 2 JUMiner_v2.2 1 0 0 2 7782 TotalCon:2<>7782|NFE2L2|4780|Complete__4071|GABPA|2551|Complete__<>AvaiableGeneRif=2<>BEST:7782|NFE2L2|0.001000235349494<>ScoreDetail__7782|NFE2L2|0.001000235349494__4071|GABPA|0.000634380736421553__ 0 0 0 0 0 49398 17634371 61783 14373 7808 NGF NGF NGF-induced 6 1.2 Nrf2 activation by tBHQ also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 6 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49399 17634371 61783 20996 11179 SOD1 SOD1 SOD1 9 1.7 Nrf2 activation by tBHQ also prevented NGF-induced apoptosis in SOD1 motor neurons ( Fig 6 A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49400 17634371 61784 7333 11920 FAS FAS Fas 26 0.3 we analyzed the effect of tBHQ on apoptosis induced by Fas ligand in SOD1 -expressing motor neurons 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49401 17634371 61784 20996 11179 SOD1 SOD1 SOD1 29 1.7 effect of tBHQ on apoptosis induced by Fas ligand in SOD1 -expressing motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49402 17634371 61785 20996 11179 SOD1 SOD1 SOD1 1 1.7 Rat SOD1 motor neurons also displayed increased sensitivity to Fas-mediated apoptosis ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49403 17634371 61787 7333 11920 FAS FAS Fas 5 0.3 The soluble extracellular domain of Fas ligand (sFasL) sFasL in the presence of an enhancer antibody 2 JUMiner_v2.2 1 0 0 2 11920 TotalCon:2<>11920|FAS|355|Complete__3594|FASN|2194|Complete__<>AvaiableGeneRif=2<>BEST:11920|FAS|0.000840215821746618<>ScoreDetail__11920|FAS|0.000840215821746618__3594|FASN|0.000403033744916279__ 0 0 0 0 0 49404 17634371 61788 20996 11179 SOD1 SOD1 SOD1 13 1.7 of motor neuron survival induced by sFasL was higher in SOD1 cultures than in nontransgenic reaching a plateau at concentrations >0.5 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 51657 17678953 64378 16327 14180 PDIA2 PDI PDI 8 1.5 One such molecule affected is protein disulfide isomerase (PDI), PDI an enzyme responsible for normal protein folding in the endoplasmic 1 JUMiner_v2.2 1 0 0 2 8548 TotalCon:3<>8548|P4HB|5034|Complete__18367|PADI1|29943|Complete__14180|PDIA2|64714|Complete__<>AvaiableGeneRif=3<>BEST:8548|P4HB|0.00148003894839338<>ScoreDetail__14180|PDIA2|0.000527065527065527__18367|PADI1|0.000269230769230769__8548|P4HB|0.00148003894839338__ 0 0 0 0 0 51658 17678953 64379 16327 14180 PDIA2 PDI PDI 4 1.5 We found that when PDI is S-nitrosylation (forming forming SNO-PDI the function of the enzyme 1 JUMiner_v2.2 1 0 0 2 8548 TotalCon:3<>8548|P4HB|5034|Complete__18367|PADI1|29943|Complete__14180|PDIA2|64714|Complete__<>AvaiableGeneRif=3<>BEST:8548|P4HB|0.00148003894839338<>ScoreDetail__14180|PDIA2|0.000527065527065527__18367|PADI1|0.000269230769230769__8548|P4HB|0.00148003894839338__ 0 0 0 0 0 51660 17678953 64395 16327 14180 PDIA2 PDI PDI 6 1.5 In this case in contrast to PDI or parkin S-nitrosylation proves to be neuroprotective by decreasing excessive 1 JUMiner_v2.2 1 0 0 2 8548 TotalCon:3<>8548|P4HB|5034|Complete__18367|PADI1|29943|Complete__14180|PDIA2|64714|Complete__<>AvaiableGeneRif=3<>BEST:8548|P4HB|0.00148003894839338<>ScoreDetail__14180|PDIA2|0.000527065527065527__18367|PADI1|0.000269230769230769__8548|P4HB|0.00148003894839338__ 0 0 0 0 0 40659 17719032 50702 20017 10940 SLC1A2 GLT-1 GLT-1 9 1.0 In wild-type animals immunoreactivity for the astrocytic glutamate transporter GLT-1 was particularly strong around ventral horn MNs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40660 17719032 50703 20017 10940 SLC1A2 GLT-1 GLT-1 7 1.0 However a marked loss of ventral horn GLT-1 was observed along with substantial MN damage prior to onset 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40661 17719032 50705 20017 10940 SLC1A2 GLT-1 GLT-1 25 1.0 markedly diminished the loss of both MNs and of astrocytic GLT-1 labeling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40663 17719032 50709 20017 10940 SLC1A2 GLT-1 GLT-1 24 1.0 resulting from a selective loss of the astrocytic glutamate transporter GLT-1 suggested an excitotoxic contribution ( Rothstein et al. 1992 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40665 17719032 50713 20996 11179 SOD1 SOD1 SOD1 21 1.4 mutant forms of the enzyme Cu Zn superoxide dismutase (SOD1), SOD1 which are associated with familial ALS in humans 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40668 17719032 50714 20996 11179 SOD1 SOD1 SOD1 24 1.4 indicate that the rate of progression of MN loss in SOD1 mutant mice varies bidirectionally with the level of expression of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40670 17719032 50715 20996 11179 SOD1 SOD1 SOD1 20 1.4 in a distinct form of familial ALS not linked to SOD1 ( Lai et al. 2006 and a Ca-AMPA channel blocker 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40679 17719032 50723 20996 11179 SOD1 SOD1 SOD1 32 1.4 Ca-AMPA channel blocker 1-naphthyl acetylspermine (NAS) NAS in G93A transgenic SOD1 rats 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40680 17719032 50724 20017 10940 SLC1A2 GLT-1 GLT-1 19 1.0 loss in these animals but also slows the loss of GLT-1 glutamate transporter in ventral horn regions near MNs consistent with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40681 17719032 50727 20996 11179 SOD1 SOD1 SOD1 2 1.4 Male hemizygous SOD1 G93A transgenic rats [Tac:N:(SD)-TgN(SOD1G93A)L26H, Tac N SD -TgN SOD1G93A L26H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40682 17719032 50743 20017 10940 SLC1A2 GLT-1 GLT-1 32 1.0 1 8000 ip 1 2000 if Sternberger Monoclonals Berkeley CA GLT-1 1 1000 Chemicon Temecula CA 3-nitrotyrosine 10_amp_#xa0;_amp_#x3bc;g/ml, 10_amp_#xa0 _amp_#x3bc g 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40685 17719032 50748 20017 10940 SLC1A2 GLT-1 GLT-1 5 1.0 For examination of NT and GLT-1 labeling staining in the neuropil surrounding ventral horn MNs care 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40686 17719032 50751 20017 10940 SLC1A2 GLT-1 GLT-1 1 1.0 For GLT-1 fluorescence was measured in 5-_amp_#x3bc m zones surrounding the MNs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40687 17719032 50752 20017 10940 SLC1A2 GLT-1 GLT-1 16 1.0 from the center of a neuron a region lacking specific GLT-1 labeling was subtracted prior to normalization of values to WT 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40688 17719032 50755 20017 10940 SLC1A2 GLT-1 GLT-1 11 1.0 were from the following sources SMI-32 Sternberger Monoclonals Berkeley CA GLT-1 Chemicon Temecula CA 3-nitrotyrosine Upstate Biotechnology Waltham MA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40689 17719032 50759 20996 11179 SOD1 SOD1 SOD1 6 1.4 NAS slows MN loss in G93A SOD1 transgenic rats 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40690 17719032 50760 20996 11179 SOD1 SOD1 SOD1 5 1.4 As previously reported hemizygous G93A SOD1 transgenic rats generally develop symptoms between 115 and 130_amp_#xa0 days 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40693 17719032 50775 20996 11179 SOD1 SOD1 SOD1 8 1.4 Effects of NAS on glial pathology in G93A SOD1 transgenic rats 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40694 17719032 50777 20996 11179 SOD1 SOD1 SOD1 16 1.4 astrogliosis nitrotyrosine labeling and loss of astrocytic glutamate transport in SOD1 mutant rodent models of ALS ( Alexander et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40696 17719032 50777 20017 10940 SLC1A2 GLT-1 GLT-1 44 1.0 Tu et al. 1996 and a specific decrease of the GLT-1 glutamate transporter has been reported in ventral horn of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40697 17719032 50778 8254 4235 GFAP GFAP GFAP 15 2.5 we see a dramatic increase in astrogliosis as indicated by GFAP labeling most prominent initially in ventral horn and extending throughout 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40698 17719032 50779 8254 4235 GFAP GFAP GFAP-positive 16 2.5 increase in both numbers and intensity of labeling of large GFAP-positive astrocytes in Tg-S mild attenuation of this astrocytosis in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40702 17719032 50787 20017 10940 SLC1A2 GLT-1 GLT-1 9 1.0 Finally there was a marked and consistent decrease in GLT-1 staining most prominent in ventral horn 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40703 17719032 50788 20017 10940 SLC1A2 GLT-1 GLT-1 4 1.0 Notably in wild-type animals GLT-1 labeling often showed a rim of particularly strong labeling immediately 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40704 17719032 50790 20017 10940 SLC1A2 GLT-1 GLT-1 2 1.0 Quantification of GLT-1 labeling in the neuropil surrounding MNs revealed a sharp decrease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40705 17719032 50790 20017 10940 SLC1A2 GLT-1 GLT-1 14 1.0 in the neuropil surrounding MNs revealed a sharp decrease in GLT-1 labeling surrounding MNs in sham-treated transgenic animals (Tg-S) Tg-S 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40707 17719032 50791 20017 10940 SLC1A2 GLT-1 GLT-1 19 1.0 NAS on NT labeling NAS completely prevented the loss of GLT-1 labeling ( Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40708 17719032 50794 20017 10940 SLC1A2 GLT-1 GLT-1 20 1.0 Howland et al. 2002 we observe substantial loss of the GLT-1 glutamate transporter most evident in the ventral horn in close 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40709 17719032 50796 20017 10940 SLC1A2 GLT-1 GLT-1 30 1.0 preservation not only of ventral horn MNs but also of GLT-1 labeling near ventral horn MNs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40710 17719032 50797 20017 10940 SLC1A2 GLT-1 GLT-1 52 1.0 protection by NAS of MNs themselves as well as of GLT-1 levels in the adjacent astrocytes is most consistent with the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40714 17719032 50800 20017 10940 SLC1A2 GLT-1 GLT-1 6 1.0 Indeed observations that substantial loss of GLT-1 preceded much of the MN loss ( Howland et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40719 17719032 50803 20996 11179 SOD1 SOD1 SOD1 29 1.4 as MNs is well documented in both sporadic human and SOD1 linked forms of the disease ( Beal et al. 1997 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40723 17719032 50810 20996 11179 SOD1 SOD1 SOD1 3 1.4 Of note while SOD1 mutations only account for a small percentage of human ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40726 17719032 50811 20996 11179 SOD1 SOD1 SOD1 21 1.4 between MNs and glia which we suggest are unique to SOD1 linked forms of disease transporter loss and oxidative tissue damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40728 17719032 50814 20996 11179 SOD1 SOD1 SOD1 9 1.4 It has become increasingly clear that MN degeneration in SOD1 linked models of ALS is non-cell-autonomous with the genotype of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40735 17719032 50830 8254 4235 GFAP GFAP GFAP 22 2.5 transgenic rats and stained for glial fibrillary acidic protein (GFAP, GFAP green and SMI-32 (red, red A 3-nitrotyrosine (B), B or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40736 17719032 50830 20017 10940 SLC1A2 GLT-1 GLT-1 35 1.0 red A 3-nitrotyrosine (B), B or the astrocytic glutamate transporter GLT-1 (green) green along with SMI-32 (red, red C 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40737 17719032 50831 8254 4235 GFAP GFAP GFAP 13 2.5 number of reactive astrocytes near transgenic MNs indicated by strong GFAP labeling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40739 17719032 50833 20017 10940 SLC1A2 GLT-1 GLT-1 6 1.0 Finally note the rim of strong GLT-1 labeling surrounding MNs in wild-type animals and the distinct loss 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40740 17719032 50835 8254 4235 GFAP GFAP GFAP 31 2.5 30-day intrathecal infusions stained for glial fibrillary acidic protein (GFAP; GFAP 400_amp_#xd7 or for 3-nitrotyrosine (NT; NT 400_amp_#xd7 inserts 40_amp_#xd7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40741 17719032 50836 8254 4235 GFAP GFAP GFAP-positive 7 2.5 Note the marked increase in numbers of GFAP-positive reactive astrocytes in transgenic animals (Tg-S), Tg-S the modest attenuation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40744 17719032 50841 8254 4235 GFAP GFAP GFAP 8 2.5 (B) B Quantification of labeling graphs show quantification of GFAP and NT labeling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40745 17719032 50842 8254 4235 GFAP GFAP GFAP 0 2.5 GFAP labeling was quantified as the number of distinct GFAP-positive astrocytes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40746 17719032 50842 8254 4235 GFAP GFAP GFAP-positive 9 2.5 GFAP labeling was quantified as the number of distinct GFAP-positive astrocytes per high power (400_amp_#xd7;) 400_amp_#xd7 field whereas NT staining 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40747 17719032 50842 8254 4235 GFAP GFAP GFAP 32 2.5 labeling intensity in 25-_amp_#x3bc m zones surrounding each MN (GFAP GFAP counts based upon 6 independent experiments _amp_#x3e 20 fields for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40751 17719032 50843 20017 10940 SLC1A2 GLT-1 GLT-1 3 1.0 Fig 4._amp_#xa0 Loss of GLT-1 in ventral horn astrocytes of G93A rats and preservation by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40752 17719032 50844 20017 10940 SLC1A2 GLT-1 GLT-1 1 1.0 (A) A GLT-1 immunofluorescence photomicrographs show the ventral horn region of lumbar spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40753 17719032 50844 20017 10940 SLC1A2 GLT-1 GLT-1 29 1.0 (upon upon termination of the 30-day intrathecal infusions stained for GLT-1 (40, 40 400_amp_#xd7 and for SMI-32 (right, right 400_amp_#xd7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40754 17719032 50845 20017 10940 SLC1A2 GLT-1 GLT-1 3 1.0 Note the strong GLT-1 labeling surrounding MNs and throughout ventral horn MN clusters in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40756 17719032 50847 20017 10940 SLC1A2 GLT-1 GLT-1 11 1.0 show clusters of ventral horn motor neurons with strong astrocytic GLT-1 labeling arrowhead shows persistent strong GLT-1 labeling in dorsal horn 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40757 17719032 50847 20017 10940 SLC1A2 GLT-1 GLT-1 17 1.0 neurons with strong astrocytic GLT-1 labeling arrowhead shows persistent strong GLT-1 labeling in dorsal horn of untreated transgenic animals 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40758 17719032 50849 20017 10940 SLC1A2 GLT-1 GLT-1 8 1.0 (B) B Quantification of labeling graph shown quantification of GLT-1 labeling in 5-_amp_#x3bc m zones surrounding each MN (compiled compiled 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36239 17937892 44757 19981 14929 SIRT1 SIRT1 SIRT1 0 1.0 [SIRT1/PGC-1: SIRT1 PGC-1 a neuroprotective axis 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36240 17937892 44757 17035 9237 PPARGC1A PGC1 PGC-1 0 2.1 [SIRT1/PGC-1: SIRT1 PGC-1 a neuroprotective axis 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36241 17937892 44760 19981 14929 SIRT1 SIRT1 SIRT1 10 1.0 it has been recently demonstrated that activation of the SIRT1/PGC-1 SIRT1 PGC-1 pathway in a metabolic context promotes mitochondrial function we 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36242 17937892 44760 17035 9237 PPARGC1A PGC1 PGC-1 10 2.1 has been recently demonstrated that activation of the SIRT1/PGC-1 SIRT1 PGC-1 pathway in a metabolic context promotes mitochondrial function we performed 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36243 17937892 44761 17035 9237 PPARGC1A PGC1 PGC-1 5 2.1 Interestingly transgenic mice with impaired PGC-1 expression have neurodegenerative lesions and show behavioural abnormalities 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36244 17937892 44762 19981 14929 SIRT1 SIRT1 SIRT1 6 1.0 As evidenced from independent investigations enhanced SIRT1 activity has been demonstrated to protect against axonal degeneration and 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36245 17937892 44762 926 620 APP amyloid amyloid 22 1.3 protect against axonal degeneration and to decrease the accumulation of amyloid beta peptides the hallmark of Alzheimer disease in cultured murine 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 36246 17937892 44763 19981 14929 SIRT1 SIRT1 SIRT1 11 1.0 addition several studies suggest that resveratrol a specific activator of SIRT1 could have protective effects in animal models of neurodegenerative diseases 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36247 17937892 44764 19981 14929 SIRT1 SIRT1 SIRT1 11 1.0 these results strongly suggest that the modulation of the SIRT1/PGC-1 SIRT1 PGC-1 pathway which has not been well documented in the 3 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 36248 17937892 44764 17035 9237 PPARGC1A PGC1 PGC-1 11 2.1 results strongly suggest that the modulation of the SIRT1/PGC-1 SIRT1 PGC-1 pathway which has not been well documented in the central 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37307 17956327 46615 1624 1033 BDNF BDNF BDNF 5 4.2 New synthesis and release of BDNF (brain-derived brain-derived neurotrophic factor is necessary and sufficient for pLTF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37308 17956327 46616 1624 1033 BDNF BDNF BDNF 2 4.2 AIH increases BDNF protein levels near phrenic motor neurons and this increase correlates 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37309 17956327 46617 1624 1033 BDNF BDNF BDNF 4 4.2 The 5-HT-dependent increase in BDNF synthesis following AIH is necessary for pLTF expression since translational 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37310 17956327 46617 1624 1033 BDNF BDNF BDNF 17 4.2 AIH is necessary for pLTF expression since translational inhibition of BDNF mRNA with siRNAs (small small interfering RNAs blocks both increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37311 17956327 46617 1624 1033 BDNF BDNF BDNF 27 4.2 mRNA with siRNAs (small small interfering RNAs blocks both increased BDNF protein levels and pLTF receptor tyrosine kinase inhibitors also block 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37312 17956327 46618 1624 1033 BDNF BDNF BDNF 0 4.2 BDNF is sufficient to elicit pLTF since localized application of BDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37313 17956327 46618 1624 1033 BDNF BDNF BDNF 10 4.2 BDNF is sufficient to elicit pLTF since localized application of BDNF protein near phrenic motor neurons elicits long-lasting phrenic motor facilitation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37314 17956327 46620 1624 1033 BDNF BDNF BDNF 10 4.2 (protein protein kinase C activation stimulating new protein synthesis including BDNF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37315 17956327 46621 1624 1033 BDNF BDNF BDNF 1 4.2 Released BDNF then activates its high-affinity receptor TrkB (tropomyosin tropomyosin receptor kinase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37316 17956327 46621 14739 8032 NTRK2 TRKB TrkB 7 1.9 Released BDNF then activates its high-affinity receptor TrkB (tropomyosin tropomyosin receptor kinase B resulting in the phosphorylation of 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37317 17956327 46621 12337 6871 MAPK1 ERK ERK 17 0.9 (tropomyosin tropomyosin receptor kinase B resulting in the phosphorylation of ERK (extracellular-signal-regulated extracellular-signal-regulated kinase MAPKs (mitogen-activated mitogen-activated protein kinases and Akt 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000960571983559348<>ScoreDetail__3393|EPHB2|0.000539444221768835__6871|MAPK1|0.000960571983559348__ 0 0 0 0 0 37318 17956327 46621 12337 6871 MAPK1 MAPK MAPKs 20 0.9 B resulting in the phosphorylation of ERK (extracellular-signal-regulated extracellular-signal-regulated kinase MAPKs (mitogen-activated mitogen-activated protein kinases and Akt also called PKB (protein 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37319 17956327 46621 543 391 AKT1 AKT Akt 25 0.8 ERK (extracellular-signal-regulated extracellular-signal-regulated kinase MAPKs (mitogen-activated mitogen-activated protein kinases and Akt also called PKB (protein protein kinase B 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37320 17956327 46621 543 391 AKT1 PKB PKB 28 0.8 kinase MAPKs (mitogen-activated mitogen-activated protein kinases and Akt also called PKB (protein protein kinase B 1 JUMiner_v2.2 1 0 0 2 9612 TotalCon:2<>391|AKT1|207|Complete__9612|PTK2B|2185|Complete__<>AvaiableGeneRif=2<>BEST:9612|PTK2B|0.000805308234644594<>ScoreDetail__391|AKT1|0.00079879496229174__9612|PTK2B|0.000805308234644594__ 0 0 0 0 0 37328 17956327 46641 12337 6871 MAPK1 ERK ERK 17 0.9 phosphatases that may play a role in neural plasticity including ERK and the serine/threonine serine threonine protein phosphatases 1 2A and 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000960571983559348<>ScoreDetail__3393|EPHB2|0.000539444221768835__6871|MAPK1|0.000960571983559348__ 0 0 0 0 0 37329 17956327 46643 12337 6871 MAPK1 ERK ERK 22 0.9 is necessary for pLTF 42 and activated forms of both ERK and PKB (Akt) Akt are increased in the ventral cervical 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000960571983559348<>ScoreDetail__3393|EPHB2|0.000539444221768835__6871|MAPK1|0.000960571983559348__ 0 0 0 0 0 37330 17956327 46643 543 391 AKT1 PKB PKB 24 0.8 for pLTF 42 and activated forms of both ERK and PKB (Akt) Akt are increased in the ventral cervical spinal cord 1 JUMiner_v2.2 1 0 0 2 9612 TotalCon:2<>391|AKT1|207|Complete__9612|PTK2B|2185|Complete__<>AvaiableGeneRif=2<>BEST:9612|PTK2B|0.000805308234644594<>ScoreDetail__391|AKT1|0.00079879496229174__9612|PTK2B|0.000805308234644594__ 0 0 0 0 0 37331 17956327 46643 543 391 AKT1 AKT Akt 25 0.8 42 and activated forms of both ERK and PKB (Akt) Akt are increased in the ventral cervical spinal cord following intermittent 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37337 17956327 46654 20996 11179 SOD1 SOD SOD 0 0.9 SOD (superoxide superoxide dismutase prevent excessive ROS accumulation 46 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37344 17956327 46658 20996 11179 SOD1 SOD SOD 9 0.9 AIH-induced pLTF also requires ROS since pre-treatment with a SOD mimetic abolishes pLTF 23 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37345 17956327 46659 20996 11179 SOD1 SOD SOD 16 0.9 following AIH although changes in superoxide anion levels (e.g e.g SOD mimetic can disrupt levels of other ROS species such as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37357 17956327 46674 20996 11179 SOD1 SOD SOD 28 0.9 with okadaic acid restores pLTF in animals pre-treated with a SOD mimetic (P.M P.M MacFarlane and G.S Mitchell unpublished work but 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37362 17956327 46685 1624 1033 BDNF BDNF BDNF 5 4.2 Key words brain-derived neurotrophic factor (BDNF), BDNF 5-hydroxytryptamine (5-HT), 5-HT long-term facilitation pattern-sensitivity phosphorylation plasticity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37363 17956327 46686 1624 1033 BDNF BDNF BDNF 6 4.2 Abbreviations used AIH acute intermittent hypoxia BDNF brain-derived neurotrophic factor ERK extracellular-signal-regulated kinase 5-HT 5-hydroxytryptamine LTF long-term 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37364 17956327 46686 12337 6871 MAPK1 ERK ERK 10 0.9 Abbreviations used AIH acute intermittent hypoxia BDNF brain-derived neurotrophic factor ERK extracellular-signal-regulated kinase 5-HT 5-hydroxytryptamine LTF long-term facilitation pLTF phrenic LTF 1 JUMiner_v2.2 1 0 0 2 6871 TotalCon:2<>3393|EPHB2|2048|Complete__6871|MAPK1|5594|Complete__<>AvaiableGeneRif=2<>BEST:6871|MAPK1|0.000960571983559348<>ScoreDetail__3393|EPHB2|0.000539444221768835__6871|MAPK1|0.000960571983559348__ 0 0 0 0 0 37365 17956327 46686 543 391 AKT1 PKB PKB 25 0.8 LTF long-term facilitation pLTF phrenic LTF PKA protein kinase A PKB protein kinase B PKC protein kinase C ROS reactive oxygen 1 JUMiner_v2.2 1 0 0 2 9612 TotalCon:2<>391|AKT1|207|Complete__9612|PTK2B|2185|Complete__<>AvaiableGeneRif=2<>BEST:9612|PTK2B|0.000805308234644594<>ScoreDetail__391|AKT1|0.00079879496229174__9612|PTK2B|0.000805308234644594__ 0 0 0 0 0 37367 17956327 46686 20996 11179 SOD1 SOD SOD 37 0.9 kinase B PKC protein kinase C ROS reactive oxygen species SOD superoxide dismutase TrkB tropomyosin receptor kinase B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37368 17956327 46686 14739 8032 NTRK2 TRKB TrkB 40 1.9 protein kinase C ROS reactive oxygen species SOD superoxide dismutase TrkB tropomyosin receptor kinase B 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 39544 17987632 49319 20996 11179 SOD1 SOD1 SOD1 7 1.9 In AD and PD patients superoxide dismutase (SOD1) SOD1 was also indicated as a major target of oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 39545 17987632 49320 20996 11179 SOD1 SOD1 SOD1 9 1.9 In particular in brain tissue of these patients different SOD1 isoforms have been identified although their functional role still remains 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 39546 17987632 49321 20996 11179 SOD1 SOD1 SOD1 8 1.9 In the light of the possibility that different SOD1 entities could be expressed also in other neurodegenerative disorders as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 39548 17987632 49321 20996 11179 SOD1 SOD1 SOD1 42 1.9 sclerosis (ALS) ALS using human neuroblastoma SH-SY5Y cells with mutated SOD1 gene H46R as cellular model 2-DE using a narrow-range IPG 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 39549 17987632 49321 20996 11179 SOD1 SOD1 SOD1 70 1.9 linear 15% SDS-PAGE in the second allowed to separate different SOD1 spots 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 39550 17987632 49323 20996 11179 SOD1 SOD1 SOD1 10 1.9 This is the first report in which the presence of SOD1 (iso) iso forms in a cellular model of ALS has 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22656 18210200 26921 9038 4827 HBB hemoglobin hemoglobin 13 1.0 also been used to produce nanotubes with glucose oxidase and hemoglobin (Hou Hou et al 2005b 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22666 18210200 27077 3865 1678 CD4 CD4 CD4 30 0.6 plasma lymph nodes spleen liver and lung as well as CD4 T-cell protection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23638 18219386 28331 20996 11179 SOD1 SOD1 SOD1 5 2.5 Abstract Mutation in superoxide dismutase_amp_#x02013 1 (SOD1) SOD1 causes the inherited degenerative neurological disease familial amyotrophic lateral sclerosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23640 18219386 28331 20996 11179 SOD1 SOD1 SOD1 21 2.5 amyotrophic lateral sclerosis (ALS), ALS a non_amp_#x02013 cell-autonomous disease mutant SOD1 synthesis in motor neurons and microglia drives disease onset and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23641 18219386 28332 20996 11179 SOD1 SOD1 SOD1 12 2.5 this issue of the JCI Harraz and colleagues demonstrate that SOD1 mutants expressed in human cell lines directly stimulate NADPH oxidase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23642 18219386 28332 17864 9801 RAC1 RAC1 Rac1 27 1.0 lines directly stimulate NADPH oxidase (Nox) Nox by binding to Rac1 resulting in overproduction of damaging ROS (see see the related 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23650 18219386 28334 20996 11179 SOD1 SOD1 SOD1 16 2.5 lateral sclerosis Nox NADPH oxidase O 2 _amp_#x02022 _amp_#x02013 superoxide SOD1 superoxide dismutase_amp_#x02013 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23651 18219386 28339 5281 2578 CYBB NOX2 Nox2 7 3.5 Figure 1 Production of ROS by microglial Nox2 during inflammation is amplified by mutant SOD1 binding to Rac1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23652 18219386 28339 20996 11179 SOD1 SOD1 SOD1 14 2.5 ROS by microglial Nox2 during inflammation is amplified by mutant SOD1 binding to Rac1 in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23653 18219386 28339 17864 9801 RAC1 RAC1 Rac1 17 1.0 Nox2 during inflammation is amplified by mutant SOD1 binding to Rac1 in ALS 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23658 18219386 28342 20996 11179 SOD1 SOD1 SOD1 20 2.5 cases of disease mutations in the superoxide dismutase_amp_#x02013 1 ( SOD1 gene are the most frequently identified 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23659 18219386 28343 20996 11179 SOD1 SOD1 SOD1 0 2.5 SOD1 catalyzes the conversion of superoxide (O2 O2 _amp_#x02022 _amp_#x02013 to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23660 18219386 28344 20996 11179 SOD1 SOD1 SOD1 1 2.5 Indeed SOD1 mimetics have been reported to slow disease progression when administered 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23666 18219386 28352 20996 11179 SOD1 SOD1 SOD1 11 2.5 more compelling are data obtained by selective silencing of mutant SOD1 synthesis by microglia ( 11 or replacement of the mutant 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23667 18219386 28353 20996 11179 SOD1 SOD1 SOD1 5 2.5 Both approaches demonstrate that mutant SOD1 synthesis in inflammatory cells of the CNS directly accelerates the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23668 18219386 28356 20996 11179 SOD1 SOD1 SOD1 5 2.5 By crossing mice expressing the SOD1 G93A mutant with mice lacking a catalytic subunit of Nox 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23669 18219386 28356 14551 7889 NOX1 NOX1 Nox1 23 1.2 of Nox (through through deletion of the gene encoding either Nox1 or Nox2 an increase in survival was seen with Nox2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23670 18219386 28356 5281 2578 CYBB NOX2 Nox2 25 3.5 (through through deletion of the gene encoding either Nox1 or Nox2 an increase in survival was seen with Nox2 deletion proving 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23671 18219386 28356 5281 2578 CYBB NOX2 Nox2 33 3.5 Nox1 or Nox2 an increase in survival was seen with Nox2 deletion proving to be of greater benefit than Nox1 deletion 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23672 18219386 28356 14551 7889 NOX1 NOX1 Nox1 42 1.2 with Nox2 deletion proving to be of greater benefit than Nox1 deletion ( 14 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23673 18219386 28357 5281 2578 CYBB NOX2 Nox2 7 3.5 Consistent with progressive microglial activation during disease Nox2 expression was upregulated in SOD1 G93A mice ( 13 14 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23674 18219386 28357 20996 11179 SOD1 SOD1 SOD1 12 2.5 progressive microglial activation during disease Nox2 expression was upregulated in SOD1 G93A mice ( 13 14 and sporadic ALS patients ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23676 18219386 28360 14554 14874 NOX5 NOX5 Nox5 8 0.9 The Nox family is composed of 7 members Nox1_amp_#x02013 Nox5 Duox1 and Duox2 are distributed in a variety of tissues 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23677 18219386 28360 6192 3062 DUOX1 DUOX1 Duox1 9 0.3 The Nox family is composed of 7 members Nox1_amp_#x02013 Nox5 Duox1 and Duox2 are distributed in a variety of tissues 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23678 18219386 28360 6193 13273 DUOX2 DUOX2 DUOX2 9 0.3 The Nox family is composed of 7 members Nox1_amp_#x02013 Nox5 Duox1 and Duox2 are distributed in a variety of tissues 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23679 18219386 28360 6193 13273 DUOX2 DUOX2 Duox2 11 0.3 family is composed of 7 members Nox1_amp_#x02013 Nox5 Duox1 and Duox2 are distributed in a variety of tissues 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23680 18219386 28361 5281 2578 CYBB NOX2 Nox2 3 3.5 The Nox prototype Nox2 is the phagocytic Nox (also also known as gp91 phox 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23681 18219386 28362 5281 2578 CYBB NOX2 Nox2 0 3.5 Nox2 contains an NADPH-binding site a FAD-binding site and 4 heme-binding 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23683 18219386 28363 5281 2578 CYBB NOX2 Nox2 0 3.5 Nox2 is constitutively associated with the transmembrane Nox stabilizing protein p22 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23684 18219386 28363 5279 2577 CYBA p22 p22 10 0.8 Nox2 is constitutively associated with the transmembrane Nox stabilizing protein p22 phox and recruitment of the activating cytosolic components p47 phox 3 JUMiner_v2.2 1 1 UserEdit 0 2 30306 TotalCon:2<>2961|DYNC1H1|1778|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:30306|PHB2|0.000494580658739346<>ScoreDetail__2961|DYNC1H1|0.000100178890876565__30306|PHB2|0.000494580658739346__ 1 1 6257 2961 DYNC1H1 0 23685 18219386 28363 14167 7660 NCF1 p47 p47 20 0.6 protein p22 phox and recruitment of the activating cytosolic components p47 phox p67 phox and p40 phox are needed for function 1 JUMiner_v2.2 1 1 UserEdit 0 2 9070 TotalCon:4<>10576|CLEC11A|6320|Complete__9070|PLEK|5341|Complete__15912|NSFL1C|55968|No_GeneRif__6062|ING1|3621|Complete__<>AvaiableGeneRif=3<>BEST:9070|PLEK|0.000773036487322202<>ScoreDetail__6062|ING1|0.000355697834689431__10576|CLEC11A|0.000377928949357521__9070|PLEK|0.000773036487322202__ 1 1 14167 7660 NCF1 1 UserEdit 23686 18219386 28363 14170 7661 NCF2 p67 p67 23 0.3 phox and recruitment of the activating cytosolic components p47 phox p67 phox and p40 phox are needed for function (Figure Figure 1 JUMiner_v2.2 1 1 UserEdit 0 2 16672 TotalCon:2<>1659|CD33|945|Complete__16672|METAP2|10988|Complete__<>AvaiableGeneRif=2<>BEST:16672|METAP2|0.000921097704868116<>ScoreDetail__1659|CD33|0.000843144596524802__16672|METAP2|0.000921097704868116__ 1 1 3884 1659 CD33 0 23687 18219386 28363 14171 7662 NCF4 p40 p40 27 0.6 of the activating cytosolic components p47 phox p67 phox and p40 phox are needed for function (Figure Figure 1 1 JUMiner_v2.2 1 1 UserEdit 0 2 6871 TotalCon:9<>682|ARHGEF2|9181|Complete__15531|EBNA1BP2|10969|Complete__9565|PSMD7|5713|Complete__6029|IL9|3578|Complete__6508|LANCL1|10314|No_GeneRif__6502|RPSA|3921|Complete__6871|MAPK1|5594|Complete__16896|RABEPK|10244|Complete__15979|TP63|8626|Complete__<>AvaiableGeneRif=8<>BEST:6871|MAPK1|0.000924400182496915<>ScoreDetail__15979|TP63|0.000530775128270656__16896|RABEPK|8.94454382826476e-05__6502|RPSA|0.000463233217211185__15531|EBNA1BP2|0.000825650199532132__682|ARHGEF2|0.000879294139049756__9565|PSMD7|0.000238521168753727__6029|IL9|0.000680307640076779__6871|MAPK1|0.000924400182496915__ 1 1 1013 682 ARHGEF2 0 23688 18219386 28364 14167 7660 NCF1 p47 p47 3 0.6 Upon cell activation p47 phox is phosphorylated thereby initiating translocation of the p47 phox 1 JUMiner_v2.2 1 1 UserEdit 0 2 9070 TotalCon:4<>10576|CLEC11A|6320|Complete__9070|PLEK|5341|Complete__15912|NSFL1C|55968|No_GeneRif__6062|ING1|3621|Complete__<>AvaiableGeneRif=3<>BEST:9070|PLEK|0.000773036487322202<>ScoreDetail__6062|ING1|0.000355697834689431__10576|CLEC11A|0.000377928949357521__9070|PLEK|0.000773036487322202__ 1 1 10577 6062 ING1 0 23689 18219386 28364 14167 7660 NCF1 p47 p47 12 0.6 activation p47 phox is phosphorylated thereby initiating translocation of the p47 phox /p67 p67 phox /p40 p40 phox complex to the 1 JUMiner_v2.2 1 1 UserEdit 0 2 9070 TotalCon:4<>10576|CLEC11A|6320|Complete__9070|PLEK|5341|Complete__15912|NSFL1C|55968|No_GeneRif__6062|ING1|3621|Complete__<>AvaiableGeneRif=3<>BEST:9070|PLEK|0.000773036487322202<>ScoreDetail__6062|ING1|0.000355697834689431__10576|CLEC11A|0.000377928949357521__9070|PLEK|0.000773036487322202__ 1 1 10577 6062 ING1 0 23690 18219386 28364 14170 7661 NCF2 p67 p67 14 0.3 is phosphorylated thereby initiating translocation of the p47 phox /p67 p67 phox /p40 p40 phox complex to the membrane where phosphorylated 1 JUMiner_v2.2 1 1 UserEdit 0 2 16672 TotalCon:2<>1659|CD33|945|Complete__16672|METAP2|10988|Complete__<>AvaiableGeneRif=2<>BEST:16672|METAP2|0.000921097704868116<>ScoreDetail__1659|CD33|0.000843144596524802__16672|METAP2|0.000921097704868116__ 1 1 3884 1659 CD33 0 23691 18219386 28364 14171 7662 NCF4 p40 p40 16 0.6 initiating translocation of the p47 phox /p67 p67 phox /p40 p40 phox complex to the membrane where phosphorylated p47 phox binds 1 JUMiner_v2.2 1 1 UserEdit 0 2 6871 TotalCon:9<>682|ARHGEF2|9181|Complete__15531|EBNA1BP2|10969|Complete__9565|PSMD7|5713|Complete__6029|IL9|3578|Complete__6508|LANCL1|10314|No_GeneRif__6502|RPSA|3921|Complete__6871|MAPK1|5594|Complete__16896|RABEPK|10244|Complete__15979|TP63|8626|Complete__<>AvaiableGeneRif=8<>BEST:6871|MAPK1|0.000924400182496915<>ScoreDetail__15979|TP63|0.000530775128270656__16896|RABEPK|8.94454382826476e-05__6502|RPSA|0.000463233217211185__15531|EBNA1BP2|0.000825650199532132__682|ARHGEF2|0.000879294139049756__9565|PSMD7|0.000238521168753727__6029|IL9|0.000680307640076779__6871|MAPK1|0.000924400182496915__ 1 1 1013 682 ARHGEF2 0 23692 18219386 28364 14167 7660 NCF1 p47 p47 24 0.6 phox /p40 p40 phox complex to the membrane where phosphorylated p47 phox binds to p22 phox 1 JUMiner_v2.2 1 1 UserEdit 0 2 9070 TotalCon:4<>10576|CLEC11A|6320|Complete__9070|PLEK|5341|Complete__15912|NSFL1C|55968|No_GeneRif__6062|ING1|3621|Complete__<>AvaiableGeneRif=3<>BEST:9070|PLEK|0.000773036487322202<>ScoreDetail__6062|ING1|0.000355697834689431__10576|CLEC11A|0.000377928949357521__9070|PLEK|0.000773036487322202__ 1 1 10577 6062 ING1 0 23693 18219386 28364 5279 2577 CYBA p22 p22 28 0.8 complex to the membrane where phosphorylated p47 phox binds to p22 phox 3 JUMiner_v2.2 1 1 UserEdit 0 2 30306 TotalCon:2<>2961|DYNC1H1|1778|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:30306|PHB2|0.000494580658739346<>ScoreDetail__2961|DYNC1H1|0.000100178890876565__30306|PHB2|0.000494580658739346__ 1 1 6257 2961 DYNC1H1 0 23694 18219386 28365 18312 670 RHOD Rho Rho 9 0.3 Another level of regulation comes from members of the Rho family of small GTPases including the Rac family 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23695 18219386 28365 543 391 AKT1 RAC Rac 16 0.0 members of the Rho family of small GTPases including the Rac family 2 JUMiner_v2.2 1 1 rac; 0 0 0 0 0 0 0 0 23696 18219386 28366 543 391 AKT1 RAC Rac 3 0.0 Members of the Rac family are not strictly NADPH subunits as they regulate other 2 JUMiner_v2.2 1 1 rac; 0 0 0 0 0 0 0 0 23697 18219386 28367 14167 7660 NCF1 p47 p47 8 0.6 Rac acts to coordinate the translocation of the p47 phox /p67 p67 phox /p40 p40 phox complex and is 1 JUMiner_v2.2 1 1 UserEdit 0 2 9070 TotalCon:4<>10576|CLEC11A|6320|Complete__9070|PLEK|5341|Complete__15912|NSFL1C|55968|No_GeneRif__6062|ING1|3621|Complete__<>AvaiableGeneRif=3<>BEST:9070|PLEK|0.000773036487322202<>ScoreDetail__6062|ING1|0.000355697834689431__10576|CLEC11A|0.000377928949357521__9070|PLEK|0.000773036487322202__ 1 1 10577 6062 ING1 0 23698 18219386 28367 14170 7661 NCF2 p67 p67 10 0.3 acts to coordinate the translocation of the p47 phox /p67 p67 phox /p40 p40 phox complex and is active only when 1 JUMiner_v2.2 1 1 UserEdit 0 2 16672 TotalCon:2<>1659|CD33|945|Complete__16672|METAP2|10988|Complete__<>AvaiableGeneRif=2<>BEST:16672|METAP2|0.000921097704868116<>ScoreDetail__1659|CD33|0.000843144596524802__16672|METAP2|0.000921097704868116__ 1 1 3884 1659 CD33 0 23699 18219386 28367 14171 7662 NCF4 p40 p40 12 0.6 the translocation of the p47 phox /p67 p67 phox /p40 p40 phox complex and is active only when bound to GTP 1 JUMiner_v2.2 1 1 UserEdit 0 2 6871 TotalCon:9<>682|ARHGEF2|9181|Complete__15531|EBNA1BP2|10969|Complete__9565|PSMD7|5713|Complete__6029|IL9|3578|Complete__6508|LANCL1|10314|No_GeneRif__6502|RPSA|3921|Complete__6871|MAPK1|5594|Complete__16896|RABEPK|10244|Complete__15979|TP63|8626|Complete__<>AvaiableGeneRif=8<>BEST:6871|MAPK1|0.000924400182496915<>ScoreDetail__15979|TP63|0.000530775128270656__16896|RABEPK|8.94454382826476e-05__6502|RPSA|0.000463233217211185__15531|EBNA1BP2|0.000825650199532132__682|ARHGEF2|0.000879294139049756__9565|PSMD7|0.000238521168753727__6029|IL9|0.000680307640076779__6871|MAPK1|0.000924400182496915__ 1 1 1013 682 ARHGEF2 0 23701 18219386 28367 543 391 AKT1 RAC Rac 0 0.0 Rac acts to coordinate the translocation of the p47 phox /p67 2 JUMiner_v2.2 1 1 rac; 0 0 0 0 0 0 0 0 23704 18219386 28369 543 391 AKT1 RAC Rac 2 0.0 Inactivation of Rac is mediated via GTPase-activating proteins which stimulate the intrinsic ability 2 JUMiner_v2.2 1 1 rac; 0 0 0 0 0 0 0 0 23705 18219386 28369 543 391 AKT1 RAC Rac 14 0.0 mediated via GTPase-activating proteins which stimulate the intrinsic ability of Rac to hydrolyze GTP to GDP 2 JUMiner_v2.2 1 1 rac; 0 0 0 0 0 0 0 0 23706 18219386 28370 14551 7889 NOX1 NOX1 Nox1 11 1.2 all Nox family members require the same interacting partners but Nox1 and Nox2 are both p47 phox and Rac dependent ( 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23707 18219386 28370 5281 2578 CYBB NOX2 NOX2 11 3.5 all Nox family members require the same interacting partners but Nox1 and Nox2 are both p47 phox and Rac dependent ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23708 18219386 28370 5281 2578 CYBB NOX2 Nox2 13 3.5 family members require the same interacting partners but Nox1 and Nox2 are both p47 phox and Rac dependent ( 15 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23709 18219386 28370 14167 7660 NCF1 p47 p47 16 0.6 the same interacting partners but Nox1 and Nox2 are both p47 phox and Rac dependent ( 15 1 JUMiner_v2.2 1 1 UserEdit 0 2 9070 TotalCon:4<>10576|CLEC11A|6320|Complete__9070|PLEK|5341|Complete__15912|NSFL1C|55968|No_GeneRif__6062|ING1|3621|Complete__<>AvaiableGeneRif=3<>BEST:9070|PLEK|0.000773036487322202<>ScoreDetail__6062|ING1|0.000355697834689431__10576|CLEC11A|0.000377928949357521__9070|PLEK|0.000773036487322202__ 1 1 10577 6062 ING1 0 23710 18219386 28370 543 391 AKT1 RAC Rac 19 0.0 partners but Nox1 and Nox2 are both p47 phox and Rac dependent ( 15 2 JUMiner_v2.2 1 1 rac; 0 0 0 0 0 0 0 0 23713 18219386 28376 5281 2578 CYBB NOX2 Nox2 8 3.5 This scenario is consistent with protection observed by Nox2 deletion in other models of neurodegeneration in which inflammation has 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23714 18219386 28377 5281 2578 CYBB NOX2 Nox2 10 3.5 In addition dopaminergic neurons cocultured with microglial cells lacking the Nox2 gene are more resistant to rotenone-induced neuronal death ( 18 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23715 18219386 28377 926 620 APP amyloid amyloid 25 1.0 to rotenone-induced neuronal death ( 18 and Alzheimer disease_amp_#x02013 linked amyloid peptides (derived derived from neurons activate microglial cells to produce 1 JUMiner_v2.2 1 1 UserEdit 0 0 0 1 1 888 598 APLP2 0 23718 18219386 28378 20996 11179 SOD1 SOD1 SOD1 8 2.5 However in the case of ALS associated with SOD1 mutations the new data reported by Harraz Engelhardt and colleagues 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23719 18219386 28378 20996 11179 SOD1 SOD1 SOD1 36 2.5 ( 20 provide a direct link between the disease-causing mutant SOD1 and Nox-mediated ROS production by microglial cells through SOD1 binding 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23720 18219386 28378 20996 11179 SOD1 SOD1 SOD1 45 2.5 mutant SOD1 and Nox-mediated ROS production by microglial cells through SOD1 binding to the Nox activator Rac1 thereby influencing the non_amp_#x02013 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23721 18219386 28378 17864 9801 RAC1 RAC1 Rac1 51 1.0 by microglial cells through SOD1 binding to the Nox activator Rac1 thereby influencing the non_amp_#x02013 cell autonomous killing of motor neurons 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23723 18219386 28379 20996 11179 SOD1 SOD1 SOD1 1 2.5 Mutant SOD1 stimulates Rac1-GTP activation of Nox and production of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23725 18219386 28380 17864 9801 RAC1 RAC1 Rac1 6 1.0 Using an approach involving immunoprecipitation of Rac1 from different mouse tissues Harraz and colleagues proposed that SOD1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23726 18219386 28380 20996 11179 SOD1 SOD1 SOD1 16 2.5 Rac1 from different mouse tissues Harraz and colleagues proposed that SOD1 interacts directly with Rac1 but not with the other Nox2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23727 18219386 28380 17864 9801 RAC1 RAC1 Rac1 20 1.0 tissues Harraz and colleagues proposed that SOD1 interacts directly with Rac1 but not with the other Nox2 cytosolic regulators ( 20 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23728 18219386 28380 5281 2578 CYBB NOX2 Nox2 26 3.5 SOD1 interacts directly with Rac1 but not with the other Nox2 cytosolic regulators ( 20 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23729 18219386 28381 20996 11179 SOD1 SOD1 SOD1-interacting 8 2.2 It is puzzling why multiple earlier screens for SOD1-interacting proteins including yeast 2-hybrid approaches did not identify Rac1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23730 18219386 28381 17864 9801 RAC1 RAC1 Rac1 17 1.0 for SOD1-interacting proteins including yeast 2-hybrid approaches did not identify Rac1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23731 18219386 28382 20996 11179 SOD1 SOD1 SOD1 16 2.5 _amp_#x02013 that is converted to H 2 O 2 by SOD1 it was further tested whether the enzymatic activity of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23732 18219386 28382 20996 11179 SOD1 SOD1 SOD1 26 2.5 SOD1 it was further tested whether the enzymatic activity of SOD1 was important for this interaction of SOD1 with Rac1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23733 18219386 28382 20996 11179 SOD1 SOD1 SOD1 33 2.5 enzymatic activity of SOD1 was important for this interaction of SOD1 with Rac1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23734 18219386 28382 17864 9801 RAC1 RAC1 Rac1 35 1.0 of SOD1 was important for this interaction of SOD1 with Rac1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23735 18219386 28383 20996 11179 SOD1 SOD1 SOD1 6 2.5 Only the metalated (native) native form of SOD1 bound to Rac1 while the demetalated (enzymatically enzymatically inactive SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23736 18219386 28383 17864 9801 RAC1 RAC1 Rac1 9 1.0 Only the metalated (native) native form of SOD1 bound to Rac1 while the demetalated (enzymatically enzymatically inactive SOD1 did not 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23737 18219386 28383 20996 11179 SOD1 SOD1 SOD1 15 2.5 SOD1 bound to Rac1 while the demetalated (enzymatically enzymatically inactive SOD1 did not 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23738 18219386 28384 20996 11179 SOD1 SOD1 SOD1 5 2.5 In addition the binding of SOD1 to Rac1 was redox sensitive and could be cycled between 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23739 18219386 28384 17864 9801 RAC1 RAC1 Rac1 7 1.0 In addition the binding of SOD1 to Rac1 was redox sensitive and could be cycled between bound and 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23740 18219386 28384 17864 9801 RAC1 RAC1 Rac1 26 1.0 bound and unbound states depending on the redox state of Rac1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23741 18219386 28385 20996 11179 SOD1 SOD1 SOD1 3 2.5 Under reducing conditions SOD1 efficiently bound Rac1-GTP the form of Rac1 that is recruited 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23742 18219386 28385 17864 9801 RAC1 RAC1 Rac1 10 1.0 Under reducing conditions SOD1 efficiently bound Rac1-GTP the form of Rac1 that is recruited to Nox2 upon activation 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23743 18219386 28385 5281 2578 CYBB NOX2 Nox2 15 3.5 bound Rac1-GTP the form of Rac1 that is recruited to Nox2 upon activation 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23744 18219386 28386 20996 11179 SOD1 SOD1 SOD1 3 2.5 The binding of SOD1 to Rac1-GTP inhibited the intrinsic and/or and or GAP-facilitated GTPase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23745 18219386 28386 17864 9801 RAC1 RAC1 Rac1 14 1.0 inhibited the intrinsic and/or and or GAP-facilitated GTPase activity of Rac1 (Figure Figure 1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23748 18219386 28387 20996 11179 SOD1 SOD1 SOD1 9 2.5 It is now widely accepted that ALS-linked mutations in SOD1 provoke disease due to the acquisition of one or more 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23749 18219386 28387 20996 11179 SOD1 SOD1 SOD1 24 2.5 the acquisition of one or more toxic properties of mutant SOD1 ( 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23751 18219386 28388 20996 11179 SOD1 SOD1 SOD1 26 2.5 in tissues from mice expressing the catalytically active ALS-linked mutant SOD1 G93A but not in tissues from mice expressing comparably high 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23752 18219386 28388 20996 11179 SOD1 SOD1 SOD1 40 2.5 not in tissues from mice expressing comparably high levels of SOD1 WT (Figure Figure 1 and ref 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23753 18219386 28389 20996 11179 SOD1 SOD1 SOD1 36 2.5 also seen in glial and neuronal cell lines expressing mutant SOD1 G93A and SOD1 L8Q but not SOD1 WT and was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23754 18219386 28389 20996 11179 SOD1 SOD1 SOD1 39 2.5 glial and neuronal cell lines expressing mutant SOD1 G93A and SOD1 L8Q but not SOD1 WT and was accompanied by increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23755 18219386 28389 20996 11179 SOD1 SOD1 SOD1 44 2.5 lines expressing mutant SOD1 G93A and SOD1 L8Q but not SOD1 WT and was accompanied by increased cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23756 18219386 28390 20996 11179 SOD1 SOD1 SOD1 5 2.5 In addition liver tissues from SOD1 G93A mice _amp_#x02014 in which no altered pathology is normally 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23758 18219386 28390 20996 11179 SOD1 SOD1 SOD1 37 2.5 _amp_#x02022 _amp_#x02013 in agreement with a direct effect of mutant SOD1 on Nox activation rather than a consequence of increased inflammation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23759 18219386 28391 20996 11179 SOD1 SOD1 SOD1 12 2.5 direct effect of increased ROS as a result of mutant SOD1 within microglial cells obviously could influence the survival of motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23760 18219386 28391 20996 11179 SOD1 SOD1 SOD1 38 2.5 demonstrations of slowed disease progression after reducing or eliminating mutant SOD1 synthesis within the myeloid lineage ( 11 12 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23762 18219386 28392 20996 11179 SOD1 SOD1 SOD1 11 2.5 between increased production of O 2 _amp_#x02022 _amp_#x02013 by mutant SOD1 and elevated Rac1-GTP levels was seen not just for SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23763 18219386 28392 20996 11179 SOD1 SOD1 SOD1 21 2.5 SOD1 and elevated Rac1-GTP levels was seen not just for SOD1 G93A but also for 2 additional ALS-linked SOD1 mutants SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23765 18219386 28392 20996 11179 SOD1 SOD1 SOD1 30 2.5 just for SOD1 G93A but also for 2 additional ALS-linked SOD1 mutants SOD1 L8Q and SOD1 G10V ( 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23766 18219386 28392 20996 11179 SOD1 SOD1 SOD1 32 2.5 SOD1 G93A but also for 2 additional ALS-linked SOD1 mutants SOD1 L8Q and SOD1 G10V ( 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23767 18219386 28392 20996 11179 SOD1 SOD1 SOD1 35 2.5 also for 2 additional ALS-linked SOD1 mutants SOD1 L8Q and SOD1 G10V ( 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23768 18219386 28393 20996 11179 SOD1 SOD1 SOD1 58 2.5 property of the more than 115 different mutations in the SOD1 gene known to cause ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23770 18219386 28394 20996 11179 SOD1 SOD1 SOD1 17 2.5 is independent of dismutase activity with multiple mutants (including including SOD1 G85R SOD1 H46R and SOD1 G127X shown to be causative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23771 18219386 28394 20996 11179 SOD1 SOD1 SOD1 20 2.5 of dismutase activity with multiple mutants (including including SOD1 G85R SOD1 H46R and SOD1 G127X shown to be causative for disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23772 18219386 28394 20996 11179 SOD1 SOD1 SOD1 24 2.5 with multiple mutants (including including SOD1 G85R SOD1 H46R and SOD1 G127X shown to be causative for disease in humans and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23773 18219386 28396 20996 11179 SOD1 SOD1 SOD1 5 2.5 Similarly the failure of demetalated SOD1 WT to bind and activate Rac1-GTP would predict that removal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23774 18219386 28396 20996 11179 SOD1 SOD1 SOD1 21 2.5 Rac1-GTP would predict that removal of the copper chaperone for SOD1 (CCS) CCS would substantially slow disease but this was not 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23775 18219386 28396 3838 1613 CCS CCS CCS 22 1.2 predict that removal of the copper chaperone for SOD1 (CCS) CCS would substantially slow disease but this was not the case 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23776 18219386 28397 20996 11179 SOD1 SOD1 SOD1 3 2.5 Thus only if SOD1 mutants increase Nox2 activity independently of their metalated state could 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23777 18219386 28397 5281 2578 CYBB NOX2 Nox2 6 3.5 Thus only if SOD1 mutants increase Nox2 activity independently of their metalated state could mutant SOD1_amp_#x02013 enhanced 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23778 18219386 28397 17864 9801 RAC1 RAC1 Rac1 16 1.0 activity independently of their metalated state could mutant SOD1_amp_#x02013 enhanced Rac1 activation and Nox-dependent O 2 _amp_#x02022 _amp_#x02013 production be a 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23780 18219386 28397 20996 11179 SOD1 SOD1 SOD1 34 2.5 be a feature common to the broader set of ALS-linked SOD1 mutants 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23782 18219386 28400 5281 2578 CYBB NOX2 Nox2 5 3.5 Decreasing ROS production by deleting Nox2 has already proven efficacious in ALS mice ( 13 14 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23785 18219386 28402 20996 11179 SOD1 SOD1 SOD1 9 2.5 The addition of apocynin to the drinking water of SOD1 G93A ALS mice beginning at 2 weeks of age increased 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23787 18219386 28403 5281 2578 CYBB NOX2 Nox2 17 3.5 and in fact greater than _amp_#x02014 the deletion of the Nox2 gene in SOD1 G93A mice previously reported by the same 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23788 18219386 28403 20996 11179 SOD1 SOD1 SOD1 20 2.5 greater than _amp_#x02014 the deletion of the Nox2 gene in SOD1 G93A mice previously reported by the same group ( 14 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23789 18219386 28404 14167 7660 NCF1 p47 p47 8 0.6 Apocynin is believed to block the translocation of p47 phox /p67 p67 phox to Nox ( 23 and would 1 JUMiner_v2.2 1 1 UserEdit 0 2 9070 TotalCon:4<>10576|CLEC11A|6320|Complete__9070|PLEK|5341|Complete__15912|NSFL1C|55968|No_GeneRif__6062|ING1|3621|Complete__<>AvaiableGeneRif=3<>BEST:9070|PLEK|0.000773036487322202<>ScoreDetail__6062|ING1|0.000355697834689431__10576|CLEC11A|0.000377928949357521__9070|PLEK|0.000773036487322202__ 1 1 10577 6062 ING1 0 23790 18219386 28404 14170 7661 NCF2 p67 p67 10 0.3 is believed to block the translocation of p47 phox /p67 p67 phox to Nox ( 23 and would therefore inhibit only 1 JUMiner_v2.2 1 1 UserEdit 0 2 16672 TotalCon:2<>1659|CD33|945|Complete__16672|METAP2|10988|Complete__<>AvaiableGeneRif=2<>BEST:16672|METAP2|0.000921097704868116<>ScoreDetail__1659|CD33|0.000843144596524802__16672|METAP2|0.000921097704868116__ 1 1 3884 1659 CD33 0 23791 18219386 28404 14551 7889 NOX1 NOX1 Nox1 31 1.2 only the Nox proteins requiring these cytosolic activators which include Nox1 and Nox2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23792 18219386 28404 5281 2578 CYBB NOX2 NOX2 31 3.5 only the Nox proteins requiring these cytosolic activators which include Nox1 and Nox2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23793 18219386 28404 5281 2578 CYBB NOX2 Nox2 33 3.5 Nox proteins requiring these cytosolic activators which include Nox1 and Nox2 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23794 18219386 28405 20996 11179 SOD1 SOD1 SOD1 29 2.5 a neuronal cell line when cells were transfected with mutant SOD1 ( 20 providing support that apocynin effectiveness may be acting 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23795 18219386 28406 5281 2578 CYBB NOX2 Nox2 3 3.5 Although expression of Nox2 by neurons astrocytes and endothelial cells has been reported ( 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23796 18219386 28406 5281 2578 CYBB NOX2 Nox2 18 3.5 and endothelial cells has been reported ( 15 staining for Nox2 in ALS mice only revealed accumulation in microglial cells ( 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23798 18219386 28407 14551 7889 NOX1 NOX1 Nox1 10 1.2 However other Nox proteins are expressed in the CNS including Nox1 in neurons and endothelial cells Nox4 in astrocytes neurons and 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23799 18219386 28407 14553 7891 NOX4 NOX4 Nox4 16 0.9 in the CNS including Nox1 in neurons and endothelial cells Nox4 in astrocytes neurons and endothelial cells and Nox5 in endothelial 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23800 18219386 28407 14554 14874 NOX5 NOX5 Nox5 24 0.9 endothelial cells Nox4 in astrocytes neurons and endothelial cells and Nox5 in endothelial cells moreover high doses of apocynin have been 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23801 18219386 28407 14553 7891 NOX4 NOX4 Nox4 38 0.9 moreover high doses of apocynin have been reported to inhibit Nox4 and Nox5 ( 15 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23802 18219386 28407 14554 14874 NOX5 NOX5 NOX5 38 0.9 moreover high doses of apocynin have been reported to inhibit Nox4 and Nox5 ( 15 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23803 18219386 28407 14554 14874 NOX5 NOX5 Nox5 40 0.9 doses of apocynin have been reported to inhibit Nox4 and Nox5 ( 15 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23804 18219386 28409 5281 2578 CYBB NOX2 Nox2 4 3.5 Of relevance for patients Nox2 upregulation has been reported in spinal cords of sporadic ALS 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23806 18219386 28409 20996 11179 SOD1 SOD1 SOD1 27 2.5 ( 13 but it is still unknown whether patients with SOD1 mutations generate similar or greater increases in Nox2 activity or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23807 18219386 28409 5281 2578 CYBB NOX2 Nox2 35 3.5 patients with SOD1 mutations generate similar or greater increases in Nox2 activity or expression 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23809 18219386 28411 5281 2578 CYBB NOX2 Nox2 8 3.5 Two reported studies of ALS mice with a Nox2 deletion reached divergent conclusions one group described downregulation of microglial 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23810 18219386 28412 20996 11179 SOD1 SOD1 SOD1 22 2.5 in the progression of disease and whether apocynin affects mutant SOD1 expression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23811 18219386 28415 5281 2578 CYBB NOX2 Nox2 5 3.5 Mutations altering the activity of Nox2 (or or other subunits of Nox are known to cause 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23812 18219386 28415 5281 2578 CYBB CGD CGD 18 2.5 of Nox are known to cause chronic granulomatous disease (CGD) CGD ( 15 which is characterized by severe and chronic infections 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23813 18219386 28416 5281 2578 CYBB CGD CGD 0 2.5 CGD patients are usually chronically administered antibiotics and IFN-_amp_#x003b3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23816 18219386 28418 20996 11179 SOD1 SOD1 SOD1 18 2.5 disease and might therefore be a direct consequence of mutant SOD1 expression in the infected tissues deprived of Nox activity rather 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23819 18219386 28424 20996 11179 SOD1 SOD1 SOD1 8 2.5 With this new finding that interaction of metalated SOD1 with Rac1 serves to activate Nox2 and that mutant forms 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23820 18219386 28424 17864 9801 RAC1 RAC1 Rac1 10 1.0 With this new finding that interaction of metalated SOD1 with Rac1 serves to activate Nox2 and that mutant forms of SOD1 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23821 18219386 28424 5281 2578 CYBB NOX2 Nox2 14 3.5 that interaction of metalated SOD1 with Rac1 serves to activate Nox2 and that mutant forms of SOD1 amplify production of ROS 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23822 18219386 28424 20996 11179 SOD1 SOD1 SOD1 20 2.5 Rac1 serves to activate Nox2 and that mutant forms of SOD1 amplify production of ROS by locking Nox2 in its activated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23823 18219386 28424 5281 2578 CYBB NOX2 Nox2 27 3.5 mutant forms of SOD1 amplify production of ROS by locking Nox2 in its activated state Harraz and colleagues have advanced a 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23824 18219386 28424 20996 11179 SOD1 SOD1 SOD1 48 2.5 new hypothesis for the gain of toxic function of mutant SOD1 ( 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23826 18219386 28425 20996 11179 SOD1 SOD1 SOD1 2 2.5 Indeed normal SOD1 function typically defined only by its dismutase activity is now 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23827 18219386 28426 20996 11179 SOD1 SOD1 SOD1 13 2.5 of these additional properties could be induced by mutations in SOD1 as one of the toxic contributors in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15717 18308427 18543 20996 11179 SOD1 SOD SOD 5 1.7 Antioxidant defense enzymes superoxide dismutase (SOD), SOD catalase (CAT), CAT glutathione peroxidase (GSHPx), GSHPx glutathione reductase (GR) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15718 18308427 18543 3544 1516 CAT CAT CAT 7 1.0 Antioxidant defense enzymes superoxide dismutase (SOD), SOD catalase (CAT), CAT glutathione peroxidase (GSHPx), GSHPx glutathione reductase (GR) GR and glucose-6-phosphate 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15727 18308427 18561 20996 11179 SOD1 SOD SOD 5 1.7 These enzymes include superoxide dismutase (SOD) SOD (E.C E.C No 1.15.1.1 that remove O 2_amp_#x2212 by catalyzing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15728 18308427 18562 3544 1516 CAT CAT CAT 1 1.0 Catalase (CAT) CAT (E.C E.C No 1.11.1.6 catalyzes the conversion of hydrogen peroxide 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15729 18308427 18569 3544 1516 CAT CAT CAT 30 1.0 other sulfydryl groups of a cell and the antioxidant enzyme CAT in its active form ( Kletzien et al. 1994 and 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15731 18308427 18570 20996 11179 SOD1 SOD SOD 30 1.7 the correlation if any between the lipid peroxidation (LPO), LPO SOD CAT GSH GSHPx GR and G-6-PDH levels and the progression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15732 18308427 18570 3544 1516 CAT CAT CAT 31 1.0 correlation if any between the lipid peroxidation (LPO), LPO SOD CAT GSH GSHPx GR and G-6-PDH levels and the progression of 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15743 18308427 18610 20996 11179 SOD1 SOD SOD 0 1.7 SOD activity was estimated by the method of Nishikimi et al 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15745 18308427 18618 3544 1516 CAT CAT CAT 0 1.0 CAT was estimated by the method of Aebi (1984) 1984 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15753 18308427 18661 20996 11179 SOD1 SOD SOD 4 1.7 However the activities of SOD and GSHPx were found to be insignificantly changed in comparison 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15755 18308427 18662 3544 1516 CAT CAT CAT 16 1.0 found that LPO ( Fig 6 started to increase and CAT GSH GR and G-6-PDH levels ( Fig 7 Fig 8 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15761 18308427 18673 3544 1516 CAT CAT CAT 4 1.0 In the present study CAT was found to exhibit significantly reduced activity when compared to 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15767 18308427 18682 20996 11179 SOD1 SOD SOD 13 1.7 elevated blood free radical levels did not induce the erythrocyte SOD and GSHPx enzyme activities in sporadic amyotrophic lateral sclerosis patients 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9656 18414597 11013 22551 11892 TNF TNF-alpha TNF-alpha 2 1.5 Pro-inflammatory cytokines (TNF-alpha TNF-alpha and IL-1 secretory phospholipase A(2) A 2 IIA and lipoprotein-PLA(2) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9657 18414597 11013 10437 5992 IL1B IL-1 IL-1 4 1.0 Pro-inflammatory cytokines (TNF-alpha TNF-alpha and IL-1 secretory phospholipase A(2) A 2 IIA and lipoprotein-PLA(2) lipoprotein-PLA 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9658 18414597 11015 22551 11892 TNF TNF-alpha TNF-alpha 0 1.5 TNF-alpha and IL-1 alter lipid metabolism and stimulate production of eicosanoids 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9659 18414597 11015 10437 5992 IL1B IL-1 IL-1 2 1.0 TNF-alpha and IL-1 alter lipid metabolism and stimulate production of eicosanoids ceramide and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9660 18414597 11020 14569 7897 NPC1 NPC1 NPC1 26 0.9 Niemann-Pick disease C is due to mutations in either the NPC1 or NPC2 genes resulting in defective cholesterol transport and cholesterol 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9661 18414597 11020 14571 14537 NPC2 NPC2 NPC2 28 1.4 C is due to mutations in either the NPC1 or NPC2 genes resulting in defective cholesterol transport and cholesterol accumulation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9751 18422522 11247 14538 7876 NOS3 eNOS eNOS 25 2.2 contrast the biological significance of endothelial nitric oxide synthase (eNOS) eNOS overexpression that occurs in several pathological conditions has not yet 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9752 18422522 11248 622 443 ALS2 ALS2 ALS2 34 1.5 a protein causing an early-onset type of amyotrophic lateral sclerosis ALS2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9753 18422522 11249 14538 7876 NOS3 eNOS eNOS 3 2.2 We found that eNOS which is endogenously expressed by these cells was activated by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9754 18422522 11249 22551 11892 TNF TNF-alpha TNF-alpha 17 1.8 by these cells was activated by tumour necrosis factor-alpha (TNF-alpha), TNF-alpha a proinflammatory cytokine that plays important roles in ALS2 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9755 18422522 11249 622 443 ALS2 ALS2 ALS2 26 1.5 (TNF-alpha), TNF-alpha a proinflammatory cytokine that plays important roles in ALS2 and several neurodegenerative diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9756 18422522 11250 22551 11892 TNF TNF-alpha TNF-alpha-dependent 1 1.8 The TNF-alpha-dependent eNOS activation occurred through generation by sphingosine-kinase-1 of sphingosine-1-phosphate stimulation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9757 18422522 11250 14538 7876 NOS3 eNOS eNOS 2 2.2 The TNF-alpha-dependent eNOS activation occurred through generation by sphingosine-kinase-1 of sphingosine-1-phosphate stimulation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9758 18422522 11250 14538 7876 NOS3 eNOS eNOS 36 2.2 and dominant negative constructs specific for the enzymes and receptors eNOS activation by TNF-alpha conferred cytoprotection from excitotoxicity and neurotoxic cues 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9759 18422522 11250 22551 11892 TNF TNF-alpha TNF-alpha 39 1.8 constructs specific for the enzymes and receptors eNOS activation by TNF-alpha conferred cytoprotection from excitotoxicity and neurotoxic cues such as reactive 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 9760 18422522 11250 543 391 AKT1 AKT Akt 19 0.0 of sphingosine-1-phosphate stimulation of its membrane receptors and activation of Akt as determined using small interference RNA and dominant negative constructs 2 JUMiner_v2.2 1 1 akt; 0 0 0 0 0 0 0 0 9761 18422522 11251 14538 7876 NOS3 eNOS eNOS 6 2.2 Our results suggest that overexpression of eNOS by neurones is a broad-range protective mechanism activated during damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 7729 18588875 8925 13708 7377 MSRA MSRA MsrA 11 1.5 function and redox control in the aging eye Role of MsrA and other repair systems in cataract and macular degenerations 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 7739 18588875 8938 13859 7473 MTRR MSR Msr 24 0.3 eye diseases and detail how the methionine sulfoxide reductase (Msr) Msr protein repair system and other redox systems play key roles 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 2042 18751914 3073 10437 5992 IL1B IL-1 IL-1 4 1.0 Pro-inflammatory cytokines (TNF-_amp_#945; TNF-_amp_#945 and IL-1 secretory phospholipase A 2 IIA and lipoprotein-PLA 2 are implicated 1 SciMiner_v2.2 1 0 0 0 0 0 0 0 0 0 2043 18751914 3073 22551 11892 TNF TNF TNF-_amp_#945 2 0.1 Pro-inflammatory cytokines (TNF-_amp_#945; TNF-_amp_#945 and IL-1 secretory phospholipase A 2 IIA and lipoprotein-PLA 2 6 SciMiner_v2.2 1 0 0 0 0 0 0 0 0 0 2044 18751914 3071 10437 5992 IL1B IL-1 IL-1 2 1.0 TNF-_amp_#945 and IL-1 alter lipid metabolism and stimulate production of eicosanoids ceramide and 1 SciMiner_v2.2 1 0 0 0 0 0 0 0 0 0 2045 18751914 3071 22551 11892 TNF TNF TNF-_amp_#945 0 0.1 TNF-_amp_#945 and IL-1 alter lipid metabolism and stimulate production of eicosanoids 6 SciMiner_v2.2 1 0 0 0 0 0 0 0 0 0 2046 18751914 3066 14569 7897 NPC1 NPC1 NPC1 26 0.9 Niemann-Pick disease C is due to mutations in either the NPC1 or NPC2 genes resulting in defective cholesterol transport and cholesterol 1 SciMiner_v2.2 1 0 0 0 0 0 0 0 0 0 2047 18751914 3066 14571 14537 NPC2 NPC2 NPC2 28 1.4 C is due to mutations in either the NPC1 or NPC2 genes resulting in defective cholesterol transport and cholesterol accumulation 1 SciMiner_v2.2 1 0 0 0 0 0 0 0 0 0 #sen2geneID pmid senID geneID hgncID approvedSymbol matchString actualString startPos score flankingText matchCodeID tag SciMinerVersion SciMinerMethod inExClude inExCludeCond phenotypeOnly conflictCode hgncIDbyNR NRText editTag editUser oldGeneID oldHgncID oldApprovedSymbol oldInExClude oldInExCludeCond 300594 7764323 431540 1576 990 BCL2 bcl 2 bcl 2 0 1.0 free radical scavengers|free radicals|proteins|proto oncogene proteins|proto oncogene proteins c bcl 2|reactive oxygen species|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299739 7841373 429640 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 protein expression in aged brain and neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299740 7841373 429641 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the proto oncogene bcl 2 is involved in the regulation of cell death and is able to block apoptosis in neurones through reduced generation of reactive oxygen species ros . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299741 7841373 429642 1576 990 BCL2 bcl 2 bcl 2 0 1.0 we have studied the immunohistochemical expression of bcl 2 protein in the aged brain and in various human neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299742 7841373 429643 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in all cases bcl 2 was strongly enriched within lipofuscin and autophagic vacuoles of neurones glial and vascular cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299743 7841373 429644 1576 990 BCL2 bcl 2 bcl 2 0 1.0 our data show that accumulation of bcl 2 is not disease specific and represents a general cellular response which accompanies the increased formation of lipofuscin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299744 7841373 429645 1576 990 BCL2 bcl 2 bcl 2 0 1.0 since oxidative stress is directly involved in lipofuscinogenesis accumulation of bcl 2 may reflect a mechanism for counterbalancing ros mediated damage or it might represent the impairment of bcl 2 dependent protection from ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 299745 7841373 429646 1576 990 BCL2 bcl 2 bcl 2 0 1.0 lipofuscin|proto oncogene proteins|proto oncogene proteins c bcl 2|gtp binding proteins| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297957 8588576 425850 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297139 8841988 424205 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 decreased cytochrome c oxidase activity but unchanged superoxide dismutase and glutathione peroxidase activities in the spinal cords of patients with amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297140 8841988 424205 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 decreased cytochrome c oxidase activity but unchanged superoxide dismutase and glutathione peroxidase activities in the spinal cords of patients with amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297142 8841988 424208 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 we measured the antioxidant actions of superoxide dismutase sod glutathione peroxidase gsh px and cytochrome c oxidase co of the human spinal cord in patients with als in comparison with those in control patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297143 8841988 424208 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we measured the antioxidant actions of superoxide dismutase sod glutathione peroxidase gsh px and cytochrome c oxidase co of the human spinal cord in patients with als in comparison with those in control patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297164 8858182 424247 9766 4851 HTT huntingtin huntingtin 0 1.0 3 nitropropionic acid as a toxin model for huntington's disease together with the demonstration of reduced mitochondrial function in huntington's disease caudate supports the proposition that mutant huntingtin may exert its effect through an abnormality of energy metabolism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297165 8858182 424249 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein precursor|dna mitochondrial|free radicals|hd protein human|nerve tissue proteins|nuclear proteins|reactive oxygen species|electron transport complex iv| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297270 8899665 424391 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 evidence against increased oxidative stress in fibroblasts from patients with non superoxide dismutase 1 mutant familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297272 8899665 424393 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 in parallel fibroblasts were examined for signs of abnormal oxidative stress by study of reactive oxygen species metabolism and concurrently leukocyte dna from the same patients was examined for superoxide dismutase 1 sod1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297273 8899665 424401 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c group|free radicals|hemostatics|reactive oxygen species|thiobarbituric acid reactive substances|vitamin k|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 296647 8910880 423324 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein precursor|reactive oxygen species|calcium| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295172 8922414 420724 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the importance of ros in programmed cell death also has been suggested from the neuroprotective effects of bcl 2 family proteins which seem to act by inhibiting ros induced cell damage kane et al. 1993 ; zhong et al. 1993 ; myers et al. 1995 ; lawrence et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295174 8922414 420734 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 histological analysis of the cervical spinal cord of wobbler mice demonstrates wallerian degeneration reductions in axon caliber and decreases in choline acetyltransferase chat activity within the anterior horn by 8 weeks of age bird et al. 1971 ; mitsumoto and bradley 1982 ; baulac et al. 1983 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295175 8922414 420843 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 then every fifth section was stained for choline acetyltransferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295176 8922414 420875 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 within the cervical spinal cord nac reduced losses of choline acetyltransferase positive neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295177 8922414 420934 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 total numbers of choline acetyltransferase positive neurons are indicated for each group n = 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295565 9007410 421584 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase and oxygen radical neurotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295566 9007410 421586 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cytosolic cu zn superoxide dismutase normally defends against damage by reactive oxygen species; however mutant forms of the enzyme might instead contribute to damage of motor neurons n some amyotrophic lateral sclerosis patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295567 9007410 421587 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 possible mechanisms of oxidative injury to neurons are discussed with reference to cytosolic cu zn superoxide dismutase mutations and other factors which might enhance oxygen radical toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297783 9044305 425429 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative stress caused by glycation of cu zn superoxide dismutase and its effects on intracellular components. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297784 9044305 425433 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 accumulating evidence supports the concept that decreases in cu zn superoxide dismutase sod activity causes apoptotic cell death in neuronal cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294101 9092140 418544 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 [amyotrophic lateral sclerosis and superoxide dismutase a review] 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294102 9092140 418545 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the recent observation that mutations in cytosolic cuzn superoxide dismutase cuzn sod are associated with amyotrophic lateral sclerosis als suggests that the disease arises from a perturbation of the homeostasis of free radicals resulting in neuronal degeneration by reactive 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294103 9092140 418550 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294710 9172131 419812 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 frontal cortical levels and activity of the pivotal ber protein apurinic/apyrimidinic endonuclease ape were determined in 11 patients with sporadic als and six age matched control subjects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294711 9172131 419812 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 frontal cortical levels and activity of the pivotal ber protein apurinic/apyrimidinic endonuclease ape were determined in 11 patients with sporadic als and six age matched control subjects. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294713 9172131 419821 13410 7211 MPG n-methylpurine-dna glycosylase n methylpurine dna glycosylase 0 1.0 dna base excision repair ber is considered to be the predominant pathway for repair of oxidative dna damage. 9 the damaged base is removed by a glycosylase e.g formamidopyrimidine or n methylpurine dna glycosylase and the resulting abasic site is repaired by apurinic/apyrimidinic endonuclease ape . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294714 9172131 419821 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 inant pathway for repair of oxidative dna damage. 9 the damaged base is removed by a glycosylase e.g formamidopyrimidine or n methylpurine dna glycosylase and the resulting abasic site is repaired by apurinic/apyrimidinic endonuclease ape . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294715 9172131 419821 878 587 APEX1 apurinic/apyrimidinic endonuclease apurinic/apyrimidinic endonuclease 0 1.0 inant pathway for repair of oxidative dna damage. 9 the damaged base is removed by a glycosylase e.g formamidopyrimidine or n methylpurine dna glycosylase and the resulting abasic site is repaired by apurinic/apyrimidinic endonuclease ape . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294716 9172131 419835 878 587 APEX1 ape 1 ape 1 0 1.0 membranes were immunoprobed by incubating blots with blocking solution containing anti ape 1:2000 for 1 h at room temperature. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294717 9172131 419847 13410 7211 MPG n-methylpurine-dna glycosylase n methylpurine dna glycosylase 0 1.0 for comparison protein extracts 50 microg from several control n _amp_#61; 4 and als n _amp_#61; 3 subjects were analyzed by western blotting using a monoclonal antibody to the human ber protein n methylpurine dna glycosylase mpg and purified human mpg positive control both provided by dr sankar mitra utmb galveston tx . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 294718 9172131 419847 13410 7211 MPG n-methylpurine-dna glycosylase, mpg n methylpurine dna glycosylase mpg 0 1.0 for comparison protein extracts 50 microg from several control n _amp_#61; 4 and als n _amp_#61; 3 subjects were analyzed by western blotting using a monoclonal antibody to the human ber protein n methylpurine dna glycosylase mpg and purified human mpg positive control both provided by dr sankar mitra utmb galveston tx . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293112 9311102 416575 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein|cytokines|excitatory amino acids|nerve growth factors|reactive oxygen species| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293242 9337068 416920 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein|amyloid beta protein precursor|reactive oxygen species|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293756 9350962 417497 551 399 ALB serum albumin serum albumin 0 1.0 r describes an immunocytochemical method for localization of central nervous system cns lipid peroxidation lp that employs a rabbit derived antibody raised against malondialdehyde mda modified rabbit serum albumin rsa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293758 9350962 417521 551 399 ALB serum albumin serum albumin 0 1.0 five milliliters of the solution was mixed with 5 ml of rabbit serum albumin rsa; 10 mg/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293760 9350962 417531 551 399 ALB serum albumin serum albumin 0 1.0 malondialdehyde rabbit serum albumin elisa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293762 9350962 417533 551 399 ALB serum albumin serum albumin 0 1.0 the mda rsa solution was poured out and the plates blocked with 200 _amp_#x3bc; l of a solution of 1% bovine serum albumin bsa in phosphate buffered saline pbs for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293765 9350962 417588 551 399 ALB serum albumin serum albumin 0 1.0 specificity of anti malondialdehyde rabbit serum albumin antibody 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291077 9462746 412763 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 a novel neurological phenotype in mice lacking mitochondrial manganese superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291079 9462746 412766 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 genetic inactivation of the mitochondrial form of superoxide dismutase in mice results in dilated cardiomyopathy hepatic lipid accumulation and early neonatal death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291080 9462746 412767 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we report that treatment with the superoxide dismutase sod mimetic manganese 5 10 15 20 tetrakis 4 benzoic acid porphyrin mntbap rescues these sod2tm1cje / mutant mice from this systemic pathology and dramatically prolongs their survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 289762 9620775 410133 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the association between mutations in the gene encoding the oxygen radical metabolizing enzyme cuzn superoxide dismutase sod1 and loss of motorneurons in the brain and spinal cord that occurs in the life shortening paralytic disease familial amyotrophic lateral sclerosis fals; ref 4 suggests that chronic and unrepaired 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 290134 9633809 410561 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 transgenic mice that highly over express a mutated human cuzn superoxide dismutase sod1 gene [gly93 >ala; tgn sod1 g93a g1h line] found in some patients with familial als fals have been shown to develop motor neuron disease that is characterized by motor neuron loss in the lumbar a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 290135 9633809 410564 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 in the present study we investigated the time course of microglial major histocompatibility ii antigen immunoreactivity and astrocytic glial fibrillary acidic protein immunoreactivity activation in relation to the course of motor neuron disease in the tgn sod1 g93a g1h fals mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 285043 9675268 403196 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 oxidative insult to normal neurons also results from catalytically active redox metal ions i.e iron and copper and particular ros generating enzymes and peptides e.g nitric oxide synthase xanthine oxidase _amp_#x3b2; amyloid etc. present in the brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 285044 9675268 403196 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 oxidative insult to normal neurons also results from catalytically active redox metal ions i.e iron and copper and particular ros generating enzymes and peptides e.g nitric oxide synthase xanthine oxidase _amp_#x3b2; amyloid etc. present in the brain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 286999 9745361 405674 20017 10940 SLC1A2 glt 1 glt1 0 1.0 specific _amp_#x2018;redox sensing' elements consisting of cysteine residues have been identified in the structures of at least three transporter subtypes glt1 glast and eaac1 and shown to regulate transport rate via thiol disulphide redox interconversion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287000 9745361 405679 20017 10940 SLC1A2 glt 1 glt1 0 1.0 five different isoforms of glutamate transporters or excitatory amino acid carriers have now been identified: glast eaat1 glt1 eaat2 eaac1 eaat3 eaat4 and eaat5 refs [ 1 2 3 4 5 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287001 9745361 405687 20017 10940 SLC1A2 glt 1 glt1 0 1.0 in studies to localize the isoforms glt1 and glast appear to be restricted to brain astrocytes [ 11 12 ] and are expressed in different proportions in different regions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287002 9745361 405688 20017 10940 SLC1A2 glt 1 glt1 0 1.0 glt1 is the most abundant glutamate transporter and represents about 1% of the total brain membrane protein[ 6 13 ] with highest concentrations in the hippocampus and cerebral cortex. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287003 9745361 405690 20017 10940 SLC1A2 glt 1 glt1 0 1.0 in astrocytic membranes glt1 and glast localize preferentially to the parts of the plasma membrane that face neuropil with lower levels in the parts facing pia mater capillary endothelium other astrocytes and neuronal cell bodie 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287004 9745361 405691 20017 10940 SLC1A2 glt 1 glt1 0 1.0 moreover the expression of glt1 and glast is under the control of neuronal soluble factors including glutamate itself [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287005 9745361 405710 20017 10940 SLC1A2 glt 1 glt1 0 1.0 the most dramatic elevation of extracellular glutamate levels and tissue damage resulted from loss of the glial transporters particularly glt1 ref [ 25 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287006 9745361 405711 20017 10940 SLC1A2 glt 1 glt1 0 1.0 indeed knockout mice lacking glt1 undergo lethal spontaneous seizures increased susceptibility to acute brain injury and die prematurely with virtually no survivors three months after birth [ 26 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287007 9745361 405716 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 toxic pathways include ca 2+ dependent activation of nitric oxide no synthase phospholipase a 2 and xanthine oxidase which can all contribute to an aberrant formation of reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287008 9745361 405723 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 reactive oxygen species generated by hydrogen peroxide h 2 o 2 or by xanthine oxidase activation inhibit [ 3 h]glutamate uptake in cultured astrocytes and reduce the transport associated current under voltage clamp with minor or no effect on the resting membrane conductance [ 34 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287009 9745361 405727 20017 10940 SLC1A2 glt 1 glt1 0 1.0 indeed the transport activities of glt1 eaac1 and glast are equally inhibited by oxidants via a direct action on the transporter proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287010 9745361 405742 20017 10940 SLC1A2 glt 1 glt1 0 1.0 eaac1 glt1 and glast exhibit redox sensing properties. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287011 9745361 405745 20017 10940 SLC1A2 glt 1 glt1 0 1.0 eaac1 glast glt1 eaat4 and eaat5 carry different cysteine residues in their sequences ranging from a minimum of two for eaat4 to a maximum of 11 for eaat5 ref [ 5 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287012 9745361 405781 20017 10940 SLC1A2 glt 1 glt1 0 1.0 sporter defect and neurodegeneration has been demonstrated by rothstein and collegues [ 50 ]: they have reported a remarkable loss of glutamate uptake activity apparently owing to a selective loss of glt1 in the spinal cord and motor cortex of patients with the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287013 9745361 405782 20017 10940 SLC1A2 glt 1 glt1 0 1.0 the mechanism s leading to loss of glt1 are not fully understood. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287014 9745361 405783 20017 10940 SLC1A2 glt 1 glt1 0 1.0 the steady state level of glt1 mrna was apparently unchanged leading investigators initially to suspect a block of translation or the internalization and/or degradation of post translationally damaged glt1 ref [ 51 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287015 9745361 405783 20017 10940 SLC1A2 glt 1 glt1 0 1.0 mrna was apparently unchanged leading investigators initially to suspect a block of translation or the internalization and/or degradation of post translationally damaged glt1 ref [ 51 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287016 9745361 405784 20017 10940 SLC1A2 glt 1 glt1 0 1.0 of abnormal glt1mrnas including intron retention and exon skipping whose processing could lead to unstable proteins undergoing rapid degradation and/or producing a dominant negative effect on normal glt1 ref [ 52 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287017 9745361 405785 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 ies by rosen and colleagues [ 53 ] linked als to reactive oxygen species toxicity since they showed that 15_amp_#x2013;20% of fals patients carry mis sense mutations in the gene encoding cu 2+ /zn 2+ superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287018 9745361 405790 20017 10940 SLC1A2 glt 1 glt1 0 1.0 s of sod1 may result in defective glutamate transport since transgenic mice expressing an als linked sod1 mutation show increased tyrosine nitration of glutamate transporters[ 43 ] and marked loss of glt1 in the spinal cord [ 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287019 9745361 405807 20017 10940 SLC1A2 glt 1 glt1 0 1.0 ion of 4 hydroxynonenal an aldehydic product of lipid peroxidative processes which by itself mimicked uptake inhibition. 4 hydroxynomenal was shown to form adducts with a number of proteins including glt1 by reaction at sulphydryls or other vulnerable groups [ 66 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287020 9745361 405816 20017 10940 SLC1A2 glt 1 glt1 0 1.0 as the glutamate transporters glt1 in particular are crucial in maintaining glutamate homeostasis[ 6 32 33 ] eventual oxidative damage of the transporters in vivo is predicted to have major neurotoxic consequences. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287021 9745361 405826 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 ber of different mechanisms may contribute to [ca 2+ ] i rise including direct influx via n methyl aspartate nmda or rs amino 3 hydroxy 5 methyl 4 isoxazole propionic acid ampa receptors metabotropic glutamate receptor mediated release from the internal stores activation of voltage dependent ca 2+ channels and reversal of na + /ca 2+ exchange. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 287022 9745361 405830 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in amyotrophic lateral sclerosis peroxynitrite onoo _amp_#x2212; or other noxious ros can be formed as a result of altered function of mutant superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 284187 9856861 401492 3544 1516 CAT catalase catalase 0 1.0 iron iii /ascorbate toxicity was completely prevented with the hydrogen peroxide detoxifying enzyme catalase and partially prevented with the antioxidant vitamin e. sod1 the enzyme that removes superoxide did not protect against iron iii /ascorbate toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280474 10077670 394958 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 abstract it has been reported that expression of familial amyotrophic lateral sclerosis fals associated mutant cu/zn superoxide dismutase 1 sod induces apoptosis of neuronal cells in culture associated with an increase in reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280475 10077670 394963 7592 3711 FKBP1A rotamase rotamase 0 1.0 because both groups of drugs inhibit the rotamase activity of cyclophilins cyp but only the immunosuppressant analogs inhibit calcineurin activity these data suggest that rotamase inhibition underlies the enhanced cell death after sodv148g expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280476 10077670 394964 7592 3711 FKBP1A rotamase rotamase 0 1.0 the importance of rotamase activity in mutant sod mediated apoptosis was supported by experiments showing that overexpressed wild type cyclophilin a cypa but not cypa with a rotamase active site point mutation protected cells from death after sodv148g expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280477 10077670 394965 7592 3711 FKBP1A rotamase rotamase 0 1.0 these data suggest that mutant sod produces a greater need for rotamase and also highlights possible new therapeutic strategies in fals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280478 10077670 394975 614 437 ALPI alkaline phosphatase alkaline phosphatase 0 1.0 cypa histidine tagged 17 expression was detected by immunostaining with his probe h 15 rabbit polyclonal antiserum santa cruz biotechnology followed by anti rabbit igg alkaline phosphatase and x phosphate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280479 10077670 394991 17300 9388 PRKAR1A camp-dependent protein kinase camp dependent protein kinase 0 1.0 in brief r ii peptide dldvpipgrfdrrvsvaae; 0.25 _amp_#x003bc;m containing the phosphorylation site of type ii camp dependent protein kinase lc services woburn ma was phosphorylated by bovine brain protein kinase a catalytic subunit 30 _amp_#x003bc;g/ml plus _amp_#x0005b;_amp_#x003b3; 32 p_amp_#x0005d;atp 0.5 mm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280481 10077670 394991 17294 9380 PRKACA protein kinase a catalytic subunit protein kinase a catalytic subunit 0 1.0 in brief r ii peptide dldvpipgrfdrrvsvaae; 0.25 _amp_#x003bc;m containing the phosphorylation site of type ii camp dependent protein kinase lc services woburn ma was phosphorylated by bovine brain protein kinase a catalytic subunit 30 _amp_#x003bc;g/ml plus _amp_#x0005b;_amp_#x003b3; 32 p_amp_#x0005d;atp 0.5 mm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280482 10077670 394998 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase activity assay. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280483 10077670 394999 7592 3711 FKBP1A rotamase rotamase 0 1.0 a previously published 21 chymotrypsin coupled assay was used to measure rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280484 10077670 395003 7592 3711 FKBP1A rotamase rotamase 0 1.0 cells were treated with csa and were harvested as described above for the rotamase assay. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280485 10077670 395034 7592 3711 FKBP1A rotamase rotamase 0 1.0 fig. 3 a shows that csa csg and fk506 immunosuppressant drugs known to inhibit calcineurin and the rotamase activity of immunophilin potentiated cell death induced by sodv148g expression fig 3 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280486 10077670 395041 7592 3711 FKBP1A rotamase rotamase 0 1.0 we also examined the effect of pkf 211_amp_#x02013;811 and psc 833 nonimmunosuppressant csa analogs that inhibit cyclophilin rotamase activity but not calcineurin 22 23 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280487 10077670 395043 7592 3711 FKBP1A rotamase rotamase 0 1.0 the results suggest that csa enhances sodv148g induced cell death by inhibiting cyclophilin rotamase activity and not because of calcineurin inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280488 10077670 395052 7592 3711 FKBP1A rotamase rotamase 0 1.0 effect of csa on rotamase activity levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280489 10077670 395053 7592 3711 FKBP1A rotamase rotamase 0 1.0 the above studies suggested that csa and its immunosuppressive analogs might enhance sod mutant induced cell death through its interference with rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280490 10077670 395054 7592 3711 FKBP1A rotamase rotamase 0 1.0 it also raised the question as to whether there is a preexisting difference in the level of rotamase activity between sodv148g expressing and mock cells making the former cells more sensitive to csa. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280491 10077670 395055 7592 3711 FKBP1A rotamase rotamase 0 1.0 therefore we measured rotamase activity in mock wt and mutant sod expressing cells before and after csa treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280492 10077670 395056 7592 3711 FKBP1A rotamase rotamase 0 1.0 the data show that all cells had a similar amount of rotamase activity before csa treatment and that csa decreased rotamase activity to a similar level in all three groups table 1 with no significant differences in this inhibition in the sodv148g expressing cells vs. other csa treated groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280493 10077670 395058 7592 3711 FKBP1A rotamase rotamase 0 1.0 these results suggested that mutant sod expressing cells might be more sensitive to effects of decreased rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280494 10077670 395060 7592 3711 FKBP1A rotamase rotamase 0 1.0 our interpretation of these studies is that human sod/rodent sod heterodimers that are formed in the transiently expressing cells may be more sensitive to conformational changes resulting from rotamase inhibition than the homogeneous rodent homodimers present in controls. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280495 10077670 395063 7592 3711 FKBP1A rotamase rotamase 0 1.0 to further examine the role of cyclophilin rotamase activity on mutant sod induced cell death we transfected ngf differentiated pc12 cells with wild type cypa cypawt cdna or cypa r55a cdna that contains a point mutation in the putative rotamase active 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280496 10077670 395063 7592 3711 FKBP1A rotamase rotamase 0 1.0 activity on mutant sod induced cell death we transfected ngf differentiated pc12 cells with wild type cypa cypawt cdna or cypa r55a cdna that contains a point mutation in the putative rotamase active site. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280497 10077670 395067 7592 3711 FKBP1A rotamase rotamase 0 1.0 these results suggest that the rotamase function of cypa protects cells from death induced by sodv148g. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280498 10077670 395073 7592 3711 FKBP1A rotamase rotamase 0 1.0 these results suggest that modulating the rotamase activity is vital for the survival of mutant sod expressing cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280499 10077670 395093 16630 8988 PIN1 prolyl isomerase prolyl isomerase 0 1.0 in addition to inhibiting calcineurin and blocking the mptp csa blocks peptidyl prolyl isomerase rotamase activity of cyclophilins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280500 10077670 395093 7592 3711 FKBP1A rotamase rotamase 0 1.0 in addition to inhibiting calcineurin and blocking the mptp csa blocks peptidyl prolyl isomerase rotamase activity of cyclophilins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280501 10077670 395094 7592 3711 FKBP1A rotamase rotamase 0 1.0 immunophilin rotamase activity is believed to have a variety of actions in neurons 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280502 10077670 395095 7592 3711 FKBP1A rotamase rotamase 0 1.0 to test whether csa enhanced sodv148g toxicity through rotamase inhibition we examined the effect of immunosuppressants csa csg and fk506 as well as nonimmunosuppressants pkf 211_amp_#x02013;811 or psc 833 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280503 10077670 395096 7592 3711 FKBP1A rotamase rotamase 0 1.0 nonimmunosuppressants do not influence calcineurin activity but do inhibit rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280504 10077670 395097 7592 3711 FKBP1A rotamase rotamase 0 1.0 we found that both drug classes enhanced apoptosis induced by mutant sod indicating that the action of csa may be related to rotamase inhibition and not to calcineurin inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280505 10077670 395098 7592 3711 FKBP1A rotamase rotamase 0 1.0 a role for rotamase in mutant sod toxicity was supported by experiments comparing mutant sod induced cell death after expression of cypawt vs. an isomerase activity deficient mutant cypa r55a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280506 10077670 395100 7592 3711 FKBP1A rotamase rotamase 0 1.0 although a recent report concluded that cypa r55a may have more rotamase activity than previously suspected 33 34 it appears that this residual activity is insufficient to permit folding of fully functional proteins 17 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280507 10077670 395101 7592 3711 FKBP1A rotamase rotamase 0 1.0 our data highlight the importance of rotamase activity in modifying the effect of mutant sod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280508 10077670 395102 7592 3711 FKBP1A rotamase rotamase 0 1.0 the findings that rotamase activity protects cells from mutant sod induced cell death and that there is roughly similar rotamase activity after csa treatment in wt and mutant sod expressing cells suggests that cells expressing mutant sod have a greater reliance on rotamase activity and has implications on our understanding of 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280509 10077670 395102 7592 3711 FKBP1A rotamase rotamase 0 1.0 activity after csa treatment in wt and mutant sod expressing cells suggests that cells expressing mutant sod have a greater reliance on rotamase activity and has implications on our understanding of the mechanism of this toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280510 10077670 395105 7592 3711 FKBP1A rotamase rotamase 0 1.0 the increased protein turnover may enhance the need for rotamase function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280511 10077670 395106 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase also may be needed to refold proteins that are partly denatured by oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280512 10077670 395108 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase may be required to maintain proteins in a correct conformation during their transport in motor axons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280513 10077670 395110 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase also may have a role in the normal folding of sod itself to help stabilize the enzyme or its dimers. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280514 10077670 395113 7592 3711 FKBP1A rotamase rotamase 0 1.0 mutant sod expression than after sodwt expression suggesting that the mutant enzyme was more sensitive than wt to the effects of csa perhaps because the mutant sod was more sensitive to a decline in rotamase activity and the consequences of misfolding. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280515 10077670 395114 7592 3711 FKBP1A rotamase rotamase 0 1.0 it also may be that other proteins perhaps ones that interact with sod are more sensitive to decreased rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280516 10077670 395115 7592 3711 FKBP1A rotamase rotamase 0 1.0 our observations have implications regarding possible therapy of fals suggesting the potential use of chaperone proteins or of agents that modulate rotamase activity to correct the deficits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280517 10077670 395120 7592 3711 FKBP1A rotamase rotamase 0 1.0 rather our studies suggest that these drugs worsen the fals mediated cell death because of rotamase inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280518 10077670 395141 7592 3711 FKBP1A rotamase rotamase 0 1.0 table 1 mean rotamase and sod activity _amp_#x0005b;percent of control mock infected pc12 cells_amp_#x0005d; 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280519 10077670 395143 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 als amyotrophic lateral sclerosis sod cu/zn superoxide dismutase 1 fals familial als cyp cyclophilin wt wild type ngf nerve growth factor adv adenovirus csa cyclosporin a nmda n methyl d aspartate mptp mitochondrial permeability transition pore 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280521 10077670 395143 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 als amyotrophic lateral sclerosis sod cu/zn superoxide dismutase 1 fals familial als cyp cyclophilin wt wild type ngf nerve growth factor adv adenovirus csa cyclosporin a nmda n methyl d aspartate mptp mitochondrial permeability transition pore 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280523 10077670 395146 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 in 1993 mutations in cu/zn superoxide dismutase 1 sod were found to be associated with 20_amp_#x00025; of cases of familial als fals 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280524 10077670 395153 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 it recently has been reported that the expression of fals associated mutant sod in nerve growth factor ngf differentiated pc12 cells primary sympathetic neurons and hippocampal neurons leads to altered o 2 content and an apoptotic cell death 12 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280525 10077670 395155 7592 3711 FKBP1A rotamase rotamase 0 1.0 suppressants bind immunophilins _amp_#x0005b;the drug receptor: e.g. cyclophilins cyp or fk binding protein_amp_#x0005d; and the drug immunophilin complex inhibits calcineurin activity as well as the rotamase peptidyl prolyl cis_amp_#x02013;trans isomerase activity of the immunophilins 13 14 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280526 10077670 395156 7592 3711 FKBP1A rotamase rotamase 0 1.0 rotamase facilitates cis_amp_#x02013;trans isomerization of the peptide bond on the n terminal side of proline residues aids normal folding and assembly of proteins including sod and has other cellular functi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280527 10077670 395160 7592 3711 FKBP1A rotamase rotamase 0 1.0 most importantly we show that immunosuppressant drugs csa csg and fk506 enhance cell death induced by mutant sod and that this enhancement depends on rotamase inhibition. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280528 10077670 395161 7592 3711 FKBP1A rotamase rotamase 0 1.0 these findings suggest that mutant sod may lead to increased protein damage or turnover and a greater reliance on rotamase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280529 10077670 395162 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase|calcineurin|immunophilins| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 272059 10544701 379957 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 lateral amyotrophic sclerosis: the discovery of a mutation in the copper zinc superoxide dismutase gene in patients with lateral amyotrophic sclerosis has made it possible to analyze the events leading to neuron death in transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273154 10593879 381898 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 tive oxygen species ros play a role in the pathogenesis of amyotrophic lateral sclerosis als a unique microdialysis or microcannula sampling technique was used in mice transfected with a mutant cu zn superoxide dismutase sod1 gene from humans with familial als mice transfected with the normal human sod1 gene and normal mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273155 10593879 381905 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 key words: mutation of cu zn superoxide dismutase gene _amp_#149; transgenic mouse _amp_#149; hydrogen peroxide _amp_#149; hydroxyl radical _amp_#149; superoxide anion 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273156 10593879 381907 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the finding of a single site mutation in the cu zn superoxide dismutase sod1 gene in familial als fals patients 2 3 linked this disease to free radicals 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273157 10593879 381913 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations of the sod1 gene reduce superoxide dismutase activity 2 3 8 9 10 11 ; this should elevate levels of o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273158 10593879 381970 3544 1516 CAT catalase catalase 0 1.0 h 2 o 2 produced from o 2 is converted to h 2 o by catalase and glutathione peroxidase gsh px the normal detoxification pathway of h 2 o 2 although some h 2 o 2 may be converted to oh by sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273159 10593879 381972 3544 1516 CAT catalase catalase 0 1.0 this is probably due to efficient h 2 o 2 removal which is the normal catalytic function of gsh px and catalase. msod1 mice had significantly higher levels of h 2 o 2 and oh than did the sod1 and nc mice and significantly lower levels of o 2 than the nc mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273160 10593879 381984 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the sod1 dimer may act in tandem as a superoxide dismutase and a peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273161 10593879 381985 3544 1516 CAT catalase catalase 0 1.0 it may work together with the detoxification enzymes such as catalase and gsh px to remove the h 2 o 2 produced from o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273162 10593879 382041 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 acsf was first pumped through the system at 15 microl/min for 1 h after placement of the perfusing loop then cytochrome c 50 microm in acsf was administered through the loop. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273163 10593879 382043 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the perfusates were centrifuged and reduced cytochrome c in the supernatant was measured by a spectrophotometer at a wavelength of 550 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273164 10593879 382044 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 to determine the levels of o 2 in the spinal cord tissue 500 microm cytochrome c was infused into the intrathecal space by the loop through the holes made in the wall at a flow rate of 1 microl/min for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273165 10593879 382046 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the tissue was dropped into a vial containing 500 microm cytochrome c in acsf then homogenized and centrifuged; the supernatant was passed through a 30 000 molecular weight ultrafiltration membrane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273166 10593879 382049 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 a the absorbance of reduced cytochrome c measured in the perfusates collected from msod1 n =6 sod1 n =3 and nc mice n =6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273167 10593879 382051 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 b the absorbance of reduced cytochrome c measured in spinal cord tissue in msod1 n =3 sod1 n =3 and nc mice n =4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273168 10593879 382101 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the levels of o 2 in the terminal cistern were sampled by a microcannula and determined by measuring reduced cytochrome c in the perfusates using our unique method 40 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273169 10593879 382102 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after the initial acsf perfusion the perfusing fluid was changed to cytochrome c 50 microm in acsf solution and equilibrated for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273170 10593879 382105 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 reduced cytochrome c in the supernatant was measured by a spectrophotometer at a wavelength of 550 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273171 10593879 382106 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 to determine the level of o 2 in the spinal cord tissue 500 microm cytochrome c was infused into the intrathecal space by the loop through the holes made on the wall at a flow rate of 1 microl/min for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273172 10593879 382108 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the tissue was removed and transferred into a vial containing 500 microm cytochrome c in acsf homogenized centrifuged at 13 000 x g for 15 min and the supernatant was passed through a 30 000 molecular weight ultrafiltration membrane micron separation inc. westborough mass. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273173 10593879 382148 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the average absorbance of reduced cytochrome c mean_amp_#177; sd is 0.060 _amp_#177; 0.011 in msod1 mice n =6 0.037 _amp_#177; 0.004 in sod1 mice n =3 and 0.130 _amp_#177; 0.030 in nc mice n =6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 273174 10593879 382152 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the average absorbance of reduced cytochrome c mean_amp_#177; sd absorbance/g wet weight tissue is 158 _amp_#177; 10 in msod1 mice n =3 138 _amp_#177; 10 in sod1 mice n =3 and 186 _amp_#177; 12 in nc mice n =4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267190 10627601 370983 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 considerable evidence supports a link between ca influx and glutamate receptor mediated neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267191 10627601 371012 6438 3229 EGF epidermal growth factor epidermal growth factor 0 1.0 glial cultures were prepared similarly except that tissue was obtained from early postnatal 1 3 d mice and plating media was supplemented with epidermal growth factor 10 ng/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267192 10627601 371024 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 exposures were terminated by replacing the exposure solution with mem + glucose along with the ionotropic glutamate receptor antagonists mk 801 and nbqx both at 10 micro m and returning the cultures to the 37degreec 5% co 2 incubator. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267193 10627601 371099 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 indeed gabaergic interneurons are characterized by the strong expression of cbps including parvalbumin celio 1986 calretinin rogers 1992 and calbindin d28k hendry and jones 1991 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267194 10627601 371110 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 although one must be careful in extrapolating findings in murine cultures to human disease it is notable that even across species motor neurons in vitro and in vivo seem to express similar glutamate receptor profiles and vulnerabilities to ampa/kainate receptor mediated injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267926 10643818 372644 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 this pathway is relevant for induction of long term potentiation while protein kinase c pkc causes maintenance of long term potentiation and protein kinase c can be induced by calcium arachidonate and reactive oxygen species fig 1b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267927 10643818 372646 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 in functional synergism 12 lipoxygenase is directly inhibited by reduced glutathione [ 5 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267928 10643818 372654 7333 11920 FAS fas antigen fas antigen 0 1.0 erm potentiation has been attributed to programmed cell death in t lymphocytes [ 7 and 8 ] and has been inferred from studies of tnf receptor dependent signaling [ 9 10 and 11 ] and engagement of the fas antigen [ 12 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267929 10643818 372655 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 two markers of oxidative stress in the central nervous system expression of heme oxygenase 1 and nuclear localization of nf kb p50 [ 13 ] are intimately associated with the outlined pathway because heme oxygenase 1 may activate cgmp kinase [ 7 ] while the nf kb proteins p50 and p49 are substrates for this enzyme weber unpublished results . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267930 10643818 372656 7683 3796 FOS c fos c fos 0 1.0 cyclic gmp dependent kinase also induces expression of c fos possibly via activation of sre creb or fap [ 14 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267931 10643818 372658 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 this is accomplished by the redox cycle catalyzed by glutathione peroxidase and glutathione reductase which can scavenge reactive oxygen intermediates including hpete during glutathione oxidation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267932 10643818 372659 606 429 ALOX12 12-lipoxygenase 12 lipoxygenase 0 1.0 in conjunction with direct inhibition of 12 lipoxygenase by glutathione [ 5 ] this mechanism may account for protection from excitotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267934 10643818 372664 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267935 10643818 372664 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267936 10643818 372664 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267937 10643818 372669 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 during apoptosis they may be cleaved distal to their normal cleavage sites and a mutation in presenilin 2 that is related to familial alzheimer's disease favors this alternative cleavage which may either directly enhance apoptosis or diminish the apoptosis regulating function of the wild type fragments [ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267938 10643818 372670 10827 6207 JUP catenin catenin 0 1.0 furthermore a complex of presenilin and _amp_#x3b2; or _amp_#x3b4; catenin can activate _amp_#x3b3; secretase the enzyme that releases the amyloid fragment a_amp_#x3b2; 1 42 with a consequent increase in the excreted amyloid _amp_#x3b2;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267940 10643818 372671 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e apoe protects neurons from hydrogen peroxide toxicity and binds specific metal ions including iron which could otherwise catalyze the generation of hydroxyl radicals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267942 10643818 372672 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 the gene product of apolipoprotein e allele epsilon 4 has decreased anti oxidant activity compared to alleles epsilon 2 and 3 [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267944 10643818 372673 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e may also protect from _amp_#x3b2; amyloid peptide toxicity by binding to amyloid _amp_#x3b2; and under certain circumstances acting as kinetic inhibitor of amyloid formation [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267945 10643818 372682 9434 4983 HMGB1 amphoterin amphoterin 0 1.0 this receptor can also be engaged by amphoterin and is physiologically involved in neurite outgrowth. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267946 10643818 372697 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 some cases of familial amyotrophic lateral sclerosis are characterized by mutations of copper_amp_#x2013;zinc superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267947 10643818 372699 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 this question arises particularly in view of the observation that superoxide dismutase activities in erythrocytes from patients may be reduced by 50% compared with healthy controls [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267948 10643818 372701 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase may act as a peroxidase [ 33 and 34 ] with mutated superoxide dismutase catalyzing substrate oxidation by hydrogen peroxide at a higher rate than wild type enzyme [ 35 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267949 10643818 372710 3544 1516 CAT catalase catalase 0 1.0 peroxidase and catalase activities are reduced in the substantia nigra caudate and putamen in parkinson's disease [ 43 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267950 10643818 372720 8759 4553 GPX1 cellular glutathione peroxidase cellular glutathione peroxidase 0 1.0 furthermore around 10% of cellular glutathione peroxidase are mitochondrial and there prevent oxidative damage by hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267951 10643818 372724 8278 4250 GGT1 glutamyl transpeptidase glutamyl transpeptidase 0 1.0 of the glutathione cycle is particularly important in the central nervous system because deficiency of enzymes associated with it glutathione synthetase _amp_#x3b3; glutamyl synthetase or _amp_#x3b3; glutamyl transpeptidase leads to defective brain function [ 49 and 50 ] in addition to acidosis and a tendency to hemolysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267952 10643818 372724 8857 4624 GSS glutathione synthetase glutathione synthetase 0 1.0 the regulatory role of the glutathione cycle is particularly important in the central nervous system because deficiency of enzymes associated with it glutathione synthetase _amp_#x3b3; glutamyl synthetase or _amp_#x3b3; glutamyl transpeptidase leads to defective brain function [ 49 and 50 ] in addition to acidosis and a tendency to hemolysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267953 10643818 372740 16737 15917 PLCB1 phospholipase c phospholipase c 0 1.0 pla 2 : phopholipase a 2 plc: phospholipase c dag: diacyl glycerol aa: arachidonic acid pkc: protein kinase c gpx: glutathione peroxidase nos: no synthetase ltp: long term potentiation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267954 10643818 372740 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 pla 2 : phopholipase a 2 plc: phospholipase c dag: diacyl glycerol aa: arachidonic acid pkc: protein kinase c gpx: glutathione peroxidase nos: no synthetase ltp: long term potentiation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267955 10643818 372743 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 maintenance dashed arrows of long term potentiation is mediated by protein kinase c which can be activated by calcium arachidonate or hydroxyl radical from the pathway to induction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267956 10643818 372755 8278 4250 GGT1 glutamyl transpeptidase glutamyl transpeptidase 0 1.0 glutathione is then transported and converted by membrane bound _amp_#x3b3; glutamyl transpeptidase followed by cleavage by membrane bound dipeptidase. _amp_#x3b3; glutamyl amino acids are transported into the cell and converted to glutamate via oxoproline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268278 10671549 373491 7568 3701 FHIT tumor suppressor protein tumor suppressor protein 0 1.0 tumor suppressor protein p53 and cell cycle inhibitor p21 accumulate as an early sign of s nitrosoglutathione mediated toxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268279 10671549 373492 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 cytochrome c release from mitochondria and caspase 3 activation also occurred. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268280 10671549 373492 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c release from mitochondria and caspase 3 activation also occurred. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268281 10671549 373493 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cells transfected with either wild type wt or mutant g93a cu zn superoxide dismutase cu zn sod produced comparable amounts of nitrite/nitrate but showed different degree of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268282 10671549 373495 1576 990 BCL2 bcl 2 bcl 2 0 1.0 we linked decreased susceptibility of the wt cells to higher and more stable bcl 2 and decreased reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268283 10671549 373497 1576 990 BCL2 bcl 2 bcl 2 0 1.0 furthermore g93a cells showed a significant decrease of bcl 2 expression and as target of no derived radicals showed lower cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268285 10671549 373497 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 furthermore g93a cells showed a significant decrease of bcl 2 expression and as target of no derived radicals showed lower cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268286 10671549 373510 1576 990 BCL2 bcl 2 bcl 2 0 1.0 among these the protein product of bcl 2 protooncogene plays a pivotal role in apoptosis by regulating cytochrome c efflux from mitochondria which in turn activates cysteine proteases caspases ultimately leading to specific dna fragmentatio 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268287 10671549 373510 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 among these the protein product of bcl 2 protooncogene plays a pivotal role in apoptosis by regulating cytochrome c efflux from mitochondria which in turn activates cysteine proteases caspases ultimately leading to specific dna fragmentation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268288 10671549 373511 1576 990 BCL2 bcl 2 bcl 2 0 1.0 constitutive expression of high bcl 2 protein levels by transfection experiments has proven that bcl 2 or related family members can protect from no mediated apoptosis 15 16 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268289 10671549 373518 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the enzyme superoxide dismutase sod may play a fundamental role in modulating no toxicity since it acts as an antioxidant dismutating o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268290 10671549 373524 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the results obtained showed that gsno mediated apoptosis in these cells is associated with a canonical sequence of events including bcl 2 p53 and p21 modulation cytochrome c release in the cytosol and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268291 10671549 373524 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 he results obtained showed that gsno mediated apoptosis in these cells is associated with a canonical sequence of events including bcl 2 p53 and p21 modulation cytochrome c release in the cytosol and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268292 10671549 373524 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the results obtained showed that gsno mediated apoptosis in these cells is associated with a canonical sequence of events including bcl 2 p53 and p21 modulation cytochrome c release in the cytosol and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268293 10671549 373529 1576 990 BCL2 bcl 2 bcl 2 0 1.0 se inhibitor mixture dithiothreitol dtt sulfanilamide p aminobenzenesulfonamide phenylmethylsulfonyl fluoride n 1 naphthyl ethylenediamine dihydrochloride bathocuproinedisulfonic acid monoclonal anti bcl 2 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268294 10671549 373529 1576 990 BCL2 bcl 2 bcl 2 0 1.0 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268295 10671549 373529 9950 5472 IGFBP3 bp 53 bp53 0 1.0 amide p aminobenzenesulfonamide phenylmethylsulfonyl fluoride n 1 naphthyl ethylenediamine dihydrochloride bathocuproinedisulfonic acid monoclonal anti bcl 2 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268296 10671549 373529 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 obenzenesulfonamide phenylmethylsulfonyl fluoride n 1 naphthyl ethylenediamine dihydrochloride bathocuproinedisulfonic acid monoclonal anti bcl 2 clone bcl 2 100 monoclonal anti p53 clone bp53 12 and cytochrome c horse heart were obtained from sigma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268297 10671549 373530 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 ac devd amc caspase 3 inhibitor i ac devd cho hoechst 33342 diethylamine nonoate nono and 3 [ _amp_#177; e ethyl 2' [ e hydroxyimino] 5 nitro 3 exenecarbamoyl]pyridine nor 4 were purchased from calbiochem. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268298 10671549 373531 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 anti cytochrome c monoclonal antibody clone 7h8.2c12 was from pharmingen san diego ca . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268299 10671549 373542 20997 11180 SOD2 mn sod mn sod 0 1.0 transfected cells had the same antioxidant pattern such as of mn sod as sh sy5y cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268300 10671549 373574 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytosolic cytochrome c determination cells detached and attached were washed with pbs and collected by centrifugation at 700 _amp_#215; g for 5 min at 4 degreec. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268301 10671549 373578 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 purified cytochrome c from horse heart was used as standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268302 10671549 373579 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 purified mouse anti cytochrome c monoclonal antibody was used as primary antibody 1:5000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268303 10671549 373581 1576 990 BCL2 bcl 2 bcl 2 0 1.0 p53 p21 and bcl 2 proteins detection cell pellet was resuspended in lysis buffer containing 10 m m tris/hcl ph 7.4 5 m m edta 150 m m nacl 0.5% octyphenoxy polyethoxyethanol igepal ca 630 sigma and protease inhibitors 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268304 10671549 373583 1576 990 BCL2 bcl 2 bcl 2 0 1.0 sates were then centrifuged at 14 000 _amp_#215; g for 15 min at 4 degreec and supernatants were removed and stored at 80 degreec. 50 microg of proteins were loaded on a 10 for p53 or 12% for p21 and bcl 2 polyacrylamide gel. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268305 10671549 373584 1576 990 BCL2 bcl 2 bcl 2 0 1.0 monoclonal anti bcl 2 1:5000 monoclonal anti p53 1:5000 or polyclonal anti p21 1:500 was used as primary antibodies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268306 10671549 373587 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activation cells attached and detached were washed and collected by centrifugation at 700 _amp_#215; g for 5 min at 4 degreec. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268307 10671549 373590 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 supernatants were used for caspase 3 assay in lysis buffer containing the specific substrate ac devd amc 12 micro m at 30 degreec. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268308 10671549 373592 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 specific activity was demonstrated by the use of the caspase 3 inhibitor i ac devd cho that completely impedes the development of fluorescence due to the cleaved product. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268309 10671549 373593 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cu zn superoxide dismutase activity cells attached and detached were washed and collected by centrifugation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268310 10671549 373598 20997 11180 SOD2 mn sod mn sod 0 1.0 under these conditions the activity of mn sod is almost fully inhibited 33 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268312 10671549 373603 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 cytochrome c oxidase activity cells attached and detached were washed and collected by centrifugation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268314 10671549 373605 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 lysates were used for cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268315 10671549 373606 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the activity was measured spectrophotometrically monitoring the oxidation of cytochrome c horse heart which had previously been reduced by treatment with excess ascorbate followed by passage on sephadex g 25 resin amersham pharmacia biotech . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268316 10671549 373608 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 activity was expressed as micromoles of cytochrome c oxidized per min mg protein using an extinction coefficient of 27.6 m m cm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268317 10671549 373648 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 the reaction between gsh and no has been suggested to be catalyzed by ceruloplasmin a multicopper oxidase involved in iron metabolism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268318 10671549 373653 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 it has been demonstrated that p21 cleavage could be reproduced in extracts prepared from irradiated cells or by recombinant caspase 3 suggesting that a caspase like activity is responsible for this cleavage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268319 10671549 373656 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 nuclear apoptosis is preceded by the disruption of the mitochondrial transmembrane potential which in turn can facilitate the release of pro apoptotic proteins such as cytochrome c through the opening of the mitochondrial permeability transition pore 54 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268320 10671549 373658 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in a previous report regarding another cell model system undergoing apoptosis 56 we demonstrated that cytochrome c release from mitochondria followed oxidative stress consequent to glutathione depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268321 10671549 373659 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 furthermore this phenomenon could be observed in healthy cells as well suggesting that cytochrome c release is part of a more general mechanism related to redox unbalance. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268322 10671549 373660 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in contrast to this hypothesis in the present report gsno treatment led to cytochrome c release with the maintenance of high intracellular glutathione concentration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268323 10671549 373662 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 moreover in the g93a cells a small level of released cytochrome c was also detected in the untreated cells indicating that these cells in culture may spontaneously die by apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268324 10671549 373663 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 taken together these results point to a mechanism for cytochrome c release different from that related to glutathione depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268326 10671549 373664 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 a specific marker of no toxicity was the decrease of cytochrome c oxidase activity which paralleled the extent of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268327 10671549 373666 1576 990 BCL2 bcl 2 bcl 2 0 1.0 an alternative model for protein export from mitochondria depends on bax and/or bid two members of the bcl 2 protein family 57 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268328 10671549 373667 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 it involves the translocation of bid or bax from cytosol to mitochondria where they may possibly form a pore as shown for the related protein bcl xl 58 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268329 10671549 373668 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in our experiments bcl 2 was down regulated by the gsno treatment in sh sy5y cells whereas the resistance of wt cells to apoptosis was associated with a higher level of this protein in the treated cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268330 10671549 373670 1576 990 BCL2 bcl 2 bcl 2 0 1.0 since they were the most prone to no induced apoptosis we propose a causative role for bcl 2 in the increased susceptibility of g93a cells to apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268331 10671549 373671 1576 990 BCL2 bcl 2 bcl 2 0 1.0 it has been suggested that the antiapoptotic effects of bcl 2 be at least in part due to its antioxidant activity 59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268332 10671549 373672 1576 990 BCL2 bcl 2 bcl 2 0 1.0 t known it is established that the cytosolic steady state of reactive oxygen species which are potentially threatening species and modulators of physiological signal transduction 60 is increased when bcl 2 is down regulated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268333 10671549 373687 1576 990 BCL2 bcl 2 bcl 2 0 1.0 a vicious circle including down regulation of bcl 2 and deviating redox activity of copper in the g93a mutant may be the amplification factor leading to ros unbalance in g93a cells and may explain how and why an als mutant cause a pro apoptotic respon 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268334 10671549 373705 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 a cytochrome c released in the cytosol was detected by western blotting using a monoclonal antibody as described under "experimental procedures." 50 microg of cytosolic protein were loaded on each lane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268335 10671549 373706 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 lane 1 sh sy5y cells; lane 2 gsno treated; lane 3 g93a cells; lane 4 gsno treated; lane 5 wt cells; lane 6 gsno treated; lane 7 purified cytochrome c. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268336 10671549 373707 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 b caspase 3 activity was measured fluorometrically with ac devd amc as substrate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268337 10671549 373709 9600 5173 HRAS p21 protein p21 protein 0 1.0 immunoreactive p53 protein c and immunoreactive p21 protein d were measured by western blotting using monoclonal antibody as detailed under "experimental procedures." 50 microg protein of cell extracts was applied to each lane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268338 10671549 373712 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 content of sh sy5y cells and effects on it by cu zn sod and gsno treatment. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268339 10671549 373713 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 immunoreactive protein was detected by western blotting using a monoclonal antibody as described under "experimental procedures." 50 microg protein of cell extracts was loaded on each lane. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268341 10671549 373733 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 b activity of cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268343 10671549 373734 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 spectrophotometric determination of cytochrome c oxidase activity was performed as described under "experimental procedures." 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268344 10671549 373742 1576 990 BCL2 bcl 2 bcl2 0 1.0 apoptotic markers: cytochrome c release caspase activation p53 accumulation p21 increase and bcl2 down regulation to examine the sequence of events occurring upon gsno toxicity we measured some of the molecular markers of apoptotic cell death at 48 h from the apoptogenic stimulus. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268345 10671549 373742 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 apoptotic markers: cytochrome c release caspase activation p53 accumulation p21 increase and bcl2 down regulation to examine the sequence of events occurring upon gsno toxicity we measured some of the molecular markers of apoptotic 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268346 10671549 373743 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytosolic extracts were prepared under conditions that keep mitochondria intact and cytosolic cytochrome c protein levels were measured by immunoblot analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268347 10671549 373744 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the cytosol from untreated sh sy5y and wt cells contained no detectable amounts of cytochrome c whereas untreated g93a cells had a small level of released cytochrome c probably as result of spontaneous apoptotic death fig 3 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268348 10671549 373745 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytosolic cytochrome c accumulated after gsno treatment; the release was highest for g93a cells and almost at the limit of detection for wt cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268349 10671549 373746 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 proteolytic activity associated to caspases was measured by testing the cytosolic extracts for their ability to cleave the fluorimetric substrate ac devd amc which is specific for caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268350 10671549 373747 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activation is important in the cascade of proteolytic events of apoptosis in that it is considered one of the points of no return in the process leading to cell destruction 40 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268351 10671549 373748 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activation followed the same trend as cytochrome c release with higher activity in the cytosolic extracts of g93a cells than in sh sy5y and wt cells fig 3 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268352 10671549 373748 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 caspase 3 activation followed the same trend as cytochrome c release with higher activity in the cytosolic extracts of g93a cells than in sh sy5y and wt cells fig 3 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268353 10671549 373751 2167 13716 C4orf6 expressed in neuroblastoma expressed in neuroblastoma 0 1.0 fig. 3 c shows that the p53 protein was stably expressed in neuroblastoma cells to a varying extent; in particular wt cells showed a lower p53 protein level with respect to sh sy5y cells and g93a cells which showed the higher level. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268354 10671549 373761 1576 990 BCL2 bcl 2 bcl 2 0 1.0 bcl 2 protein modulation is responsible for cell survival or suicide; constitutive expression of high bcl 2 protein levels by transfection experiments has proven that bcl 2 or related family members can protect cells from no mediated apoptosis 44 45 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268355 10671549 373762 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in our experiments as evidenced by western blot analysis untreated sh sy5y and wt cells express high levels of bcl 2 protein whereas g93a cells show a much lower content fig 4 . 48 h of gsno treatment decreased bcl 2 expression although to a different extent; in particular bcl 2 content of g93a cells was at the lim 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268356 10671549 373762 1576 990 BCL2 bcl 2 bcl 2 0 1.0 protein whereas g93a cells show a much lower content fig 4 . 48 h of gsno treatment decreased bcl 2 expression although to a different extent; in particular bcl 2 content of g93a cells was at the limit of detection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268358 10671549 373777 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 among the above mentioned molecular target of no toxicity the hemoprotein cytochrome c oxidase appears to be the only one strongly affected by gsno insult and protected by native cu zn sod fig 7 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268359 10671549 373783 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 nono diethylamine nonoate; nor 4 3 [ _amp_#177; e ethyl 2' [ e hydroxyimino] 5 nitro 3 exenecarbamo yl]pyridine; dcf da 2' 7' dichlorodihydrofluorescein diacetate; ac devd amc ac asp glu val asp amc caspase 3 substrate ii fluorogenic; ac devd cho ac asp glu val asp cho caspase 3 inhibitor i; ros reactive oxygen species; fals familial amyotrophic lateral sclerosis; pipes piperazine n n ' bis[2 ethanesulfon 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268360 10671549 373783 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 substrate ii fluorogenic; ac devd cho ac asp glu val asp cho caspase 3 inhibitor i; ros reactive oxygen species; fals familial amyotrophic lateral sclerosis; pipes piperazine n n ' bis[2 ethanesulfonic acid]; chaps 3 [cholamindopropyl dimethylammonio] 1 propanesulfonate 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268361 10671549 373783 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the abbreviations used are: no nitric oxide; wt sh sy5y transfected with wild type cu zn sod; g93a sh sy5y transfected with mutant g93a cu zn sod; cu zn sod copper zinc superoxide dismutase; gsno s nitrosoglutathione; nono diethylamine nonoate; nor 4 3 [ _amp_#177; e ethyl 2' [ e hydroxyimino] 5 nitro 3 exenecarbamo yl]pyridine; dcf da 2' 7' dichlorodihydrofluorescein diacetate; ac devd 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268362 10671549 373784 1576 990 BCL2 bcl 2 bcl 2 0 1.0 cytochrome c group|nitroso compounds|proto oncogene proteins c bcl 2|tumor suppressor protein p53|nitric oxide|s nitrosoglutathione|glutathione|superoxide dismutase|caspases|oncogene protein p2| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268363 10671549 373784 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c group|nitroso compounds|proto oncogene proteins c bcl 2|tumor suppressor protein p53|nitric oxide|s nitrosoglutathione|glutathione|superoxide dismutase|caspases|oncogene protein p2| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264089 10742195 364686 17649 9655 PTPN3 tyrosine phosphatase tyrosine phosphatase 0 1.0 enzymes: caspase 3 critical for initiating apoptosis was inhibited by zn 2+ with an ic 50 _amp_#x3c; 10 nm 1:1 stoichiometry ; and the ic 50 for fructose 1 6 diphosphatase aldehyde dehydrogenase and tyrosine phosphatase were 100_amp_#x2013;200 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264090 10742195 364686 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 vallee_amp_#x2019;s group [ 3 ] has now shown that nanomolar levels of zn 2+ modulated by mt regulate the activities of metabolically critical enzymes: caspase 3 critical for initiating apoptosis was inhibited by zn 2+ with an ic 50 _amp_#x3c; 10 nm 1:1 stoichiometry ; and the ic 50 for fructose 1 6 diphosphatase aldehyde dehydrogenase and tyrosine phosphatas 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264091 10742195 364686 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 s of metabolically critical enzymes: caspase 3 critical for initiating apoptosis was inhibited by zn 2+ with an ic 50 _amp_#x3c; 10 nm 1:1 stoichiometry ; and the ic 50 for fructose 1 6 diphosphatase aldehyde dehydrogenase and tyrosine phosphatase were 100_amp_#x2013;200 nm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264092 10742195 364693 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the most important recent contribution to understanding basic neuronal cu 2+ metabolism has been the elaboration of the copper chaperone of superoxide dismutase ccs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264093 10742195 364695 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 recently ccs was reported to play an essential role in loading cu 2+ onto superoxide dismutase sod 1 under conditions of low cytosolic cu 2+ [ 8 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264094 10742195 364701 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh _amp_#x2022; [ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264095 10742195 364701 23482 12442 TYR tyrosinase tyrosinase 0 1.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264097 10742195 364701 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh _amp_#x2022; [ 10 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264098 10742195 364733 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 familial ad linked mutations of amyloid precursor protein app presenilin 1 and presenilin 2 increase both cerebral a_amp_#x3b2; burden and a_amp_#x3b2;1 42 production underscoring the role that a_amp_#x3b2; metabolism plays in ad pathogenesis see [ 10 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264099 10742195 364733 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 familial ad linked mutations of amyloid precursor protein app presenilin 1 and presenilin 2 increase both cerebral a_amp_#x3b2; burden and a_amp_#x3b2;1 42 production underscoring the role that a_amp_#x3b2; metabolism plays in ad pathogenesis see [ 10 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264101 10742195 364742 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 we have also reported [ 25 ] that apolipoprotein e apoe modulates the precipitation of a_amp_#x3b2; by cu 2+ and zn 2+ which is important because apoe isoforms segregate with the genetic risk for ad; inheritance of the apoe4 isoform carries the great 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264102 10742195 364792 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 in familial pd a mutation of the alpha synuclein gene has been identified which is important because alpha synuclein is a component of lewy bodies which typify the neuropathology. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264103 10742195 364793 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 one recent report [ 49 ] proposes abnormal interaction of alpha synuclein with cu 2+ in the formation of lewy bodies but the concentrations of cu 2+ used in the study were far in excess of what is likely in the tissue. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264104 10742195 364795 7975 3951 FXN frataxin frataxin 0 1.0 friedrich_amp_#x2019;s ataxia fa is a disease characterized by neurodegeneration and cardiomyopathy and is caused by a mutation of frataxin a mitochondrial protein involved in iron homeostasis and respiratory function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264105 10742195 364796 7975 3951 FXN frataxin frataxin 0 1.0 frataxin has recently been shown to export non heme bound iron from the mitochondria hence the mutation appears to cause a loss of function that raises iron levels in the mitochondria [ 50 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 261647 10899935 360029 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 calcineurin activity is regulated both by redox compounds and by mutant familial amyotrophic lateral sclerosis superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 261648 10899935 360033 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 evidence for the existence of a redox regulation of this enzyme has been also obtained by overexpression of wild type antioxidant cu zn superoxide dismutase sod1 that promotes cn activity and protects it from oxidative inactivation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262352 10930589 361587 3544 1516 CAT catalase catalase 0 1.0 further cells incubated with vitamin c catalase or the flavinoid quercetin significantly reduced ros in all groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262353 10930589 361588 3544 1516 CAT catalase catalase 0 1.0 the catalase inhibitor 3 amino 1 2 4 triazole resulted in a ten fold increase of ros in all groups. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262354 10930589 361589 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 neither nitroarginine a nitric oxide synthase inhibitor or vitamin e altered the ros levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262355 10930589 361596 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 about 2% of als cases are associated with missense mutations in the gene for cytosolic cu zn superoxide dismutase sod1 cuznsod [ 1 and 2 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262356 10930589 361621 3544 1516 CAT catalase catalase 0 1.0 lactate dehydrogenase ldh activity was used to calculate the specific fluorescence. nitroarginine aldrich catalase boehringer mannheim and other chemicals sigma studied were added 15 min before loading of the cells with c dcdhf da am table 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262357 10930589 361665 3544 1516 CAT catalase catalase 0 1.0 sod1 is a major source of h 2 o 2 in cells [ 20 ] and catalase and glutathione peroxidase are the primary enzymes responsible for decomposition of h 2 o 2 [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262358 10930589 361668 3544 1516 CAT catalase catalase 0 1.0 catalase reduced the c dcf fluorescence in resting or menadione stimulated cells in all three groups of cells tested. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262359 10930589 361669 3544 1516 CAT catalase catalase 0 1.0 however the reduction was more pronounced in menadione stimulated cells. 3 amino 1 2 4 triazole 3 at an inhibitor of catalase [ 22 and 23 ] increased the c dcf fluorescence of all three types of cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262360 10930589 361674 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 quercetin a bio flavonoid molecule with antioxidant properties [ 26 ] showed effects similar to ascorbic acid. nitroarginine an inhibitor of nitric oxide synthase nos [ 27 ] did not affect the c dcf fluorescence in resting cells of any group. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 262361 10930589 361702 3544 1516 CAT catalase catalase 0 1.0 reduction of c dcf fluorescence by catalase and other antioxidants vitamin c and the flavinoid quercetin but not inhibitor of nos supports the conclusion that c dcdhf was oxidized by h 2 o 2 table 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257639 11050436 352940 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the transformation of this superoxide into hydrogen peroxide and under certain conditions then into hydroxyl radicals is important in diseases where respiratory chain function is abnormal or where superoxide dismutase function is altered as in amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257640 11050436 352949 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 ubiquinol cytochrome c oxidoreductase is responsible for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the rieske iron sulphur protein and cytochrome c 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257641 11050436 352949 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 complex iii ubiquinol cytochrome c oxidoreductase is responsible for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the riesk 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257642 11050436 352949 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ble for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the rieske iron sulphur protein and cytochrome c 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257643 11050436 352949 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257644 11050436 352949 5283 2579 CYC1 cytochrome c-1 cytochrome c 1 0 1.0 ble for taking reducing equivalents which are generated in complexes i and ii and contained in ubiquinol and transfer ring them through reactions with cytochrome b the rieske iron sulphur protein and cytochrome c 1 to the final electron acceptor cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257645 11050436 352951 23742 30862 UQCR ubiquinol-cytochrome c reductase ubiquinol cytochrome c reductase 0 1.0 the q cycle mechanism proposed for the operation of the ubiquinol cytochrome c reductase operates as follows. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257647 11050436 352952 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 iquinol donates one electron to the rieske iron sulphur protein a myxathiazol inhibitor site generating a semiquinone in proximity to the outer face of the inner membrane which then reduces the first cytochrome b haem b l . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257648 11050436 352953 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 the second cytochrome b haem b h situated closer to the matrix side of the membrane accepts an electron from the first haem and reduces ubiquinone to form ubisemiquinone and subsequently with passage of another electron to 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257649 11050436 352955 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 blocking electron passage out of cytochrome b h prevents the semiquinone at the q o site from donating its electron and so inhibition with antimycin produces a >tenfold increase in superoxide production from complex iii fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257650 11050436 352982 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the mutations seen in cuznsod in als patients are odd in that they do not destroy superoxide dismutase activity even though they sometimes affect enzyme stability [ 5 6 and 29 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257651 11050436 352997 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in transgenic mice bearing cuznsod mutations known to cause als in humans the protective bcl 2 protein when overexpressed transgenically can protect against neuronal death brought about by als mutations in experimental animals [ 37 and 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257652 11050436 352998 4770 2244 COQ7 clk 1 clk 1 0 1.0 one intriguing example of the link between the ros generating function of the respiratory chain and life span is that provided by the clk 1 protein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257653 11050436 352999 4770 2244 COQ7 clk 1 clk 1 0 1.0 the clk 1 protein is responsible for one of the final steps in ubiquinone synthesis so that defective activity results in low endogenous synthesis of ubiquinone for the mitochondrial respiratory chain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257654 11050436 353008 3544 1516 CAT catalase catalase 0 1.0 thus transgenic drosophila with increased expression of cuznsod did not show increased life span unless accompanied by increased expression of catalase to remove the hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257655 11050436 353010 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in mammals increased life span by transgenic modulation of levels of superoxide dismutase has not been observed [ 42 and 43 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257656 11050436 353035 4770 2244 COQ7 clk 1 clk 1 0 1.0 interference with ubiquinone synthesis in some organisms as demonstrated by the c. elegans clk 1 mutants would be expected to cause a reduction in ubisemiquinone levels a reduction in mitochondrial superoxide production and a subsequent deceleration of shortening and increase in life span[ 40 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257657 11050436 353040 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 oxygen is initially converted to superoxide o 2 _amp_#x2212; either by xanthine oxidase respiratory chain complexes i and iii or other cellular enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257658 11050436 353041 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the superoxide is converted to hydrogen peroxide h 2 o 2 by superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257659 11050436 353042 3544 1516 CAT catalase catalase 0 1.0 hydrogen peroxide is converted to water by either catalase or glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257660 11050436 353056 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 this then promptly reduces the b l haem of cytochrome b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257661 11050436 353057 13734 7427 MT-CYB cytochrome b cytochrome b 0 1.0 the b h haem of cytochrome b then reduces ubiquinone q to produce another ubisemiquinone. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257663 11050436 353063 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 complex i nadh ubiquinone oxidoreductase complex iii ubiquinol cytochrome c oxidoreductase complex iv cytochrome c oxidase and complex v h + translocating atp synthetase are shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253643 11223912 347837 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 mitochondrial uptake of ca 2+ has recently been found to play an important role in glutamate induced neurotoxicity gnt as well as in the activation of ca 2+ dependent molecules such as calmodulin and neuronal nitric oxide synthase nnos in the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253645 11223912 347841 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mitochondrial uncouplers markedly blocked acute excitotoxicity and membrane permeable superoxide dismutase mimics attenuated acute excitotoxicity induced by glutamate and nmda but not by alpha amino 3 hydroxy 5 methylisoxazole 4 propionate ampa or kainate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253646 11223912 347847 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 phenylhydrazone|kainic acid|2 4 dinitrophenol|glutamic acid|calmidazolium|cyclosporine|n methylaspartate|calcium|dizocilpine maleate|alpha amino 3 hydroxy 5 methyl 4 isoxazolepropionic acid|dibucaine|nitric oxide synthase|nitric oxide synthase type i|nos1 protein rat|superoxide dismutase|calcium calmodulin dependent protein kinase type 2|calcium calmodulin dependent protein kinases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253647 11223912 347847 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 |nitric oxide synthase type i|nos1 protein rat|superoxide dismutase|calcium calmodulin dependent protein kinase type 2|calcium calmodulin dependent protein kinases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253681 11228742 347969 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 activation of nf kappa b by reactive oxygen intermediates in the nervous system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253682 11228742 347970 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nuclear factor kappa b nf kappa b is a transcription factor crucially involved in glial and neuronal function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253683 11228742 347970 14352 7794 NFKB1 nuclear factor kappa-b nuclear factor kappa b 0 1.0 nuclear factor kappa b nf kappa b is a transcription factor crucially involved in glial and neuronal function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253684 11228742 347971 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nf kappa b is ubiquitously distributed within the nervous system and its inducible activity can be discerned from constitutive activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253685 11228742 347972 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 prototypic inducible nf kappa b in the nervous system is composed of the dna binding subunits p50 and p65 complexed with an inhibitory i kappa b alpha molecule. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253686 11228742 347973 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 a number of signals from the cell surface can lead to rapid activation of nk kappa b thus releasing the inhibition by i kappa b. this activates translocation of nf kappa b to the nucleus where it binds to kappa b motifs of target genes and activates transcription. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253687 11228742 347974 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 previous findings have identified reactive oxygen intermediates roi as a common denominator of nf kappa b activating signals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253688 11228742 347975 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 more specifically hydrogen peroxide h2o2 might be used as second messenger in the nf kappa b system despite its cytotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253689 11228742 347976 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 analysis of pathways leading to nf kappa b activation in the nervous system has identified a number of roi dependent pathways such as cytokine and neurotrophin mediated activation glutamatergic signal transduction and various diseases with crucial roi involvement e.g. alzheimer's disease parkinson's disease experimental autoimmune encephalomyelitis multiple 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253690 11228742 347976 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 analysis of pathways leading to nf kappa b activation in the nervous system has identified a number of roi dependent pathways such as cytokine and neurotrophin mediated activation glutamatergic signal transduction and various diseases with cr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253692 11228742 347977 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 a number of nf kappa b specific target genes contribute to the production of roi or are involved in detoxification of rois. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253693 11228742 347978 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 in this review possible mechanisms and regulatory pathways of roi mediated nf kappa b activation are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253694 11228742 347980 14352 7794 NFKB1 nf kappa b nf kappa b 0 1.0 nf kappa b|oxidants|reactive oxygen species| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 249610 11328670 340451 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 invited review: manganese superoxide dismutase in disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 249612 11328670 340452 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 manganese superoxide dismutase mnsod is essential for life as dramatically illustrated by the neonatal lethality of mice that are deficient in mnsod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242842 11513882 330566 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 approximately 10% of all familial cases of amyotrophic lateral sclerosis fals are linked to mutations in the sod1 gene which encodes the copper/zinc superoxide dismutase cuznsod . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242843 11513882 330573 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the sod1 gene which encodes the enzyme copper/zinc superoxide dismutase are associated with familial amyotrophic lateral sclerosis fals a fatal neurodegenerative disorder affecting spinal cord and brain motor neurons [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242844 11513882 330582 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in order to address our hypothesis that calcineurin is one of the targets we investigated the ability of four different copper/zinc superoxide dismutase cuznsod proteins three mutant forms and the wild type wt enzyme to protect calcineurin from oxidative inactivation in vitro. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242845 11513882 330616 17566 9577 PSPH phosphoserine phosphatase phosphoserine phosphatase 0 1.0 phosphoserine phosphatase assay was performed as described previously [ 5 and 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242846 11513882 330617 3430 1442 CALM1 calmodulin 1 calmodulin 1 0 1.0 in brief 40 _amp_#x3bc;l recombinant or partially purified calcineurin was mixed with test buffer 40 mm tris_amp_#x2013;hcl ph 8 0.1 m kcl 0.4 mg/ml bsa 0.67 mm dtt 0.67 _amp_#x3bc;m calmodulin 1 _amp_#x3bc;m fkbp and 0.5 _amp_#x3bc;m okadaic acid for inhibition of phophotase a1 and a2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242847 11513882 330637 17566 9577 PSPH phosphoserine phosphatase phosphoserine phosphatase 0 1.0 incubation of calcineurin for 20 min at 30_amp_#xb0;c under aerobic conditions in the presence of calcium led to a rapid loss of phosphoserine phosphatase activity to 5_amp_#x2013;8% of baseline activity fig 2a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242848 11513882 330662 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 therefore calcineurin would be an ideal candidate for a proposed influence of superoxide dismutase mutations on signal transduction pathways leading to a mutant steady state finally resulting in neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 242849 11513882 330680 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 since the calcineurin inactivation is dependent on the presence of calcium motoneurons which are subject to glutamate receptor mediated ca 2+ influxes may be especially at risk for calcineurin inactivation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245377 11562447 333613 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 t. marmorata choline acetyltransferase chat was impaired to the same extent as bovine brain chat. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245379 11562447 333617 551 399 ALB serum albumin serum albumin 0 1.0 peroxynitrite dependent nitrations were impaired when synaptosomes were pretreated with thioreductants glutathione n acetyl cysteine dithiothreitol or antioxidants uric acid melatonin bovine serum albumin desferrioxamine . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245380 11562447 333625 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 no can then combine with o 2 which is formed at sites of free radical generation beckman et al. 1990 ; pryor and squadrito 1995 such as mitochondria or through enzyme activity e.g. monoamine oxidase xanthine oxidase to form peroxynitrite onoo . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245381 11562447 333628 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 clinical studies showed that tyrosine hydroxylase the first and rate limiting enzyme in catecholamine biosynthesis that is selectively affected in parkinson's disease is nitrated suggesting that the cause of the pathology may be an onoo overload ara 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245382 11562447 333634 207 15814 ACSS2 acetyl-coa synthetase acetyl coa synthetase 0 1.0 the first is acetate which is converted into acetyl coa by acetyl coa synthetase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245383 11562447 333636 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 synthesis of ach from choline and acetyl coa is performed by choline acetyltransferase chat a cytosolic enzyme wu and hersh 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245384 11562447 333639 21633 11506 SYP synaptophysin synaptophysin 0 1.0 onoo dependent changes in several presynaptic proteins chat synaptophysin vamp/synaptobrevin actin tubulin present in t. marmorata synaptosomes and synaptic vesicles were examined and showed examples of nitration of tyrosines and covalent oligomerization. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245385 11562447 333653 21633 11506 SYP synaptophysin synaptophysin 0 1.0 polyclonal antibody against t. marmorata synaptophysin and monoclonal antibodies against vamp/synaptobrevin and tubulin were developed and characterized in the laboratory by dr. nicolas morel laboratoire de neurobiologie cellulaire et moleculaire cnrs gi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245387 11562447 333690 551 399 ALB serum albumin serum albumin 0 1.0 the reaction was started by the addition of the substrates [1 c]acetyl coa 14 microm and choline 2.5 mm in the presence of 250 microm eserine 10 microm bovine serum albumin bsa and 75 mm nacl and stopped after 1 h by dilution with cold sodium phosphate buffer. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245388 11562447 333724 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 1 but neither was inhibited by h 2 o 2 up to 1 mm this study or by similar concentrations of the no donors s nitroso n acetylpenicillamine and sodium nitroprusside morot gaudry talarmain et al. 1997 alpha synuclein by souza et al 2000 or proteolysis may occur requiring further studies. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245389 11562447 333726 3455 24190 CAMK2N1 calcium/calmodulin-dependent protein kinase ii calcium/calmodulin dependent protein kinase ii 0 1.0 olled proteolysis and subcellular localization cytosolic versus membrane bound isoforms and the presence of thiol agents can all modulate the activity of the enzyme posttranslationally oda 1999 alpha calcium/calmodulin dependent protein kinase ii bruce and hersh 1989 ; dobransky et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245390 11562447 333737 22692 12008 TPH1 tryptophan hydroxylase tryptophan hydroxylase 0 1.0 inactivation by onoo of the enzyme activity by sulfhydryl oxidation was recently shown to be essential for tryptophan hydroxylase another neurotransmitter synthesis enzyme kuhn and geddes 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245391 11562447 333747 21633 11506 SYP synaptophysin synaptophysin 0 1.0 moreover we were able to define affected residues by taking advantage of a specific antibody raised against a well conserved sequence gyqpnygq q of the t. marmorata synaptophysin cowan et al. 1990 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245392 11562447 333751 21633 11506 SYP synaptophysin synaptophysin 0 1.0 can affect numerous proteins at the presynaptic side of a neuromuscular junction in several subcellular compartments; these include choline transporter at the plasma membrane chat in the cytosol and synaptophysin tubulin or actin at the periphery of synaptic vesicles. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245393 11562447 333785 23858 12642 VAMP1 synaptobrevin 1 synaptobrevin 1 0 1.0 arrows show actin 1/200 c tubulin 1/1000 d synaptophysin 1/2500 e and vamp/synaptobrevin 1/25 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245394 11562447 333785 21633 11506 SYP synaptophysin synaptophysin 0 1.0 arrows show actin 1/200 c tubulin 1/1000 d synaptophysin 1/2500 e and vamp/synaptobrevin 1/25 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245395 11562447 333793 8885 20374 GSX1 gsh 1 gsh 1 0 1.0 concentration of the drugs were as follows: 5 mm gsh 1.25 mm nac 1 mm uric acid 1 mm bsa 1 mm dtt 200 microm desferrioxamine deferriox and 1 mm melatonin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245396 11562447 333799 8885 20374 GSX1 gsh 1 gsh 1 0 1.0 concentrations of protectors were for the high affinity choline uptake protection assay a : 5 mm gsh 1 mm nac 1 mm dtt 0.5 mm uric acid 1 mm bsa 200 microm desferrioxamine desfer. 1 mm melatonin melat. ; and for chat activity protection assay b : 5 mm gsh 5 mm nac 1 mm dtt 1 mm uric acid 1 mm bsa 200 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245397 11562447 333844 21633 11506 SYP synaptophysin synaptophysin 0 1.0 synaptophysin an integral vesicular 38 kda glycoprotein was detected in the controls fig 5 e as a doublet using an antibody directed against the c terminal epitope gyqpnygq q cowan et al. 1990 ; n morel personal c 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245398 11562447 333853 22692 12008 TPH1 tryptophan hydroxylase tryptophan hydroxylase 0 1.0 as shown for tryptophan hydroxylase kuhn and geddes 1999 protection against onoo induced tyrosine nitrations may prevent the loss of enzymatic activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245399 11562447 333855 8885 20374 GSX1 gsh 1 gsh 1 0 1.0 synaptosomes were pretreated with the following thioreductants: 5 mm glutathione gsh 1.25 mm n acetylcysteine nac and 1 mm dithiothreitol dtt ; and with the following antioxidants: 1 mm uric acid 1 mm melatonin 0.2 mm desferrioxamine and 1 mm bsa for 30 min before the addition of 1 mm 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245400 11562447 333868 21633 11506 SYP synaptophysin synaptophysin 0 1.0 dr. pierre potier in whose laboratories this work was performed for continuous support; dr. nicolas morel for help on immunological studies and the kind gift of antibodies against vamp/synaptobrevin synaptophysin and tubulin; dr. fran_amp_ccedil;ois marie meunier for sequence alignments; dr. seana o'regan for expertise in choline uptake mechanisms and critical reading; and dr. michael spedding and dr. esther 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245402 11562447 333874 551 399 ALB serum albumin serum albumin 0 1.0 trite; ach acetylcholine; sin 1 3 morpholinosydnonimine; coa coenzyme a; chat choline acetyltransferase; vamp/synaptobrevin vesicular associated membrane protein; tca trichloroacetic acid; bsa bovine serum albumin; page polyacrylamide gel electrophoresis; ecl enhanced chemiluminescence; gsh glutathione; nac n acetylcysteine; dtt dithiothreitol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245403 11562447 333874 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 onoo peroxynitrite; ach acetylcholine; sin 1 3 morpholinosydnonimine; coa coenzyme a; chat choline acetyltransferase; vamp/synaptobrevin vesicular associated membrane protein; tca trichloroacetic acid; bsa bovine serum albumin; page polyacrylamide gel electrophoresis; ecl enhanced chemiluminescence; gsh glutathione 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245404 11562447 333875 3520 16014 CASD1 o-acetyltransferase o acetyltransferase 0 1.0 acetates|antioxidants|carbon radioisotopes|nitrates|oxidants|reducing agents|molsidomine|peroxynitric acid|3 morpholino sydnonimine|3 nitrotyrosine|acetylcholine|tyrosine|choline|uric acid|choline o acetyltransferase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238968 11679167 325597 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 the importance of this protective mechanism is illustrated by tdh3p a glyceraldehyde 3 phosphate dehydrogenase isoform. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238969 11679167 325602 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 methionine sulfoxide reductase is able to repair mildly oxidised proteins by reducing methionine sulfoxide to methionine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238970 11679167 325607 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 it was recently shown that hydrogen peroxide induced protein carbonylation is specific and glyceraldehyde 3 phosphate dehydrogenase and mitochondrial enzymes are the major targets inactivated cabiscol et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238971 11679167 325608 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 the inactivation of glyceraldehyde 3 phosphate dehydrogenase may contribute to cellular protection as it increases the levels of glucose 6 phosphate to be used in the pentose phosphate pathway in order to increase the production of nadph see section 3.4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238972 11679167 325616 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 in s. cerevisiae several components of the ubiquitin 26s proteasome pathway and vacuolar proteases are induced by hydrogen peroxide godon et al. 1998 ; lee et al. 1999 which is consistent with the involvement of these proteolytic pathways in the degrad 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238973 11679167 325634 8885 20374 GSX1 gsh 1 gsh1 0 1.0 the disruption of gsh1 gene encoding the rate limiting enzyme of glutathione biosynthesis increases hydrogen peroxide sensitivity but also leads to a high frequency of petite respiration deficient cell generation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238974 11679167 325635 8885 20374 GSX1 gsh 1 gsh1 0 1.0 the function of glutathione in the protection of the mtdna is independent of its role in oxidative stress resistance as suppressors of the gsh1 mutation that decreased the rate of generation of petites did not increase hydrogen peroxide resistance of gsh 1_amp_#x394; cells lee et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238975 11679167 325636 43 34 ABCA4 atp binding cassette transporter atp binding cassette transporter 0 1.0 atm1p an atp binding cassette transporter that controls iron homeostasis within the yeast mitochondria is also important for mtdna integrity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238976 11679167 325644 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 the toxicity of lipid hydroperoxides has been associated to a decrease of coenzyme q and glutathione levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238977 11679167 325645 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 coenzyme q as well as vitamin e protect cells by reducing lipid peroxyl radicals and therefore by inhibiting the propagation of lipid peroxidation do et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238979 11679167 325647 21992 19737 TENC1 putative protein tyrosine phosphatase putative protein tyrosine phosphatase 0 1.0 it was recently shown that the inhibition of yeast growth by linoleic acid hydroperoxide requires a putative protein tyrosine phosphatase oca1p of unknown function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238980 11679167 325672 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the association of heat shock and oxidative stress is further supported by the data revealing that the superoxide dismutase genes are upregulated by heat shock costa et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238981 11679167 325673 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in agreement s. cerevisiae mutants deficient in antioxidant defences such as catalase superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238982 11679167 325673 3544 1516 CAT catalase catalase 0 1.0 in agreement s. cerevisiae mutants deficient in antioxidant defences such as catalase superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238983 11679167 325673 3544 1516 CAT catalase catalase 0 1.0 superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238984 11679167 325673 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in agreement s. cerevisiae mutants deficient in antioxidant defences such as catalase superoxide dismutase and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238985 11679167 325673 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 and cytochrome c peroxidase are sensitive to a lethal heat shock and the overexpression of genes encoding catalase and superoxide dismutase increase the resistance to the severe heat shock davidson et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238986 11679167 325674 8885 20374 GSX1 gsh 1 gsh1 0 1.0 the oxygen heat shock association is also correlated with glutathione levels as the expression of gsh1 and gsh2 genes coding for the two enzymes involved in glutathione synthesis is induced by a sublethal heat shock under aerobic but not anaerobic conditions sugiyama et al. 2000a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238987 11679167 325678 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the link between ethanol and oxidative stress was revealed by different experimental evidences such as the increase of the mitochondrial superoxide dismutase mnsod activity by ethanol the high ethanol sensitivity of s. cerevisiae cells deficient in mnsod costa and costa and the induction of ctt1 gene upon ethanol stress schuller et al. 1994 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238988 11679167 325711 8413 4330 GLRX glutaredoxin glutaredoxin 0 1.0 owth is highlighted by a significant decrease in the growth rate of cells deficient in antioxidant defences namely superoxide dismutases sod 1_amp_#x394; sod 2_amp_#x394; glutathione gsh 1_amp_#x394; glutaredoxin grx 5_amp_#x394; ubiquinol coq 3_amp_#x394; or poliamines spe 2_amp_#x394; moradas ferreira and costa 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238989 11679167 325713 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 in glucose consuming cells the high activity of protein kinase a represses gene transcription mediated by these factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238990 11679167 325714 3544 1516 CAT catalase catalase 0 1.0 hap1p regulates the transcriptional activation of the antioxidant genes such as sod2 mitochondrial superoxide dismutase cta1 peroxisomal catalase ctt1 cytosolic catalase and ubi4 polyubiquitin . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238991 11679167 325714 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 hap1p regulates the transcriptional activation of the antioxidant genes such as sod2 mitochondrial superoxide dismutase cta1 peroxisomal catalase ctt1 cytosolic catalase and ubi4 polyubiquitin . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238992 11679167 325728 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 for example the increasing requirement of nadph is met by the increase of glucose 6 phosphate utilisation by the pentose phosphate pathway as the activity of glucose 6 phosphate dehydrogenase zwf1p is induced by hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238993 11679167 325729 23454 12435 TXN thioredoxin thioredoxin 0 1.0 indeed the nadph is essential for the glutathione and the thioredoxin antioxidant systems which play a key role in maintaining a reduced intracellular state in the cells challenged by an oxidative stress fig 5 kuge and jones 1994 ; izawa et al. 1995 ; morgan et al. 199 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238994 11679167 325732 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 i the glycolytic flux is inhibited: genes coding for glycolytic enzymes are downregulated and glyceraldehyde 3 phosphate dehydrogenase is oxidatively inactivated see section 2.1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238995 11679167 325735 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 the inhibition of the glycolytic pathway at the step catalysed by glyceraldehyde 3 phosphate dehydrogenase increases the pool of dihydroxyacetone phosphate available for the glycerol cycle godon et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238996 11679167 325736 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 iii the glutamate catabolic pathway is upregulated: the expression of succinate semi aldehyde dehydrogenase gene uga5 is induced and the loss/overexpression of glutamate decarboxylase gene gad1 decreases/increases hydrogen peroxide resistance coleman et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238997 11679167 325738 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 under non stress conditions these factors are negatively regulated by the ras/protein kinase a pathway which is activated by glucose and promotes cellular growth fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238998 11679167 325739 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 under stress conditions the ras/protein kinase a pathway is inhibited and the different transcription factors are activated by specific signal transduction pathways. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238999 11679167 325742 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 yap1p also upregulates the rpi1 gene which codes for protein that represses the ras/protein kinase a pathway dumond et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239001 11679167 325752 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 it was recently shown that the thioredoxin system consisting of thioredoxin thioredoxin reductase and thioredoxin peroxidase plays a key role in regulating the yap1p dependent stress response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239002 11679167 325753 23454 12435 TXN thioredoxin thioredoxin 0 1.0 indeed yap1p is constitutively active in thioredoxin deficient mutants trx 1_amp_#x394; trx 2_amp_#x394; izawa et al. 1999 and the whole genome analysis of gene expression showed that 70% of the yap1p targets are upregulated in mutants lacking thioredo 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239003 11679167 325753 23454 12435 TXN thioredoxin thioredoxin 0 1.0 deficient mutants trx 1_amp_#x394; trx 2_amp_#x394; izawa et al. 1999 and the whole genome analysis of gene expression showed that 70% of the yap1p targets are upregulated in mutants lacking thioredoxin reductase trr 1_amp_#x394; under non stress conditions carmel harel et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239005 11679167 325754 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 in addition the thioredoxin peroxidase tpx1p is essential for the transcriptional activation of trx2 and trr1 genes ross et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239006 11679167 325755 23454 12435 TXN thioredoxin thioredoxin 0 1.0 as yap1p/skn7p mediates the upregulation of thioredoxin system these results indicate that yap1p function is regulated by a feedback mechanism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239007 11679167 325756 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the reduction of yap1p disulphide bonds by the thioredoxin system exposes the nuclear export signals and crm1p exports yap1p back to the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239008 11679167 325760 23454 12435 TXN thioredoxin thioredoxin 0 1.0 these results suggest that the effects of hydrogen peroxide endogenously produced or added are stronger in cells lacking thioredoxin reductase probably due to a decreased capacity to eliminate the oxidant and/or to reduce yap1p disulphide bonds. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239009 11679167 325761 23454 12435 TXN thioredoxin thioredoxin 0 1.0 despite the increased levels of antioxidant defences and other stress proteins the trr 1_amp_#x394; mutants are hypersensitive to hydrogen peroxide indicating that the thioredoxin system plays a critical role in the detoxification of hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239010 11679167 325763 7683 3796 FOS ap 1 ap 1 0 1.0 interestingly the yeast ap 1 family yap1p of proteins are involved in the sensing of reactive oxygen species in the different yeasts toone et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239011 11679167 325771 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the activation of these factors requires a functional mitochondria and the activity of cytochrome c peroxidase ccp1p . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239013 11679167 325772 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 indeed the induction of tpx1 thioredoxin peroxidase gene is skn7p and yap1p dependent and is lower in respiration deficient mutants and ccp 1_amp_#x394; cells charizanis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239014 11679167 325798 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the accumulation of oxidised proteins carbonyls and mixed disulphides and the increased production of reactive oxygen species concomitant with a depletion of antioxidant defences glutathione and superoxide dismutase seem to be key factors in ageing and cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239015 11679167 325799 20997 11180 SOD2 mn superoxide dismutase mn superoxide dismutase 0 1.0 ted to respiratory growth conditions which display high levels of antioxidant defences maclean et al. 2001 and by the decreased life span observed in mutants deficient in cuzn superoxide dismutase or mn superoxide dismutase longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239018 11679167 325800 20997 11180 SOD2 mn superoxide dismutase mn superoxide dismutase 0 1.0 the deficiency in mn superoxide dismutase leads to the accumulation of superoxide radicals which destroy the 4fe_amp_#x2013;4s clusters of mitochondrial enzymes e.g. aconitase leading to an impaired respiratory activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239020 11679167 325807 348 21285 ADCY10 adenylate cyclase adenylate cyclase 0 1.0 in agreement mutations in adenylate cyclase extend life span by a msn2/4p dependent mechanism. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239021 11679167 325810 10601 6081 INS insulin insulin 0 1.0 sch9p is an homologue of the mammalian protein kinase b/akt which is involved in insulin signalling apoptosis and cellular proliferation and functions in a pathway that regulates ageing and stress resistance paradis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239022 11679167 325810 543 391 AKT1 protein kinase b protein kinase b 0 1.0 sch9p is an homologue of the mammalian protein kinase b/akt which is involved in insulin signalling apoptosis and cellular proliferation and functions in a pathway that regulates ageing and stress resistance paradis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239023 11679167 325817 1576 990 BCL2 bcl 2 bcl 2 0 1.0 several proteins have been identified as being major regulators of apoptosis including the bcl 2 family and caspases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239024 11679167 325818 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the bcl 2 family of proteins consist of anti apoptotic proteins such as bcl 2 and bcl x l and pro apoptotic proteins such as bax and bak gross et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239025 11679167 325818 1578 992 BCL2L1 bcl x bcl x 0 1.0 the bcl 2 family of proteins consist of anti apoptotic proteins such as bcl 2 and bcl x l and pro apoptotic proteins such as bax and bak gross et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239026 11679167 325827 1389 30213 ATP13A2 putative atpase putative atpase 0 1.0 the mutation of the yeast cdc48 gene which codes for a putative atpase homologous to the mammalian anti apoptotic valosine containing protein vcp shirogane et al. 1999 also induces both apoptosis and the accumulation of reactive oxygen species madeo et al. 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239027 11679167 325828 1576 990 BCL2 bcl 2 bcl 2 0 1.0 on dna strand breaks and plasma membrane inversion laun et al. 2001 ; v the life span of non dividing yeast cells lacking superoxide dismutase is extended by overexpressing the anti apoptotic protein bcl 2 longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239028 11679167 325828 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 cellular levels of glutathione decreases the mitochondrial membrane potential and affects the intracellular redox potential and these effects are reverted by expression of a plant antioxidant defence glutathione s transferase/peroxidase kampranis et al. 2000 ; iii bax lethality is higher under respiratory conditions and is suppressed in respiration deficient mutants and by inhibition of the f 0 f 1 atpase/h + pump with ol 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239029 11679167 325828 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 both oxidative stress see above and apoptosis including chromatin fragmentation dna strand breaks and plasma membrane inversion laun et al. 2001 ; v the life span of non dividing yeast cells lacking superoxide dismutase is extended by overexpressing the anti apoptotic protein bcl 2 longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239030 11679167 325832 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the regulatory role of the bcl 2 members e.g. depends on their ability to regulate the mitochondrial function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239031 11679167 325833 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in yeast bcl 2 proteins interact with the voltage dependent anion channel vdac and the adenine nucleotide translocator ant and these proteins are components of the mitochondrial permeability transition pore complex 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239032 11679167 325833 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 in yeast bcl 2 proteins interact with the voltage dependent anion channel vdac and the adenine nucleotide translocator ant and these proteins are components of the mitochondrial permeability transition pore complex that is required for bax lethality marzo et al. 1998 ; shimizu et al. 1999 ; vander heiden et al. 1999 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239033 11679167 325834 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 it has been suggested that the cytochrome c released into the cytosol as a consequence of pore opening has a pro apoptotic activity manon et al. 1997 ; minn et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239034 11679167 325835 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 however ant is not essential for bax induced cytochrome c release from the mitochondria and contradictory results have been described regarding the role of vdac priault and priault ; shimizu et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239035 11679167 325836 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 it should be noted that the importance of cytochrome c release in bax lethality was recently questioned as bax induces cell death in yeast cells expressing a functional cytochrome c_amp_#x2013;gfp fusion that is not relocalised into the cytosol roucou et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239036 11679167 325860 7975 3951 FXN frataxin frataxin 0 1.0 this disorder results from a deficiency in frataxin a nuclear encoded mitochondrial protein with no homology to proteins of known function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239037 11679167 325860 3248 1260 C21orf2 nuclear encoded mitochondrial protein nuclear encoded mitochondrial protein 0 1.0 this disorder results from a deficiency in frataxin a nuclear encoded mitochondrial protein with no homology to proteins of known function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239038 11679167 325861 7975 3951 FXN frataxin frataxin 0 1.0 studies on the yeast frataxin homologue yfh1p suggest that this protein is an iron binding protein that plays a key role in regulation of iron homeostasis and resistance to oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239039 11679167 325862 7975 3951 FXN frataxin frataxin 0 1.0 indeed yfh1p exhists as a monomer in the absence of iron but self aggregates in the presence of iron forming multimers able to sequester more than 16 iron atoms per frataxin molecule adamec et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239040 11679167 325863 7975 3951 FXN frataxin frataxin 0 1.0 both frataxin and yfh1p are processed in the mitochondria to a mature form that is essential for the control of mitochondrial iron homeostasis knight et al. 1998 ; branda et al. 1999 ; cavadini et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239041 11679167 325874 7975 3951 FXN frataxin frataxin 0 1.0 as the excess of iron is known to promote the formation of the highly reactive hydroxyl radicals the absence of an oxidative stress response may account for cellular dysfunction of frataxin deficient mutants. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239042 11679167 325887 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 a under physiological conditions cells growing on glucose contain high levels of camp which activates protein kinase a pka and inhibits the general stress response mediated by msn2/4p and specific stress responses mediated by skn7p and yap1p. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239043 11679167 325896 23454 12435 TXN thioredoxin thioredoxin 0 1.0 glutathione and thioredoxin antioxidant systems. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239044 11679167 325897 23454 12435 TXN thioredoxin thioredoxin 0 1.0 a glutathione gsh and thioredoxin trx sh2 are oxidised during reduction of hydroperoxides and disulphide bonds. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239045 11679167 325898 23454 12435 TXN thioredoxin thioredoxin 0 1.0 b nadph is essential for reduction of oxidised glutathione gssg and thioredoxin trx s 2 to gsh and trx sh 2 respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239046 11679167 325902 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 zwf1 glucose 6 phosphate dehydrogenase gpd1 glycerol phosphate dehydrogenase gpp2 glycerol phosphate phosphatase ybr149w glycerol dehydrogenase dak1 dihydroxyacetone kinase gad1 glutamate decarboxylase uga5 succinate semialdehyde dehydrog 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239047 11679167 325909 23454 12435 TXN thioredoxin thioredoxin 0 1.0 a under non stress conditions thioredoxin reduces the cysteine residues and exposes the nes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239736 11701756 326723 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative inactivation of calcineurin by cu zn superoxide dismutase g93a a mutant typical of familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239737 11701756 326726 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in a recent work we have observed that calcineurin activity is depressed in two models for familial amyotrophic lateral sclerosis fals associated with mutations of the antioxidant enzyme cu zn superoxide dismutase sod1 namely in neuroblastoma cells expressing either sod1 mutant g93a or mutant h46r and in brain areas from g93a transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 234251 11796206 317438 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we previously characterized the enhanced peroxidative activity of the human familial als fals mutants of copper zinc superoxide dismutase cuznsod a4v and g93a in vitro. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230689 11905995 311195 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mitochondrial dysfunction is an early event of motor neuron degeneration in transgenic mice overexpressing mutant superoxide dismutase sod 1 gene and mitochondrial abnormality is observed in human als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 230690 11905995 311196 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ll culture system we demonstrated that infection of mouse nsc 34 motor neuron like cells with adenovirus containing mutant g93a sod1 gene increased cellular oxidative stress mitochondrial dysfunction cytochrome c release and motor neuron cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232222 11978481 313819 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the generation of nitric oxide no _amp_#x2022; from arginine by nitric oxide synthase is a process which is involved in neurotransmission regulation of vascular relaxation and in inflammatory processes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232223 11978481 313820 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 the generation of no _amp_#x2022; is catalyzed by three isoforms of nitric oxide synthase neuronal nitric oxide synthase nnos endothelial nitric oxide synthase enos and inducible nitric oxide synthase inos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232224 11978481 313820 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 the generation of no _amp_#x2022; is catalyzed by three isoforms of nitric oxide synthase neuronal nitric oxide synthase nnos endothelial nitric oxide synthase enos and inducible nitric oxide synthase inos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232226 11978481 313846 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 recent work showed that transgenic mice with a knockout of methionine sulfoxide reductase which repairs oxidized methione have a reduced life span and show increased protein carbonyls [ 17 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232227 11978481 313850 4423 1991 CKB creatine kinase creatine kinase 0 1.0 prior studies showed that glutamine synthetase and creatine kinase are particularly vulnerable to oxidative damage [ 12 and 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232228 11978481 313850 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 prior studies showed that glutamine synthetase and creatine kinase are particularly vulnerable to oxidative damage [ 12 and 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232229 11978481 313855 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 one protein was manganese superoxide dismutase which was previously shown to be selectively nitrated at tyr 34 and inactivated [ 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232231 11978481 313857 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 nitration of tyrosine residues in glutamine synthetase by peroxynitrite inhibits oxidation of methione residues and leads to inactivation of the enzyme [ 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232232 11978481 313861 4423 1991 CKB creatine kinase creatine kinase 0 1.0 creatine kinase is another key intracellular enzyme regulating energy metabolism that is nitrated and inactivated by peroxynitrite [ 25 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232233 11978481 313871 4423 1991 CKB creatine kinase creatine kinase 0 1.0 there were also significant decreases in glutamine synthetase and creatine kinase activity and alterations in spin labeled synaptosomes consistent with oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232234 11978481 313871 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 there were also significant decreases in glutamine synthetase and creatine kinase activity and alterations in spin labeled synaptosomes consistent with oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232236 11978481 313875 12369 6893 MAPT microtubule-associated protein tau microtubule associated protein tau 0 1.0 neurofibrillary tangles are protein aggregates which are largely made up of the microtubule associated protein tau. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232237 11978481 313885 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the source of the nitric oxide is possibly from upregulation of an inducible nitric oxide synthase in neurofibrillary tangle bearing neurons or from nitric oxide synthase in astrocytes and microglia adjacent to senile plaques [ 38 and 39 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232238 11978481 313887 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 a 6 fold increase in 3 nitrotyrosine concentrations was detected in ad cerebrospinal fluid as compared to age matched controls [ 41 ] and an increase in nitrated manganese superoxide dismutase was also reported [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232240 11978481 313900 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 we and others showed that inhibitors of neuronal nitric oxide synthase blocked mptp induced dopaminergic toxicity in mice and that mptp neurotoxicity was attenuated in mice deficient in neuronal nitric oxide synthase [ 45 and 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232242 11978481 313901 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 we subsequently showed that neuronal nitric oxide synthase inhibitors blocked mptp neurotoxicity in baboons and this was accompanied by an inhibition of 3 nitrotyrosine staining [ 47 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232244 11978481 313905 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 an increase in nitrated manganese superoxide dismutase was found in cerebrospinal fluid [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232246 11978481 313913 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 other evidence for oxidative damage to proteins in pd is increased expression of neural heme oxygenase 1 and increased immunostaining of glycosylated proteins [ 55 and 56 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232247 11978481 313925 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 other groups reported marked increases of both free 3 nitrotyrosine and nitrated manganese superoxide dismutase in the cerebrospinal fluid of sporadic als patients [ 42 and 62 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232250 11978481 313927 4423 1991 CKB creatine kinase creatine kinase 0 1.0 we found significant decreases in creatine kinase activity in the transgenic als mice that were mimicked by exposure of brain extracts of peroxynitrite [ 63 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232251 11978481 313929 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 an increase in neuronal nitric oxide synthase nnos was found in motor neurons in one study [ 65 66 and 67 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229374 12125078 309248 23454 12435 TXN thioredoxin thioredoxin 0 1.0 gga was found to induce the expression of heat shock protein 70 as well as thioredoxin which may partly contribute to the protective effect of gga. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 229375 12125078 309248 9691 5232 HSPA1A heat shock protein 70 heat shock protein 70 0 1.0 gga was found to induce the expression of heat shock protein 70 as well as thioredoxin which may partly contribute to the protective effect of gga. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 224454 12218958 300505 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase applications and relevance to human diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 224455 12218958 300508 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase sod catalyzes the conversion of single electron reduced species of molecular oxygen to hydrogen peroxide and oxygen. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 224456 12218958 300510 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 among these cu zn superoxide dismutase sod1 is widely distributed and comprises 90% of the total sod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226064 12368231 302530 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 overexpression of sod1 protects vulnerable motor neurons after spinal cord injury by attenuating mitochondrial cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226065 12368231 302531 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 defective cu zn superoxide dismutase sod1 is responsible for some types of amyotrophic lateral sclerosis and ventral horn motor neurons vmn have been shown to die through a mitochondria dependent apoptotic pathway after chronic exposure 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226066 12368231 302534 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 superoxide production mitochondrial release of cytochrome c and activation of caspase 9 were examined and apoptotic dna injury was also characterized. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226067 12368231 302534 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 superoxide production mitochondrial release of cytochrome c and activation of caspase 9 were examined and apoptotic dna injury was also characterized. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226068 12368231 302535 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 in the wild type animals increased superoxide production mitochondrial release of cytochrome c and cleaved caspase 9 were observed exclusively in vmn after sci. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226069 12368231 302535 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the wild type animals increased superoxide production mitochondrial release of cytochrome c and cleaved caspase 9 were observed exclusively in vmn after sci. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226070 12368231 302537 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 transgenic animals showed less superoxide production mitochondrial cytochrome c release and caspase 9 activation resulting in death of only 45% of the vmn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226071 12368231 302537 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 transgenic animals showed less superoxide production mitochondrial cytochrome c release and caspase 9 activation resulting in death of only 45% of the vmn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226072 12368231 302541 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c group|superoxides|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 226214 12373523 302680 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 1 a signal transduction role because nitration of tyrosine residues through tyro _amp_#8226; formation can modulate as well the phosphorylation tyrosine kinases activity and/or tyrosine hydroxylation tyrosine hydroxylase inactivation leading to consequent dopamine synthesis failure and increased degradation of target proteins respectively; 2 a role of _amp_#8220;blocker_amp_#8221; for radical radical reactions scaven 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218389 12392777 292016 20997 11180 SOD2 mn superoxide dismutase mn superoxide dismutase 0 1.0 the antioxidant enzymes in the brain include cu/zn superoxide dismutase sod 1 and mn superoxide dismutase sod 2 which catalyze the conversion of o 2 _amp_#x221a; _amp_#x2212; to h 2 o 2 [ 73 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218391 12392777 292017 3544 1516 CAT catalase catalase 0 1.0 h 2 o 2 is then converted to h 2 o by either catalase or glutathione peroxidase gsh px . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218392 12392777 292031 14352 7794 NFKB1 nuclear factor kappa-b nuclear factor kappa b 0 1.0 another index of oxidative stress is the activation of the transcriptional factor nuclear factor kappa b nf _amp_#x3ba;b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218393 12392777 292035 1576 990 BCL2 bcl 2 bcl 2 0 1.0 moreover nf _amp_#x3ba;b induces the expression of the so called inhibitor of apoptosis proteins iaps bcl 2 and calbindins [ 179 and 270 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 221146 12437573 295643 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we have recently observed that calcineurin activity is depressed in human neuroblastoma cells expressing cu zn superoxide dismutase sod1 mutant g93a and in brain areas from g93a transgenic mice and that mutant g93a sod1 oxidatively inactivates calcineurin in vitro. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 221147 12437573 295646 14354 7797 NFKBIA ikappabalpha ikappabalpha 0 1.0 alteration of the phosphorylation state of ikappabalpha the inhibitor of nf kappab translocation into the nucleus and induction of cyclooxygenase 2 are consistent with the up regulation of this transcription factor in this system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207579 12614931 278044 9462 5013 HMOX1 ho 1 ho 1 0 1.0 expression of heme oxygenase 1 ho 1 a marker of oxidative stress also increased. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207580 12614931 278044 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 expression of heme oxygenase 1 ho 1 a marker of oxidative stress also increased. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207581 12614931 278053 3544 1516 CAT catalase catalase 0 1.0 ecause of its high level of polyunsaturated fatty acids as substrates for lipid peroxidation high rate of oxygen consumption and low or moderate levels of the antioxidant enzymes superoxide dismutase catalase and gpx compared with kidney or liver [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207582 12614931 278053 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 to oxidative injury because of its high level of polyunsaturated fatty acids as substrates for lipid peroxidation high rate of oxygen consumption and low or moderate levels of the antioxidant enzymes superoxide dismutase catalase and gpx compared with kidney or liver [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207583 12614931 278109 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 mrna 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207584 12614931 278110 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the heme oxygenase 1 ho 1 mrna level was measured by northern blot analysis as previously described [ 21 ] using total cellular rna 5 _amp_#x3bc;g from control or ea treated nsc 34 cells about 2.5_amp_#xd7;10 6 cells . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207585 12614931 278110 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 the heme oxygenase 1 ho 1 mrna level was measured by northern blot analysis as previously described [ 21 ] using total cellular rna 5 _amp_#x3bc;g from control or ea treated nsc 34 cells about 2.5_amp_#xd7;10 6 cells . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207586 12614931 278150 9462 5013 HMOX1 ho 1 ho 1 0 1.0 as a marker of oxidative stress we also measured the induction of ho 1 mrna. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207587 12614931 278151 9462 5013 HMOX1 ho 1 ho 1 0 1.0 exposure to 100 _amp_#x3bc;m ea promptly increased ho 1 mrna with a massive rise 3 h after treatment respectively 1.6 12 and 16 times the control level after 1 2 and 3 h of treatment; fig 5 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207588 12614931 278173 3544 1516 CAT catalase catalase 0 1.0 ease in dcfh da oxidation after treatment with ea indicates the presence of increased levels of h 2 o 2 and could be a direct consequence of gsh deficiency since in mitochondria_amp_#x2014;which lack catalase activity_amp_#x2014;h 2 o 2 is metabolized by gsh peroxidase using the reducing equivalents of gsh. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207589 12614931 278177 3544 1516 CAT catalase catalase 0 1.0 in addition levels of catalase are very low in the nervous system [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207590 12614931 278178 3544 1516 CAT catalase catalase 0 1.0 interestingly treatment with catalase was beneficial in a mouse model of als [ 28 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207591 12614931 278197 9462 5013 HMOX1 ho 1 ho 1 0 1.0 gsh depletion by ea induced expression of ho 1 which has been reported to be protective in different models of oxidative stress induced neuronal injury [ 43 and 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207592 12614931 278198 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 zymatic activity potentially act as antioxidants [ 45 ] and can thus exert anti apoptotic effects with co acting in a dominant manner as an anti apoptotic messenger possibly through activation of the p38 mitogen activated protein kinase mapk signal transduction pathway [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207593 12614931 278198 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the end products of ho 1 enzymatic activity potentially act as antioxidants [ 45 ] and can thus exert anti apoptotic effects with co acting in a dominant manner as an anti apoptotic messenger possibly through activation of t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207594 12614931 278199 9462 5013 HMOX1 ho 1 ho 1 0 1.0 however the role of ho 1 in our model requires further investigation since proapoptotic signals prevailed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207595 12614931 278200 9462 5013 HMOX1 ho 1 ho 1 0 1.0 interestingly increased immunoreactivity for ho 1 and p38mapk were detected in human and mouse als [ 47 48 and 49 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207596 12614931 278224 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 effect of ethacrynic acid on heme oxygenase 1 expression in nsc 34 cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207597 12614931 278226 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the heme oxygenase 1 ho 1 mrna signal is shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 207598 12614931 278226 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 the heme oxygenase 1 ho 1 mrna signal is shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208066 12618129 278659 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 mitochondrial respiratory chain dysfunction was also found in transgenic mice expressing a mutant form of superoxide dismutase 1 associated with familial als [ 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208067 12618129 278684 4996 2422 CS citrate synthase citrate synthase 0 1.0 the activities of complex i+iii nadh_amp_#x2013;cytochrome c reductase ii+iii succinate_amp_#x2013;cytochrome c reductase iv cytochrome c oxidase cox and the mitochondrial matrix enzyme citrate synthase cs were measured as described elsewhere [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208069 12618129 278684 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 the activities of complex i+iii nadh_amp_#x2013;cytochrome c reductase ii+iii succinate_amp_#x2013;cytochrome c reductase iv cytochrome c oxidase cox and the mitochondrial matrix enzyme citrate synthase cs were measured as described elsewhere [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208070 12618129 278724 4996 2422 CS citrate synthase citrate synthase 0 1.0 enzymatic activities of the mitochondrial respiratory chain complexes i+iii ii+iii cox and of the nuclear encoded mitochondrial matrix enzyme citrate synthase were measured on cybrid clones and mass cultures. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208071 12618129 278790 4996 2422 CS citrate synthase citrate synthase 0 1.0 a respiratory chain activities in cybrid mass cultures als n = 13; controls n = 10 normalized by the activity of the mitochondrial matrix enzyme citrate synthase cs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208073 12618129 278794 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 i+iii nadh cytochrome c reductase; ii+iii succinate cytochrome c reductase; cox cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209890 12654515 280253 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 vascular endothelial growth factor vegf is neurotrophic and also protects from hypoxia induced neuronal injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209891 12654515 280266 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the landmark discovery that mutations of the copper_amp_#x2013;zinc superoxide dismutase sod1 gene cause a portion of human familial als and that transgenic animal models expressing mutant sod1 mimic human als have contributed significantly to our understanding of human als [ 5 18 37 41 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209892 12654515 280269 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 recently vascular endothelial growth factor vegf has been demonstrated to have neurotrophic effects by promoting neuronal cell survival in vitro and in vivo [ 23 26 43 and 45 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209893 12654515 280271 23910 12680 VEGFA vascular permeability factor vascular permeability factor 0 1.0 vegf also known as vascular permeability factor is a dimeric glycoprotein that binds to endothelial cell specific receptors fms like tyrosine kinase flt 1 and fetal liver kinase flk 1 [ 16 and 36 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209894 12654515 280272 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 acting through these receptors vegf is believed to initiate several intracellular signal transduction systems including phosphatidylinositol 3 kinase pi3 k and mitogen activated protein kinase mapk [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209897 12654515 280332 16616 8978 PIK3CG pi3-kinase pi3 kinase 0 1.0 pi3 kinase activity assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209898 12654515 280354 3544 1516 CAT catalase catalase 0 1.0 based on our previous study showing that the anti oxidants catalase n acetyl cysteine n ac and the spin trapping molecule 5_amp_#x2032; 5_amp_#x2032; dimethylpryrroline n oxide dmpo were all protective fig 1d and ref [ 32 ] we assume that oxidative stress is at least 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209899 12654515 280378 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 several lines of evidence prompted us to examine the effects of vegf on mutant sod1 mediated motor neuron like cell death: i vegf acts as a neurotrophic factor preventing hypoxia ischemia mediated neuronal cell death [ 23 ]; ii increased oxidative stress plays an important role in hypoxia mediated neuronal cell death [ 30 and 33 ]; iii disruption of the hyp 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209900 12654515 280397 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 horylated akt has been demonstrated to promote cell survival by inactivation of one or more apoptotic factors [ 1 14 15 and 22 ] glycogen synthase kinase 3 forkhead transcription factors [ 8 ] and/or caspase 9 [ 9 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209901 12654515 280448 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 e proteins|reactive oxygen species|tumor necrosis factor alpha|vascular endothelial growth factor a|vascular endothelial growth factors|hydrogen peroxide|superoxide dismutase 1|superoxide dismutase|1 phosphatidylinositol 3 kinase|protein serine threonine kinases|proto oncogene proteins c akt| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211476 12663085 281778 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 protein cross linkage results in aggregates which then form intracellular protease resistant and ubiquitin proteasome resistant deposits consequently inhibiting the intracellular transport of materials. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211477 12663085 281789 14282 7739 NEFL nf l nf l 0 1.0 neurofilaments have three isoforms which are referred to as light nf l medium nf m and heavy chains nf h . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211478 12663085 281789 14285 7734 NEFM nf m nf m 0 1.0 neurofilaments have three isoforms which are referred to as light nf l medium nf m and heavy chains nf h . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211480 12663085 281801 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 since mutations of the superoxide dismutase 1 sod 1 gene were first identified in 1993 it has been considered a possible cause of familial als fals [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211482 12663085 281812 11780 6563 LGALS3 galectin 3 galectin 3 0 1.0 e as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211483 12663085 281812 5546 2728 DDOST age r1 age r1 0 1.0 although many are as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211484 12663085 281812 17314 9411 PRKCSH 80k-h protein 80k h protein 0 1.0 although many are as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211485 12663085 281820 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 a_amp_#x3b2; induces the production of tumor necrosis factor _amp_#x3b1; by microglia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211486 12663085 281829 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 m_amp_#xfc;nch et al. reported that the accumulation of intracellular age was observed in up to 95% of pyramidal neurons in patients with presenilin 1 mutations [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211487 12663085 281830 9462 5013 HMOX1 ho 1 ho 1 0 1.0 age coexisted with hemeoxygenase 1 ho 1 on neurofibrillary tangles [ 119 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211488 12663085 281831 9462 5013 HMOX1 ho 1 ho 1 0 1.0 since ho 1 is induced under oxidative stress it was speculated that reactive oxygen species were produced by tau modified with age leading to the induction of ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211489 12663085 281904 551 399 ALB albumin albumin 0 1.0 an increased accumulation of amadori products was found in all major proteins of the csf of ad patients including albumin apoe and transthyretin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211490 12663085 281905 551 399 ALB albumin albumin 0 1.0 glycation in albumin normalized on protein quantity was nearly 1.5 times greater in ad patients than in controls total csf glycation of the samples was 8.9 and 3.1 arbitrary units/_amp_#x3bc;g of protein respectively . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211491 12663085 281906 551 399 ALB albumin albumin 0 1.0 this demonstrated that increased csf glycation in ad is not due to a specific protein modification because all major csf proteins of different origin are involved in the process albumin from plasma 90% of transthyretin synthesized by choroid plexus and apoe derived from astrocytes . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211492 12663085 281906 23358 12405 TTR transthyretin transthyretin 0 1.0 demonstrated that increased csf glycation in ad is not due to a specific protein modification because all major csf proteins of different origin are involved in the process albumin from plasma 90% of transthyretin synthesized by choroid plexus and apoe derived from astrocytes . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211493 12663085 281938 8403 4323 GLO1 glyoxalase i glyoxalase i 0 1.0 glyoxalase i catalyzes the conversion of mg to s lactoylglutathione which in turn is converted to lactate by glyoxalase ii [ 91 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211494 12663085 281938 9010 4805 HAGH glyoxalase ii glyoxalase ii 0 1.0 glyoxalase i catalyzes the conversion of mg to s lactoylglutathione which in turn is converted to lactate by glyoxalase ii [ 91 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211495 12663085 281950 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 2 3 dg induced toxicity in pc12 cells which was suppressed by the overexpression of aldehyde reductase [ 102 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211496 12663085 281953 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the cytotoxic effects were attenuated by antioxidants aminoguanidine and inhibitors of nitric oxide synthase nos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211497 12663085 281955 4691 2206 COL4A4 collagen iv collagen iv 0 1.0 4 neurite production and neuronal survival of cultured drg neurons were significantly reduced on glycated collagen iv and laminin [ 54 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211498 12663085 281982 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 1 enzyme systems such as aldehyde reductase and glyoxalase detoxify 3 dg and mg which are the building blocks of age. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211499 12663085 281987 523 381 AKR1B1 aldose reductase aldose reductase 0 1.0 aldehyde reductase has been identified as a detoxication enzyme of 3 dg and mg and has homology to aldose reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211500 12663085 281987 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 aldehyde reductase has been identified as a detoxication enzyme of 3 dg and mg and has homology to aldose reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211501 12663085 281988 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 in pc12 cells overexpressing aldehyde reductase 3 dg toxicity was suppressed as described above [ 102 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211502 12663085 281989 356 249 ADH1A aldehyde reductase aldehyde reductase 0 1.0 aldehyde reductase however can be glycated and its enzymatic activity attenuated [ 103 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211503 12663085 281992 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 in addition to its suppressive effect on glycation ag has antioxidant properties [ 81 ] and also inhibits inducible nitric oxide synthase inos [ 100 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211504 12663085 282019 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 neuronal hyaline inclusions nhis abnormal intracellular structures that appear in the soma and neurites of some of the surviving lower motor neurons and contain ubiquitin and phosphorylated neurofilament protein are the characteristic markers of fals with sod 1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211505 12663085 282091 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 among the three types of age receptors other than rage reported in the human brain age r1 oligosaccharyltransferase family and age r2 substrate of protein kinase c have been found in neurons while age r3 is restricted to glial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211506 12663085 282091 5546 2728 DDOST age r1 age r1 0 1.0 among the three types of age receptors other than rage reported in the human brain age r1 oligosaccharyltransferase family and age r2 substrate of protein kinase c have been found in neurons while age r3 is restricted to glial cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211507 12663085 282092 5546 2728 DDOST age r1 age r1 0 1.0 al. investigated the distributions of these receptors in conglomerates of cortical motor neurons in eight als brains five sporadic als and three fals and three control brains with antibodies against age r1 and age r2 [ 13 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211508 12663085 282093 5546 2728 DDOST age r1 age r1 0 1.0 they found that age r1 immunoreactivity was co localized with those of age sod 1 and neurofilaments. 12.7. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211509 12663085 282101 3544 1516 CAT catalase catalase 0 1.0 sod and catalase activities were not changed suggesting that specific defects of the gsh system are more important in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212294 12684448 283316 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 observations of elevated csf glutamate in amyotrophic lateral sclerosis als together with findings that motor neurons are selectively vulnerable to glutamate receptor mediated "excitotoxic" injury support an excitotoxic contribution to the motor neuron loss in the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212296 12684448 283326 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 although a small percentage 1 2% of cases have been linked to mutations in the enzyme superoxide dismutase 1 sod1 rosen et al. 1993 the vast majority 90 95% are sporadic. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212297 12684448 283331 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 mns seem to possess large numbers of unusual ampa type glutamate receptor channels that are directly permeable to ca carriedo et al. 1995 1996 ; williams et al. 1997 ; vandenberghe et al. 2000 and activation of these channels with the selective agonists ampa or kainate ind 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212298 12684448 283351 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 control studies using the astrocyte specific marker glial fibrillary acidic protein gfap confirmed the identity of cells with these morphological characteristics see fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212299 12684448 283353 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 cultures were fixed in 4% paraformaldehyde blocked and exposed to primary antibody [smi 32 1:5000 and gfap 1:400 dako glostrup denmark ; glutamate transporter glt 1 also known as eaat2 0.17 microg/ml kindly supplied by jeff rothstein johns hopkins university baltimore md ; 3 nitrotyrosine 10 microg/ml upstate biotechnology waltham ma ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212300 12684448 283365 3544 1516 CAT catalase catalase 0 1.0 xposed for 15 min to sham wash or to kainate [100 micro m plus + 5 methyl 10 11 dihydro 5h dibenzo [a d] cyclohepten 5 10 imine maleate mk 801 ] alone or in the presence of antioxidants sod 100 u/ml; catalase 400 u/ml followed after another 10 min by incubation in [ h]glutamate 2 microci/ml in hss for 5 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212301 12684448 283390 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 behave similarly to those in situ with both seeming to possess large numbers of ca permeable ampa channels to show poor intracellular ca buffering and to be selectively vulnerable to injury caused by glutamate receptor activation o'brien and fischbach 1986 ; hugon et al. 1989 ; rothstein et al. 1993 ; carriedo et al. 1996 2000 ; williams et al. 1997 ; vandenberghe et al. 1998 ; palecek et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212302 12684448 283391 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 thus the relatively selective ros generation we observe in cultured mns in response to glutamate receptor activation and the ability of this ros to escape the cell and affect the surrounding microenvironment is likely to model events that can occur in vivo . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212303 12684448 283415 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in addition the suggestion that the ros can exit mns and affect surrounding astrocytes provides an explanation for previous reports of oxidative modifications of the glt 1 transporter in als pedersen et al. 1998 ; trotti et al. 1999 ; deitch et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212304 12684448 283424 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 c under confocal microscopy the close spatial relationship between the mn smi 32 red and glial glutamate transporters anti glt 1 green is apparent. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212305 12684448 283455 3544 1516 CAT catalase catalase 0 1.0 a spinal cultures were exposed to sham wash or to kainate ka ; 100 micro m plus 10 micro m mk 801 alone or with addition of the antioxidants sod 100 u/ml and catalase 400 u/ml to the bath ka+ao before [ h]glutamate uptake assays as described. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212306 12684448 283495 3544 1516 CAT catalase catalase 0 1.0 furthermore this local decrease in uptake was prevented by addition of cell impermeant antioxidant enzymes sod 100 u/ml; catalase 400 u/ml to the bath. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203910 12718737 273318 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative stress in neurodegenerative diseases: therapeutic implications for superoxide dismutase mimetics. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203911 12718737 273323 3544 1516 CAT catalase catalase 0 1.0 antioxidant enzymes such as superoxide dismutase sod catalase and glutathione peroxidase gpx have demonstrated therapeutic efficacy in models of neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203912 12718737 273323 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 antioxidant enzymes such as superoxide dismutase sod catalase and glutathione peroxidase gpx have demonstrated therapeutic efficacy in models of neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 203913 12718737 273325 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 most recently sod mimetics small molecules which mimic the activity of endogenous superoxide dismutase have come to the forefront of antioxidant therapeutics. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205115 12753090 274886 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 proteasome activation and nnos down regulation in neuroblastoma cells expressing a cu zn superoxide dismutase mutant involved in familial als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205116 12753090 274888 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we demonstrated that expression of the fully active g93a cu zn superoxide dismutase mutant in neuroblastoma cells is associated with an increased level of oxidatively modified proteins in terms of carbonylated residues. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205117 12753090 274891 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 nitrosative stress was not involved in the oxidative unbalance as a decrease in neuronal nitric oxide production and down regulation of neuronal nitric oxide synthase nnos level were detected. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205119 12753090 274893 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the altered rate of proteolysis observed in g93a cells was specific for nnos as cu zn superoxide dismutase cu zn sod degradation by proteasome was influenced neither by its mutation nor by increased proteasome activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201232 12893007 269238 12369 6893 MAPT tau protein tau protein 0 1.0 in contrast tau protein in phf is relatively resistant to postmortem dephosphorylation [ cooper et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201233 12893007 269240 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 another important observation is accumulation of abnormal ubiquitin conjugated proteins in affected neurons suggesting dysfunction of the proteasome proteolytic system in these cells [ shringarpure et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201234 12893007 269262 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 accumulation of abnormal ubiquitin conjugated proteins in affected neurons in ad suggests dysfunction of proteasome system while co existence of hne immunoreactivity in the same cells suggests the essential role of oxidative damage in 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201236 12893007 269263 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 hne immunopositivity seems to be associated with the inheritance of apolipoprotein e 4 apoe alleles. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201237 12893007 269266 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 hne is toxic for p19 cells causing cross linking of tau into high molecular weight substances that are conjugated with ubiquitin [ montine et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201238 12893007 269268 8877 4638 GSTP1 glutathione transferase glutathione transferase 0 1.0 significant decrease of glutathione transferase activity and of other antioxidative enzymes was described in amygdala hippocampus and inferior parietal lobule in patients with ad [ lovell and markesbery 1998 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201239 12893007 269288 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 about 20% of the fals cases which are dominantly inherited are linked with mutation in the gene encoding the superoxide dismutase sod 1 protein [ rosen et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201240 12893007 269290 3544 1516 CAT catalase catalase 0 1.0 nding ubiquitous antioxidative enzyme that catalyses the conversion of the toxic superoxide radical to hydrogen peroxide which in turn is converted to h 2 o by the action of glutathione peroxidase or catalase [ fridovich 1986 ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201241 12893007 269297 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 neurofilament proteins and neurotrophic factor tyrosine kinase receptors are proteins particularly susceptible to nitrotyrosine damage [ beckman et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201242 12893007 269299 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 the same inclusions contain epitopes of ubiquitin and phosphorylated neurofilament protein [ shibata et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201243 12893007 269302 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 an in vitro study showed that hne impaires the glutamate and glucose transport and the choline acetyltransferase activity in cultured motor neurons [ pedersen et al ] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201244 12893007 269334 20070 11049 SLC6A3 dopamine transporter dopamine transporter 0 1.0 these data suggest that hne is an important mediator of oxidative stress that alters dopamine uptake after binding to sh groups of the dopamine transporter and to na + /k + atpase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201719 12901835 269760 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 we report that the expression of mutant g93a copper/zinc superoxide dismutase sod1 associated with familial amyotrophic lateral sclerosis specifically causes a decrease in mtt reduction rate and atp levels and an increase in both cytosolic and mitochondrial reactive oxygen spe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201720 12901835 269768 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in the early 1990s it has been demonstrated that about 20% of familial als fals patients possess point mutations in the gene coding for the antioxidant enzyme cu zn superoxide dismutase sod1 [ siddique et al 1991 deng et al 1993 and rosen et al 1993 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201722 12901835 269787 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 decreased activity of cytochrome c oxidase was demonstrated in spinal cord motor neurons [ borthwick et al 1999 ] and lymphocytes [ curti et al 1996 ] from sals patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201723 12901835 269788 14217 7688 NDUFA5 ubiquinone reductase ubiquinone reductase 0 1.0 nadh ubiquinone reductase defects have been shown both in postmortem brains from sod1 linked fals patients [ browne et al 1998 ] and in skeletal muscle from sals patients [ vielhaber et al 1999 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201724 12901835 269804 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activity apoalert caspase 3 colorimetric assay kit clontech palo alto usa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201725 12901835 269843 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 neither caspase 3 activation fig 1b nor the number of condensed nuclei fig 1c_amp_#x2013;e was found to be significantly increased in g93a mutant cells indicating that no significant spontaneous apoptotic tendency was 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201726 12901835 269894 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 this is in line with the recent report [ lee et al 2002 ] that aggregation of fals sod1 is not causative of death in nerve growth factor ngf differentiated pc12 cells transfected with mutant sod1s sodmt v148g or a4v . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202336 12909279 270753 3544 1516 CAT catalase catalase 0 1.0 these include enzymatic activities superoxide dismutase catalase peroxidase and peroxiredoxin low molecular weight antioxidant species vitamin e ascorbate glutathione plus more complex forms of protection such as systems for metal transport and buffering and induc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202337 12909279 270753 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 these include enzymatic activities superoxide dismutase catalase peroxidase and peroxiredoxin low molecular weight antioxidant species vitamin e ascorbate glutathione plus more complex forms of protection such as systems for metal transport and buffering 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202338 12909279 270757 3544 1516 CAT catalase catalase 0 1.0 the central nervous system cns is particularly sensitive to this kind of damage for a number of reasons including a low level of some antioxidant enzymes catalase and gsh peroxidase a high content of easily oxidised substrates e.g membrane polyunsaturated lipids and an inherently high flux of ros generated during neurochemical reactions such as dopamine oxidat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202339 12909279 270764 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 to the concept that oxidative stress plays a major role in als as in other neurodegenerative diseases is provided by the observation that mutations in the gene coding for the antioxidant enzyme cu zn superoxide dismutase sod1 have been reported in fals patients [ 21 and 80 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202340 12909279 270779 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 in fact it is known that neurons and astrocytes of sals patients contain cytoplasmic aggregates that show immunoreactivity for sod1 and ubiquitin; similar inclusion bodies were also observed in sod1 linked fals patients [ 12 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202342 12909279 270800 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 as a chain of consequent events modulating extracellular transport uptake intracellular delivery from chaperones e.g copper chaperone for sod1 ccs cox17 and atx1 to specific targets such as sod1 and cytochrome c oxidase and/or storage in copper scavenging systems such as gsh and metallothioneins [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202343 12909279 270818 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 one link between cu and fe metabolism is represented by the enzyme ceruloplasmin cp the copper protein of the plasma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202344 12909279 270819 4840 2295 CP ferroxidase ferroxidase 0 1.0 cp is an enzyme with very efficient ferroxidase activity [ 41 ] that is able to oxidise fe ii to fe iii conveying four electrons to oxygen in a single step: thus water is produced and iron can enter its transport and deposit pathway via incorporat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202345 12909279 270819 22023 11740 TF transferrin transferrin 0 1.0 [ 41 ] that is able to oxidise fe ii to fe iii conveying four electrons to oxygen in a single step: thus water is produced and iron can enter its transport and deposit pathway via incorporation into transferrin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202347 12909279 270835 22054 11763 TFRC transferrin receptor transferrin receptor 0 1.0 if the ire is located on the 3_amp_#x2032; untranslated region of the mrna the binding of irp usually causes an up regulation of the coded protein as for example for the transferrin receptor [ 28 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202348 12909279 270868 17610 9605 PTGS2 cox 2 cox2 0 1.0 nf _amp_#x3ba;b modulates the expression of several proteins such as nitric oxide synthase nos [ 93 ] and cox2 [ 70 ] that might be involved in mechanisms of inflammation mediated neurodegeneration and be crucial in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202349 12909279 270868 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 nf _amp_#x3ba;b modulates the expression of several proteins such as nitric oxide synthase nos [ 93 ] and cox2 [ 70 ] that might be involved in mechanisms of inflammation mediated neurodegeneration and be crucial in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202350 12909279 270869 17610 9605 PTGS2 cox 2 cox2 0 1.0 indeed cox2 and nos activity are dramatically increased in post mortem spinal cord samples from sporadic als patients and in astrocytes from fals mice [ 2 and 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202351 12909279 270870 17610 9605 PTGS2 cox 2 cox2 0 1.0 increased levels of cox2 and of the pro inflammatory prostaglandin pge2 were found in the cerebrospinal fluid from als patients [ 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202352 12909279 270871 17610 9605 PTGS2 cox 2 cox2 0 1.0 treatment with a selective cox2 inhibitor markedly inhibits production of pge2 in the spinal cord of als mice protecting motor neurones and significantly prolonging survival [ 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 192552 13678536 256990 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cross talk of nitric oxide oxygen radicals and superoxide dismutase regulates the energy metabolism and cell death and determines the fates of aerobic life. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 192553 13678536 256992 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 because mitochondria are the major site of free radical generation they are highly enriched with enzymes such as mn type superoxide dismutase in matrix and antioxidants including gsh on both sides of inner membranes thus minimizing oxidative stress in and around this organelle. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 192554 13678536 256994 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the present work shows that cu/zn type superoxide dismutase which has been postulated for a long time to be a cytosolic enzyme also localizes bound to inner membranes of mitochondria thereby minimizing oxidative stress in and around this organelle while mitoc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 196463 14572730 262141 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 neurons but may also involve altered function of non neural cells. _amp_#x201c;non cell autonomous_amp_#x201d; death of neurons is induced by the pro oxidant activity of a mutant form of copper/zinc superoxide dismutase sod 1 in patients with familial als which supports a crucial role of glia in the pathogenesis of als. 6 7 and 8 several findings indicate that neuroinflammatory processes mediate als pathogenesis and 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 186281 14625013 249317 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 transgenic mice overexpressing the human mutated form g93a of cu zn superoxide dismutase msod1 develop motor neuron degeneration resembling amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 186282 14625013 249325 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the exact etiology of the disease is unknown but mutations in the gene encoding cu zn superoxide dismutase sod1 are found in approximately 2% of als patients [ 12 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187460 14648077 250304 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187462 14648077 250304 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 by prx2 and gpx1 that direct 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187463 14648077 250304 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 otect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 by prx2 and gpx1 that directly regulate the redox system 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187465 14648077 250304 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then co 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187466 14648077 250309 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin 2 0 1.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187467 14648077 250309 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase 1 0 1.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187469 14648077 250309 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187470 14648077 250313 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 for the first antioxidant enzyme group three isoforms of superoxide dismutase sod [ec 1.15.1.1] have been identified: sod1 sod2 and sod3 [ 9 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187471 14648077 250314 3544 1516 CAT catalase catalase 0 1.0 in the second enzyme group the peroxiredoxin prx and glutathione peroxidase gpx families as well as catalase localized within peroxisomes have been identified. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187472 14648077 250315 3544 1516 CAT catalase catalase 0 1.0 unlike sod and catalase enzymes of the prx and gpx families require secondary enzymes and cofactors to function at high efficiency. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187473 14648077 250319 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 peroxiredoxin2 prx2 is a novel organ specific antioxidative enzyme that is mainly expressed in mammalian brain [ 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187474 14648077 250321 23454 12435 TXN thioredoxin thioredoxin 0 1.0 prx2 requires thioredoxin reductase tr as a secondary enzyme as well as thioredoxin and nadph as cofactors to function at high efficiency; the activity of prx2 in the thioredoxin/tr/nadph system is over five times higher than that of prx2 by itself [ 5 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187476 14648077 250322 17266 9354 PRDX3 thioredoxin-dependent peroxide reductase thioredoxin dependent peroxide reductase 0 1.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187477 14648077 250322 17264 9353 PRDX2 thioredoxin-dependent peroxide reductase 1 thioredoxin dependent peroxide reductase 1 0 1.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187479 14648077 250322 17264 9353 PRDX2 thioredoxin peroxidase 1 thioredoxin peroxidase 1 0 1.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187480 14648077 250323 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in addition to controlling the intracellular content of h 2 o 2 prx2 directly regulates the redox signals of the thioredoxin/tr/nadph system because alone the secondary enzyme and cofactors i.e. thioredoxin/tr/nadph can not directly regulate the redox system and can not act on h 2 o 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187481 14648077 250327 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 like prx2 gpx1 needs glutathione reductase gr as a secondary enzyme as well as glutathione and nadph as cofactors to work at high efficiency and this process is also one of the redox signals in living cells [ 21 24 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187483 14648077 250336 551 399 ALB serum albumin serum albumin 0 1.0 n of polyclonal antibody against prx2 a synthetic peptide corresponding to the c terminal region of prx2 amino acids 184_amp_#x2013;198: nh 2 kpnvddskeyfskhn cooh with or without conjugation to human serum albumin hsa at the carboxyl end was supplied by peptide institute osaka japan . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187484 14648077 250354 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 the anti prx2 antibody recognizes the hsa conjugated prx2 peptide but does not react with has prx2 peroxiredoxin2 elisa enzyme linked immunosorbent assay has human serum albumin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187485 14648077 250354 551 399 ALB serum albumin serum albumin 0 1.0 the anti prx2 antibody recognizes the hsa conjugated prx2 peptide but does not react with has prx2 peroxiredoxin2 elisa enzyme linked immunosorbent assay has human serum albumin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187486 14648077 250360 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 table 1 characteristics of five fals cases fals familial amyotrophic lateral sclerosis sod superoxide dismutase lbhi lewy body like hyaline inclusion 2 bp two base pair pci posterior column involvement type + detected nd not determined as asphyxia ih intraperitoneal hemorrhage rd respiratory distress pn pneumo 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187488 14648077 250372 551 399 ALB serum albumin serum albumin 0 1.0 the following primary antibodies were utilized: an affinity purified rabbit antibody against prx2 concentration: 1 _amp_micro;g/ml a polyclonal antibody to gpx1 [diluted 1:2 000 in 1% bovine serum albumin containing phosphate buffered saline bsa pbs ph 7.4] [ 2 ] and a polyclonal antibody to human sod1 diluted 1:10 000 in 1% bsa pbs ph 7.4 [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187489 14648077 250401 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187490 14648077 250401 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187491 14648077 250414 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 b _amp_#x2013; f no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187492 14648077 250414 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 b _amp_#x2013; f no counterstaining he hematoxylin and eosin gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187493 14648077 250438 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 lization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187494 14648077 250438 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 r stainability and immunolocalization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187496 14648077 250438 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 similar stainability and immunolocalization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187497 14648077 250447 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 hese three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187498 14648077 250447 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 onal immunolocalizations of these three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187500 14648077 250447 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 the precise intra inclusional immunolocalizations of these three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187501 14648077 250450 17264 9353 PRDX2 peroxiredoxin 2 peroxiredoxin2 0 1.0 round and sausage like lbhis in the neuropil are positive for both sod1 and prx2 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187502 14648077 250450 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase1 0 1.0 round and sausage like lbhis in the neuropil are positive for both sod1 and prx2 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187503 14648077 250453 8759 4553 GPX1 glutathione peroxidase 1 glutathione peroxidase1 0 1.0 round lbhis in the neuropil are positive for both sod1 and gpx1 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion gpx1 glutathione peroxidase1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187504 14648077 250453 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase1 0 1.0 round lbhis in the neuropil are positive for both sod1 and gpx1 arrows sod1 superoxide dismutase1 lbhi lewy body like hyaline inclusion gpx1 glutathione peroxidase1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187505 14648077 250469 21633 11506 SYP synaptophysin synaptophysin 0 1.0 or normal cytosolic constitutive proteins including tubulin and tau protein as well as neuron specific constitutive proteins containing phosphorylated neurofilament proteins nfp nonphosphorylated nfp synaptophysin and neuron specific enolase [ 13 17 18 ]; this results in partial impairment of the maintenance of cell metabolism [ 13 17 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187506 14648077 250469 12369 6893 MAPT tau protein tau protein 0 1.0 such sequestration into lbhis has also been observed for normal cytosolic constitutive proteins including tubulin and tau protein as well as neuron specific constitutive proteins containing phosphorylated neurofilament proteins nfp nonphosphorylated nfp synaptophysin and neuron specific enolase [ 13 17 18 ]; this results in par 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188363 14660707 251221 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 p experiments were performed on vulnerable hypoglossal motoneurones mns and mitochondrial function was disturbed by bath application of 1_amp_#x02013;2 m m sodium cyanide cn which inhibits complex iv cytochrome c oxidase of the electron transport chain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188365 14660707 251324 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 we investigated the impact of a disturbed respiratory chain on membrane currents and [ca 2+ ] i using cyanide cn a known inhibitor of cytochrome c oxidase complex iv . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188366 14660707 251379 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 this is based on the observation that impaired vascular endothelial growth factor vegf synthesis due to hypoxia selectively damages mns oosthuyse et al 2001 ; lambrechts et al 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189433 14690536 252558 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 expression of sod1 g93a or wild type sod1 in primary cultures of astrocytes down regulates the glutamate transporter glt 1: lack of involvement of oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189435 14690536 252562 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 using western blotting immunocytochemistry and rt pcr it was shown that expression of either hsod1 g93a or hsod1wt in astrocytes produced down regulation of the levels of a glutamate transporter glt 1 without alterations in its mrna level. hsod1 g93a or hsod1wt expression caused a decrease of the monomeric form of glt 1 without increasing oxidative multimers of glt 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189436 14690536 252562 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 without alterations in its mrna level. hsod1 g93a or hsod1wt expression caused a decrease of the monomeric form of glt 1 without increasing oxidative multimers of glt 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189437 14690536 252563 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the effects were selective to glt 1 since another glutamate transporter glast protein and mrna levels were not altered. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189438 14690536 252564 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 reflecting the decrease in glt 1 protein [3h]d aspartate uptake was reduced in cultures expressing hsod1 g93a or hsod1wt. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189439 14690536 252565 3544 1516 CAT catalase catalase 0 1.0 the hsod1 induced decline in glt 1 protein and [3h]d aspartate uptake was not blocked by the antioxidant trolox nor potentiated by antioxidant depletion using catalase and glutathione peroxidase inhibitors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189440 14690536 252565 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the hsod1 induced decline in glt 1 protein and [3h]d aspartate uptake was not blocked by the antioxidant trolox nor potentiated by antioxidant depletion using catalase and glutathione peroxidase inhibitors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189441 14690536 252567 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 this study suggests that levels of glt 1 protein in astrocytes are reduced rapidly by overexpression of hsod1 and is due to a property shared between the wild type and g93a mutant form but does not involve the production of intracellular ox 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189442 14690536 252569 20017 10940 SLC1A2 excitatory amino acid transporter 2 excitatory amino acid transporter 2 0 1.0 excitatory amino acid transporter 2|sod1 g93a protein|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189760 14698606 252862 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 most cases are sporadic although a subset 10% is familial with 20% of these being linked to mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189761 14698606 252906 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 specifically the astrocytic glutamate transporter glt 1 also known as the excitatory amino acid transporter eaat 2 appears to be particularly affected [ 34 and 35 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189762 14698606 252923 17610 9605 PTGS2 cox 2 cox 2 0 1.0 supporting a role for inflammation inhibitors of the enzyme cyclooxygenase 2 cox 2 have shown beneficial effects in sod1 mutant mouse models [ 49 and 50 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189763 14698606 252929 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 indeed the glt 1 transporter which is damaged in als is concentrated in astrocytic processes directly abutting motor neurons [ 55 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189764 14698606 252941 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 they are also compatible with possible apoptotic contributions to motor neuron loss in als [ 58 ] because mitochondria which contain cytochrome c and other apoptotic mediators are crucial regulators of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190875 14739060 254345 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 neuronal increases in calcium can activate a series of enzymes including protein kinase c proteases phosphatases phospholipases nnos and xanthine oxidase [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190876 14739060 254345 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 neuronal increases in calcium can activate a series of enzymes including protein kinase c proteases phosphatases phospholipases nnos and xanthine oxidase [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190877 14739060 254356 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 astrocytes take up glutamate convert it to glutamine through the action of glutamine synthetase an enzyme requiring atp and then release it for uptake by neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190878 14739060 254357 8420 4331 GLS glutaminase glutaminase 0 1.0 neurons then convert glutamine back to glutamate through the action of glutaminase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190879 14739060 254358 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 this cycle can be disrupted by inhibitors of glutamine synthetase an enzyme which can be easily damaged by oxidative stress [ 31 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190880 14739060 254360 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 finally excessive response to glutamate receptor mediated stimulation occur intra cellularly [ 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190881 14739060 254366 1576 990 BCL2 bcl 2 bcl2 0 1.0 three main signals cause the release of apoptogenic mitochondrial mediators: _amp_#x2022; pro apoptotic members of bcl2 family _amp_#x2022; elevated levels of intra cellular calcium such as that triggered by excitotoxicity _amp_#x2022; elevated levels of ros_amp_#x2013;rns 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190882 14739060 254368 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 hen it is released from the mitochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to inhibitors of activated caspases and causes further caspase activation _amp_#x2022; apoptosis inducing factor and endonuclease g mediate caspase independent cell death pathways 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190883 14739060 254368 6634 3346 ENDOG endonuclease g endonuclease g 0 1.0 tochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to inhibitors of activated caspases and causes further caspase activation _amp_#x2022; apoptosis inducing factor and endonuclease g mediate caspase independent cell death pathways 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190884 14739060 254368 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 _amp_#x2022; cytochrome c a member of the mitochondrial electron chain required for the generation of atp when it is released from the mitochondria into cytoplasm trigger the caspase chain _amp_#x2022; smac/diablo binds to in 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190885 14739060 254371 5696 2773 DFFB caspase-activated dnase caspase activated dnase 0 1.0 he collapse of trans membrane electrochemical gradient the loss of matrix solutes the swelling of mitochondria causing the release of cytochrome c procapases 2 3 and 9 apoptosis initiating factor and caspase activated dnase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190886 14739060 254371 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 this results in the collapse of trans membrane electrochemical gradient the loss of matrix solutes the swelling of mitochondria causing the release of cytochrome c procapases 2 3 and 9 apoptosis initiating factor and caspase activated dnase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190887 14739060 254372 5696 2773 DFFB caspase-activated dnase caspase activated dnase 0 1.0 cytochrome c and the cytosolic factor apaf1 activate the caspases while apoptosis initiating factor and caspase activated dnase move to the nucleus initiating apoptosis or programmed cell death [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190888 14739060 254372 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c and the cytosolic factor apaf1 activate the caspases while apoptosis initiating factor and caspase activated dnase move to the nucleus initiating apoptosis or programmed cell death [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190889 14739060 254382 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 g93a transgenic mouse [ 46 50 47 48 and 49 ]. _amp_#x2022; protein misfolding and aggregates: for example of a_amp_#x3b2; 42 for ad [ 43 ]. _amp_#x2022; proteasome dysfunction on ubiquinited material ubiquitin forms covalent bonds with other protein in order to mark them for degradation by an atp dependent non lysosomial proteolytic system i.e proteasome . _amp_#x2022; oxidative stress mitochondria dysfunc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190890 14739060 254392 17381 9461 PRPH peripherin peripherin 0 1.0 another intermediate filament peripherin is found in neuronal inclusions in patients with sporadic als and in transgenic mice with sod1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190891 14739060 254396 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the involvement of mitochondria and apoptosis in neuronal death is too revealed by a prolonged period of neuronal caspase activation especially caspase 1 [ 17 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190892 14739060 254397 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 ice [ 46 and 63 ] revealed an up regulation of gene related to an inflammatory process such as tnf_amp_#x3b1; gene resulting in glial activation together with change in apoptosis related gene such as caspase 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190893 14739060 254401 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 in familial forms missense mutation have been identified for gene encoding _amp_#x3b2; amyloid precursor protein as well as presenilin 1 psen1 and presenilin 2 psen2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190894 14739060 254401 17462 9509 PSEN2 presenilin 2 presenilin 2 0 1.0 in familial forms missense mutation have been identified for gene encoding _amp_#x3b2; amyloid precursor protein as well as presenilin 1 psen1 and presenilin 2 psen2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190895 14739060 254402 12369 6893 MAPT tau protein tau protein 0 1.0 the sporadic forms are thought to result from a complex interaction among multiple predisposing genes such as variant apoe the gene for _amp_#x3b1; 2 macrogobulin and perhaps the gene for tau protein and other factors including environmental contributions and occurrence by chance [ 45 and 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190896 14739060 254403 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 tion of proteins: microtubular tau protein for the former accumulation of several aggregated proteins _amp_#x3b2; amyloid especially its toxic form a_amp_#x3b2; 42 apoe [ 43 ] hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0;and 2 with an inflammatory reaction around the deposit of _amp_#x3b2; amyloid for the latter [ 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190897 14739060 254403 12369 6893 MAPT tau protein tau protein 0 1.0 the neuropathological hallmarks neurofibrillary tangles and senile plaques are both aggregation of proteins: microtubular tau protein for the former accumulation of several aggregated proteins _amp_#x3b2; amyloid especially its toxic form a_amp_#x3b2; 42 apoe [ 43 ] hyperphosphorylated tau ubiquitin presenilin 1_amp_#xa0;and 2 with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190899 14739060 254413 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 1.0 parkin is one member of the family of ubiquitin ligase responsible for ubiquination a process tagging proteins for degradation through proteosomal pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190900 14739060 254425 9766 4851 HTT huntingtin huntingtin 0 1.0 the increased number in gag repeats in the mutant gene are expressed as an elongated huntingtin protein [ 38 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190901 14739060 254426 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 as demonstrated in transgenic mouse this abnormal protein is cleaved to fragments conjugated with ubiquitin; which aggregate forming neuronal intra nuclear inclusions. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190905 14739060 254456 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 primary coenzyme q deficiency cause a mitochondrial encephalomyopathy that is responsive to coenzyme q administration [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190906 14739060 254489 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 clinical trials are underway to test inhibitors of apoptosis such as minocycline [ 17 ] coenzyme q in pd [ 56 ] and many others using so called antioxidants despite disappointing results obtained [ 51 and 52 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190907 14739060 254491 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 then the antioxidant defenses: vitamins a e c selenium food rich in vegetables and fruits and perhaps by using mitochondrial cofactors such as l carnitine r _amp_#x3b1; lipoic acid [ 35 ] riboflavine coenzyme q etc. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183237 15031734 244221 211 132 ACTB beta actin beta actin 0 1.0 all four bases of dna are susceptible to oxidative damage involving hydroxylation 7 and significant protein carbonylation for example of creatine kinase and beta actin 2 and nitration is observed in ad brains whereas increased levels of 8 hydroxyguanine and 8 hydroxy 2 deoxyguanosine are observed in pd brains; the selective attack on guanine bases implies oh radica 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183238 15031734 244221 4423 1991 CKB creatine kinase creatine kinase 0 1.0 all four bases of dna are susceptible to oxidative damage involving hydroxylation 7 and significant protein carbonylation for example of creatine kinase and beta actin 2 and nitration is observed in ad brains whereas increased levels of 8 hydroxyguanine and 8 hydroxy 2 deoxyguanosine are observed in pd brains; the selective attack on guanine bases im 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183239 15031734 244223 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 in the ad brain the activity of the antioxidant proteins catalase superoxide dismutase sod glutathione peroxidase and glutathione reductase are increased in the hippocampus and amygdala 9 10 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183240 15031734 244223 3544 1516 CAT catalase catalase 0 1.0 in the ad brain the activity of the antioxidant proteins catalase superoxide dismutase sod glutathione peroxidase and glutathione reductase are increased in the hippocampus and amygdala 9 10 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183241 15031734 244223 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in the ad brain the activity of the antioxidant proteins catalase superoxide dismutase sod glutathione peroxidase and glutathione reductase are increased in the hippocampus and amygdala 9 10 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183242 15031734 244229 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 glutamate and glucose from cell culture 12 whereas hne modifies proteins resulting in a multitude of effects including inhibition of the neuronal glucose transporter type 3 the glutamate transporter glt 1 ref 13 as well as the na + +k + atpases 14 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183243 15031734 244229 20025 11007 SLC2A3 glucose transporter type 3 glucose transporter type 3 0 1.0 acrolein downregulates the uptake of glutamate and glucose from cell culture 12 whereas hne modifies proteins resulting in a multitude of effects including inhibition of the neuronal glucose transporter type 3 the glutamate transporter glt 1 ref 13 as well as the na + +k + atpases 14 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183244 15031734 244230 12337 6871 MAPK1 mitogen-activated protein kinase 1 mitogen activated protein kinase 1 0 1.0 hne activates c jun aminoterminal kinases and mitogen activated protein kinase 1 also known as p38 thereby stimulating an apoptotic cascade 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183245 15031734 244230 10824 6204 JUN c jun c jun 0 1.0 hne activates c jun aminoterminal kinases and mitogen activated protein kinase 1 also known as p38 thereby stimulating an apoptotic cascade 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183246 15031734 244231 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 modifications to proteins result in the impairment of enzymes for example glutamine synthase superoxide dismutase whereas ros interactions with dna lead to mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183247 15031734 244242 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 n redox active metals and oxygen species via reactions such as the fenton and haber weiss reactions or via indirect pathways involving the calcium activation of metallo enzymes such as phospholipases nitric oxide synthase and xanthine dehydrogenase also known as xanthine oxidase 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183248 15031734 244242 24288 12805 XDH xanthine dehydrogenase xanthine dehydrogenase 0 1.0 oxygen species via reactions such as the fenton and haber weiss reactions or via indirect pathways involving the calcium activation of metallo enzymes such as phospholipases nitric oxide synthase and xanthine dehydrogenase also known as xanthine oxidase 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183249 15031734 244242 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 the fenton and haber weiss reactions or via indirect pathways involving the calcium activation of metallo enzymes such as phospholipases nitric oxide synthase and xanthine dehydrogenase also known as xanthine oxidase 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183250 15031734 244251 7975 3951 FXN frataxin frataxin 0 1.0 we have proposed that the proteins implicated in several age dependent neurodegenerative disorders a beta in ad alpha synuclein in pd sod1 in als frataxin in friedreich's ataxia box 1 and alpha b crystallin in cataracts might abnormally present cu 2+ or fe 3+ ligands for inappropriate reaction with o 2 fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183251 15031734 244251 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 we have proposed that the proteins implicated in several age dependent neurodegenerative disorders a beta in ad alpha synuclein in pd sod1 in als frataxin in friedreich's ataxia box 1 and alpha b crystallin in cataracts might abnormally present cu 2+ or fe 3+ ligands for inappropriate reaction with o 2 fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183252 15031734 244263 20351 17128 SLC39A3 zinc transporter zinc transporter 0 1.0 results have highlighted the importance of zn 2+ in amyloid plaque formation; for example age and female sex related plaque formation in tg2576 transgenic mice was reduced by genetic ablation of the zinc transporter 3 protein which is required for zinc transport into synaptic vesicles 36 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183253 15031734 244277 3544 1516 CAT catalase catalase 0 1.0 synthetic a beta is toxic to cells in the presence of cu 2+ but this toxicity is inhibited by extracellular catalase which implicates h 2 o 2 in the toxic pathway 50 51 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183254 15031734 244301 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the principal protein component of these deposits is alpha synuclein 65 which is ubiquitously expressed in the brain; mutations of alpha synuclein a30p and a53t contribute to familial forms of the disease 66 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183255 15031734 244314 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 a diverse array of evidence is emerging that alpha synuclein has a role in modulating the activity of dopamine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183256 15031734 244316 17754 9752 QDPR dihydropteridine reductase dihydropteridine reductase 0 1.0 the mutations in alpha synuclein have been shown to alter the expression of dihydropteridine reductase which indirectly regulates the synthesis of dopamine 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183257 15031734 244316 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the mutations in alpha synuclein have been shown to alter the expression of dihydropteridine reductase which indirectly regulates the synthesis of dopamine 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183258 15031734 244317 22087 11782 TH tyrosine hydroxylase tyrosine hydroxylase 0 1.0 synuclein forms stable complexes with the human dopamine transporter thereby inhibiting uptake of dopamine by its transporter 80 and that alpha synuclein can regulate dopamine synthesis by inhibiting tyrosine hydroxylase 81 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183259 15031734 244317 20070 11049 SLC6A3 dopamine transporter dopamine transporter 0 1.0 co immunoprecipitation experiments have shown that alpha synuclein forms stable complexes with the human dopamine transporter thereby inhibiting uptake of dopamine by its transporter 80 and that alpha synuclein can regulate dopamine synthesis by inhibiting tyrosine hydroxylase 81 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183260 15031734 244317 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 co immunoprecipitation experiments have shown that alpha synuclein forms stable complexes with the human dopamine transporter thereby inhibiting uptake of dopamine by its transporter 80 and that alpha synuclein can regulate dopamine synthesis by inhibiting tyrosine hydroxylase 81 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183261 15031734 244318 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the link between alpha synuclein and redox chemistry associated with iron bound dopamine/neuromelanin has been given further credence by a study showing that initiation of lewy body formation coincides with alpha synuclein depositio 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183262 15031734 244318 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 and redox chemistry associated with iron bound dopamine/neuromelanin has been given further credence by a study showing that initiation of lewy body formation coincides with alpha synuclein deposition exclusively within lipofuscin and neuromelanin deposits 82 ; in addition alpha synuclein crosslinked to neuromelanin has been reported 83 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183263 15031734 244318 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 deposition exclusively within lipofuscin and neuromelanin deposits 82 ; in addition alpha synuclein crosslinked to neuromelanin has been reported 83 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183264 15031734 244319 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the breakdown in alpha synuclein modulated dopamine homeostasis is consistent with the recent observation that the pathogenicity of mutant alpha synuclein is dopamine dependent 84 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183265 15031734 244320 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 in addition to the regulation of dopamine by alpha synuclein studies have shown a direct interaction of alpha synuclein with metal ions leading to protein aggregation 85 86 87 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183266 15031734 244321 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 methionine oxidation inhibits alpha synuclein aggregation; however in the presence of certain metal ions aggregation and fibrillization of alpha synuclein still occurs 88 which highlights a potential role of metals and oxidative stress in the deposition of alpha synuclein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183267 15031734 244321 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 still occurs 88 which highlights a potential role of metals and oxidative stress in the deposition of alpha synuclein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183268 15031734 244354 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 are continuing with regard to the design of small molecule stimulators of endogenous neurotrophins an alternative approach to increasing endogenous neurotrophins _amp_#8212; for example brain derived neurotrophic factor which is known to enhance learning and memory and also protect against oxidative stress _amp_#8212; is caloric restriction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183269 15031734 244354 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 hough efforts are continuing with regard to the design of small molecule stimulators of endogenous neurotrophins an alternative approach to increasing endogenous neurotrophins _amp_#8212; for example brain derived neurotrophic factor which is known to enhance learning and memory and also protect against oxidative stress _amp_#8212; is caloric restriction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183270 15031734 244392 12337 6871 MAPK1 mitogen-activated protein kinase 1 mitogen activated protein kinase 1 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183271 15031734 244392 7975 3951 FXN frataxin frataxin 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183272 15031734 244392 211 132 ACTB beta actin beta actin 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183273 15031734 244392 4423 1991 CKB creatine kinase creatine kinase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183274 15031734 244392 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183275 15031734 244392 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183276 15031734 244392 24288 12805 XDH xanthine dehydrogenase xanthine dehydrogenase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183277 15031734 244392 3544 1516 CAT catalase catalase 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183278 15031734 244392 20025 11007 SLC2A3 glucose transporter type 3 glucose transporter type 3 0 1.0 beta actin catalase creatine kinase frataxin glucose transporter type 3 glutathione peroxidase glutathione reductase mitogen activated protein kinase 1 sod alpha synuclein xanthine dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183279 15031734 244394 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 alzheimer's disease amyotrophic lateral sclerosis friedreich's ataxia huntington's disease nitric oxide synthase parkinson's disease stroke wilson's disease 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183280 15031734 244401 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 a beta amyloid beta; ros reactive oxygen species; sod superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183281 15031734 244415 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 the equilibrium between vesicle bound dopamine and cytoplasmic dopamine is regulated by alpha synuclein; mutations in this protein shift the dopamine equilibrium in favour of the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183282 15031734 244416 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 in the presence of fe and under conditions of oxidative stress alpha synuclein will aggregate and form deposits. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183283 15031734 244417 13411 7212 MPHOSPH1 mpp 1 mpp 1 0 1.0 mpp 1 methyl 4 phenyl pyridine. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 183284 15031734 244420 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the normal function of superoxide dismutase sod is to convert toxic superoxide radicals into h 2 o 2 that are subsequently inactivated by catalase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 184282 15038597 246226 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 in particular we recently demonstrated that in copper deficiency mitochondrial function is impaired due to decreased activity of cytochrome c oxidase leading to production of reactive oxygen species which in turn triggers mitochondria mediated apoptotic neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 177202 15105254 236595 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 in parkinson's disease pd mitochondrial toxins and perturbed ubiquitin dependent proteolysis may impair atp production and increase oxyradical production and maos. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 177203 15105254 236596 9766 4851 HTT huntingtin huntingtin 0 1.0 the inheritance of polyglutamine expanded huntingtin may promote neuronal degeneration in huntington's disease hd in part by increasing maos. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169744 15208263 227119 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the gene coding for the ubiquitous anti oxidant enzyme cu zn superoxide dismutase sod1 are associated with familial amyotrophic lateral sclerosis fals a fatal disease characterized by selective loss of motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169745 15208263 227122 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 we show that human glioblastoma cells expressing g93a sod1 induce activation of caspase 1 release of cytokines and activation of apoptotic pathways in cocultured human neuroblastoma cells also expressing g93a sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169746 15208263 227123 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 activation of caspase 1 and caspase 3 is observed also in neuroblastoma lines expressing other fals sod1s g37r g85r and i113t cocultured with glioblastoma lines expressing the corresponding mutant enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169747 15208263 227123 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 activation of caspase 1 and caspase 3 is observed also in neuroblastoma lines expressing other fals sod1s g37r g85r and i113t cocultured with glioblastoma lines expressing the corresponding mutant enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169748 15208263 227126 9905 5438 IFNG interferon, gamma interferon gamma 0 1.0 proinflammatory cytokines interferon gamma and nitric oxide are among the molecular signals exchanged between glial and neuronal cells that generate a functional interplay between the two cell types. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 169749 15208263 227131 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 cytokines|enzyme inhibitors|lipopolysaccharides|noc 18|nitric oxide donors|nitroso compounds|reactive oxygen species|ng nitroarginine methyl ester|interferon type ii|catalase|nitric oxide synthase|sod1 g93a protein|superoxide dismutase 1|superoxide dismutase|caspase 1| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 172854 15266948 231018 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 melatonin has been shown to either stimulate gene expression for the antioxidant enzymes superoxide dismutase catalase glutathione peroxidase glutathione reductase or to increase their activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 172855 15266948 231018 3544 1516 CAT catalase catalase 0 1.0 melatonin has been shown to either stimulate gene expression for the antioxidant enzymes superoxide dismutase catalase glutathione peroxidase glutathione reductase or to increase their activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 172856 15266948 231018 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 melatonin has been shown to either stimulate gene expression for the antioxidant enzymes superoxide dismutase catalase glutathione peroxidase glutathione reductase or to increase their activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175554 15333927 234325 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 structure of the cytosolic cu zn superoxide dismutase from schistosoma mansoni. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175555 15333927 234326 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 cu zn superoxide dismutase cu zn sod is an essential enzyme for protecting cells from the toxic effects of reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 175556 15333927 234330 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 this is the first report of a crystal structure of a cu zn superoxide dismutase derived from a human parasite. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 166654 15480846 223890 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 iron has been shown to accumulates at site where neurons degenerate in neurodegenerative diseases of parkinson s disease alzheimer s disease huntington disease amyotrophic lateral sclerosis and friedreich ataxia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151511 15812313 199883 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in the copper_amp_#47;zinc superoxide dismutase sod1 gene are known to be responsible for familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151512 15812313 199887 3542 1515 CAST calpain inhibitor calpain inhibitor 0 1.0 moreover this copper induced toxicity was attenuated by a free radical scavenger a caspase inhibitor or a calpain inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151513 15812313 199891 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the mutation in the copper_amp_#47;zinc superoxide dismutase sod1 gene is known to be associated with the familial als fals because of some undefined property of mutant sod1 protein _amp_#91; 1 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151514 15812313 199907 16325 8808 PDHB pyruvate dehydrogenase pyruvate dehydrogenase 0 1.0 copper overload induces lipid peroxidation marked by the formation of 4 hydroxy nonenal and it inhibits pyruvate dehydrogenase pdh by covalently modifying the lipoic acid moiety of the enzyme _amp_#91; 10 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151515 15812313 199917 3542 1515 CAST calpain inhibitor calpain inhibitor 0 1.0 of cells expressing mutant sod1 the cells were treated with various agents prior to exposing the cells to cu 2_amp_#43; namely enzyme inhibitors _amp_#91;z vad fmk a pan caspase inhibitor calpeptin a calpain inhibitor _amp_#93; intermediates of energy metabolism or cofactors of mitochondrial enzymes pyruvate thiamine lipoic acid alternate energy substrates lactate oxaloacetate [alpha] ketoglutarate free radical sc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151516 15812313 199948 4840 2295 CP ceruloplasmin ceruloplasmin 0 1.0 copper is an essential trace metal and is required for the proper functioning of several enzymes including cytochrome c oxidase ceruloplasmin and sod1 _amp_#91; 13 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151518 15812313 199948 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 copper is an essential trace metal and is required for the proper functioning of several enzymes including cytochrome c oxidase ceruloplasmin and sod1 _amp_#91; 13 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151519 15812313 199957 16325 8808 PDHB pyruvate dehydrogenase pyruvate dehydrogenase 0 1.0 this cu 2_amp_#43; neurotoxicity was attenuated by the pyruvate dehydrogenase cofactors thiamine or dihydrolipoic acid. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 154000 15850589 203907 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 nitrocellulose membranes were probed with a polyclonal sheep anti human superoxide dismutase cu/zn antibody 1:1000; calbiochem emd biosciences inc la jolla ca usa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 154001 15850589 204017 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 failure to maintain this condition can result from several mechanisms including oxidative modifications of critical thiols in the inner mitochondrial membrane particularly in mptp components such as adenine nucleotide translocator ant . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 154002 15850589 204046 1576 990 BCL2 bcl 2 bcl2 0 1.0 treatment with inhibitors of mptp opening and overexpression of bcl2 which inhibits the opening of mptp under stressful conditions delayed the disease onset and prolonged survival in transgenic mice with mutant sod1 [42] [43] and [44] and rendered cells transfected wi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142775 15863242 187979 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 cu/zn superoxide dismutase 1 sod1 encoded on chromosome 21 is a key enzyme in metabolism of oxygen free radicals and oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142777 15863242 187987 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 the human cu/zn superoxide dismutase 1 gene hsod1 was the first chromosome 21 gene to be characterised groner et al. 1985 and it was even shown earlier to be overexpressed at the protein level in down syndrome ds; trisomy 21 patients sine 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142778 15863242 188041 21672 11517 TAC1 substance p substance p 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142779 15863242 188041 8831 4605 GRP bombesin bombesin 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142780 15863242 188041 452 333 AGT angiotensin i angiotensin i 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142781 15863242 188041 452 333 AGT angiotensin ii angiotensin ii 0 1.0 calibration of the instrument was performed externally with [m + h] + ions of angiotensin i angiotensin ii substance p bombesin and adrenocorticotropic hormones clip 1_amp_#x2013;17 and clip 18_amp_#x2013;39 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142782 15863242 188092 3843 1618 CCT5 tcp 1 epsilon tcp 1 epsilon 0 1.0 eight t complex 1 proteins tcp 1 were studied in ds brain; the tcp 1 epsilon yoo et al. 2001a as well as alpha and beta subunits were significantly decreased in fetal second trimester ds brain yoo et al. 2001b and decrease of the gamma subunit was here observed in hippocampus 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142783 15863242 188092 21932 11655 TCP1 t-complex 1 t complex 1 0 1.0 eight t complex 1 proteins tcp 1 were studied in ds brain; the tcp 1 epsilon yoo et al. 2001a as well as alpha and beta subunits were significantly decreased in fetal second trimester ds brain yoo et al. 2001b and dec 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142784 15863242 188097 23397 12408 TUBA3C tubulin, alpha 2 tubulin alpha 2 0 1.0 while reduced neurofilament triplet m protein and neuronal tropomodulin markers for neuronal density may simply indicate neuronal loss in brain of transgenic animals tubulin alpha 2 and beta chains were overexpressed in this study ruling out that decrease of proteins in this study was simply due to neuronal loss. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142785 15863242 188099 6372 3189 EEF1A1 ef tu ef tu 0 1.0 species ros with subsequent oxidation and modification of transcription neurodegeneration per se or general impairment of translation reflected by reduced expression of translation elongation factor ef tu like protein p43 table 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142786 15863242 188105 6135 3013 DPYS dihydropyrimidinase dihydropyrimidinase 0 1.0 a most intriguing finding was misexpression of dihydropyrimidinase related proteins major neuronal migration guidance cues in tg hsod1 mice: pathfinding of growing axons to reach their target during brain development or modeling is a subtle process needed to build u 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142787 15863242 188106 6135 3013 DPYS dihydropyrimidinase dihydropyrimidinase 0 1.0 abnormal brain development in ds was described in a couple of morphological reports becker et al. 1991 epstein 1995 wisniewski and bobinski 1991 and wisniewski and kida 1994 and decrease of dihydropyrimidinase related protein 2 in ds was previously observed weitzdoerfer et al. 2001a and weitzdoerfer et al. 2001b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142788 15863242 188107 6135 3013 DPYS dihydropyrimidinase dihydropyrimidinase 0 1.0 expressional patterns of several dihydropyrimidinase related proteins including isoforms or posttranslational modifications thereof in tg hsod1 mice and in ds were similar and may represent or lead to neurodegenerative changes abnormal wiring and plast 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142790 15863242 188108 23546 17598 UBE2J1 ubiquitin-conjugating enzyme e2 ubiquitin conjugating enzyme e2 0 1.0 finally the manifold decrease of ubiquitin conjugating enzyme e2 level in tg hsod1 mice catalyzing covalent attachment of ubiquitin to other proteins may reflect sod1 mediated impaired protein handling in terms of ubiquitination. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142793 15863242 188110 23406 20778 TUBB tubulin beta polypeptide tubulin beta polypeptide 0 1.0 we have included fragments of two proteins table 1 similar to tubulin beta polypeptide and sex determining protein that were differentially expressed between groups but these were not included in the discussion as no definitive assignment can be made based upon an incomplete sequence. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144769 15896810 189884 7975 3951 FXN frataxin frataxin 0 1.0 recent evidence suggests that frataxin might detoxify ros via activation of glutathione peroxidase and elevation of thiols and in addition that decreased expression of frataxin protein is associated with frda. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144771 15896810 189891 9462 5013 HMOX1 ho 1 ho 1 0 1.0 among the various hsps hsp32 also known as heme oxygenase i ho 1 has received considerable attention as it has been recently demonstrated that ho 1 induction by generating the vasoactive molecule carbon monoxide and the potent antioxidant bilirubin could represent a protective system potentially active against brain oxidative injury. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144772 15896810 189901 5180 17937 CUZD1 erg 1 erg 1 0 1.0 there is evidence to support that oxidative stress alters the expression of antioxidant enzymes and enhances expression and/or dna binding of numerous transcription factors including ap 1 fos jun myc erg 1 sapk and nfkb [3] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144773 15896810 189901 7683 3796 FOS ap 1 ap 1 0 1.0 there is evidence to support that oxidative stress alters the expression of antioxidant enzymes and enhances expression and/or dna binding of numerous transcription factors including ap 1 fos jun myc erg 1 sapk and nfkb [3] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144774 15896810 189908 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however although activation of stress tolerance signaling leading to protective nuclear responses such as increased expression of heat shock proteins antioxidant enzymes and bcl 2 may be triggered to withstand all the above mentioned pathogenic changes a vicious cycle of increasing oxidative damage may insidiously develop over a period of years inducing progressive degenerativ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144775 15896810 189910 22023 11740 TF transferrin transferrin 0 1.0 evated content of iron in specific areas of the human brain such as globus pallidus and substantia nigra sn while cerebrospinal fluid has very little iron binding capacity owing to its low content of transferrin; e cns contains non replicating neuronal cells which once damaged may be permanently dysfunctional or committed to programmed cell death apoptosis . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144776 15896810 189910 3544 1516 CAT catalase catalase 0 1.0 ble substrates such as polyunsaturated fatty acids and catecholamines; b relatively low levels of antioxidants such as glutathione and vitamin e and antioxidant enzymes such as glutathione peroxidase catalase and superoxide dismutase ; c the endogenous generation of reactive oxygen free radicals via several specific reactions; d the elevated content of iron in specific areas of the human brain such as glo 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144777 15896810 189910 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 s such as polyunsaturated fatty acids and catecholamines; b relatively low levels of antioxidants such as glutathione and vitamin e and antioxidant enzymes such as glutathione peroxidase catalase and superoxide dismutase ; c the endogenous generation of reactive oxygen free radicals via several specific reactions; d the elevated content of iron in specific areas of the human brain such as globus pallidus and substant 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144778 15896810 189917 7975 3951 FXN frataxin frataxin 0 1.0 there is now evidence to suggest that frataxin might detoxify ros via activation of glutathione peroxidase and elevation of thiols [10] and in addition that decreased expression of frataxin protein is associated with frda [11] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144779 15896810 189922 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 clinical and genetic features of friedreich ataxia 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144780 15896810 189923 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 friedreich ataxia is the commonest form of inherited ataxia with a frequency of 1 in 50 000 live births. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144781 15896810 189933 7975 3951 FXN frataxin frataxin 0 1.0 mutations in the frda gene either gaa expansions or point mutations result in reduced expression of a protein called frataxin [16] which has been shown to be localized to mitochondria [16] [17] and [18] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144782 15896810 189935 7975 3951 FXN frataxin frataxin 0 1.0 the amount of residual frataxin in lymphoblastoid cell lines from frda patients correlates with the gaa expansion size in the smaller allele [16] and likely represents the molecular basis of the relationship between gaa expansion s 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144783 15896810 189938 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 there is significant evidence that the pathogenesis of several neurodegenerative diseases including parkinson's disease alzheimer's disease friedreich ataxia multiple sclerosis and amyotrophic lateral sclerosis may involve the generation of reactive oxygen species ros reactive nitrogen species rns and mitochondrial dysfunction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144785 15896810 189939 7975 3951 FXN frataxin frataxin 0 1.0 studies using the budding yeast saccharomyces cerevisiae have provided the first clues to understand the consequences of frataxin loss [17] [18] [19] [20] and [21] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144786 15896810 189940 7975 3951 FXN frataxin frataxin 0 1.0 it has been shown that deletion of the yeast frataxin homolog yfh1 results in a 10 fold increase in iron within the mitochondria along with increased ros production [17] and [20] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144787 15896810 189944 7975 3951 FXN frataxin frataxin 0 1.0 recent evidence suggests that frataxin might detoxify ros via activation of glutathione peroxidase and elevation of thiols [10] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144788 15896810 189945 7975 3951 FXN frataxin frataxin 0 1.0 transgenic overexpression of human frataxin increases cellular antioxidant defense via activation of glutathione peroxidase and elevation of reduced thiols thereby reducing the incidence of malignant transformation induced by ros as observed b 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144789 15896810 189946 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 up regulation of protein manganese superoxide dismutase mnsod fails to occur in frda fibroblasts exposed to iron [25] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144791 15896810 189949 7975 3951 FXN frataxin frataxin 0 1.0 there is evidence that frataxin acts as a chaperone for fe ii and a storage compartment for excess iron [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] and [38] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144792 15896810 189950 7975 3951 FXN frataxin frataxin 0 1.0 this is consistent with the roles played by frataxin in iron export fe_amp_#x2013;s cluster assembly heme biosynthesis and prevention of oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144793 15896810 189951 7975 3951 FXN frataxin frataxin 0 1.0 also frataxin plays a direct role in the mitochondrial energy activation and oxidative phosphorylation [11] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144794 15896810 189953 7975 3951 FXN frataxin frataxin 0 1.0 in mouse models deletion of the frataxin gene results in embryonic lethality [40] while its selective inactivation in neuronal and cardiac tissues leads to neurological symptoms and cardiomyopathy associated with mitochondrial iron_amp_#x20 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144795 15896810 189954 7975 3951 FXN frataxin frataxin 0 1.0 in contrast a model expressing 25_amp_#x2013;35% of wild type frataxin levels by virtue of a gaa 230 expansion inserted in the first intron of the mouse gene has no obvious phenotype [39] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144796 15896810 189959 4423 1991 CKB creatine kinase creatine kinase 0 1.0 free metabolically active [adp] the major regulator of the oxidative phosphorylation can be calculated from the mrs data using the creatine kinase equilibrium expression [42] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144797 15896810 189971 7975 3951 FXN frataxin frataxin 0 1.0 the length of the gaa expansion has been shown to determine the amount of frataxin expressed [16] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144798 15896810 189972 7975 3951 FXN frataxin frataxin 0 1.0 therefore the residual expression of frataxin probably determines the reduced skeletal muscle mitochondrial atp production rate we detected in vivo. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144800 15896810 190030 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 other data are also consistent with these findings as it has been shown both in a patient with cytochrome c oxidase deficiency and in an animal model of copper deficiency that more than a 50% deficit in complex iv activity did not affect the respiratory flux [56] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144802 15896810 190045 5893 2898 DLD diaphorase diaphorase 0 1.0 excessive formation of no_amp_#xb7; from glial origin has been evidenced in some study in which nadph diaphorase a cytochemical marker of nos activity positive glial cells have been identified in the substantia nigra of postmortem brains obtained from individuals with parkinson's disease [88] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144803 15896810 190054 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the enzyme responsible for no synthesis is the nitric oxide synthase nos family of enzymes which catalyse the conversion of arginine to citrulline and no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144804 15896810 190061 10436 5991 IL1A interleukin 1 interleukin 1 0 1.0 activation of inos requires gene transcription and the induction can be influenced by endotoxin and cytokines interleukin 1 interleukin 2 lipopolysaccharide interferon _amp_#x3b3; tumor necrosis factor . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144805 15896810 190061 10452 6001 IL2 interleukin 2 interleukin 2 0 1.0 activation of inos requires gene transcription and the induction can be influenced by endotoxin and cytokines interleukin 1 interleukin 2 lipopolysaccharide interferon _amp_#x3b3; tumor necrosis factor . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144806 15896810 190061 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 activation of inos requires gene transcription and the induction can be influenced by endotoxin and cytokines interleukin 1 interleukin 2 lipopolysaccharide interferon _amp_#x3b3; tumor necrosis factor . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144807 15896810 190062 10480 5962 IL10 interleukin 10 interleukin 10 0 1.0 this activation can be blocked by anti inflammatory drugs dexamethasone inhibitory cytokines interleukin 4 interleukin 10 prostaglandins pga 2 tissue growth factors or inhibitors of protein synthesis e.g. cycloheximide [94] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144808 15896810 190062 10458 6014 IL4 interleukin 4 interleukin 4 0 1.0 this activation can be blocked by anti inflammatory drugs dexamethasone inhibitory cytokines interleukin 4 interleukin 10 prostaglandins pga 2 tissue growth factors or inhibitors of protein synthesis e.g. cycloheximide [94] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144809 15896810 190066 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the rate of this reaction is three times faster than the rate of superoxide dismutase sod in catalyzing the dismutation of the superoxide anion to hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144811 15896810 190071 551 399 ALB serum albumin serum albumin 0 1.0 nitrosothiols with biological relevance have been isolated and characterized including s nitrosoglutathione and the nitrosothiols of serum albumin [101] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144812 15896810 190074 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 no has been demonstrated to stimulate the auto adp ribosylation of glyceraldehyde 3 phosphate dehydrogenase gapdh by reacting with a critical cysteine with resulting binding of nad to the catalytic cysteine inhibition of gapdh activity and depression of glycolysis [104] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144813 15896810 190078 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 other heme protein targets for no are catalase cytochrome c hemoglobin and peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144814 15896810 190078 3544 1516 CAT catalase catalase 0 1.0 other heme protein targets for no are catalase cytochrome c hemoglobin and peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144815 15896810 190081 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 through this mechanism no a irreversibly inactivates the enzyme ribonucleotide reductase thereby inhibiting dna synthesis b moves iron from iron storage proteins such as ferritin and c mobilizes cu+ from caeruloplasmin and metallothionein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144816 15896810 190097 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 the factors responsible for this include the inner mitochondrial membrane lipid composition and/or the oxidant/antioxidant balance particularly manganese superoxide dismutase and/or heat shock protein activity and expressions as well as the glutathione status. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144818 15896810 190121 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 this reaction can occur spontaneously but most often is catalyzed by glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144819 15896810 190128 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 the latter finding that could also be induced by addition of a_amp_#x3b2; to synaptosomes [127] coupled with the reported loss of glutamine synthetase activity in ad brain [127] suggests that glutamate stimulated excitotoxic mechanisms could be important in neurodegeneration in ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144820 15896810 190129 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 there are evidences of an impairment in vivo of glutathione homeostasis and antioxidant enzymes in patients with friedreich ataxia suggesting a relevant role of free radical cytotoxicity in the pathophysiology of the disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144821 15896810 190130 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 in fact a reduction of free glutathione levels in the blood of patients with friedreich ataxia a total glutathione concentration comparable to the controls and a significant increase of glutathione bound to haemoglobin in erythrocytes have been demonstrated in frda patients [128] also associat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144822 15896810 190130 8877 4638 GSTP1 glutathione transferase glutathione transferase 0 1.0 in in erythrocytes have been demonstrated in frda patients [128] also associated with a significant elevation in the superoxide dismutase/glutathione peroxidase activity ratio and with an 83% rise of glutathione transferase activity in the blood [129] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144823 15896810 190130 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 arable to the controls and a significant increase of glutathione bound to haemoglobin in erythrocytes have been demonstrated in frda patients [128] also associated with a significant elevation in the superoxide dismutase/glutathione peroxidase activity ratio and with an 83% rise of glutathione transferase activity in the blood [129] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144824 15896810 190142 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144825 15896810 190142 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144826 15896810 190142 9462 5013 HMOX1 ho 1 ho 1 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144827 15896810 190144 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144828 15896810 190146 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144829 15896810 190146 8888 4646 GTF2A1 glucose regulated protein glucose regulated protein 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144830 15896810 190147 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after a variety of central nervous system cns insults hsp70 is synthesized at high levels and is present in the cytosol nucleus and endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144831 15896810 190151 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after heat shock for instance the synthesis of hsp70 increases to a point to where it becomes the most abundant single protein in a cell. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144832 15896810 190152 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 once synthesized hsp70 binds to denaturated proteins in an atp dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144833 15896810 190159 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 only recently however with the availability of transgenic animals and gene transfer has become possible to overexpress the gene encoding hsp70 to test directly the hypothesis that stress proteins protects cells from injury and it has been demonstrated that overproduction of hsp70 leads to protection in several different models of nervous sy 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144834 15896810 190159 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 to test directly the hypothesis that stress proteins protects cells from injury and it has been demonstrated that overproduction of hsp70 leads to protection in several different models of nervous system injury [136] and [137] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144835 15896810 190160 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 following focal cerebral ischemia mrna encoding hsp70 is synthesized in most ischemic cells except in areas of very low blood flow because of limited atp levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144836 15896810 190161 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 proteins is produced mainly in endothelial cells in the core of infarcts in the cells that are most resistant to ischemia in glial cells at the edges of infarcts and in neurons outside the areas of i 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144837 15896810 190162 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 it has been suggested that this neuronal expression of hsp70 outside an infarct can be used to define the ischemic penumbras which means the zone of protein denaturation in the ischemic areas [138] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144838 15896810 190165 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 transfection of cultured astrocytes with hsp70 protects them from ischemia or glucose deprivation [140] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144839 15896810 190166 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 hsp70 has been demonstrated to inhibit caspase 3 activation caused by ceramide and also affect jun kinase and p38 kinase activation [141] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144840 15896810 190166 12354 6886 MAPK9 jun kinase jun kinase 0 1.0 hsp70 has been demonstrated to inhibit caspase 3 activation caused by ceramide and also affect jun kinase and p38 kinase activation [141] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144841 15896810 190166 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 hsp70 has been demonstrated to inhibit caspase 3 activation caused by ceramide and also affect jun kinase and p38 kinase activation [141] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144842 15896810 190167 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 in addition hsp70 binds to and modulates the function of bag 1 the bcl 2 binding protein [142] thus modulating some type of apoptosis related cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144843 15896810 190167 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in addition hsp70 binds to and modulates the function of bag 1 the bcl 2 binding protein [142] thus modulating some type of apoptosis related cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144844 15896810 190167 1497 939 BAG3 bcl-2-binding protein bcl 2 binding protein 0 1.0 in addition hsp70 binds to and modulates the function of bag 1 the bcl 2 binding protein [142] thus modulating some type of apoptosis related cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144845 15896810 190170 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 we have demonstrated in astroglial cell cultures that cytokine induced nitrosative stress is associated with an increased synthesis of hsp70 stress proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144846 15896810 190171 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increase in hsp70 protein expression was also found after treatment of cells with the no generating compound sodium nitroprusside snp thus suggesting a role for no in inducing hsp70 proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144847 15896810 190173 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ubiquitin is one of the smallest hsps and is expressed throughout brain in response to ischemia. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144848 15896810 190174 6708 3415 EPO erythropoietin erythropoietin 0 1.0 it is involved in targeting and chaperoning of proteins degraded in proteasomes which include nfkb cyclins hsfs hypoxia inducible factor some apoptosis related proteins tumor necrosis factor and erythropoietin receptors [146] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144849 15896810 190174 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 it is involved in targeting and chaperoning of proteins degraded in proteasomes which include nfkb cyclins hsfs hypoxia inducible factor some apoptosis related proteins tumor necrosis factor and erythropoietin receptors [146] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144850 15896810 190176 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 it chaperones cytoskeletal proteins such as intermediate filaments actin or glial fibrillary acidic protein following stress in astrocytes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144851 15896810 190177 7333 11920 FAS apo 1 apo 1 0 1.0 it also protects against fas apo 1 staurosporine tnf and etoposside induced apoptotic cell death as well as h 2 o 2 induced necrosis [147] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144852 15896810 190179 8888 4646 GTF2A1 glucose regulated protein glucose regulated protein 0 1.0 hsp60 glucose regulated protein 75 grp75 and hsp10 chaperone proteins within mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144853 15896810 190183 9462 5013 HMOX1 ho 1 ho 1 0 1.0 there are three isoforms of heme oxygenase: ho 1 or inducible isoform ho 2 or constitutive isoform and the recently discovered ho 3 [149] [150] [151] [152] [153] and [154] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144854 15896810 190183 9463 5014 HMOX2 ho 2 ho 2 0 1.0 there are three isoforms of heme oxygenase: ho 1 or inducible isoform ho 2 or constitutive isoform and the recently discovered ho 3 [149] [150] [151] [152] [153] and [154] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144855 15896810 190187 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the iron released by ho 1 is bound by ferritin perhaps via a ho 1 chaperone function [155] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144856 15896810 190189 9462 5013 HMOX1 ho 1 ho 1 0 1.0 increasing evidence suggests that the ho 1 gene is redox regulated and contains in its promoter region the antioxidant responsive element are similar to other antioxidant enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144857 15896810 190191 9462 5013 HMOX1 ho 1 ho 1 0 1.0 significant increases in the levels of ho 1 have been observed in ad brains in association with neurofibrillary tangles [157] and ho 1 mrna was found to be increased in ad neocortex and cerebral vessels [158] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144858 15896810 190192 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [153] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144859 15896810 190192 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [153] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144860 15896810 190193 9462 5013 HMOX1 ho 1 ho 1 0 1.0 it is conceivable that the dramatic increase in ho 1 in ad may be a direct response to increased free heme associated with neurodegeneration and an attempt to convert the highly damaging heme into the antioxidants biliverdin and bilirubin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144861 15896810 190194 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is rapidly upregulated by oxidative and nitrosative stresses as well as by glutathione depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144862 15896810 190204 9462 5013 HMOX1 ho 1 ho 1 0 1.0 remarkably recent evidence has demonstrated that curcumin is a potent inducer of ho 1 in vascular endothelial cells [7] and [167] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144863 15896810 190205 9462 5013 HMOX1 ho 1 ho 1 0 1.0 we have also recently demonstrated in astroglial cells the role of caffeic acid phenylethyl ester cape an active component of propolis as a novel ho 1 inducer [162] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144864 15896810 190222 4770 2244 COQ7 coenzyme q coenzyme q 0 1.0 the effect of another antioxidant treatment coenzyme q 10 400 mg/day plus vitamin e 2100 iu/day on in vivo cardiac and calf muscle energy metabolism left ventricle hypertrophy lvh and ataxia has been evaluated in ten frda patients [177] after 6 months of 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144865 15896810 190240 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 a deficiency of the micronutrient has also been reported in patients with friedreich ataxia and there are histological similarities between friedreich's cardiomyopathy and keshan disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144866 15896810 190243 7975 3951 FXN friedreich ataxia friedreich ataxia 0 1.0 as iron induced mitochondrial oxidative damage is central to the pathology of friedreich ataxia and in addition some studies suggest a link between frataxin expression glutathione peroxidase gpx activity and oxidative stress the administration of selenium supplements could normalize the antioxi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144867 15896810 190243 7975 3951 FXN frataxin frataxin 0 1.0 as iron induced mitochondrial oxidative damage is central to the pathology of friedreich ataxia and in addition some studies suggest a link between frataxin expression glutathione peroxidase gpx activity and oxidative stress the administration of selenium supplements could normalize the antioxidant activity of myocardial glutathione peroxidase and slow t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144868 15896810 190250 7975 3951 FXN frataxin frataxin 0 1.0 although the precise function of frataxin still remains to be defined frda has clearly been identified as a nuclear encoded mitochondrial disorder. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147202 15964487 194016 7334 11936 FASLG fas ligand fas ligand 0 1.0 in these processes mitochondria appear to be a key point of convergence of different pathways initiated by several apoptotic stimuli including receptor activation by fas ligand kavurma and khachigian 2003 or glutamate stout et al. 1998 or after exposure to neurotoxins such as veratridine jordan et al. 2002 or staurosporine tafani et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147203 15964487 194017 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 opening of a permeability transition pore ptp leads to mitochondrial swelling and the release of intramitochondrial proteins to the cytoplasm including cytochrome c apaf 1 and caspase family members which participate in apoptosis pathways van gurp et al 2003 joza et al 2003 and galindo et al 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147204 15964487 194023 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 also its administration in mice expressing a mutant superoxide dismutase sod1 g37r at late presymptomatic stage delayed the onset of motor neuron degeneration and muscle strength decline and increased the longevity of sod1 g37r mice kriz et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147206 15964487 194028 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 the exact mechanisms by which minocycline plays these neuroprotective effects remain unknown although a reduced expression of cycloxygenase 2 caspase 1 and inducible nitric oxide synthase inos mrna have been described chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147207 15964487 194028 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 the exact mechanisms by which minocycline plays these neuroprotective effects remain unknown although a reduced expression of cycloxygenase 2 caspase 1 and inducible nitric oxide synthase inos mrna have been described chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147209 15964487 194064 551 399 ALB serum albumin serum albumin 0 1.0 mitochondrial protein concentrations were quantified spectrophotometrically micro bca protein reagent kit pierce rockford il usa with bovine serum albumin used as standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147210 15964487 194086 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the activity of complex ii_amp_#x2013;iii succinate cytochrome c reductase was determined following the method of king 1967 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147212 15964487 194087 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 complex iv cytochrome c oxidase; e.c.1.9.3.1 activity was determined as described by wharton and tzagoloff 1967 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147214 15964487 194101 14257 7711 NDUFS4 mitochondrial respiratory chain complex i mitochondrial respiratory chain complex i 0 1.0 consistently the mitochondrial uncoupler carbonyl cyanide 4 trifluoromethoxyphenlhydrazone fccp 1_amp_#x3bc;m fccp depleted and rotenone a mitochondrial respiratory chain complex i inhibitor 10_amp_#x3bc;m rot increased the nucleotide signal fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147215 15964487 194151 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 indeed calcium induces the release of mitochondrial cytochrome c by different mechanisms selective for brain versus liver andreyev and fiskum 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147216 15964487 194161 23199 12716 TRPV1 vanilloid receptor subtype 1 vanilloid receptor subtype 1 0 1.0 al 2003b drugs able to depolarize mitochondria including the protonophores fccp and carbonyl cyanide m chlorophenylhydrazone provide protection against acute glutamate neurotoxicity reynolds 1999 and vanilloid receptor subtype 1 mediated death jambrina et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136181 16026864 180216 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 als is sporadic in 90% of cases; the remaining 10% are of genetic origin with a subset being induced by mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136182 16026864 180232 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 early evidence for involvement of ca 2+ was provided by the observation that ca 2+ binding proteins such as calbindin d28k and parvalbumin were absent in motoneuron populations lost early in als cortical spinal and lower cranial nerve motoneurons whereas motoneurons damaged late or infrequently in the disease those of onuf's nucleus and 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136183 16026864 180232 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 rons whereas motoneurons damaged late or infrequently in the disease those of onuf's nucleus and the oculomotor trochlear and abducens nerves expressed markedly higher levels of calbindin d28k and/or parvalbumin [13] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136184 16026864 180264 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 most interestingly recent work provided evidence that mutant sod1 might disrupt association of complex iv cytochrome c with the inner mitochondrial membrane and by this interfere with mitochondrial respiration [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136185 16026864 180270 7521 3665 FGF1 endothelial cell growth factor endothelial cell growth factor 0 1.0 in line with these observations als like symptoms and neuropathology can be produced in mice by a targeted deletion that eliminates the ability of vascular endothelial cell growth factor vegf to respond to tissue hypoxia [54] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136186 16026864 180289 17713 9704 PVALB parvalbumin parvalbumin 0 1.0 it is interesting to note that experimentally measured buffering capacities correlated well with the expression profiles of ca 2+ binding proteins such as parvalbumin and calbindin d28k supporting the notion that they might represent the major structural components responsible for endogenous ca 2+ buffering. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136188 16026864 180337 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 als related disturbance of mitochondrial respiration by mutant superoxide dismutase 1 sod1 or hypoxia results in increased formation of reactive oxygen species ros 48 and 49 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136867 16043017 181169 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 familial als cases accounting for 10_amp_#x2013;15% of all als disease are caused by a gain of function mutation in cu zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136868 16043017 181176 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 these proteins are sod1 translationally controlled tumor protein tctp ubiquitin carboxyl terminal hydrolase l1 uch l1 and possibly b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136869 16043017 181176 23792 12609 USP11 ubiquitin carboxyl-terminal hydrolase ubiquitin carboxyl terminal hydrolase 0 1.0 these proteins are sod1 translationally controlled tumor protein tctp ubiquitin carboxyl terminal hydrolase l1 uch l1 and possibly b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136870 16043017 181176 23620 12513 UCHL1 uch l1 uch l1 0 1.0 these proteins are sod1 translationally controlled tumor protein tctp ubiquitin carboxyl terminal hydrolase l1 uch l1 and possibly b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136871 16043017 181177 23620 12513 UCHL1 uch l1 uch l1 0 1.0 because oxidative modification can lead to structural alteration and activity decline our current study suggests that oxidative modification of uch l1 tctp sod1 and possibly b crystallin may play an important role in the neurodegeneration of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136872 16043017 181181 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 inherited als accounts for 10_amp_#x2013;15% of cases and among all of the familial als fals patients 20_amp_#x2013;30% of them are caused by a gain of function mutation in cu zn superoxide dismutase sod1 [3] and [4] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136873 16043017 181190 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 the proteinaceous inclusions found in tissues from als patients [23] [24] and [25] and msod transgenic mice [22] and [26] reportedly are rich in msod ubiquitin and neurofilament proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136874 16043017 181198 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 also elevation of inflammation related genes e.g. induced nitric oxide synthase proinflammatory cytokines occurs at 11 weeks of age in the presymptomatic stage before motor neuron death in g93a sod1 transgenic mice suggesting that neuroinflammation mediated oxidative stress is a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136875 16043017 181251 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ubiquitin carboxyl terminal hydrolase l1 uch l1 assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136876 16043017 181251 23792 12609 USP11 ubiquitin carboxyl-terminal hydrolase ubiquitin carboxyl terminal hydrolase 0 1.0 ubiquitin carboxyl terminal hydrolase l1 uch l1 assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136877 16043017 181251 23620 12513 UCHL1 uch l1 uch l1 0 1.0 ubiquitin carboxyl terminal hydrolase l1 uch l1 assay 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136879 16043017 181252 23521 12468 UBC ubiquitin c ubiquitin c 0 1.0 the activities of uch l1 in the spinal cord were measured by determining the rate of conversion of ubiquitin c terminal 7 amido 4 methylcoumarin ub amc calbiochem to ubiquitin and free amc [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136880 16043017 181252 23620 12513 UCHL1 uch l1 uch l1 0 1.0 the activities of uch l1 in the spinal cord were measured by determining the rate of conversion of ubiquitin c terminal 7 amido 4 methylcoumarin ub amc calbiochem to ubiquitin and free amc [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136881 16043017 181255 23620 12513 UCHL1 uch l1 uch l1 0 1.0 uch l1 activities of each individual were assayed by the change of _amp_#x3bb; em 460 nm over time. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136882 16043017 181256 23620 12513 UCHL1 uch l1 uch l1 0 1.0 the average uch l1 activities of six transgenic animals were compared to those of six control animals using student's t test. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136883 16043017 181269 23620 12513 UCHL1 uch l1 uch l1 0 1.0 these proteins were identified as sod1 translationally controlled tumor protein tctp uch l1 and b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136884 16043017 181274 23620 12513 UCHL1 uch l1 uch l1 0 1.0 we report here that the specific carbonyl levels of human sod1 tctp uch l1 and possibly b crystallin are significantly increased in the spinal cord of g93a sod1 transgenic mice compared to that of nontransgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136885 16043017 181281 23620 12513 UCHL1 uch l1 uch l1 0 1.0 in order to confirm that oxidative modification inactivated protein activity we compared the activity of uch l1 in the g93a sod1 transgenic mice to that in the control mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136886 16043017 181282 23620 12513 UCHL1 uch l1 uch l1 0 1.0 consistent with our prior studies that demonstrate loss of activity of oxidatively modified proteins [49] [50] and [51] uch l1 activity was significantly decreased 29% in the g93a sod1 transgenic mice compared to that of nontransgenic control fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136887 16043017 181289 23620 12513 UCHL1 uch l1 uch l1 0 1.0 in the current study we identified the proteins that demonstrate increased carbonyl levels compared to those of the nontransgenic mice as sod1 tctp uch l1 and b crystallin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136888 16043017 181293 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 moreover free radical production in the g93a sod1 transgenic animals is induced by sod1 mutation [32] alteration of tumor necrosis factor tnf and tnf modulating cytokines [38] and [46] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136889 16043017 181303 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 uch l1 belongs to a family of ubiquitin carboxyl terminal hydrolases that play important roles in the ubiquitin_amp_#x2013;proteolytic pathway [71] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136890 16043017 181303 23620 12513 UCHL1 uch l1 uch l1 0 1.0 uch l1 belongs to a family of ubiquitin carboxyl terminal hydrolases that play important roles in the ubiquitin_amp_#x2013;proteolytic pathway [71] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136891 16043017 181306 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 uch ls then recycle ubiquitin from ubiquitinated protein complexes or polyubiquitin chains by cleaving the amide linkage next to the c terminal glycine of ubiquitin [72] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136892 16043017 181307 23620 12513 UCHL1 uch l1 uch l1 0 1.0 loss of uch l1 function causes neuroaxonal dystrophy [74] [75] and [76] significant protein oxidization [45] and accumulation of synuclein protein in gracile axonal dystrophy mice [77] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136893 16043017 181308 23620 12513 UCHL1 uch l1 uch l1 0 1.0 similarly decreased uch l1 activity by mutation also enhances protein aggregation in escherichia coli [78] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136894 16043017 181309 23620 12513 UCHL1 uch l1 uch l1 0 1.0 therefore based on the prior literature oxidative inactivation of uch l1 presented in the current study possibly contributes to both the protein aggregation and the oxidative stress observed in g93a sod1 transgenic mice and als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136895 16043017 181310 23620 12513 UCHL1 uch l1 uch l1 0 1.0 consistent with this notion and consistent with our finding fig 4 that uch l1 activity is decreased in g93a sod1 mouse spinal cord the inclusions of human als and msod1 including g93a mice are excessively ubiquitinated [79] [80] [81] and [82] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136896 16043017 181316 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 moreover crystallins were recruited to aggregates when cells were treated with proteasome inhibitor [88] and the degradation of b crystallin along with ubiquitin conjugation was decreased in bovine lens epithelial cells when b crystallin was oxidized [89] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136897 16043017 181319 8445 4341 GLUL glutamine synthetase glutamine synthetase 0 1.0 consistent with this notion inclusions in als patients contain b crystallin metallothionein glutamine synthetase and tubulin immunoreactivities [90] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136898 16043017 181321 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ubiquitin protein epitopes and b crystallin are found in fibrillar neuronal inclusions in the cortex of sporadic als patients [79] [80] [81] and [91] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136899 16043017 181323 23620 12513 UCHL1 uch l1 uch l1 0 1.0 based on our current observations the increased oxidative modification of sod1 uch l1 and b crystallin plays a significant role in the protein aggregation in the spinal cords of g93a sod1 transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136900 16043017 181324 23620 12513 UCHL1 uch l1 uch l1 0 1.0 study provides insight into the mechanism of g93a sod1 neurotoxicity in vivo which involves oxidative modification of a ca 2+ regulating protein tctp and proteins involved in inclusion formation sod1 uch l1 and b crystallin suggesting a potential relationship between protein oxidation protein aggregation and ca 2+ regulation in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136901 16043017 181325 23620 12513 UCHL1 uch l1 uch l1 0 1.0 moreover one can speculate that the oxidative modification of these proteins impairs protein stability b crystallin ca 2+ binding tctp protein degradation uch l1 and antioxidant capacity sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136902 16043017 181340 23620 12513 UCHL1 uch l1 uch l1 0 1.0 fig. 4._amp_#xa0;activity of uch l1 in g93a sod1 transgenic mice as a percentage of the nontransgenic control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136903 16043017 181341 23620 12513 UCHL1 uch l1 uch l1 0 1.0 the activity of uch l1 is significantly decreased in the spinal cord of g93a sod1 transgenic mice compared to nontransgenic control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137282 16046141 181622 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 vation of the caspases cascade is also effective in preventing both the mitochondrial damage and the increase in the production of reactive oxygen species induced by fals sod1 even in the presence of cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137283 16046141 181628 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondria alterations membrane depolarization decreased activity of respiratory complexes cytochrome c release and oxidative stress increased ros flux oxidatively modified proteins seem likely candidates to explain many facets of als because of their early occurrence in experimental models and in pati 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137284 16046141 181629 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 als occurs both as a sporadic and as a familial dominantly inherited disease fals and about one fifth of fals patients have mutations in the gene coding for the enzyme cu zn superoxide dismutase sod1 rosen et al. 1993 . fals sod1 mutations cause the appearance of a pro oxidant pro apoptotic function in a typically anti oxidant anti apoptotic enzyme rabizadeh et al. 1995 wiedau pazos et al. 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137285 16046141 181634 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 t al. 1997 and prolongs life in a transgenic mouse model kostic et al. 1997 ; caspases 1 and 3 have consistently been shown to play an important role in the death of motor neurons in this disease and caspase 9 is activated in spinal motor neurons of human als subjects inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137286 16046141 181634 1576 990 BCL2 bcl 2 bcl2 0 1.0 members of the bcl gene family show altered expression in post mortem samples from sporadic and familial als patients and in experimental models as well mu et al. 1996 and vukosavic et al. 1999 and bcl2 prevents death of cells expressing fals sod1 ghadge et al. 1997 and prolongs life in a transgenic mouse model kostic et al. 1997 ; caspases 1 and 3 have consistently been shown to play an important r 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137287 16046141 181636 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 of apoptosis by oxidative stress is a feature observed in several experimental paradigms cai and jones 1998 and luetjens et al. 2000 and oxidative stress mediated mitochondrial dysfunction leading to cytochrome c release plays an important role in the initiation of motor neuron death by mutant sod1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137288 16046141 181637 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in spinal cord specimens of both als patients and in the mice model for fals evidence of prominent recruitment of the mitochondrial apoptotic pathway has been documented by the observation of cytochrome c release and by the observation that prevention of cytochrome c release prolongs the lifespan of transgenic sod1 g93a mice zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137289 16046141 181637 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 release and by the observation that prevention of cytochrome c release prolongs the lifespan of transgenic sod1 g93a mice zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137290 16046141 181639 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 upon release from mitochondria cytochrome c becomes part of the apoptosome a complex in which apaf1 serves as a scaffold protein also for the binding of pro caspase 9 the apoptosome recruits and processes caspase 9 to form a holoenzyme complex which in turn recruits and activates the effector caspases cecconi 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137291 16046141 181639 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 the apoptosome recruits and processes caspase 9 to form a holoenzyme complex which in turn recruits and activates the effector caspases cecconi 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137292 16046141 181639 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 upon release from mitochondria cytochrome c becomes part of the apoptosome a complex in which apaf1 serves as a scaffold protein also for the binding of pro caspase 9 the apoptosome recruits and processes caspase 9 to form a holoenzyme complex 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137293 16046141 181640 3526 1503 CASP2 caspase 2 caspase 2 0 1.0 therefore the apoptosome has a crucial role in the activation of several caspases such as caspase 2 3 6 7 8 and 10 adams and cory 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137294 16046141 181642 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 our data demonstrate that removal of apaf1 prevents cell death and mitochondrial damage by intercepting activation of the caspases cascade even in the presence of cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137295 16046141 181654 5902 2903 DLG4 psd 95 psd95 0 1.0 ed to differentiate both etna+/+ and _amp_#x2212;/_amp_#x2212; cells display neurite outgrowth and the upregulation of some neural markers neun class iii _amp_#x3b2; tubulin choline acetyltransferase psd95 and tau; cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137296 16046141 181654 4285 1912 CHAT choline acetyltransferase choline acetyltransferase 0 1.0 nal precursors; when induced to differentiate both etna+/+ and _amp_#x2212;/_amp_#x2212; cells display neurite outgrowth and the upregulation of some neural markers neun class iii _amp_#x3b2; tubulin choline acetyltransferase psd95 and tau; cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137297 16046141 181658 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 the broad caspase inhibitor zvad fmk 100 _amp_#x3bc;m; calbiochem and the caspase 9 specific inhibitor zlehd fmk 100 _amp_#x3bc;m; calbiochem were added at this time. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137298 16046141 181661 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspase 1 and caspase 3 activities were determined by measuring the rates of 7 amido 4 methylcoumarin amc release from synthetic caspase substrates: ac yvad amc for caspase 1 and ac devd amc for caspase 3 calbiochem . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137299 16046141 181661 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 1 and caspase 3 activities were determined by measuring the rates of 7 amido 4 methylcoumarin amc release from synthetic caspase substrates: ac yvad amc for caspase 1 and ac devd amc for caspase 3 calbiochem . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137300 16046141 181665 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 specific activity was demonstrated by the use of the caspase 1 and caspase 3 inhibitors ac yvad cho and ac devd cho respectively that completely block the development of fluorescence due to the cleaved product. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137301 16046141 181665 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 specific activity was demonstrated by the use of the caspase 1 and caspase 3 inhibitors ac yvad cho and ac devd cho respectively that completely block the development of fluorescence due to the cleaved product. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137302 16046141 181674 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 for cytochrome c and aif release experiments etna cells were harvested in hypotonic buffer 2 mm mgcl 2 10 mm kcl 10 mm tris_amp_#x2013;hcl ph 7.6 supplemented with protease inhibitor cocktail sigma and incubated for 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137303 16046141 181682 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 caspase 1 was detected with a rabbit polyclonal antibody sigma aldrich recognizing the 45 kda pro enzyme and the 20 kda active subunit. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137304 16046141 181683 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activity was detected using a rabbit polyclonal antibody cell signaling specifically reacting with the cleaved 17/19 kda fragments of active caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137305 16046141 181684 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 caspase 9 activity was detected using a rabbit polyclonal antibody cell signaling specifically reacting with the cleaved fragments of active caspase 9. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137306 16046141 181685 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mouse monoclonal anti cytochrome c antibody was purchased from bd bioscience. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137307 16046141 181703 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 an anti cytochrome c monoclonal antibody clone 6h2.b4 pharmingen an anti cytochrome c polyclonal antibody santa cruz an anti aif monoclonal antibody clone e1 santa cruz and an anti endog polyclonal antibody prosci incorporated were used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137308 16046141 181716 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 ring that the percentage of transfected cells was estimated around 30% see materials and methods . 48 h after transfection expression of mutant sod1s induces activation of caspase 3 caspase 9 but not caspase 1 fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137309 16046141 181716 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 icularly conspicuous considering that the percentage of transfected cells was estimated around 30% see materials and methods . 48 h after transfection expression of mutant sod1s induces activation of caspase 3 caspase 9 but not caspase 1 fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137310 16046141 181716 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 onspicuous considering that the percentage of transfected cells was estimated around 30% see materials and methods . 48 h after transfection expression of mutant sod1s induces activation of caspase 3 caspase 9 but not caspase 1 fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137311 16046141 181718 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 cell death induced by mutant sod1 is prevented by treatment both with pan caspase inhibitor z vad and by caspase 9 inhibitor lehd fig 1 d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137312 16046141 181724 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 transient transfection of control sh cells or sh/apaf1 cells with wtsod1 or g93a sod1 mutant elicits high level comparable expression of the two proteins in both cell lines fig 2 a but activation of caspase 3 is dramatically increased only in g93a expressing sh/apaf1 cells as compared to g93a transfected sh cells fig 2 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137313 16046141 181729 17732 9717 PXMP3 paf 1 paf1 0 1.0 stable cell lines have been named etna e mbryonic t elencephalic n aive a paf1 ; etna+/+ and etna_amp_#x2212;/_amp_#x2212; cell lines have been preliminary characterized both in basal growth conditions and after further differentiation cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137314 16046141 181730 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 etna_amp_#x2212;/_amp_#x2212; cells do not express apaf1 and the absence of this adapter provides them with a complete resistance to caspase 3 activation elicited by a classic pro apoptotic agent such as staurosporine cozzolino et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137315 16046141 181731 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we have observed that apaf1 deletion also provides these cells with a complete resistance to activation of caspase 3 induced by several fals sod1s and observed in control etna+/+ cells 24 h after transfection with the cdna coding for the mutant protein fig 3 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137316 16046141 181734 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c release induced by fals sod1 is independent of apaf1 expression 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137317 16046141 181735 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondrial damage and cytochrome c release are pro apoptotic features observed in several experimental paradigms for fals see introduction . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137318 16046141 181736 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 to compare cytochrome c release in cells expressing either fals sod1s or wild type sod1 etna cells were transfected with cdna coding for gfp sod1s fusion proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137319 16046141 181739 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 furthermore while no cytochrome c release is observed in cells expressing gfp or the wild type enzyme both etna_amp_#x2212;/_amp_#x2212; and etna+/+ cells expressing different fals sod1s display cytochrome c release independently from the apaf1 genotype figs 4 b_amp_#x2013;d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137320 16046141 181740 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondrial release of pro apoptotic factors induced by fals sod1 is specific for cytochrome c ; indeed we have observed that other mitochondrial factors involved in apoptotic pathways such as aif fig 4 and fig 5 and endog not shown are not affected by the expression of mutant sod1s in this sy 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137321 16046141 181752 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 it is widely believed that activation of the apoptosome followed by caspase 9 and caspase 3 activation plays a central role in cell death in the nervous system yuan and yankner 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137322 16046141 181752 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 it is widely believed that activation of the apoptosome followed by caspase 9 and caspase 3 activation plays a central role in cell death in the nervous system yuan and yankner 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137323 16046141 181757 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 mitochondrial membrane depolarization decreased activity of respiratory complexes and cytochrome c release occur at the asymptomatic stage in fals sod1 transgenic mice bendotti et al. 2001 and jung et al. 2002 and in cultured cells expressing the mutant protein carr_amp_#xec; et al. 1997 beal 2000 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137324 16046141 181763 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 leading to bioenergetic failure in the motor neurons bendotti et al. 2001 and jung et al. 2002 and to alteration in the mitochondrial permeability transition pore causing leakage of cytochrome c and apoptosis inducing factor aif friedlander 2003 were suggested to play a role in the mitochondrial dependent motor neuron death through the activation of a caspase mediated cascade leading to programmed cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137325 16046141 181763 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 respiratory chain leading to bioenergetic failure in the motor neurons bendotti et al. 2001 and jung et al. 2002 and to alteration in the mitochondrial permeability transition pore causing leakage of cytochrome c and apoptosis inducing factor aif friedlander 2003 were suggested to play a role in the mitochondrial dependent motor neuron death through the activation of a caspase mediated cascade leading to prog 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137326 16046141 181767 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we have observed that indeed apaf1 is a key factor in the noxious function of fals sod1: while overexpression of apaf1 exacerbates the induction of apoptosis fig 2 its removal prevents activation of caspase 3 even in the presence of cytochrome c release fig 3 and fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137327 16046141 181767 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 1 is a key factor in the noxious function of fals sod1: while overexpression of apaf1 exacerbates the induction of apoptosis fig 2 its removal prevents activation of caspase 3 even in the presence of cytochrome c release fig 3 and fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137328 16046141 181772 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 either exert some aberrant chemistry specifically inside or on the surface of mitochondria or interfere with cytoplasmic functions modulating mitochondria functionality: both could lead to release of cytochrome c activation of the caspase cascade and impairment in the respiratory chain atp depletion and changes in the membrane permeability. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137329 16046141 181780 1576 990 BCL2 bcl 2 bcl 2 0 1.0 pasinelli et al. have reported that both wt and mutsod1 bind to bcl 2 an anti apoptotic protein located on the cytoplasmic face of outer mitochondria membranes and have suggested that entrapment of bcl 2 by large mutsod1 aggregates may deplete motor neurons of this anti apoptotic protein pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137330 16046141 181781 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in a recent paper kirkinezos et al. have reported that cytochrome c association with the inner mitochondrial membrane is impaired in the cns of g93a sod1 mice kirkinezos et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137331 16046141 181790 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 c left panel: sh sy5y cells were transfected as in panel a. after 48 h equal amounts 30 _amp_#x3bc;g of clear cell lysates were incubated with 20 _amp_#x3bc;m ac yvad amc for caspase 1 and ac devd amc for caspase 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137332 16046141 181790 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 t panel: sh sy5y cells were transfected as in panel a. after 48 h equal amounts 30 _amp_#x3bc;g of clear cell lysates were incubated with 20 _amp_#x3bc;m ac yvad amc for caspase 1 and ac devd amc for caspase 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137333 16046141 181793 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 right panel: caspase 1 caspase 3 and caspase 9 activity were also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137334 16046141 181793 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 right panel: caspase 1 caspase 3 and caspase 9 activity were also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137335 16046141 181793 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 right panel: caspase 1 caspase 3 and caspase 9 activity were also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137336 16046141 181795 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 ication of apoptotic nuclei of sh sy5y transfected with wtsod1 or g37r g85r and i113t sod1 for the indicated periods of time in the absence or in the presence of 100 _amp_#x3bc;m zlehd fmk a specific caspase 9 inhibitor or zvad fmk a pan caspase inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137337 16046141 181800 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 b cells were treated as in panel a and analyzed for caspase 3 activation 24 h after transfection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137338 16046141 181805 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 a left panel: caspase 3 activity was assayed in cells 24 h after transient transfection with either wtsod1 or g93a g37r g85r and i113t sod1 mutants. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137339 16046141 181806 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 caspase 3 activity is expressed as arbitrary fluorescence units afu n _amp_#xa0;=_amp_#xa0;3 . 100 _amp_#x3bc;m zvad fmk a pan caspase inhibitor was used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137340 16046141 181807 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 right panel: caspase 3 activity was also assessed by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137341 16046141 181815 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 gfp green cytochrome c red and merged patterns of the same representative fields are shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137342 16046141 181817 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 c the proportion of gfp positive cells releasing cytochrome c was scored n _amp_#xa0;=_amp_#xa0;3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137343 16046141 181818 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 d cytosolic fractions of etna cells transfected for 24 h with wtsod1 or g93a g37r g85r and i113t sod1 mutants were assessed for the presence of cytochrome c and aif by western blot. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137344 16046141 181819 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 extracts from the mitochondrial fraction of untransfected etna cells were used as a positive control for aif and cytochrome c expression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137345 16046141 181822 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 double labeling confocal immunofluorescence microscopy staining of cytochrome c green and aif red in etna cells 48 h after transfection with wtsod1 gfp g93a sod1 gfp g85r sod1 gfp and a4v sod1 gfp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137346 16046141 181823 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 white arrowheads point to cells with released cytochrome c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137915 16050975 182086 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 however remarkable mitochondrial abnormalities have also been identified in transgenic mouse models of familial als expressing mutant cu zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137916 16050975 182109 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 ons are bunina bodies round eosinophilic inclusions containing a homogeneous granular matrix surrounded by vesicular and tubular structures tomonaga et al. 1978 and skein like inclusions that contain ubiquitin and are comprised of bundles of 15_amp_#x2013;20 nm thick neurofilaments migheli et al. 1990 and sasaki and maruyama 1992 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137918 16050975 182119 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 approximately 20% of fals cases are due to mutations in the gene encoding superoxide dismutase 1 sod1; cu zn dismutase; mim147450 rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137919 16050975 182145 14257 7711 NDUFS4 mitochondrial respiratory chain complex i mitochondrial respiratory chain complex i 0 1.0 deficits in the activities of mitochondrial respiratory chain complex i wiedemann et al. 1998 and complex iv vielhaber et al. 2000 have been identified in the skeletal muscle and in the spinal cord of sals patients borthwick et al. 1999 and wiedemann et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137920 16050975 182187 3525 1499 CASP1 caspase 1 caspase 1 0 1.0 for example caspase 1 and 3 are activated sequentially in differentiated neuroblastoma cells expressing mutant sod1 in response to oxidative stress pasinelli et al. 1998 and pasinelli et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137921 16050975 182189 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 in spinal motor neurons of g93a transgenic mice cytochrome c is released from mitochondria leading to caspase 9 activation guegan et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137922 16050975 182189 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in spinal motor neurons of g93a transgenic mice cytochrome c is released from mitochondria leading to caspase 9 activation guegan et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137923 16050975 182190 1576 990 BCL2 bcl 2 bcl 2 0 1.0 both inhibition of caspase activation li et al. 2000 and the overexpression of the mitochondrial anti apoptotic protein bcl 2 kostic et al. 1997 slow motor neuron degeneration and extend the survival of sod1 mutant mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137924 16050975 182195 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 one may envision a scenario where mitochondrial dysfunction results in quantal releases of pro apoptotic factors such as cytochrome c apoptosis inducing factor aif and endog from individual mitochondria perhaps in response to local calcium mediated toxicity for example under excitatory synapses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137925 16050975 182195 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 one may envision a scenario where mitochondrial dysfunction results in quantal releases of pro apoptotic factors such as cytochrome c apoptosis inducing factor aif and endog from individual mitochondria perhaps in response to local calcium mediated toxicity for example under excitatory synapses. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137926 16050975 182215 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 higgins and colleagues have observed that sod1 and cytochrome c a resident protein of the intermembrane space colocalize at the early stages of mitochondrial vacuolization in mutant sod1 transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137927 16050975 182218 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the expanded outer membrane could become porous and allow for leakage of cytochrome c and other pro apoptotic molecules into the cytosol potentially triggering the apoptotic cascade higgins et al. 2003 and xu et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137928 16050975 182228 1576 990 BCL2 bcl 2 bcl 2 0 1.0 an example of such potentially harmful protein protein interactions is the binding of mutant sod1 with bcl 2 pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137929 16050975 182256 1576 990 BCL2 bcl 2 bcl 2 0 1.0 within mitochondria mutant sod1 may interfere with the anti apoptotic function of bcl 2 pasinelli et al. 2004 affect mitochondrial import by interfering with the translocation machinery tom/tim liu et al. 2004 generate toxic free radicals ros via aberrant superoxide chemistry estevez et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137931 16050975 182258 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131951 16188953 173803 166 118 ACO2 aconitase 2 aconitase 2 0 1.0 detoxification of reactive oxygen species ros by pramipexole is shown in vitro and in vivo by evaluating mitochondrial ros release and aconitase 2 activity respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131953 16188953 173806 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 finally both compounds were tested in superoxide dismutase 1 g93a mice a model of familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131955 16188953 173829 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 twenty percent of familial als cases are caused by mutations in superoxide dismutase 1 sod1 which expressed in mice result in a phenotype resembling the pathology in patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131956 16188953 173896 3544 1516 CAT catalase catalase 0 1.0 in further conditions ppx 300 microm malonate malo 10 mm the sod catalase mimic euk 134 melov et al. 2001 euk 30 microm or atp 1 mm was added. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131957 16188953 173900 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 in a further set of experiments hydrogen peroxide ~80% and to a smaller extent superoxide ~20% were generated by xanthine oxidase 0.3 mu/ml and hypoxanthine 0.1 mm fridovich 1970 in a solution containing ppx snd or euk 134 at the indicated concentrations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131958 16188953 173961 9851 5385 IDH3B isocitrate dehydrogenase isocitrate dehydrogenase 0 1.0 twenty microliters of lysate was added to a well of a 96 well microtiter plate followed by the addition of a prewarmed solution 37degreec containing 0.4 mm nadp 1.2 mm mncl 2 and 2 u/ml isocitrate dehydrogenase in buffer [10 mm tris/hcl 0.6 mm mncl 2 20 microm d l fluorocitrate and 1% v/v triton x 100]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131960 16188953 173965 166 118 ACO2 aconitase 2, mitochondrial aconitase 2 mitochondrial 0 1.0 additionally a monoclonal antibody raised against the 23 c terminal amino acids of aconitase 2 mitochondrial aconitase from rat nanotools; antik_amp_ouml;rpertechnik teningen germany was used to study the expression of the protein in mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131961 16188953 173968 166 118 ACO2 aconitase 2 aconitase 2 0 1.0 afterward aconitase 2 expression was analyzed by a standard western blot protocol by probing the used nitrocellulose membranes with the anti aconitase 2 antibody 2 microg/ml using an enhanced chemiluminescence detection system applied biosystems . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131962 16188953 173998 3544 1516 CAT catalase catalase 0 1.0 therefore we reevaluated the antioxidative properties of ppx and snd targeted toward different reactive species and compartments; obtained efficacies were compared with euk 134 a potent sod catalase mimetic jung et al. 2001 ; melov et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131963 16188953 173999 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 we show that ppx and the equipotent snd are weak h 2 o 2 scavengers if generation and detoxification are measured in the same compartment in absence of a detection system xanthine oxidase . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131964 16188953 174058 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 a ros were generated by xanthine oxidase in a solution containing euk 134 black bars ppx light gray bars or snd dark gray bars at the indicated concentrations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131965 16188953 174110 3544 1516 CAT catalase catalase 0 1.0 after demonstrating entry of ppx into brain cells and mitochondria we reevaluated the antioxidative properties of ppx and snd and compared the obtained efficacy with euk 134 a potent sod catalase mimetic melov et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131966 16188953 174111 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 first h 2 o 2 and superoxide were generated by xanthine oxidase fridovich 1970 in a cell free assay where detoxifying enzymes and membranes are absent. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131967 16188953 174114 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 as expected euk 134 was the most potent compound which at a concentration of 300 microm was able to detoxify >95% ros generated by xanthine oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131968 16188953 174117 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 additionally both enantiomers showed equipotent efficacy in detoxification of xanthine oxidase generated ros fig 3a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132329 16194581 174728 3544 1516 CAT catalase catalase 0 1.0 moreover the brain is not particularly endowed with antioxidant defenses: it has a very low level of catalase activity and only moderate amounts of the endogenous antioxidant enzymes superoxide dismutase and glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132330 16194581 174728 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 moreover the brain is not particularly endowed with antioxidant defenses: it has a very low level of catalase activity and only moderate amounts of the endogenous antioxidant enzymes superoxide dismutase and glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132331 16194581 174740 14352 7794 NFKB1 nuclear factor kappa-b nuclear factor kappa b 0 1.0 ced signal transduction leading to the activation genes such as the inducible nitric oxide synthase inos interleukin 1_amp_#x3b2; il 1_amp_#x3b2; tumor necrosis factor _amp_#x3b1; tnf _amp_#x3b1; and nuclear factor kappa b nf _amp_#x3ba;b [1] [49] [60] [65] [69] [72] [81] and [86] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132332 16194581 174740 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 1.0 neuroinflammation has been connected to enhanced signal transduction leading to the activation genes such as the inducible nitric oxide synthase inos interleukin 1_amp_#x3b2; il 1_amp_#x3b2; tumor necrosis factor _amp_#x3b1; tnf _amp_#x3b1; and nuclear factor kappa b nf _amp_#x3ba;b [1] [49] [60] [65] [69] [72] [81] and [86] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132333 16194581 174740 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 neuroinflammation has been connected to enhanced signal transduction leading to the activation genes such as the inducible nitric oxide synthase inos interleukin 1_amp_#x3b2; il 1_amp_#x3b2; tumor necrosis factor _amp_#x3b1; tnf _amp_#x3b1; and nuclear factor kappa b nf _amp_#x3ba;b [1] [49] [60] [65] [69] [72] [81] and [86] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132334 16194581 174759 17461 9508 PSEN1 presenilin 1 presenilin 1 0 1.0 amyloid precursor protein/presenilin 1 app/psl transgenic mice have been used as a murine model for ad since these mutations facilitate the production of beta amyloid and consequently alzheimer like plaques in several regions of the brain 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132335 16194581 174767 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 the levels of extracellular signal regulated kinase erk and protein kinase c pkc were elevated in the bb supplemented app/psl mice as compared to those found in the non supplemented mice [41] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132336 16194581 174767 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 the levels of extracellular signal regulated kinase erk and protein kinase c pkc were elevated in the bb supplemented app/psl mice as compared to those found in the non supplemented mice [41] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132339 16194581 174781 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 the localized expression of erk and insulin like growth factor 1 igf 1 and its receptor igf 1r was also assayed by immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132340 16194581 174786 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 the data indicated that bb supplementation increased hippocampal plasticity and cognitive performance via concerted mechanisms involving neurogenesis neurotrophic factor igf 1 and its receptor and map kinase signal transduction cascades. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133282 16227974 175711 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 approximately 10% of cases are inherited and roughly a quarter of these inherited forms result from mutations in the cytosolic form of the antioxidant protein superoxide dismutase sod1 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133284 16227974 175716 23521 12468 UBC ubiquitin c ubiquitin c 0 1.0 at least five separate genes that are associated with parkinson's disease have been identified including those encoding alpha synuclein parkin ubiquitin c terminal hydrolase 1 dj1 and pten induced kinase 1 pink1 refs 2 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133285 16227974 175716 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 at least five separate genes that are associated with parkinson's disease have been identified including those encoding alpha synuclein parkin ubiquitin c terminal hydrolase 1 dj1 and pten induced kinase 1 pink1 refs 2 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133286 16227974 175719 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 for instance in the brains of patients with parkinson's disease alpha synuclein is modified by oxidative and nitrative stress 2 3 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133287 16227974 175720 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 inhibiting mitochondrial function leads to increased alpha synuclein aggregation which can in turn lead to impaired mitochondrial function 5 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133288 16227974 175729 522 380 AKR1A1 alcohol dehydrogenase alcohol dehydrogenase 0 1.0 hypotheses exist regarding how a beta induces injury but one possibility is that this peptide can directly induce oxidative stress 12 potentially through an interaction with the mitochondrial protein alcohol dehydrogenase 13 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133289 16227974 175738 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 the levels of carbonylated proteins increase dramatically with age 15 and mutants of d. melanogaster that lack carbonyl reductase activity suffer from neurodegenerative symptoms 16 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133290 16227974 175755 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 a number of groups have proposed that a plasma membrane superoxide generating enzyme system known as the nadph oxidase is involved 22 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133291 16227974 175757 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 subsequent analysis showed that components of the nadph oxidase system are expressed in other cell types and that a large family of tissue specific oxidases exist 23 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133292 16227974 175758 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consistent with its potential role in vascular disease knockout mice that are deficient in nadph oxidase have reduced vascular oxidant production and in some settings reduced atherosclerosis 24 25 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133294 16227974 175760 20997 11180 SOD2 superoxide dismutase 2 superoxide dismutase 2 0 1.0 superoxide dismutase 2 +/ sod2 +/ mice which lack one copy of this mitochondrial antioxidant protein show an increased rate of atherosclerotic plaque formation 26 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133295 16227974 175776 1271 795 ATM ataxia telangiectasia mutated ataxia telangiectasia mutated 0 1.0 for example there is evidence that p53 myc ataxia telangiectasia mutated atm and ras can all alter intracellular ros levels 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133296 16227974 175784 5811 2859 DHCR24 seladin 1 seladin 1 0 1.0 another group noted that inhibiting seladin 1 could also block ras or oxidant induced senescence 42 seladin 1 had been previously discovered in the context of alzheimer's disease in which it seems to be selectively downregulated 43 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133297 16227974 175785 5811 2859 DHCR24 seladin 1 seladin 1 0 1.0 notably following hydrogen peroxide treatment seladin 1 translocates to the nucleus where it seems to bind to and stabilize p53. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133298 16227974 175845 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 alpha synuclein app atm jund parkin peroxiredoxin i pink1 ras seladin 1 sirt1 sirt3 sod1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133299 16227974 175845 5811 2859 DHCR24 seladin 1 seladin 1 0 1.0 alpha synuclein app atm jund parkin peroxiredoxin i pink1 ras seladin 1 sirt1 sirt3 sod1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134204 16242643 176945 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 furthermore malonate did not induce the expression of the inos caspase 3 8 and 9 genes which have been shown to be up regulated in several models where minocycline resulted cytoprotective. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134205 16242643 176946 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in addition malonate induced down regulation of the antiapoptotic gene bcl 2 was not prevented by minocycline controversially the mechanism previously proposed to explain minocycline protective action. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134207 16242643 176951 10437 5992 IL1B interleukin 1, beta interleukin 1 beta 0 1.0 in this sense tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134208 16242643 176951 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134209 16242643 176951 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 in this sense tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134210 16242643 176953 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 this blockade in turn inhibits the release of the proapoptotic factors cytochrome c smac diablo and apoptosis inducing factor from the mitochondria wang et al. 2003 and zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134211 16242643 176953 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 this blockade in turn inhibits the release of the proapoptotic factors cytochrome c smac diablo and apoptosis inducing factor from the mitochondria wang et al. 2003 and zhu et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134212 16242643 176965 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 moreover although no modifications in the expression of the mrna's encoding for inos caspase 3 8 and 9 after malonate additions were found we observed a significant reduction of blc 2 mrna expression which was not reverted by minocycline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134214 16242643 176972 551 399 ALB serum albumin serum albumin 0 1.0 tissues were incubated with trypsin for 20 min at 37_amp_#xb0;c and dissociated by trituration in a medium containing dnase bovine serum albumin and trypsin inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134215 16242643 177078 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 inos caspase 3 8 and 9 mrna expression levels are not modulated by malonate 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134216 16242643 177080 1576 990 BCL2 bcl 2 bcl 2 0 1.0 among them the down regulation of caspases and inos and the up regulation of bcl 2 have been documented recently wang et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134217 16242643 177081 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in order to check whether these pathways were involved in malonate induced granular cell death we first analyzed the pattern of expression of inos caspase 3 8 and 9 and the antiapoptotic gene bcl 2 in malonate treated cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134218 16242643 177081 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in order to check whether these pathways were involved in malonate induced granular cell death we first analyzed the pattern of expression of inos caspase 3 8 and 9 and the antiapoptotic gene bcl 2 in malonate treated cells. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134219 16242643 177082 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the results shown in fig. 6 a revealed that malonate at the concentration which causes a significant decrease in cell viability does not modify the expression of the inos caspase 3 8 and 9 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134220 16242643 177083 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however 50 mm malonate caused a significant down regulation of the antiapoptotic gene bcl 2 fig 6 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134221 16242643 177085 1576 990 BCL2 bcl 2 bcl 2 0 1.0 therefore we studied whether minocycline would prevent the down regulation of bcl 2 gene expression induced by malonate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134222 16242643 177086 1576 990 BCL2 bcl 2 bcl 2 0 1.0 as depicted in fig. 6 b minocycline consistently with its lack of protective effect failed to block the down regulation of bcl 2 caused by malonate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134223 16242643 177091 1576 990 BCL2 bcl 2 bcl 2 0 1.0 additionally although malonate treatment fails to induce the mrna expression of caspase 3 8 and 9 as well as inos it decreases the mrna of the antiapoptotic protein bcl 2 an effect that was not abrogated by minocycline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134224 16242643 177091 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 additionally although malonate treatment fails to induce the mrna expression of caspase 3 8 and 9 as well as inos it decreases the mrna of the antiapoptotic protein bcl 2 an effect that was not abrogated by minocycline. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134225 16242643 177101 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cardiolipin is a phospholipid located in the inner mitochondrial membrane whose oxidation can be the consequence of the release of cytochrome c from the mitochondria to the cytoplasm tuominen et al. 2002 a release that we have previously observed to be increased in sh sy5y cells challenged with malonate fern_amp_#xe1;ndez g_amp_#xf3;mez et a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134226 16242643 177103 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 as a consequence of permeability transition pore formation cytochrome c is released to the cytoplasm turning on the apoptotic machinery. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134227 16242643 177115 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we found no changes in the expression of the genes coding for inos caspase 3 8 and 9. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134228 16242643 177116 1576 990 BCL2 bcl 2 bcl 2 0 1.0 conversely we did find a significant down regulation of bcl 2 expression after a 24 h malonate exposure. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134229 16242643 177117 1576 990 BCL2 bcl 2 bcl 2 0 1.0 it should be noted that the up regulation of bcl 2 gene expression has been recently proposed as a mechanism mediating minocycline induced cytoprotection wang et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134230 16242643 177118 1576 990 BCL2 bcl 2 bcl 2 0 1.0 however abounding on the lack of protective effect by minocycline in the present work this drug failed to reverse the down regulation of bcl 2 induced by malonate treatment nor induced bcl 2 expression by itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134231 16242643 177149 1576 990 BCL2 bcl 2 bcl 2 0 1.0 fig. 6._amp_#xa0;malonate does not affect inos caspase 3 8 and 9 but significantly reduces bcl 2 mrna expression levels. mrna expression in malonate treated cerebellar granular cells was quantitatively measured by real time pcr using gadph mrna levels as control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134232 16242643 177149 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 fig. 6._amp_#xa0;malonate does not affect inos caspase 3 8 and 9 but significantly reduces bcl 2 mrna expression levels. mrna expression in malonate treated cerebellar granular cells was quantitatively measured by real time pcr using gadph mrna levels as c 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134233 16242643 177150 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 a lack of effects of malonate on the inos caspase 3 8 and 9 mrna expression levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134234 16242643 177151 1576 990 BCL2 bcl 2 bcl 2 0 1.0 b effect of malonate on bcl 2 mrna expression levels. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134235 16242643 177152 1576 990 BCL2 bcl 2 bcl 2 0 1.0 minocycline pre treatment fails to avoid the bcl 2 down regulation induced by malonate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134236 16242643 177158 1576 990 BCL2 bcl 2 bcl 2 0 1.0 cardiolipins|enzyme inhibitors|malonates|neuroprotective agents|neurotoxins|proto oncogene proteins c bcl 2|reactive oxygen species|minocycline|malonic acid|glutathione|succinate dehydrogenase|caspases| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129646 16406002 170378 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 combining findings on neurodegeneration and oxidative stress in drosophila with studies on the metabolic characteristics of the human enzyme carbonyl reductase cr it is clear now that cr has a potential physiological role for neuroprotection in humans. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129647 16406002 170415 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in various cell lines reactive aldehyde induced apoptosis was accompanied by c jun n terminal kinase and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129648 16406002 170415 10824 6204 JUN c jun c jun 0 1.0 in various cell lines reactive aldehyde induced apoptosis was accompanied by c jun n terminal kinase and caspase 3 activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129649 16406002 170424 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 in general routes of metabolism for these carbonylic lipids include spontaneous and enzyme catalyzed glutathione gsh conjugation and either oxidation by aldehyde dehydrogenase or carbonyl reduction catalyzed by enzymes from two different protein superfamilies the aldo keto reductases akr [12] and the short chain dehydrogenases sdr [13] to which sniffer belongs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129650 16406002 170426 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 sniffer is a carbonyl reductase and belongs to the superfamily of short chain dehydrogenases/reductases 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129651 16406002 170427 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 it turned out as a surprise that according to its primary structure sniffer shows similarity with human carbonyl reductase cr; secondary alcohol: nadp + oxidoreductase; ec 1.1.1.184 [14] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129652 16406002 170433 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 sniffer is so far the only known functional carbonyl reductase in drosophila melanogaster which emphasizes the importance of this enzyme as a neuroprotective agent [5] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129653 16406002 170434 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 carbonyl reductase plays a unique role in the detoxification of reactive aldehydes derived from lipid peroxidation 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129654 16406002 170443 523 381 AKR1B1 aldose reductase aldose reductase 0 1.0 at a first glance compared to cr the enzyme akr1b1 previously named aldose reductase from the akr superfamily exhibits a higher k cat / k m due to a lower k m for one and gs one reduction [18] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129655 16406002 170458 5526 18985 DCXR carbonyl reductase carbonyl reductase 0 1.0 acid; hne = 4 hydroxynon 2 enal; hno = 1 hydroxynon 2 en 4 one; ona = 4 oxononanal; one = 4 oxonon 2 enal; gsh = reduced glutathione ar = aldose reductase akr1b1 ; aldh = aldehyde dehydrogenase; cr = carbonyl reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129656 16406002 170458 523 381 AKR1B1 aldose reductase aldose reductase 0 1.0 abbreviations: dhn = 4 dihydroxynonene; hna = 4 hydroxynonan acid; hne = 4 hydroxynon 2 enal; hno = 1 hydroxynon 2 en 4 one; ona = 4 oxononanal; one = 4 oxonon 2 enal; gsh = reduced glutathione ar = aldose reductase akr1b1 ; aldh = aldehyde dehydrogenase; cr = carbonyl reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 129657 16406002 170458 570 412 ALDH9A1 aldehyde dehydrogenase aldehyde dehydrogenase 0 1.0 nonene; hna = 4 hydroxynonan acid; hne = 4 hydroxynon 2 enal; hno = 1 hydroxynon 2 en 4 one; ona = 4 oxononanal; one = 4 oxonon 2 enal; gsh = reduced glutathione ar = aldose reductase akr1b1 ; aldh = aldehyde dehydrogenase; cr = carbonyl reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113439 16624679 147583 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 _#x201d; generating adenosine triphosphate atp through oxidative phosphorylation which relies on the activity of the four respiratory enzyme complexes of the mitochondrial etc the f0f1 atpase and the adenine nucleotide translocator ant fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113441 16624679 147724 1576 990 BCL2 bcl 2 bcl 2 0 1.0 interestingly bcl 2 which has protective activity against oxidative stress [24] and prevents cell death induced by rotenone by blocking the loss of mitochondrial membrane potential [45] and [49] was trapped by sod1 aggr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113442 16624679 147733 20225 16554 SLC25A6P1 adenine nucleotide translocator adenine nucleotide translocator 0 1.0 atp is then released into the cytosol via the adenine nucleotide translocator ant and the _amp_#x201c;voltage dependent_amp_#x201d; anion channel vdac which are the core components of the mitochondrial membrane permeability pore. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113443 16624679 147734 1576 990 BCL2 bcl 2 bcl 2 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113444 16624679 147734 17080 9257 PPID cyclophilin d cyclophilin d 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113445 16624679 147734 17080 9257 PPID cyp d cyp d 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 17082 9259 PPIF 0 113446 16624679 147734 4423 1991 CKB creatine kinase creatine kinase 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113447 16624679 147734 23264 1158 TSPO peripheral benzodiazepine receptor peripheral benzodiazepine receptor 0 1.0 other putative components of this complex are the peripheral benzodiazepine receptor pbr creatine kinase ck hexokinase ii hk cyclophilin d cyp d and bax/bcl 2 like proteins bax bak bcl 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 103420 16681429 132323 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 methods: we determined activity of the following ades: copper zinc superoxide dismutase cuzn sod catalase cat glutathione peroxidase gsh px and glutathione reductase gr in erythrocytes from sporadic als patients [sals /+ ] familial als patients with the leu144phe mutation in the sod1 gene [fals +/+ ] asymptomatic carriers with the leu144phe mutation in the sod1 g 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 103421 16681429 132323 3544 1516 CAT catalase catalase 0 1.0 methods: we determined activity of the following ades: copper zinc superoxide dismutase cuzn sod catalase cat glutathione peroxidase gsh px and glutathione reductase gr in erythrocytes from sporadic als patients [sals /+ ] familial als patients with the leu144phe mutation in the sod1 gene [fals +/+ ] asy 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 103422 16681429 132323 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 methods: we determined activity of the following ades: copper zinc superoxide dismutase cuzn sod catalase cat glutathione peroxidase gsh px and glutathione reductase gr in erythrocytes from sporadic als patients [sals /+ ] familial als patients with the leu144phe mutation in the sod1 ge 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106297 16764863 137649 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 to further examine the mechanisms of bmaa induced injury to mns cultures were exposed to bmaa 100_amp_#xa0;_amp_#x3bc;m in the presence of the selective glutamate receptor antagonists mk 801 10_amp_#xa0;_amp_#x3bc;m and/or nbqx 10_amp_#xa0;_amp_#x3bc;m fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106298 16764863 137652 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 fluorescence imaging techniques were used to address mechanisms of mn injury downstream from glutamate receptor activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106299 16764863 137658 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 previous studies have demonstrated that glutamate receptor mediated ca 2+ entry triggers the generation of ros lafon cazal et al. 1993 dugan et al. 1995 reynolds and hastings 1995 carriedo et al. 1998 and carriedo et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106300 16764863 137677 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 enotypic development eagleson et al. 1985 schaffner et al. 1987 and martinou et al. 1989 and results in mns far more closely resembling mns in vivo in terms of such factors as axodendritic growth and glutamate receptor expression than occurs in pure mn cultures vandenberghe et al. 1998 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106301 16764863 137687 5893 2898 DLD diaphorase diaphorase 0 1.0 in a previous study we identified a subpopulation of cortical neurons nadph diaphorase neurons which was far more susceptible to bmaa injury than the overall cortical neuronal population weiss et al. 1989a and weiss et al. 1989b providing precedent for the idea that vulnerability to bm 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 106302 16764863 137698 5893 2898 DLD diaphorase diaphorase 0 1.0 however in our prior studies we found that the preferential injury to the nadph diaphorase neurons induced by lower bmaa exposures was predominantly mediated by ampa/kainate receptors weiss et al. 1989a weiss et al. 1989b and smith and meldrum 1990 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100381 16877542 128958 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 herein we show that nadph oxidase the main reactive oxygen species producing enzyme during inflammation is activated in spinal cords of als patients and in spinal cords in a genetic animal model of this disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100382 16877542 128959 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we demonstrate that inactivation of nadph oxidase in als mice delays neurodegeneration and extends survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100385 16877542 128960 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100386 16877542 128960 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100387 16877542 128966 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 transgenic sod1 g93a mice [c57bl/6j tgn sod1 g93a 1gur dl ] were crossed with gp91 phox deficient mice b6.129s6 cybb tm1din . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100388 16877542 128972 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 primer sequences for gp91 phox glial fibrillary acidic protein macrophage antigen complex 1 and gapdh and pcr conditions are presented in supporting text . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100389 16877542 128972 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 primer sequences for gp91 phox glial fibrillary acidic protein macrophage antigen complex 1 and gapdh and pcr conditions are presented in supporting text . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100390 16877542 129014 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is up regulated in inflamed spinal cords of als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100391 16877542 129015 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 to determine the role of nadph oxidase in motor neuron degeneration we first evaluated its expression at different stages of the disease in transgenic mice expressing mutant human sod1 with a substitution of glycine to alanine in position 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100392 16877542 129016 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 expression of nadph oxidase in the spinal cord which carries the brunt of the pathology in this als model was determined by analyzing its catalytic subunit gp91 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100393 16877542 129016 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 expression of nadph oxidase in the spinal cord which carries the brunt of the pathology in this als model was determined by analyzing its catalytic subunit gp91 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100394 16877542 129017 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 both gp91 phox message and protein contents in whole tissue extracts of spinal cord rose over time in transgenic sod1 g93a mice fig 1 a b d and e in concert with the development of a glial response fig 6 which is p 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100395 16877542 129018 14170 7661 NCF2 p67 phox p67 phox 0 1.0 the levels of the p67 phox subunit that contains the nadph binding site of the nadph oxidase complex 10 were increased in membrane fractions of spinal cord extracts from symptomatic transgenic sod1 g93a mice fig 1 c indicating 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100396 16877542 129018 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 the levels of the p67 phox subunit that contains the nadph binding site of the nadph oxidase complex 10 were increased in membrane fractions of spinal cord extracts from symptomatic transgenic sod1 g93a mice fig 1 c indicating that this cytosolic subunit did translocate to the plasma membran 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100397 16877542 129019 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 conversely none of these nadph oxidase alterations were seen in age matched nontransgenic littermates fig 1 a _amp_#x02013; e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100398 16877542 129020 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 histological evaluation of the spinal cord of symptomatic transgenic sod1 g93a mice showed numerous gp91 phox positive cells primarily in the gray matter of the anterior horn fig 1 g whereas sparse staining was observed in the spinal cord of age matched nontransgenic controls fig 1 f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100399 16877542 129021 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 consistent with nadph oxidase expression by professional phagocytes confocal microscopy demonstrated the colocalization of the gp91 phox subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013; j ; no gp91 phox colocalization was detected with the motor neuron marker nonphosphorylated neurofilament 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100400 16877542 129021 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013; j ; no gp91 phox colocalization was detected with the motor neuron marker nonphosphorylated neurofilament heavy chain or with the astrocyte marker glial fibrillary acid protein data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100401 16877542 129021 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consistent with nadph oxidase expression by professional phagocytes confocal microscopy demonstrated the colocalization of the gp91 phox subunit with a microglial marker the ricinus communis agglutinin lectin fig 1 h _amp_#x02013 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100402 16877542 129023 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase causes protein oxidation in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100403 16877542 129024 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we further characterized the status of spinal cord nadph oxidase in transgenic sod1 g93a mice by probing for formation of ros and evidence of protein oxidation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100404 16877542 129026 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 in contrast in symptomatic transgenic sod1 g93a mice carrying the wild type gp91 phox allele sod g93a /gp91 phox+ spinal cord ethidium fluorescence was intense fig 1 l and coincided anatomically with the areas of gp91 phox expression fig 1 g and microglial activation fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100405 16877542 129026 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 + spinal cord ethidium fluorescence was intense fig 1 l and coincided anatomically with the areas of gp91 phox expression fig 1 g and microglial activation fig 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100406 16877542 129029 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 symptomatic transgenic sod1 g93a /gp91 phox+ mice but not age matched sod1 g93a /gp91 phox_amp_#x02212; mice had increased levels of spinal cord protein carbonyl adducts compared with nontransgenic controls expressing either wild type or null 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100407 16877542 129029 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 but not age matched sod1 g93a /gp91 phox_amp_#x02212; mice had increased levels of spinal cord protein carbonyl adducts compared with nontransgenic controls expressing either wild type or null mutant gp91 phox fig 1 n . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100408 16877542 129030 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 immunohistochemically the most robust labeling for protein carbonyl adducts occurred in spinal cord sections from sod1 g93a /gp91 phox+ mice at the level of cells with mixed morphology including large motor neurons fig 1 o _amp_#x02013; q . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100409 16877542 129031 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase induction and neuronal protein carbonylation in sporadic als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100410 16877542 129032 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we then sought to determine whether the nadph oxidase alterations identified in transgenic sod1 g93a mice were also present in human sporadic als the most common form of the disease 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100411 16877542 129033 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 consistent with the mouse data gp91 phox content was low fig 2 a and b and its immunoreactivity was faint in control postmortem spinal cords fig 2 d whereas gp91 phox content was _amp_#x02248;3 fold higher and its immunoreactivity robust in sporadic als spinal cords fig 2 e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100412 16877542 129034 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 in the latter gp91 phox positive cells colocalized with the microglial associated antigen cd68 fig 2 f and were identified in all of the typical als loci of neurodegeneration including the anterior horn and the lateral cort 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100413 16877542 129038 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox mitigates the disease phenotype in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100414 16877542 129039 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 next we explored the contribution of nadph oxidase activation on the disease phenotype in the sod1 g93a mouse model of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100415 16877542 129040 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 transgenic sod1 g93a /gp91 phox_amp_#x02212; mice reached end stage paralysis defined as a loss of the righting reflex later than their transgenic sod1 g93a /gp91 phox+ counterparts fig 3 a which resulted in a longer lifespan of transgenic sod1 g93a /gp91 phox_amp_#x02212; mice log rank test = 15.3; p _amp_#x0003c; 0.001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100416 16877542 129041 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in addition to the prolonged survival inactivation of nadph oxidase did mitigate neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100417 16877542 129042 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 compared with end stage transgenic sod1 g93a /gp91 phox+ mice age matched transgenic sod1 g93a /gp91 phox_amp_#x02212; mice had _amp_#x02248;50% more anterior horn motor neurons in the spinal cord fig 3 b _amp_#x02013; e and myelinated axons in the fifth 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100418 16877542 129043 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 spinal cord microgliosis evidenced by macrophage antigen complex 1 immunostaining and levels of the glial cytokine il 1_amp_#x003b2; did not differ between age matched transgenic sod1 g93a /gp91 phox+ mice and sod1 g93a /gp91 phox_amp_#x02212; mice fig 7 which is published as supporting information on the pnas web site . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100419 16877542 129044 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 also not affected by the deficit of gp91 phox were the levels of human sod1 in transgenic sod1 g93a mice fig 7 or the size of muscle fibers in the fibularis and peroneus longus muscles in nontransgenic mice fig 3 t . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100420 16877542 129045 13949 7577 MYH7 myosin heavy chain myosin heavy chain 0 1.0 the selected muscles are mainly composed of fast twitch fibers and by immunostaining for myosin heavy chain we did not observe any obvious alteration in the makeup of muscle fiber types among the different mouse groups fig 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100423 16877542 129047 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100424 16877542 129047 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100425 16877542 129048 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 we then explored whether nadph oxidase mediated protein modifications might promote neurodegeneration in als by damaging essential surviving pathways for motor neurons such as igf1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100426 16877542 129051 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however protein carbonyl adducts were evident in the _amp_#x003b1; chain of the igf1 tyrosine kinase cognate receptor in the spinal cord of symptomatic transgenic sod1 g93a /gp91 phox+ mice fig 4 a and b ; similar results were obtained for the _amp_#x003b2; chain of igf1 receptor data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100427 16877542 129058 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however there were fewer phospho igf1 receptor immunoreactive cells in spinal cord sections from symptomatic transgenic sod1 g93a /gp91 phox+ mice than from age matched sod1 g93a /gp91 phox_amp_#x02212; mice fig 4 c _amp_#x02013; e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100428 16877542 129059 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 as fewer cells that were immunoreactive for a downstream target of akt phospho bad fig 4 h _amp_#x02013; j and smaller phospho bad:total bad ratios fig 4 k and l in symptomatic transgenic sod1 g93a /gp91 phox+ mice compared with their age matched sod1 g93a /gp91 phox_amp_#x02212; counterparts. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100429 16877542 129060 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 these data further support the idea that oxidative modification of igf1 receptor in symptomatic transgenic sod1 g93a /gp91 phox+ mice is associated with a range of molecular perturbations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100430 16877542 129062 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 to test the idea that nadph oxidase derived ros could impair igf1 pathway function an in vitro cell system using the neuron like cell lines sh sy5y and imr32 was used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100431 16877542 129065 3544 1516 CAT catalase catalase 0 1.0 to conditioned medium containing 0.1 milliunits/ml glucose oxidase generating an average stable concentration of 75 _amp_#x003bc;m h 2 o 2 fig 5 e ; this effect was abolished by adding 1 000 units/ml catalase to the medium data not shown . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100432 16877542 129069 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 however both the alteration of igf1 mediated akt phosphorylation and the loss of cell viability mediated by lps activated microglia were counteracted by the specific nadph oxidase inhibitor apocynin fig 5 c d and f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100433 16877542 129073 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 germane to the molecular basis of this deleterious effect on motor neurons is our finding that virtually all spinal cord microglial cells express the gp91 phox subunit of the oxidant producing enzyme nadph oxidase fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100434 16877542 129073 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 germane to the molecular basis of this deleterious effect on motor neurons is our finding that virtually all spinal cord microglial cells express the gp91 phox subunit of the oxidant producing enzyme nadph oxidase fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100435 16877542 129074 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 agreeing with the fact that in nonactivated phagocytes nadph oxidase is quiescent 7 gp91 phox positive cells in spinal cords from 1 to 4 month old nontransgenic mice had a morphology of resting microglia and did not seem to produce ros figs 1 and 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100436 16877542 129074 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 agreeing with the fact that in nonactivated phagocytes nadph oxidase is quiescent 7 gp91 phox positive cells in spinal cords from 1 to 4 month old nontransgenic mice had a morphology of resting microglia and did not seem to produce ros figs 1 and 6 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100437 16877542 129075 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 conversely in transgenic sod1 g93a mice paralleling the worsening of the als phenotype there was an intensification of spinal cord microgliosis accompanied by an up regulation and activation of nadph oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100438 16877542 129077 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 corroborating this view are the levels of protein carbonyls which were markedly elevated in spinal cord extracts of symptomatic transgenic sod1 g93a mice for the most part in a nadph oxidase dependent manner fig 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100439 16877542 129078 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 evidence of microgliosis nadph oxidase up regulation and protein carbonylation was also found in postmortem spinal cords from human sporadic als cases fig 2 supporting the conclusion that the occurrence of inflammation mediated oxidative 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100440 16877542 129079 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 our results also show that abrogation of the gp91 phox subunit of nadph oxidase in transgenic sod1 g93a mice eliminates the production of microglial derived ros fig 1 m and importantly prolongs survival and retards neurodegeneration in this als model fig 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100441 16877542 129079 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our results also show that abrogation of the gp91 phox subunit of nadph oxidase in transgenic sod1 g93a mice eliminates the production of microglial derived ros fig 1 m and importantly prolongs survival and retards neurodegeneration in this als model fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100442 16877542 129080 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox in transgenic sod1 g93a mice did not alter the spinal cord microglial response or the expression of human sod1 in transgenic sod1 g93a mice fig 7 which is a known determinant of disease severity in t 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100443 16877542 129081 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 consequently the attenuated phenotype seen in transgenic sod1 g93a /gp91 phox_amp_#x02212; mice is attributable to the lack of nadph oxidase activity and not to either an impaired microglial response or expression of the human sod1 g93a transgene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100444 16877542 129082 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 these data provide compelling evidence that nadph oxidase contributes to the degeneration of motor neurons in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100445 16877542 129084 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 however the magnitude of benefit afforded by gp91 phox deletion in transgenic sod1 g93a mice argues that targeting neuroinflammation by inhibiting just one of its mediators such as nadph oxidase may not be sufficient to produce robust and lasting neuropr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100446 16877542 129084 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 however the magnitude of benefit afforded by gp91 phox deletion in transgenic sod1 g93a mice argues that targeting neuroinflammation by inhibiting just one of its mediators such as nadph oxidase may not be sufficient to produce robust and lasting neuroprotection in als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100447 16877542 129085 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 all cells not motor neurons only which are located in the vicinity of activated microglia may indiscriminately have their plasma membrane proteins and lipids damaged by nadph oxidase derived ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100448 16877542 129091 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in this study we indeed found that receptors for igf1 were primarily expressed on motor neurons in mouse spinal cords fig 8 and that the igf1 signaling pathway was impaired by a nadph oxidase dependent mechanism in symptomatic transgenic sod1 g93a mice fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100449 16877542 129092 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 although igf1 per se did not seem to be damaged by inflammation nadph oxidase did stimulate the oxidative modification of igf1 receptors fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100450 16877542 129095 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 ggregate show that several molecular events that are normally elicited by ligation of the igf1 receptor including autophosphorylation and akt phosphorylation were indeed abated by ros in a microglial nadph oxidase dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100451 16877542 129096 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our data also show that microglial nadph oxidase by impairing the igf1 signaling pathway renders sh sy5y cells in our in vitro system more prone to die upon exposure to a hostile environment such as that emulated by lps activated microglial conditi 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100452 16877542 129099 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in our study however we did not find any evidence that the rescue of the igf1 pathway by abrogating nadph oxidase was associated with muscle hypertrophy fig 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100453 16877542 129100 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 nevertheless whether transgenic sod1 g93a mice carrying the gp91 phox null mutation reach end stage paralysis later and exhibit an attenuated neurodegenerative process because of some effects at the skeletal muscle level is an interesting possibility that cannot be exc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100454 16877542 129114 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 microglial nadph oxidase stimulates carbonylation of spinal cord motor neurons in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100455 16877542 129115 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a _amp_#x02013; e spinal cord gp91 phox mrna a and d and protein b and e in 1 month old asymptomatic to 4 month old end stage transgenic sod1 more ... 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100456 16877542 129117 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase is up regulated and associated with motor neuron carbonylation in the spinal cord of sporadic als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100457 16877542 129118 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a and b immunoblots and bar graph for gp91 phox using spinal cord extracts from six normal controls and six age matched als patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100458 16877542 129121 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 deletion of gp91 phox increases lifespan and lessens neurodegeneration in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100459 16877542 129122 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 a survival comparison of transgenic sod1 g93a /gp91 phox+ mice red 122.0 _amp_#x000b1; 1.7 days; n = 19 and transgenic sod1 g93a /gp91 phox_amp_#x02212; littermates more ... 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100460 16877542 129124 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 modulation of the igf1/akt pathway by nadph oxidase derived ros. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100463 16877542 129130 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100465 16877542 129130 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100467 16877542 129133 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 insights into its neurodegenerative mechanisms followed the discovery that dominant mutations in the gene for superoxide dismutase 1 sod1 cause familial als 2 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100468 16877542 129138 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 among the microglia derived mediators that could promote neurodegeneration are reactive oxygen species ros produced by the enzyme nadph oxidase complex 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100470 16877542 129141 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in light of these facts we undertook the study of nadph oxidase in both human als and one of its genetic models. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100471 16877542 129142 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 our results for both human and mouse postmortem tissues indicate that spinal cord microgliosis in als is accompanied with an up regulation of nadph oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100472 16877542 129143 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 furthermore by using mutant deficient mice in functional nadph oxidase as well as in neuron like cell culture systems we provide compelling evidence that supports the concept that this microglial ros generating enzymatic complex promotes spinal cord motor neuron degener 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87992 17099894 113908 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 motor neuron degeneration in amyotrophic lateral sclerosis mutant superoxide dismutase 1 transgenic mice: mechanisms of mitochondriopathy and cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87994 17099894 113909 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 the mechanisms of human mutant superoxide dismutase 1 msod1 toxicity to motor neurons mns are unresolved. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87995 17099894 113912 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 the mn death is independent of activation of caspases 1 3 and 8 or apoptosis inducing factor within mns with a blockade of apoptosis possibly mediated by aven up regulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87996 17099894 113914 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87999 17099894 113914 13731 7419 MT-CO1 cytochrome c oxidase subunit i cytochrome c oxidase subunit i 0 1.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88000 17099894 113915 5893 2898 DLD diaphorase diaphorase 0 1.0 mitochondria in msod1 mouse mns accumulate nadph diaphorase and inducible nitric oxide synthase inos like immunoreactivity and inos gene deletion extends significantly the life span of g93a msod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88001 17099894 113915 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 mitochondria in msod1 mouse mns accumulate nadph diaphorase and inducible nitric oxide synthase inos like immunoreactivity and inos gene deletion extends significantly the life span of g93a msod1 mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88002 17099894 113917 20523 11138 SNCA alpha synuclein alpha synuclein 0 1.0 olving blockade of apoptosis accumulation of mn mitochondria with enhanced toxic potential from distal terminals nos localization in mn mitochondria and peroxynitrite damage and early degeneration of alpha synuclein + interneurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88214 17105868 114229 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the proapoptotic proteins fas fas associated death domain caspase 8 and caspase 3 were also elevated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88215 17105868 114229 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 the proapoptotic proteins fas fas associated death domain caspase 8 and caspase 3 were also elevated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88216 17105868 114240 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the ratio of apoptotic cell death genes bax to bcl 2 is increased at both the mrna and protein level in spinal motor neurons from patients with als and from sod1 g93a mice mu et al. 1996 ; vukosavic et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88217 17105868 114241 1576 990 BCL2 bcl 2 bcl 2 0 1.0 mutant sod1 g93a has been observed to aggregate in spinal cord mitochondria but not liver mitochondria and binds to bcl 2 pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88218 17105868 114242 1576 990 BCL2 bcl 2 bcl 2 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 200 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88219 17105868 114242 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 2001 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88220 17105868 114242 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 2001 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88221 17105868 114242 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 altered expression and dysfunction of bcl 2 may contribute to the activation of mitochondrial apoptosis machinery such as caspase 9 caspase 3 and cytochrome c in spinal motor neurons of als transgenic mice and humans with als guegan et al. 2001 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88222 17105868 114243 1576 990 BCL2 bcl 2 bcl 2 0 1.0 in support of this idea overexpression of bcl 2 or the caspase inhibitory protein xiap prolongs survival and improves motor performance in als mice expressing the sod1 g93a mutation kostic et al. 1997 ; inoue et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88225 17105868 114247 9939 5464 IGF1 insulin-like growth factor 1 insulin like growth factor 1 0 1.0 surprisingly insulin like growth factor 1 prevents neuronal cell apoptosis and protects spinal motor neurons in als mice ryu et al. 1999 ; kaspar et al. 2003 but markedly potentiates neuronal cell necrosis induced by hydroxyl radical or glut 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88226 17105868 114284 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 ctions were then reacted overnight at 4degreec with the primary antibodies: mouse anti fas bd biosciences san jose ca anti nitrotyrosine 4 microg/ml; upstate biotechnology lake placid ny anti cleaved caspase 3 cell signaling technology danvers ma and anti neun. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88227 17105868 114294 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the following primary antibodies were used: fas fadd bd bioscience franklin lakes nj cleaved caspase 3 and cleaved caspase 8 1 microg/ml; cell signaling technology . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88228 17105868 114294 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 the following primary antibodies were used: fas fadd bd bioscience franklin lakes nj cleaved caspase 3 and cleaved caspase 8 1 microg/ml; cell signaling technology . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88229 17105868 114332 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 oxidative stress in als seems to be attributable to multiple factors including mitochondrial dysfunction reduced glutathione peroxidase activity and point mutations in the cu zn superoxide dismutase sod1 gene the last of which are present in approximately 20% of familial als cases rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88230 17105868 114335 4772 26515 COQ10A coenzyme q10 homolog a coenzyme q10 a 0 1.0 second in transgenic mice expressing the sod1 g93a mutation transgenic als mice administration of antioxidants such as coenzyme q10 a component of the mitochondrial respiratory chain and creatine an inhibitor of the mitochondrial transition pore reduces free radical formation and increases life span and motor performance matthews e 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88231 17105868 114342 1576 990 BCL2 bcl 2 bcl 2 0 1.0 the latter effect may be attributable to interaction of mutant sod1 and bcl 2 causing mitochondrial dysfunction and subsequently increased sensitivity to oxidative stress pasinelli et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88232 17105868 114348 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 we found that expression of fas and fadd were increased selectively in the ventral motor neurons of g93a transgenic mice and that this led to activation of caspase 8 and caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88233 17105868 114348 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 we found that expression of fas and fadd were increased selectively in the ventral motor neurons of g93a transgenic mice and that this led to activation of caspase 8 and caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88234 17105868 114351 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in support of this li blocked activation of the fas pathway during serum deprivation induced apoptosis and attenuated motor neuron degeneration as well as activation of fas caspase 8 and caspase 3 in the spinal cords of als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88235 17105868 114351 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 in support of this li blocked activation of the fas pathway during serum deprivation induced apoptosis and attenuated motor neuron degeneration as well as activation of fas caspase 8 and caspase 3 in the spinal cords of als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88236 17105868 114354 16613 8975 PIK3CA phosphatidylinositol 3-kinase phosphatidylinositol 3 kinase 0 1.0 0 blocks free radical neurotoxicity in cortical cell cultures at a dose as low as 0.3 microm and completely blocks free radical production after focal cerebral gwag et al. 2006 beta and activation of phosphatidylinositol 3 kinase that result in activation of the serine/threonine kinase akt 1 and phospholipase c gamma chalecka franaszek and chuang 1999 ~0.425 _amp_#177; 0.05 meq/l in blood below the therapeutic range 0.6 1.5 m 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88237 17105868 114354 16737 15917 PLCB1 phospholipase c phospholipase c 0 1.0 completely blocks free radical production after focal cerebral gwag et al. 2006 beta and activation of phosphatidylinositol 3 kinase that result in activation of the serine/threonine kinase akt 1 and phospholipase c gamma chalecka franaszek and chuang 1999 ~0.425 _amp_#177; 0.05 meq/l in blood below the therapeutic range 0.6 1.5 meq/l in blood for treatment of manic episodes and depression in humans ross and fra 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88238 17105868 114356 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 long term treatment with li increases expression of brain derived neurotrophic factor in the hippocampus and neocortex which mediates the antiapoptotic action of li fukumoto et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88239 17105868 114356 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 long term treatment with li increases expression of brain derived neurotrophic factor in the hippocampus and neocortex which mediates the antiapoptotic action of li fukumoto et al. 2001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88240 17105868 114357 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88242 17105868 114357 14727 8023 NTF3 neurotrophin 3 neurotrophin 3 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; won 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88243 17105868 114357 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88244 17105868 114357 14728 8024 NTF4 nt 4/5 nt 4/5 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; won et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88245 17105868 114357 14728 8024 NTF4 nt 4/5 nt 4/5 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; won et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88246 17105868 114357 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88247 17105868 114358 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 neurotrophins can induce oxidative stress through up regulation of nadph oxidase leading to neuronal cell necrosis kim et al. 2002 kim et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88248 17105868 114383 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 c western blot analysis showing expression of cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control or g93a mice at ages indicated a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88249 17105868 114383 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 c western blot analysis showing expression of cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control or g93a mice at ages indicated a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88250 17105868 114384 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 levels of cleaved caspase 8 b and caspase 3 c were measured and scaled to actin mean _amp_#177; s.e.m. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88251 17105868 114384 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 levels of cleaved caspase 8 b and caspase 3 c were measured and scaled to actin mean _amp_#177; s.e.m. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88252 17105868 114386 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 d fluorescence photomicrographs of lumbar ventral sections from control a and g93a mice b at 12 weeks of age immunolabeled with an antibody for cleaved caspase 3. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88253 17105868 114387 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 note activation of caspase 3 in the motor neurons arrows from g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88254 17105868 114395 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 c western blot analysis of fadd after immunoprecipitation ip with fas antibody cleaved caspase 8 cleaved caspase 3 and actin in neuron rich cortical cell cultures deprived of serum for 12 h alone or in the presence of 1 microm neu2000 or 5 mm li . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88255 17105868 114395 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 c western blot analysis of fadd after immunoprecipitation ip with fas antibody cleaved caspase 8 cleaved caspase 3 and actin in neuron rich cortical cell cultures deprived of serum for 12 h alone or in the presence of 1 microm neu2000 or 5 mm li . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88256 17105868 114403 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 f western blot analysis of fas fadd cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control and g93a transgenic mice treated with saline neu2000 30 mg/kg/days or li 200 mg/kg/days for 4 weeks starting from 8 weeks of age a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88257 17105868 114403 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 f western blot analysis of fas fadd cleaved caspase 8 cleaved caspase 3 and actin in lumbar segments from control and g93a transgenic mice treated with saline neu2000 30 mg/kg/days or li 200 mg/kg/days for 4 weeks starting from 8 weeks of age a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88258 17105868 114423 7334 11936 FASLG fas ligand fas ligand 0 1.0 fas and fas ligand mediated apoptosis plays a role in neuronal loss in animal models of stroke martin et al. 2001 beta amyloid neurotoxicity in cultured cortical neurons su et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88259 17105868 114425 22151 21354 TICAM2 cytoplasmic adaptor cytoplasmic adaptor 0 1.0 expression of fas and its cytoplasmic adaptor protein fadd and fas fadd interaction were also increased in the lumbar spinal cord of g93a transgenic mice at 12 weeks of age compared with control mice fig 2a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88260 17105868 114427 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 increased expression of the apoptosis inducing signaling complex was followed by activation of caspase 8 and caspase 3 in the lumbar spinal cord fig 2c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88261 17105868 114427 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 increased expression of the apoptosis inducing signaling complex was followed by activation of caspase 8 and caspase 3 in the lumbar spinal cord fig 2c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88262 17105868 114428 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the active form of caspase 3 was observed in spinal motor neurons from g93a mice fig 2d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88263 17105868 114429 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 these findings suggest that fas fadd caspase 8 and caspase 3 are activated in spinal motor neurons and mediate subsequent neuronal apoptosis in als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88264 17105868 114429 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 these findings suggest that fas fadd caspase 8 and caspase 3 are activated in spinal motor neurons and mediate subsequent neuronal apoptosis in als mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88265 17105868 114441 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 interaction of fadd with fas cleaved caspase 8 and cleaved caspase 3 were all increased in neuron rich cortical cell cultures deprived of serum for 8 h and these changes were blocked by the addition of li but not neu2000 fig 3c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88266 17105868 114441 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 interaction of fadd with fas cleaved caspase 8 and cleaved caspase 3 were all increased in neuron rich cortical cell cultures deprived of serum for 8 h and these changes were blocked by the addition of li but not neu2000 fig 3c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88267 17105868 114445 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 daily administration of neu2000 in the diet slightly but statistically insignificantly attenuated the increase in fas fadd and cleaved caspase 8 and caspase 3 in the lumbar spinal cords of g93a transgenic mice at 12 weeks of age fig 3f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88268 17105868 114445 3532 1509 CASP8 caspase 8 caspase 8 0 1.0 daily administration of neu2000 in the diet slightly but statistically insignificantly attenuated the increase in fas fadd and cleaved caspase 8 and caspase 3 in the lumbar spinal cords of g93a transgenic mice at 12 weeks of age fig 3f . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88269 17105868 114469 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 abbreviations: als amyotrophic lateral sclerosis; page paw grip endurance; mfr mitochondrial free radicals; div days in vitro; bso dl buthionine [ s r ] sulfoximine; sod superoxide dismutase; ldh lactate dehydrogenase; fadd fas associated death domain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72569 17150307 92627 7683 3796 FOS ap 1 ap 1 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72570 17150307 92627 7683 3796 FOS c fos c fos 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72571 17150307 92627 10824 6204 JUN c jun c jun 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72572 17150307 92627 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition gsh depletion enhanced oxidative stress markers ap 1 transcriptional activation c jun c fos and ho 1 expression in nsc34 cells analyzed by a luciferase reporter western blotting and quantitative pcr assays respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72573 17150307 92628 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72574 17150307 92628 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72575 17150307 92628 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 furthermore depletion of gsh decreased mitochondrial function facilitated apoptosis inducing factor aif translocation cytochrome c release and caspase 3 activation and consequently led to motor neuron like cell apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72576 17150307 92629 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 in an als like transgenic mouse model overexpressing mutant g93a sod1 gene we showed that the reduction of gsh in the spinal cord and motor neuron cells is correlated with aif translocation caspase 3 activation and motor neuron degeneration during als like disease onset and progression. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72577 17150307 92634 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations of cu zn superoxide dismutase sod1 gene cause motor neuron degeneration and have linked to 2_amp_#x02013;5% of als cases rosen et al. 1994 ; rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72578 17150307 92646 8857 4624 GSS gsh synthetase gsh synthetase 0 1.0 gsh is synthesized in two sequential enzymatic reactions catalyzed by _amp_#x003b3; glutamylcysteine synthetase _amp_#x003b3; gcs and gsh synthetase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72579 17150307 92699 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the forward and reverse real time pcr primers for amplification of ho 1 transcripts were 5_amp_#x02019; ctcactggcaggaaatcatccc 3_amp_#x02019; and 5_amp_#x02019; gagaggtcacccaggtagcg respectively. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72580 17150307 92710 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after protein concentration measurement western blotting was performed to analyze cytochrome c release. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72581 17150307 92712 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 western analysis was performed to analyze cytochrome c release and aif translocation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72582 17150307 92714 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 after permeabilization with 0.2% triton x 100 in pbs and blocking with 10% goat serum cells were incubated with specific antibodies overnight at 4 _amp_#x000b0;c aif cytochrome c and active caspase 3 antibodies were all at 1:300 dilution; chemicon inc. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72583 17150307 92714 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after permeabilization with 0.2% triton x 100 in pbs and blocking with 10% goat serum cells were incubated with specific antibodies overnight at 4 _amp_#x000b0;c aif cytochrome c and active caspase 3 antibodies were all at 1:300 dilution; chemicon inc. . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72584 17150307 92746 7683 3796 FOS ap 1 ap 1 0 1.0 ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72585 17150307 92746 7683 3796 FOS c fos c fos 0 1.0 ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72586 17150307 92746 10824 6204 JUN c jun c jun 0 1.0 ea treatment enhanced ap 1 transcriptional activation as detected by a luciferase reporter gene assay figure 3a c jun figure 3b and c fos expression data not shown as detected by western analysis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72587 17150307 92747 9462 5013 HMOX1 ho 1 ho 1 0 1.0 similarly gsh depletion also increased ho 1 expression as detected by quantitative real time pcr reaction and western blotting analyses respectively figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72588 17150307 92755 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 results gsh depletion promoted aif redistribution cytochrome c release caspase 3 activation and apoptotic cell death a biochemical assay and an immunohistochemical analysis were used to identify the molecular pathways of cell apoptosis by gsh depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72589 17150307 92755 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 results gsh depletion promoted aif redistribution cytochrome c release caspase 3 activation and apoptotic cell death a biochemical assay and an immunohistochemical analysis were used to identify the molecular pathways of cell apoptosis by gsh depletion. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72590 17150307 92759 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 similarly mitochondrial and cytosolic fractionation coupled with western blotting analysis and immunohistochemistry showed that cytochrome c release was involved in nsc34 cell apoptosis caused by gsh depletion figure 6c 6d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72591 17150307 92761 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 gsh depletion increased caspases 3 activation revealed by immunohistochemical staining with anti active caspase 3 antibody figure 7a_amp_#x02013;7c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72592 17150307 92769 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 decreased gsh was associated with aif nuclear translocation caspase 3 activation and motor neuron cell death figure 9 in als like transgenic mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72593 17150307 92779 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 cytochrome c mediated caspase 3 activation elicited by gsh reduction also contributed to motor neuron cell death apoptosis . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72594 17150307 92779 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c mediated caspase 3 activation elicited by gsh reduction also contributed to motor neuron cell death apoptosis . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72595 17150307 92793 8857 4624 GSS glutathione synthetase glutathione synthetase 0 1.0 gsh is biosynthesized from l glutamate catalyzed by _amp_#x003b3; gcs and glutathione synthetase gs in the cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72596 17150307 92798 7683 3796 FOS ap 1 ap 1 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72597 17150307 92798 7683 3796 FOS c fos c fos 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72598 17150307 92798 10824 6204 JUN c jun c jun 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72599 17150307 92798 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition gsh depletion increased the expression of the early oxidative stress markers c jun c fos data not shown and ap 1 activation figure 3 and secondary oxidative stress markers such as ho 1 expression figure 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72600 17150307 92809 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 the dramatic increase in cytochrome c release to cytosol detected by the fractionation assay and immunohistochemical analysis figure 6b and 6d most likely reflects the increased activation of caspase 3 and consequently contributes to the markedly increased of apoptosis elicited through the reduction of gsh in nsc34 cells figure 7 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72601 17150307 92809 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the dramatic increase in cytochrome c release to cytosol detected by the fractionation assay and immunohistochemical analysis figure 6b and 6d most likely reflects the increased activation of caspase 3 and consequently contributes to the 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72602 17150307 92810 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c mediated caspase activation has also been shown to lead motor neuron degeneration in als like mouse and human als patients guegan et al. 2001 ; li et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72603 17150307 92811 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 discussion decreased gsh is associated with motor neuron degeneration and als like disease onset and progression in the g93a sod1 transgenic mouse model more recently alterations of glutathione s transferase pi activity have been reported in als patients kuzma et al. 2006 ; usarek et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72604 17150307 92811 8877 4638 GSTP1 glutathione s-transferase pi glutathione s transferase pi 0 1.0 discussion decreased gsh is associated with motor neuron degeneration and als like disease onset and progression in the g93a sod1 transgenic mouse model more recently alterations of glutathione s transferase pi activity have been reported in als patients kuzma et al. 2006 ; usarek et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72605 17150307 92817 3544 1516 CAT catalase catalase 0 1.0 more significantly treatment of als like transgenic mice with antioxidants such as sod and catalase mimetics jung et al. 2001 dmpo liu et al. 2002 iron porphyrin wu et al. 2003 or manganese porphyrin crow et al. 2005 delays disease onset and extends survival. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72606 17150307 92844 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 figure 9 redistribution of aif and active caspase 3 in motor neuron cells of als like mice 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72607 17150307 92846 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 aif apoptosis inducing factor als amyotrophic lateral sclerosis bso l buthionine sulfoximine dcf dichlorofluorescin dmem dulbecco_amp_#x02019;s modified eagle_amp_#x02019;s medium ea ethacrynic acid fbs fetal bovine serum _amp_#x 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72608 17150307 92846 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 etal bovine serum _amp_#x003b3; gcs _amp_#x003b3; glutamylcysteine synthetase gsh glutathione gssg oxidized glutathione mbm monobromobimane pfa paraformaldehyde ros reactive oxygen species sod1 cu zn superoxide dismutase tunel terminal deoxynucleotidyl transferase mediated nick end labeling 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 72609 17150307 92847 480 8768 AIFM1 apoptosis-inducing factor apoptosis inducing factor 0 1.0 apoptosis inducing factor|biological markers|enzyme inhibitors|reactive oxygen species|buthionine sulfoximine|ethacrynic acid|glutathione|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74577 17174478 95135 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mutations in a superoxide dismutase which removes oxygen free radicals may cause the neurodegenerative disease amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74578 17174478 95136 24250 12791 WRN werner syndrome werner syndrome 0 1.0 additionally dna repair disorders that affect the brain to varying extents include ataxia telangiectasia like disorder cockayne syndrome or werner syndrome. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74579 17174478 95140 24250 12791 WRN werner syndrome werner syndrome 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74580 17174478 95140 24316 12814 XPA xeroderma pigmentosum xeroderma pigmentosum 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74581 17174478 95140 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74582 17174478 95140 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 keywords: amyotrophic lateral sclerosis ataxia telangiectasia like disorder werner syndrome xeroderma pigmentosum nitric oxide synthase superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74583 17174478 95156 24250 12791 WRN werner syndrome werner syndrome 0 1.0 severe neurodegeneration is clearly apparent in some disorders such as cockayne syndrome lehmann 2003 while more aging related phenotypes are present in others including werner syndrome goto 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74584 17174478 95194 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 tion repair hrdc helicase rnase d conserved domain mmr mismatch repair mrn mre11/rad50/nbs1 mtdna mitochondrial dna ner nucleotide excision repair no nitric oxide e i or nnos endothelial inducible or neuronal nitric oxide synthase nosox nos catalytic oxygenase module nosred nos reductase module nhej nonhomologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription cou 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74585 17174478 95194 24250 12791 WRN werner syndrome werner syndrome 0 1.0 omologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription coupled nucleotide excision repair thm thumb domain ttd trichothiodystropy ws werner syndrome xp xeroderma pigmentosum 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74586 17174478 95194 24316 12814 XPA xeroderma pigmentosum xeroderma pigmentosum 0 1.0 ng ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription coupled nucleotide excision repair thm thumb domain ttd trichothiodystropy ws werner syndrome xp xeroderma pigmentosum 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74588 17174478 95194 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 ide e i or nnos endothelial inducible or neuronal nitric oxide synthase nosox nos catalytic oxygenase module nosred nos reductase module nhej nonhomologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription coupled nucleotide excision repair thm thumb domain ttd trichothiodystropy ws werner syndrome xp xeroderma pigmentosum 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74589 17174478 95195 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74591 17174478 95198 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 most of these free radicals are rapidly scavenged in the cell by the superoxide dismutase sod enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74592 17174478 95216 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74594 17174478 95227 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 ros and copper zinc superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74595 17174478 95232 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase1 0 1.0 however mutations in the superoxide dismutase1 sod1 gene give rise to approximately 20% of fals cases deng et al. 1993 rosen et al. 1993 rakhit et al. 2002 while mutations in several other genes including als2 setx or vapb cause much rarer forms 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74596 17174478 95233 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 sod1 encodes a cytosolic copper zinc superoxide dismutase cu zn sod which similar to the mitochondrial mnsod is responsible for the disproportionation of harmful superoxide radicals to hydrogen peroxide and oxygen fridovich 1986 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74597 17174478 95244 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 cu zn sod with essential cellular components bruijn et al. 1998 johnston et al. 2000 cleveland and rothstein 2001 and this has been demonstrated with the copper chaperone for sod ccs kato et al. 2001 nitric oxide synthase nos and phosphorylated neurofilaments chou et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74598 17174478 95256 3544 1516 CAT catalase catalase 0 1.0 the catalase protein completes the process of eliminating ros by converting hydrogen peroxide into water and oxygen. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74599 17174478 95257 3544 1516 CAT catalase catalase 0 1.0 in addition to this defense against oxidative damage human catalase has roles in ethanol metabolism zimatkin et al. 1998 inflammation halliwell and gutteridge 1984 apoptosis yabuki et al. 1999 aging and cancer miyamoto et al. 1996 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74600 17174478 95260 3544 1516 CAT catalase catalase 0 1.0 several catalase crystal structures have been determined aiding our understanding of reactive oxygen control by defining the reaction and inhibition mechanisms goth 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74601 17174478 95261 3544 1516 CAT catalase catalase 0 1.0 these studies include the definition of the chemistry of the human catalase through structures of the resting state enzyme and complexes of a catalase bound to cyanide and 3at inhibitors putnam et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74602 17174478 95262 3544 1516 CAT catalase catalase 0 1.0 human catalase forms a tetrameric assembly and this may be important to ensure that the active site is sequestered and that the enzyme is competent to complete the reaction. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74603 17174478 95263 3544 1516 CAT catalase catalase 0 1.0 interestingly an unstable catalase isolated from patients homozygous for a swiss type acatalasemia a hereditary catalase deficiency disorder rapidly disassociates into inactive dimers with reduced heme content. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74604 17174478 95264 3544 1516 CAT catalase catalase 0 1.0 this suggests that catalase assembly variants may play roles in disease susceptibility aebi et al. 1974 in addition to nonsense and splicing mutations hirono et al. 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74605 17174478 95265 3544 1516 CAT catalase catalase 0 1.0 from the structural data a mechanism for the recognition and removal of peroxide by catalase has been proposed putnam et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74606 17174478 95268 3544 1516 CAT catalase catalase 0 1.0 catalase uses these two asymmetric interactions with the substrate to prime the otherwise symmetric peroxide bond for heterolytic bond cleavage; good geometry for both iron coordination and hydrogen bond form 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74607 17174478 95271 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ros and nitric oxide synthase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74608 17174478 95277 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 no is a small easily diffusible and transient free radical whose availability is controlled at the synthesis level by the nitric oxide synthase nos enzymes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74609 17174478 95288 16990 9208 POR nadph-dependent cytochrome p450 reductase nadph dependent cytochrome p450 reductase 0 1.0 nosred belongs to a large protein family including nadph dependent cytochrome p450 reductase and sulfite reductase flavoprotein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74611 17174478 95288 16990 9208 POR cytochrome p450 reductase cytochrome p450 reductase 0 1.0 nosred belongs to a large protein family including nadph dependent cytochrome p450 reductase and sulfite reductase flavoprotein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74612 17174478 95293 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ros and nitric oxide synthase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74613 17174478 95309 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 1.0 this model is consistent with the proposed role of the same region in the structurally related cytochrome p450 bm3 sevrioukova et al. 1999 and reminiscent of those found in multiple redox centers containing proteins zhang et al. 1998 lennon et al. 2000 leys et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74614 17174478 95313 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 ros and nitric oxide synthase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74615 17174478 95396 24250 12791 WRN werner syndrome werner syndrome 0 1.0 hereditary mutations in wrn are associated with werner syndrome ws a rare autosomal recessive disorder that gives rise to multiple progeroid pathologies including osteoporosis atherosclerosis and a greatly increased cancer incidence goto 1997 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74616 17174478 95405 1675 1058 BLM bloom syndrome bloom syndrome 0 1.0 mutations in blm and recq4l cause bloom syndrome and rothmund thomson syndrome respectively harrigan et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74617 17174478 95416 22185 23696 TIPARP parp 1 parp 1 0 1.0 rigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74618 17174478 95416 7490 3650 FEN1 fen 1 fen 1 0 1.0 inks to ber include physical and functional interaction with pol_amp_#x003b2; harrigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74619 17174478 95416 16068 270 PARP1 poly (adp-ribose) polymerase poly adp ribose polymerase 0 1.0 ion with pol_amp_#x003b2; harrigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74620 17174478 95416 16068 270 PARP1 poly adp-ribose polymerase 1 poly adp ribose polymerase 1 0 1.0 ion with pol_amp_#x003b2; harrigan et al. 2003 pol_amp_#x003b4; szekely et al. 2000 replication protein a rpa brosh et al. 1999 flap endonuclease 1 fen 1 brosh et al. 2001b pcna lebel et al. 1999 and poly adp ribose polymerase 1 parp 1 von kobbe et al. 2003a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74621 17174478 95420 22185 23696 TIPARP parp 1 parp 1 0 1.0 furthermore wrn has been observed in an endogenous complex with the ku70/80 subunit and poly adp ribose polymerase 1 parp 1 li et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74622 17174478 95420 16068 270 PARP1 poly (adp-ribose) polymerase poly adp ribose polymerase 0 1.0 furthermore wrn has been observed in an endogenous complex with the ku70/80 subunit and poly adp ribose polymerase 1 parp 1 li et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74623 17174478 95420 16068 270 PARP1 poly adp-ribose polymerase 1 poly adp ribose polymerase 1 0 1.0 furthermore wrn has been observed in an endogenous complex with the ku70/80 subunit and poly adp ribose polymerase 1 parp 1 li et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74624 17174478 95421 22185 23696 TIPARP parp 1 parp 1 0 1.0 notably parp 1 binds sites of ssbs and dsbs and is also implicated in the control of genomic integrity and mammalian life span burkle et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74625 17174478 95429 24250 12791 WRN werner syndrome werner syndrome 0 1.0 additionally wrn exonuclease activity is required to fully compliment a werner syndrome dna end joining phenotype in an in vivo plasmid based assay perry et al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74626 17174478 95431 24250 12791 WRN werner syndrome werner syndrome 0 1.0 however werner syndrome cells have mild radiation sensitivity which rules out wrn as an essential dsb repair protein but wrn exonuclease may nevertheless be used for resolution of a limited class of dsbs. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74627 17174478 95444 14656 7983 NR5A1 sf 1 sf 1 0 1.0 the two n terminal domains are helicase lobes that share structural similar to superfamily sf 1 and 2 helicases but have some features unique to the recq family. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74628 17174478 95456 1675 1058 BLM bloom syndrome bloom syndrome 0 1.0 the cysteine side chains are conserved in the recq family and mutations in these residues disrupt recq helicase function and are sufficient to cause bloom syndrome when mutated in blm ellis et al. 1995 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74629 17174478 95466 22185 23696 TIPARP parp 1 parp 1 0 1.0 onuclease domain activity is regulated through the interaction of its c terminus with p53 blander et al. 1999 ku70/80 cooper et al. 2000 li and comai 2000 brosh et al. 2001a karmakar et al. 2002b and parp 1 von kobbe et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74630 17174478 95467 22185 23696 TIPARP parp 1 parp 1 0 1.0 while wrn helicase activity is regulated by c terminal interactions that include trf2 opresko et al. 2002 rad52 baynton et al. 2003 and parp 1 von kobbe et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74631 17174478 95468 7490 3650 FEN1 fen 1 fen 1 0 1.0 an example of wrn stimulation of partner proteins includes the fen 1 partner protein whose structures with dna and pcna have been defined hosfield et al. 1998 chapados et al. 2004 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74632 17174478 95469 7490 3650 FEN1 fen 1 fen 1 0 1.0 wrn interaction that was mapped to the winged helix domain stimulates fen 1 nucleolytic activity by more than 80 fold brosh et al. 2001b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74634 17174478 95478 24316 12814 XPA xeroderma pigmentosum xeroderma pigmentosum 0 1.0 this includes patients with the rare genetic disorders xeroderma pigmentosum xp trichothiodystrophy ttd and cockayne syndrome cs . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74635 17174478 95491 16854 9122 PMS2 dna mismatch repair dna mismatch repair 0 1.0 a small n terminal domain is attached to helicase domain hd1 fig 7 which shares structural similarity to the mismatch recognition domain of the dna mismatch repair protein muts obmolova et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75166 17191135 96090 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 an inducible and redox regulated enzyme has having an important role in cellular antioxidant defense. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75167 17191135 96102 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mccord and fridovich first described superoxide dismutase implying a potential physiological role of superoxide [ 2 ] subsequently confirmed in numerous studies [ 3 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75168 17191135 96104 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in defense against this the cell has developed a number of antioxidant defense systems including superoxide dismutase the peroxidases the glutathione redox cycle with its associated constitutive enzymes as well as glutathione itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75169 17191135 96113 9462 5013 HMOX1 ho 1 ho 1 0 1.0 heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75170 17191135 96113 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 ho 1 also referred to as hsp32 belongs to the hsps family and protects brain cells from oxidative stress by degrading toxic heme into free iron carbon monoxide co and biliverdin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75171 17191135 96116 9462 5013 HMOX1 ho 1 ho 1 0 1.0 fig. 1 a cellular stress response and the interplay between ho 1 and trxr. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75172 17191135 96120 9462 5013 HMOX1 ho 1 ho 1 0 1.0 acetylcarnitine through activation via acetylation of the redox sensitive transcription factor nrf2 and its consequent binding to the antioxidant responsive element are in the ho gene up regulates ho 1 and trxr thus counteracting nitrosative stress and no mediated neurotoxicity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75173 17191135 96122 23454 12435 TXN thioredoxin thioredoxin 0 1.0 oxs oxidative stress; ho 1 heme oxygenase; trxr thioredoxin reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75174 17191135 96122 9462 5013 HMOX1 ho 1 ho 1 0 1.0 oxs oxidative stress; ho 1 heme oxygenase; trxr thioredoxin reductase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75175 17191135 96123 23454 12435 TXN thioredoxin thioredoxin 0 1.0 trx thioredoxin sh reduced form s s oxidized form. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75176 17191135 96124 9462 5013 HMOX1 ho 1 ho 1 0 1.0 b regulation of ho 1 gene. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75177 17191135 96125 12211 6782 MAFK nuclear factor erythroid-2 nuclear factor erythroid 2 0 1.0 nuclear factor erythroid 2 related factor 2 nrf2 is a transcription factor responsible for the induction of several genes related to the cellular stress response including ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75178 17191135 96125 9462 5013 HMOX1 ho 1 ho 1 0 1.0 nuclear factor erythroid 2 related factor 2 nrf2 is a transcription factor responsible for the induction of several genes related to the cellular stress response including ho 1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75179 17191135 96126 11267 25888 KLHL22 kelch-like kelch like 0 1.0 under normal conditions nrf2 is sequestered in the cytoplasm by an actin binding protein kelch like ech associating protein 1 keap1 but upon exposure of cells to oxidative stress nrf2 dissociates from keap1 translocates to the nucleus binds to antioxidant responsive elements ares and activates ho 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75180 17191135 96126 9462 5013 HMOX1 ho 1 ho 1 0 1.0 like ech associating protein 1 keap1 but upon exposure of cells to oxidative stress nrf2 dissociates from keap1 translocates to the nucleus binds to antioxidant responsive elements ares and activates ho 1 gene this review will emphasize the role of free radicals in the pathogenesis of neurodegenerative disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75181 17191135 96127 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in addition the key role played by members of the vitagene system such as ho 1 and thioredoxin fig 1 a in modulating the onset and progression of major neurodegenerative diseases such as ad and pd are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75182 17191135 96127 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition the key role played by members of the vitagene system such as ho 1 and thioredoxin fig 1 a in modulating the onset and progression of major neurodegenerative diseases such as ad and pd are discussed. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75183 17191135 96139 23454 12435 TXN thioredoxin thioredoxin 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75184 17191135 96139 20997 11180 SOD2 mn sod mn sod 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75185 17191135 96139 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 in eukaryotes typical examples are genes such as heme oxygenase thioredoxin and detoxificant enzymes mn sod glutathione s transferase nadph: quinone reductase cytokine immunoreceptors and growth factors. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75186 17191135 96140 9462 5013 HMOX1 ho 1 ho 1 0 1.0 hat the antioxidant protein heme oxygenase could _amp_#8220;sense_amp_#8221; no and thus protect against ros and rns insults is supported by the following findings: a no and no related species induce ho 1 expression and increase heme oxygenase activity in human glioblastoma cells hepatocytes and aortic vascular cells; b cells pre treated with various no releasing molecules acquire increased resistance 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75187 17191135 96141 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 the conception that no and rns can be directly involved in the modulation of ho 1 expression in eukaryotes is based on the evidence that different no releasing agents can markedly increase ho 1 and hsp70 in a variety of tissues including brain cells [ 19 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75188 17191135 96141 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the conception that no and rns can be directly involved in the modulation of ho 1 expression in eukaryotes is based on the evidence that different no releasing agents can markedly increase ho 1 and hsp70 in a variety of tissues including brain cells [ 19 20 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75189 17191135 96142 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 in rat glial cells treatment with lipopolysaccaride lps and interferon g ifn g promotes a rapid increase in both inos expression and nitrite levels followed by enhancement of hsp70 [ 3 20 ] whereas the modulation of ho 1 mrna expression by inos derived no following stimulation with lps has also been reported in different brain regions particularly in the hippocampus and substan 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75190 17191135 96142 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ls treatment with lipopolysaccaride lps and interferon g ifn g promotes a rapid increase in both inos expression and nitrite levels followed by enhancement of hsp70 [ 3 20 ] whereas the modulation of ho 1 mrna expression by inos derived no following stimulation with lps has also been reported in different brain regions particularly in the hippocampus and substantia nigra in an in vivo rat model of sep 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75191 17191135 96143 9462 5013 HMOX1 ho 1 ho 1 0 1.0 moreover the early increase in inos protein levels observed in endothelial cells exposed to low oxygen tension seems to precede the stimulation of ho 1 expression and activity an effect that appears to be finely regulated by redox reactions involving glutathione [ 18 21 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75192 17191135 96144 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 taken together these findings point to a possible role of the no as a signaling molecule which by triggering expression of cytoprotective genes such as ho 1 and hsp70 may lead to adaptation and resistance of brain cells to subsequent more severe nitrosative and oxidative stress [ 21 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75193 17191135 96144 9462 5013 HMOX1 ho 1 ho 1 0 1.0 taken together these findings point to a possible role of the no as a signaling molecule which by triggering expression of cytoprotective genes such as ho 1 and hsp70 may lead to adaptation and resistance of brain cells to subsequent more severe nitrosative and oxidative stress [ 21 23 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75194 17191135 96145 7683 3796 FOS activator protein 1 activator protein 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or nitrosant species might be crucial for deter 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75195 17191135 96145 7683 3796 FOS ap 1 ap 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or nitrosant species might be crucial for determinin 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75196 17191135 96145 9462 5013 HMOX1 ho 1 ho 1 0 1.0 consistent with this several transcription factors that recognize specific binding sites within the promoter and distal enhancer regions of the ho 1 gene such as fos/jun [activator protein 1 ap 1 ] nuclear factor kb nfkb and the more recently identified nrf2 proteins [ 24 26 ] fig 1 b contain cysteine residues whose interaction with oxidant or ni 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75197 17191135 96147 14424 19374 NKRF transcription factor nrf transcription factor nrf 0 1.0 eatment of astrocytes exposed to cytokine induced nitrosative stress restores gsh/gssg ratio and complex iv inhibition an effect associated with up regulation of ho 1 and nuclear translocation of the transcription factor nrf 2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75198 17191135 96147 9462 5013 HMOX1 ho 1 ho 1 0 1.0 acetylcarnitine treatment of astrocytes exposed to cytokine induced nitrosative stress restores gsh/gssg ratio and complex iv inhibition an effect associated with up regulation of ho 1 and nuclear translocation of the transcription factor nrf 2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75199 17191135 96156 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75200 17191135 96156 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75201 17191135 96156 9462 5013 HMOX1 ho 1 ho 1 0 1.0 some of the known hsps include ubiquitin hsp10 hsp27 hsp32 or ho 1 hsp47 hsp60 hsc70 hsp70 or hsp72 hsp90 and hsp100/105. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75202 17191135 96159 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75203 17191135 96159 8888 4646 GTF2A1 glucose regulated protein glucose regulated protein 0 1.0 included in this family are hsc70 heat shock cognate the constitutive form hsp70 the inducible form also referred to as hsp72 grp75 a constitutively expressed glucose regulated protein found in the endoplasmic reticulum . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75204 17191135 96160 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after a variety of central nervous system cns insults hsp70 is synthesized at high levels and is present in cytosol nucleus and endoplasmic reticulum [ 24 32 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75205 17191135 96164 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 after heat shock synthesis of hsp70 may increase to become the most abundant protein in the cell. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75206 17191135 96165 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 once synthesized hsp70 binds to denaturated proteins in an atp dependent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75207 17191135 96169 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increase in hsp70 protein expression was also found after treatment of cells with the no generating compound sodium nitroprusside snp thus suggesting a role for no in inducing hsp70 proteins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75208 17191135 96172 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in these conditions exogenous antioxidant treatment with ferulic acid ethyl ester faee afforded protection of cortical neurons from b amyloid toxicity by acting at three different levels: i inducing ho 1 and hsp72 proteins ii decreasing the neuronal 3 nitrotyrosine levels and therefore inducible nos activity; and iii by the well known direct free radical quenching activity [ 38 ] fig 1 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75209 17191135 96175 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 during translocation this proteins interact with hsp70 atp dependent binding and the release of hsp70 provide the major driving force for complete transport of polypeptides into the matrix. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75210 17191135 96176 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 although most imported polypeptides are released from soluble hsp70 however a subset of aggregation sensitive polypeptides must be transferred from hsp70 to hsp60 for folding [ 40 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75211 17191135 96177 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 owing to the close functional interaction between this chaperonin system and the hsp70 system it is likely that up regulation of hsp60 may be a fundamental site targeted by lac action with consequent restoration of complex iv function under conditions of nitrosative stress dependent pe 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75212 17191135 96177 9718 5261 HSPD1 chaperonin chaperonin 0 1.0 owing to the close functional interaction between this chaperonin system and the hsp70 system it is likely that up regulation of hsp60 may be a fundamental site targeted by lac action with consequent restoration of complex iv function under conditions of nitrosativ 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75213 17191135 96178 9462 5013 HMOX1 ho 1 ho 1 0 1.0 heme oxygenase system until 1997 two heme oxygenase ho isoforms were described: an inducible isoform ho 1 and a constitutive isoform ho 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75214 17191135 96178 9463 5014 HMOX2 ho 2 ho 2 0 1.0 heme oxygenase system until 1997 two heme oxygenase ho isoforms were described: an inducible isoform ho 1 and a constitutive isoform ho 2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75215 17191135 96183 9462 5013 HMOX1 ho 1 ho 1 0 1.0 apart from the identity between the active centers of the enzyme ho 1 and ho 2 broadly differ in cell and tissue regulation and distribution. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75216 17191135 96183 9463 5014 HMOX2 ho 2 ho 2 0 1.0 apart from the identity between the active centers of the enzyme ho 1 and ho 2 broadly differ in cell and tissue regulation and distribution. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75217 17191135 96184 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is induced by various stimuli including ros rns ischemia heat shock lps hemin and the neuroprotective agent neotrofin [ 41 44 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75218 17191135 96185 9462 5013 HMOX1 ho 1 ho 1 0 1.0 furthermore in cultured human cells ho 1 expression can be repressed by hypoxia or by the treatment with interferon g or desferrioxamine [ 47 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75219 17191135 96186 9463 5014 HMOX2 ho 2 ho 2 0 1.0 on the contrary ho 2 the constitutive form is responsive to developmental factors adrenal glucocorticoids [ 41 45 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75220 17191135 96187 9462 5013 HMOX1 ho 1 ho 1 0 1.0 although ho 1 and ho 2 catalyze the same reaction they play different roles in protecting tissues against injuries. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75221 17191135 96187 9463 5014 HMOX2 ho 2 ho 2 0 1.0 although ho 1 and ho 2 catalyze the same reaction they play different roles in protecting tissues against injuries. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75222 17191135 96188 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the current hypothesis suggests that ho 1 induction is one of the earlier cellular responses to tissue damage and is responsible for the rapid transformation of the pro oxidant heme into carbon monoxide co and bilirubin br two molecules with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75223 17191135 96189 9463 5014 HMOX2 ho 2 ho 2 0 1.0 on the contrary ho 2 constitutively expressed is primarily involved in maintaining cell heme homeostasis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75224 17191135 96191 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the induction of ho 1 is regulated principally by two upstream enhancers e1 and e2 [ 52 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75225 17191135 96193 14345 7782 NFE2L2 nf e2 nf e2 0 1.0 there is now evidence to suggest that heterodimers of nf e2 related factors 2 nrf2 and one or another of the small maf proteins i.e mafk maff and mafg are directly involved in induction of ho 1 gene through these mares [ 53 ]. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 14343 7780 NFE2 0 75226 17191135 96193 9462 5013 HMOX1 ho 1 ho 1 0 1.0 there is now evidence to suggest that heterodimers of nf e2 related factors 2 nrf2 and one or another of the small maf proteins i.e mafk maff and mafg are directly involved in induction of ho 1 gene through these mares [ 53 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75227 17191135 96195 9462 5013 HMOX1 ho 1 ho 1 0 1.0 hence regulation of ho 1 gene expression by bach1 and heme occurs through antagonism between transcription activators and the repressor bach1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75228 17191135 96196 14345 7782 NFE2L2 nf e2 nf e2 0 1.0 mal physiological conditions expression of ho 1 is repressed by bach1/maf complex while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with the transcriptional promotion of ho 1 [ 33 ]. 7 JUMiner_v2.2 2 1 UserEdit 0 0 0 1 1 14343 7780 NFE2 0 75229 17191135 96196 9462 5013 HMOX1 ho 1 ho 1 0 1.0 under normal physiological conditions expression of ho 1 is repressed by bach1/maf complex while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75230 17191135 96196 9462 5013 HMOX1 ho 1 ho 1 0 1.0 x while increased levels of heme displace bach1 from the enhancers and allow activators such as heterodimer of maf with nf e2 related activators nrf2 to interact with the transcriptional promotion of ho 1 [ 33 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75231 17191135 96200 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in the rat brain bvr is co expressed in cells that display ho 1 and/or ho 2 under normal conditions as well as in regions and cell types that have the potential to express heat shock inducible ho 1 protein [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75232 17191135 96200 9463 5014 HMOX2 ho 2 ho 2 0 1.0 in the rat brain bvr is co expressed in cells that display ho 1 and/or ho 2 under normal conditions as well as in regions and cell types that have the potential to express heat shock inducible ho 1 protein [ 57 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75233 17191135 96203 9463 5014 HMOX2 ho 2 ho 2 0 1.0 heme oxygenase 1 is ubiquitary and particularly abundant in reticuloendothelial organs such as liver and spleen whereas ho 2 is localized in specific organs such as brain kidney and testis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75234 17191135 96203 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is ubiquitary and particularly abundant in reticuloendothelial organs such as liver and spleen whereas ho 2 is localized in specific organs such as brain kidney and testis [ 44 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75235 17191135 96204 9463 5014 HMOX2 ho 2 ho 2 0 1.0 the cns is endowed with very high ho activity under basal conditions mostly accounted for by ho 2 the latter being expressed in neuronal populations in forebrain hippocampus hypothalamus midbrain basal ganglia thalamus cerebellum and brainstem. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75236 17191135 96206 9462 5013 HMOX1 ho 1 ho 1 0 1.0 this finding indicates that the activation of ho 1 and the following formation of co can be induced by many noxious stimuli within the nuclei that are primarily involved in the central regulation of the stress response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75237 17191135 96208 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 heme oxygenase 1 is also found within cells of glial lineage where its gene expression can be induced by oxidative stress [ 58 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75238 17191135 96213 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the thioredoxin system the thioredoxin trx system trx and trx reductase has received a considerable attention in the last years as a stress responsive gene [ 60 ] fig 1 a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75239 17191135 96215 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 originally identified in escherichia coli in 1964 as a hydrogen donor for ribonucleotide reductase required for dna synthesis trx plays an essential role in cell function by limiting oxidative stress directly via antioxidant effects and indirectly by protein protein interactions [ 61 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75240 17191135 96217 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 in fact trx and gsh systems are involved in a variety of redox dependent pathways such as supplying reducing equivalents for ribonucleotide reductase the first step in dna biosynthesis and peptide methionine sulfoxide reductase an enzyme involved in antioxidant defenses and regulation of the cellular redox state [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75241 17191135 96217 19183 10451 RRM1 ribonucleotide reductase ribonucleotide reductase 0 1.0 in fact trx and gsh systems are involved in a variety of redox dependent pathways such as supplying reducing equivalents for ribonucleotide reductase the first step in dna biosynthesis and peptide methionine sulfoxide reductase an enzyme involved in antioxidant defenses and regulation of the cellular redox state [ 60 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75242 17191135 96221 23454 12435 TXN thioredoxin thioredoxin 0 1.0 thioredoxin itself is kept in a reduced form by trxr and nadph collectively known as the trx system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75243 17191135 96236 23454 12435 TXN thioredoxin thioredoxin 0 1.0 trx 1 and trxr the most extensively studied eukaryotic thioredoxin proteins were first localized immunohistochemically in the rat sciatic nerve. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75244 17191135 96239 22027 11742 TFAP2A ap 2 ap 2 0 1.0 ene contains a series of stress responsive elements various transcription factor binding sites such as sp1 gcf and wt zfp conferring constitutive expression inducible expression elements such as ap 1 ap 2 nf kb oct 1 pea 3 myb and the antioxidant responsive element are [ 71 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75245 17191135 96239 7683 3796 FOS ap 1 ap 1 0 1.0 trx gene contains a series of stress responsive elements various transcription factor binding sites such as sp1 gcf and wt zfp conferring constitutive expression inducible expression elements such as ap 1 ap 2 nf kb oct 1 pea 3 myb and the antioxidant responsive element are [ 71 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75246 17191135 96243 7683 3796 FOS ap 1 ap 1 0 1.0 in has been reported to cause the translocation of trx from the cytoplasm to the nucleus where it regulates the redox activation and dna binding activity of critical transcription factors such as the ap 1 family members nf kb jun fos p53 creb pebp2/cbf myb all involved in fundamental processes such as gene expression cell growth and apoptosis [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75247 17191135 96248 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 ngf a neurotrophic factor regulating development maintenance and function of the cns has been shown to activate trx 1 expression via cyclic amp camp response elements cres present in the trx 1 gene promoter and also to induce 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75248 17191135 96249 9462 5013 HMOX1 ho 1 ho 1 0 1.0 that beyond its ability to regulate the function of proteins through thiol disulfide exchange reactions trx may also have beneficial effects during oxidative stress by transcriptionally upregulating ho 1 with important cytoprotective pleiotropic effects deriving from heme degradation biliverdin and bilirubin formation as well as carbon monoxide generation [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75249 17191135 96254 23454 12435 TXN thioredoxin thioredoxin 0 1.0 the prxs also called thioredoxin peroxidases are a relatively newly discovered family of antioxidant enzymes most of which use the reducing activity of trx or other electron donors to catalyze the reduction of peroxides including h 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75250 17191135 96269 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 onal changes of the protein and ubiquitination clearing misfolded proteins to the proteasome and segregation of tau aggregates from the cellular machinery and recruitment of chaperone pairs including hsp70 and hsp27 endowed with anti apoptotic properties [ 85 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75251 17191135 96270 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 binding of phosphorylated tau to hsp70 implies that the complex may be a substrate for the e3 ligase carboxyl terminus of heat shock cognate hsc 70 interacting protein chip [ 86 88 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75252 17191135 96271 19134 10417 RPS27A ubiquitin ubiquitin 0 1.0 chip_amp_#8217;s is a ubiquitin e3 ligase that can collaborate with molecular chaperones to facilitate protein folding and prevent protein aggregation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75253 17191135 96272 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 together with hsp70 chip can regulate tau ubiquitination and degradation in a cell culture system [ 87 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75254 17191135 96273 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 increased levels of chip and hsp70 has ben detected in ad compared with normal controls [ 86 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75255 17191135 96279 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 mass spectrometry analysis of proteins that specifically coimmunoprecipitate with ab has identified chaperone proteins such as hsp70 and alpha b crystallin related small hsp hsp16 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75256 17191135 96281 9462 5013 HMOX1 ho 1 ho 1 0 1.0 recently the involvement of ho 1 in the antidegenerative mechanisms operating in ad has received considerable attention as it has been demonstrated that the amyloid precursor protein app decreases ho activity thus reducing the intra 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75257 17191135 96282 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 induction which occurs together with the induction of other stress proteins during various physiopathological conditions represents a strong protective system potentially active against brain oxidati 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75258 17191135 96283 9462 5013 HMOX1 ho 1 ho 1 0 1.0 significant increases in the levels of ho 1 have been observed in ad brains in association with neurofibrillary tangles and also ho 1 mrna was found increased in ad neocortex and cerebral vessels [ 92 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75259 17191135 96284 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [ 94 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75260 17191135 96284 9462 5013 HMOX1 ho 1 ho 1 0 1.0 ho 1 increase was not only in association with neurofibrillary tangles but also co localized with senile plaques and glial fibrillary acidic protein positive astrocytes in ad brains [ 94 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75261 17191135 96285 12369 6893 MAPT tau protein tau protein 0 1.0 in addition takeda et al. explored the relationship between ho 1 and tau protein this latter being the major component of intraneuronal neurofibrillary tangles in ad [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75262 17191135 96285 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition takeda et al. explored the relationship between ho 1 and tau protein this latter being the major component of intraneuronal neurofibrillary tangles in ad [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75263 17191135 96286 12369 6893 MAPT tau protein tau protein 0 1.0 in transfected neuroblastoma cells overexpressing ho 1 the activity of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense ho 1 or vector transfected cells [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75264 17191135 96286 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in transfected neuroblastoma cells overexpressing ho 1 the activity of this enzyme was increased and conversely the level of tau protein was significantly decreased when compared with antisense ho 1 or vector transfected cells [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75265 17191135 96287 12369 6893 MAPT tau protein tau protein 0 1.0 the suppression of tau protein expression was almost completely counteracted by zinc deuteroporphyrin a specific inhibitor of ho activity [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75266 17191135 96288 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the activated forms of erks extracellular signal regulated kinases were also decreased in cells overexpressing ho 1 although no changes in the expression of total erks were observed [ 93 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75267 17191135 96291 9462 5013 HMOX1 ho 1 ho 1 0 1.0 consistently recent data from our laboratory has provided clear evidence in the inferior parietal brain of ad patients of a significant increase in the expression of ho 1 and trxr whereas this latter was not increased in the cerebellum of ad brains compared to controls [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75268 17191135 96294 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 in addition ad lymphocytes showed an increased expression of inducible nitric oxide synthase ho 1 hsp72 hsp60 and trxr [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75269 17191135 96294 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition ad lymphocytes showed an increased expression of inducible nitric oxide synthase ho 1 hsp72 hsp60 and trxr [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75270 17191135 96301 23454 12435 TXN thioredoxin thioredoxin 0 1.0 these observations strongly support a role for nitrosative stress in the pathogenesis of ad and indicate that the stress responsive genes such as heme oxygenase and thioredoxin reductase may represent important targets for novel cytoprotective strategies [ 96 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75271 17191135 96302 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the protective role played by ho 1 in ad in fact raises new possibilities regarding the use of natural substances which are able to increase ho 1 levels as potential drugs for the treatment of ad. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75272 17191135 96306 9462 5013 HMOX1 ho 1 ho 1 0 1.0 in addition curcumin has been shown to significantly increase ho 1 in astrocytes and vascular endothelial cells [ 100 101 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75273 17191135 96307 9462 5013 HMOX1 ho 1 ho 1 0 1.0 this latter effect on ho 1 can explain at least in part the strong antioxidant properties of curcumin in particular keeping in mind that ho 1 derived br has the ability to efficiently scavenge both ros and rns [ 8 11 13 99 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75274 17191135 96322 1316 841 ATP5G1 atp synthase lipid-binding protein atp synthase lipid binding protein 0 1.0 bundant ones it has reported that lac modulates specific genes in the rat cns such as the hsp72 gene the gene for the isoform of 14 3 3 protein and that encoding for the precursor mitochondrial p3 of atp synthase lipid binding protein [ 107 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75275 17191135 96324 9462 5013 HMOX1 heme oxygenase 1 heme oxygenase 1 0 1.0 these results have shown for the first time that acetylcarnitine induces heme oxygenase 1 and hsp60 heat shock proteins with a mechanism involving activation and nuclear translocation of the transcription factor nrf2 [ 27 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75276 17191135 96326 20997 11180 SOD2 mn sod mn sod 0 1.0 e alone in unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75277 17191135 96326 8865 25806 GSTCD glutathione s-transferase glutathione s transferase 0 1.0 unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75278 17191135 96326 9462 5013 HMOX1 ho 1 ho 1 0 1.0 is conceivable that acetylcarnitine alone in unstressed conditions by promoting acetylation of dna binding proteins may modulate are mediated expression of stress inducible genes [ 107 124 ] such as ho 1 g glutamylcysteine synthetase mn sod and glutathione s transferase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75279 17191135 96354 9462 5013 HMOX1 ho 1 ho 1 0 1.0 the evidence that phenolic compounds such as curcumin and ferulic acid can induce ho 1 and trxr and thus reduce ad strongly indicates the therapeutic potential of nutritional compounds against nd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75286 17192933 96373 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 correction of humoral derangements from mutant superoxide dismutase 1 spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75287 17192933 96379 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 mt spinal cord organotypic slices secreted higher levels of nitric oxide interleukin il 1beta il 6 and il 12p70 and lower levels of vascular endothelial growth factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75288 17192933 96379 10463 6018 IL6 il 6 il 6 0 1.0 mt spinal cord organotypic slices secreted higher levels of nitric oxide interleukin il 1beta il 6 and il 12p70 and lower levels of vascular endothelial growth factor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75289 17192933 96380 23910 12680 VEGFA vascular endothelial growth factor vascular endothelial growth factor 0 1.0 the toxicity of mt spinal cord organotypic cultures was reduced and axonal lengths were restored to near normal by coculturing in the presence of reactive oxygen species scavenger vascular endothelial growth factor and neutralizing antibodies to il 1beta il 6 and il 12. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 75290 17192933 96380 10463 6018 IL6 il 6 il 6 0 1.0 reduced and axonal lengths were restored to near normal by coculturing in the presence of reactive oxygen species scavenger vascular endothelial growth factor and neutralizing antibodies to il 1beta il 6 and il 12. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67824 17317654 85964 78 61 ABCD1 adrenoleukodystrophy adrenoleukodystrophy 0 1.0 the x linked adrenoleukodystrophy x ald and oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 67825 17317654 85970 78 61 ABCD1 adrenoleukodystrophy adrenoleukodystrophy 0 1.0 the aim of the present study was to review the literature concerning the advances in the treatment of x adrenoleukodystrophy x ald omim # 300100 in the last two decades and to shed more light on the link between oxidative stress and x ald. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70643 17368952 89802 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 effort to study the role of reactive species in amyotrophic lateral sclerosis als the goal of this work is to explore the correlation between nitration and oxidation of proteins and mutation of cu zn superoxide dismutase sod1 in als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70644 17368952 89803 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 transgenic mice overexpressing the mutant cu zn superoxide dismutase msod1 gene from humans with familial als wild type mice overexpressing the normal human sod1 gene and normal mice without gene overexpression were used. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70645 17368952 89816 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the discovery of mutation of the cu zn superoxide dismutase sod1 gene in familial als patients deng et al 1993 and rosen et al 1993 was the first breakthrough in identifying causes of familial als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70646 17368952 89817 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 to explore how mutant cu zn superoxide dismutase msod1 causes als a transgenic mouse model was established by introducing a human mutant gly 93_amp_#x2192;ala g93a of the sod1 gene into the mouse gurney et al. 1994 ; these transgenic mice developed 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70647 17368952 89820 3544 1516 CAT catalase catalase 0 1.0 superoxide dismutase sod is a major antioxidative defense enzyme converting superoxide anion o 2 _amp_#xb7; _amp_#x2212; to hydrogen peroxide h 2 o 2 which is reduced to h 2 o by catalase and selenium dependent glutathione peroxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70648 17368952 89820 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase sod is a major antioxidative defense enzyme converting superoxide anion o 2 _amp_#xb7; _amp_#x2212; to hydrogen peroxide h 2 o 2 which is reduced to h 2 o by catalase and selenium dependent glutathio 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 70649 17368952 89833 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 expression of inducible _amp_#xb7; nitric oxide synthase nos increases during the development of als in the g93a transgenic mice compared with normal sod1 mice and nc mice almer et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54605 17496232 67630 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 on the contrary lack of no disrupts pathways like s nitrosylation or h 2 o 2 production and likewise is a gateway to disease in amyotrophic lateral sclerosis with superoxide dismutase 1 mutations or to cancer proliferation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54606 17496232 67631 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 peroxynitrite; hydrogen peroxide; mitochondrial nitric oxide synthase; mitogen activated protein kinase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54607 17496232 67638 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 transcriptional increase of neuronal nitric oxide synthase nnos determines extensive binding to complex i and iv and contributes to hypothyroid phenotype. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54609 17496232 67641 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 mw molecular weight; mnsod manganese superoxide dismutase; 2d two dimensional. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54612 17496232 67648 864 576 APAF1 apoptotic protease activating factor 1 apoptotic protease activating factor 1 0 1.0 no and h 2 o 2 release and activation of intrinsic programmed cell death via apoptotic protease activating factor 1 and activation of p53. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54613 17496232 67649 1576 990 BCL2 bcl 2 bcl 2 0 1.0 increased no and onoo result in dna damage p53 accumulation increased bax/bcl 2 cytochrome c cyt c release and caspase activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54614 17496232 67649 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 increased no and onoo result in dna damage p53 accumulation increased bax/bcl 2 cytochrome c cyt c release and caspase activation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54615 17496232 67662 5902 2903 DLG4 psd 95 psd95 0 1.0 these enzymes are bound to anchoring proteins in cell membrane caveolin and in synaptic vesicles psd95 in skeletal and cardiac muscles dystrophin and to heat shock protein hsp 90 or 70 chaperones 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54616 17496232 67662 5927 2928 DMD dystrophin dystrophin 0 1.0 these enzymes are bound to anchoring proteins in cell membrane caveolin and in synaptic vesicles psd95 in skeletal and cardiac muscles dystrophin and to heat shock protein hsp 90 or 70 chaperones 79 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54617 17496232 67663 5927 2928 DMD dystrophin dystrophin 0 1.0 the interaction with these proteins may involve different effects: 1 increased hsp90 nos or decreased caveolin nos enzyme activity 2 modified subcellular traffic dystrophin impedes nos i traffic to mitochondria 76 and 3 participation in ubiquitination and degradation 54 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54618 17496232 67666 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in contrast nos ii is not constitutive and does not depend on ca concentration; nos ii gene expression is modulated by inflammatory mediators like cytokines tnf alpha ifn gamma and lps that activate transcription factors like nf kappab or ap 1 59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54619 17496232 67666 7683 3796 FOS ap 1 ap 1 0 1.0 and does not depend on ca concentration; nos ii gene expression is modulated by inflammatory mediators like cytokines tnf alpha ifn gamma and lps that activate transcription factors like nf kappab or ap 1 59 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54620 17496232 67670 12416 6915 MB myoglobin myoglobin 0 1.0 most no binds to cytosolic compounds like myoglobin 35 111 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54621 17496232 67705 20997 11180 SOD2 manganese superoxide dismutase manganese superoxide dismutase 0 1.0 in the presence of mitochondrial manganese superoxide dismutase mnsod most of o 2 is dismutated to h 2 o 2 which is freely diffusible to cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54623 17496232 67709 14631 2874 NQO1 nadh dehydrogenase nadh dehydrogenase 0 1.0 cordingly at 0.3 0.5 microm no inhibits electron transfer between cytochromes b and c 1 in the respiratory chain 108 111 whereas relatively prolonged 0.5 1 microm no exposure selectively inhibits the nadh dehydrogenase activity at mitochondrial complex i in intact cells 50 and isolated mitochondria 120 a hallmark of neurodegenerative experimental or clinical entities like parkinson disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54624 17496232 67715 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in agreement supplementation of submitochondrial particles with complex i or complex ii substrates increases by 10 to 20 fold no utilization; in contrast addition of superoxide dismutase sod decreases no utilization and prolongs its mean life and increases h 2 o 2 110 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54625 17496232 67726 3544 1516 CAT catalase catalase 0 1.0 because peroxisomes contain the highest concentration of catabolizing catalase mitochondria with very low levels of degrading enzymes are accepted as the main source of o 2 species 17 33 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54627 17496232 67729 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 1.0 otherwise enzymes that catabolize h 2 o 2 catalase gluthatione peroxidase gpx; reactions 6 and 7 and thioredoxin peroxidase trx; reaction 8 are preferentially distributed in cytosol and peroxisomes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54628 17496232 67729 3544 1516 CAT catalase catalase 0 1.0 otherwise enzymes that catabolize h 2 o 2 catalase gluthatione peroxidase gpx; reactions 6 and 7 and thioredoxin peroxidase trx; reaction 8 are preferentially distributed in cytosol and peroxisomes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54629 17496232 67737 3544 1516 CAT catalase catalase 0 1.0 considering the reduction to h 2 o by liver cytosolic gpx and catalase at the respective concentrations of 2.7 x 10 m and 1.2 x 10 m and the rate constants for reactions 7 and 8 the no dependent [h 2 o 2 ] ss could be calculated as follows 17 : 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54630 17496232 67740 3544 1516 CAT catalase catalase 0 1.0 lation of [h 2 o 2 ] ss implies an effective regulation of the different pathways participating in the process including the concentration and activities of mtnos cytosolic classic nos isoforms mnsod catalase and peroxidases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54631 17496232 67751 3544 1516 CAT catalase catalase 0 1.0 in this study cells were reverted to a normal phenotype by cotransfection with catalase and the authors concluded that a major role of h 2 o 2 is to activate genes related to the proliferating cascade. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54632 17496232 67757 7683 3796 FOS ap 1 ap 1 0 1.0 erks stimulate cell proliferation and induction of active cyclin d 1 by different mechanisms including the enhancement of ap 1 activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54633 17496232 67769 19050 10436 RPS6KB1 p70 s6k p70 s6k 0 1.0 another mechanism is the activation of specific phosphorylation cascades that participate in the progression of the cell cycle; for instance h 2 o 2 acts as a messenger in growth factor induced p70 s6k signaling pathway in mouse epidermal cells which plays an important role in the transition from g 0 /g 1 to s phase of the cell cycle 9 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54634 17496232 67773 5008 2432 CSF1 macrophage colony stimulating factor macrophage colony stimulating factor 0 1.0 activation of a myeloid leukemia cell line tf 1a by granulocyte/macrophage colony stimulating factor induced only a transient activation of mek and erk1/2 and 50% increase in cell proliferation whereas prolonged stimulation with 10 to 10 m pma underwent 91 98% cell differentiation without proliferat 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54635 17496232 67776 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the proapoptotic effects depend on translocation of bax to mitochondria and generation of ros and ultimately on the release of cytochrome c but in a caspase independent manner. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54636 17496232 67793 1576 990 BCL2 bcl 2 bcl 2 0 1.0 some antiapoptotic effects include s nitrosylation and inhibition of caspases increase of hsps and bcl 2 and activation of akt/pkb which induces cytoprotective gene expression through nf kappab activation 85 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54637 17496232 67796 1576 990 BCL2 bcl 2 bcl 2 0 1.0 on the other hand proapoptotic effects of no include inhibition of nf kappab decreased bcl 2 expression 87 89 118 and increased p53 expression both by no mediated inhibition of proteasome degradation and by direct dna damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54638 17496232 67807 14631 2874 NQO1 nadh dehydrogenase nadh dehydrogenase 0 1.0 similar to the nadh dehydrogenase site of electron leak forming complex i being directed into the matrix side of the inner mitochondrial membrane in mitochondria o 2 can be detoxified by matrix antioxidant defense systems. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54639 17496232 67840 3544 1516 CAT catalase catalase 0 1.0 isolated neonatal hepatocytes supplemented with h 2 o 2 catalase inhibitor 3 amino 1 2 4 triazole or l arginine invariably determined a dose dependent negative modulation of cell proliferation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54640 17496232 67851 1576 990 BCL2 bcl 2 bcl 2 0 1.0 caspases are cysteine proteases that cleave specific aspartate residues in other regulatory proteins like bcl 2 bax and mekk for review see ref 83 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54641 17496232 67852 22551 11892 TNF tnf alpha tnf alpha 0 1.0 in the extrinsic pathway binding of membrane ligands like tnf alpha and fas to membrane receptors triggers the activation of caspases and the induction of apoptosis 6 106 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54643 17496232 67853 864 576 APAF1 apoptotic protease activating factor 1 apoptotic protease activating factor 1 0 1.0 in the intrinsic program mitochondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54644 17496232 67853 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 elease of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54645 17496232 67853 3534 1511 CASP9 caspase 9 caspase 9 0 1.0 hondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54646 17496232 67853 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the intrinsic program mitochondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54647 17496232 67861 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 no can directly induce cytochrome c release through mitochondrial membrane potential loss 46 or by tyrosine nitration of cytochrome c 67 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54648 17496232 67862 3527 1504 CASP3 caspase 3 caspase 3 0 1.0 no donors or endogenous no induces apoptotic cell death with the activation of jnk/sapk and p38 mapk and caspase 3 or inactivation of nf kappab. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54649 17496232 67868 1576 990 BCL2 bcl 2 bcl 2 0 1.0 disruption of the nf kappab gene is associated with embryo lethality; many antiapoptotic pathways like bcl 2 are induced by nf kappab. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54650 17496232 67872 1578 992 BCL2L1 bcl xl bcl xl 0 1.0 no mediated p53 accumulation induces cell cycle arrest by p21 upregulation or apoptosis by increase in bax/bcl xl cytochrome c release and caspase activation 100 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54651 17496232 67872 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 no mediated p53 accumulation induces cell cycle arrest by p21 upregulation or apoptosis by increase in bax/bcl xl cytochrome c release and caspase activation 100 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54652 17496232 67874 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 on the other hand no has antiapoptotic effects that can be associated with cgmp production which suppresses mitochondrial cytochrome c release ceramide generation and caspase activation 46 77 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54653 17496232 67875 9691 5232 HSPA1A hsp 70 hsp70 0 1.0 other antiapoptotic no pathways include s nitrosylation and inactivation of caspases thiols and upregulation of antiapoptotic genes like that of heme oxygenase 127 and hsp70 which protects hepatocytes from apoptosis induced by oxidative and nitrative stress 46 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59793 17584954 75221 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 mitochondria; reactive oxygen species; amyotrophic lateral sclerosis; copper zinc superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59795 17584954 75259 551 399 ALB serum albumin serum albumin 0 1.0 the resulting pellet was washed once in modified chappell perry buffer with 0.5% bovine serum albumin and once in modified chappell perry buffer without bovine serum albumin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59797 17584954 75313 4996 2422 CS citrate synthase citrate synthase 0 1.0 mple genes encoding the mitochondrial respiratory chain and the tca cycle are significantly downregulated following denervation 48 60 66 and the levels of cytochrome c oxidase succinate dehydrogenase citrate synthase and cardiolipin are significantly lowered 8 14 days after denervation 18 82 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59799 17584954 75313 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 1.0 for example genes encoding the mitochondrial respiratory chain and the tca cycle are significantly downregulated following denervation 48 60 66 and the levels of cytochrome c oxidase succinate dehydrogenase citrate synthase and cardiolipin are significantly lowered 8 14 days after denervation 18 82 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59800 17584954 75322 8118 4141 GAPDH glyceraldehyde 3-phosphate dehydrogenase glyceraldehyde 3 phosphate dehydrogenase 0 1.0 in fact increased ros production following denervation is mirrored by decreases in surface hydrophobicity and enzymatic activity of glyceraldehyde 3 phosphate dehydrogenase and creatine kinase 64 possibly due to increased oxidative damage 63 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59801 17584954 75322 4423 1991 CKB creatine kinase creatine kinase 0 1.0 in fact increased ros production following denervation is mirrored by decreases in surface hydrophobicity and enzymatic activity of glyceraldehyde 3 phosphate dehydrogenase and creatine kinase 64 possibly due to increased oxidative damage 63 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59803 17584954 75327 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 1.0 mitochondrial ros has also been shown to lead to upregulation of the expression of ubiquitin ligase atrogin 1/mafbx 53 and could therefore contribute to atrophy through increased degradation of proteins by the 26s proteasome system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59804 17584954 75327 7405 16731 FBXO32 atrogin 1 atrogin 1 0 1.0 mitochondrial ros has also been shown to lead to upregulation of the expression of ubiquitin ligase atrogin 1/mafbx 53 and could therefore contribute to atrophy through increased degradation of proteins by the 26s proteasome system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49405 17634371 61544 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 nerve growth factor ngf can induce apoptosis by signaling through the p75 neurotrophin receptor p75 in several nerve cell populations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49406 17634371 61544 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 nerve growth factor ngf can induce apoptosis by signaling through the p75 neurotrophin receptor p75 in several nerve cell populations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49407 17634371 61546 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the present study we show that p75 mediated apoptosis in motor neurons involved neutral sphingomyelinase activation increased mitochondrial superoxide production and cytochrome c release to the cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49409 17634371 61548 20996 11179 SOD1 superoxide dismutase 1 superoxide dismutase 1 0 1.0 in motor neurons overexpressing the amyotrophic lateral sclerosis als linked superoxide dismutase 1 sod1 mutation ngf induced apoptosis even in the absence of an external source of no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49410 17634371 61549 12211 6782 MAFK nuclear factor erythroid-2 nuclear factor erythroid 2 0 1.0 the increased susceptibility of sod1 motor neurons to ngf was associated to decreased nuclear factor erythroid 2 related factor 2 nrf2 expression and downregulation of the enzymes involved in glutathione biosynthesis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49411 17634371 61554 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 key words: amyotrophic lateral sclerosis; mitochondria; motor neurons; nerve growth factor; nrf2; p75 ; superoxide 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49412 17634371 61555 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 nerve growth factor ngf has a key role on the development and function of the nervous system snider 1994 ; chao 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49413 17634371 61557 1624 1033 BDNF neurotrophin neurotrophin 0 1.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49414 17634371 61557 14738 8031 NTRK1 tyrosine kinase receptor tyrosine kinase receptor 0 1.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barr 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49417 17634371 61557 3889 11919 CD40 tumor necrosis factor receptor superfamily tumor necrosis factor receptor superfamily 0 1.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49418 17634371 61560 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 induction of p75 renders motor neurons vulnerable to ngf induced apoptosis. p75 has been implicated in motor neuron death occurring in transgenic mice overexpressing mutant cu zn superoxide dismutase sod1 lowry et al. 2001b ; copray et al. 2003 ; kust et al. 2003 ; turner et al. 2003a b or after axotomy ferri et al. 1998 ; wiese et al. 1999 ; lowry et al. 2001a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49419 17634371 61563 12211 6782 MAFK nuclear factor erythroid-2 nuclear factor erythroid 2 0 1.0 astrocytes can protect motor neurons against p75 induced apoptosis by the activation of the transcription factor nuclear factor erythroid 2 related factor 2 nrf2 which increases antioxidant defenses vargas et al. 2006 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49420 17634371 61565 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 the death pathway is not completely elucidated but is associated with activation of c jun n terminal kinase jnk release of cytochrome c from mitochondria and subsequent activation of caspases 9 6 and 3 casaccia bonnefil et al. 1996 ; yoon et al. 1998 ; wang et al. 2001 ; bhakar et al. 2003 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49421 17634371 61565 10824 6204 JUN c jun c jun 0 1.0 the death pathway is not completely elucidated but is associated with activation of c jun n terminal kinase jnk release of cytochrome c from mitochondria and subsequent activation of caspases 9 6 and 3 casaccia bonnefil et al. 1996 ; yoon et al. 1998 ; wang et al. 2001 ; bhakar et al. 200 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49422 17634371 61568 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ceramide could be a mediator of apoptosis by acting directly or indirectly on mitochondria where it can dissipate the membrane potential promote cytochrome c release and induce reactive oxygen species ros production garcia ruiz et al. 1997 ; gudz et al. 1997 ; quillet mary et al. 1997 ; mansat de mas et al. 1999 ; birbes et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49423 17634371 61576 14727 8023 NTF3 ngf 2 ngf 2 0 1.0 mouse ngf 2.5s was obtained from harlan madison wi recombinant human soluble fas ligand and tert butylhydroquinone tbhq from alexis san diego ca and primers from integrated dna technologies coralville ia . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49424 17634371 61576 7334 11936 FASLG fas ligand fas ligand 0 1.0 mouse ngf 2.5s was obtained from harlan madison wi recombinant human soluble fas ligand and tert butylhydroquinone tbhq from alexis san diego ca and primers from integrated dna technologies coralville ia . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49426 17634371 61587 8240 4232 GDNF glial cell line derived neurotrophic factor glial cell line derived neurotrophic factor 0 1.0 motor neuron survival was maintained by the addition of glial cell line derived neurotrophic factor gdnf 1 ng/ml; sigma to the culture media. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49427 17634371 61597 7334 11936 FASLG fas ligand fas ligand 0 1.0 soluble fas ligand was added in the presence of enhancer antibody 1 microg/ml 16 h after motor neuron plating. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49428 17634371 61609 14533 7872 NOS1 neuronal nitric oxide synthase neuronal nitric oxide synthase 0 1.0 gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaagatcctgaccgagcgtg 3' and 5' tctgctggaaggtggacagtgagg 3' 497 bp . p75 primers were from promega madison wi . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49430 17634371 61609 8204 4311 GCLC glutamate-cysteine ligase glutamate cysteine ligase 0 1.0 pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcc 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49431 17634371 61609 8204 4311 GCLC glutamate-cysteine ligase glutamate cysteine ligase 0 1.0 modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49432 17634371 61609 8204 4311 GCLC glutamate-cysteine ligase, catalytic subunit glutamate cysteine ligase catalytic subunit 0 1.0 f2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaag 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49433 17634371 61609 8205 4312 GCLM glutamate-cysteine ligase modifier subunit glutamate cysteine ligase modifier subunit 0 1.0 pcr primers specific to each gene are as follows: nrf2 5' ttcctctgctgccattagtcagtc 3' and 5' gctcttccatttccgagtcactg 3' 242 bp ; glutamate cysteine ligase modifier subunit gclm 5' aatcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49434 17634371 61632 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 after 12 h cultures were fixed as described above and processed for cytochrome c immunolabeling using alexa fluor 488 cytochrome c apoptosis detection kit from invitrogen. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49435 17634371 61652 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the present study we found that the p75 apoptotic pathway in motor neurons involved increased ceramide production and cytochrome c release into the cytosol as observed in other cell types casaccia bonnefil et al. 1996 ; kuner and hertel 1998 ; brann et al. 2002 ; bhakar et al. 2003 . p75 induced ceramide generation in motor neur 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49436 17634371 61660 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 it is noteworthy that the increased superoxide production by mitochondria does not require nitric oxide whereas cytochrome c release does require the presence of an external source of nitric oxide such as the addition of deta nonoate. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49437 17634371 61661 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 these results suggest that peroxynitrite a strong oxidant formed from the reaction of superoxide and nitric oxide disrupts mitochondrial function to promote cytochrome c release beckman and koppenol 1996 ; radi et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49438 17634371 61679 8857 4624 GSS glutathione synthetase glutathione synthetase 0 1.0 gsh is synthesized by the consecutive action of the enzymes gcl and glutathione synthetase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49439 17634371 61687 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ngf induced apoptosis in motor neurons involves nsmase activation and triggers cytochrome c release from mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49440 17634371 61693 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 b fluorescence microphotographs showing cytochrome c immunoreactivity in motor neurons maintained with gdnf control or exposed to ngf plus deta nonoate ngf+no . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49441 17634371 61694 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the absence of ngf motor neurons showed a punctuate mitochondrial labeling of cytochrome c whereas 12 h after treatment with ngf+no motor neurons showed a diffuse cytoplasmic labeling. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49442 17634371 61695 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 c gw4869 100 n m ; gw prevented cytochrome c release induced by ngf+no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49443 17634371 61698 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 gw alone did not affect cytochrome c labeling data not shown . * p _lt_ 0.05 significantly different from control. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49444 17634371 61718 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 c fluorescence microphotographs showing cytochrome c immunoreactivity in sod1 motor neurons maintained with gdnf and exposed to vehicle control or ngf 100 ng/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49445 17634371 61719 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the absence of ngf motor neurons showed a punctuate labeling of cytochrome c and 12 h after treatment with ngf a diffuse labeling was observed in affected motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49446 17634371 61751 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 immunofluorescence studies revealed that nsmase activation was followed by cytochrome c release from mitochondria fig 1 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49447 17634371 61752 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in the absence of ngf motor neurons showed a punctate pattern of cytochrome c immunoreactivity indicative of mitochondrial localization. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49448 17634371 61753 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 ngf 100 ng/ml or deta nonoate 10 micro m treatment alone did not affect cytochrome c localization fig 1 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49449 17634371 61754 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 in contrast after 12 h of ngf treatment in the presence of deta nonoate ~27% of motor neurons displayed a diffuse pattern of cytochrome c immunoreactivity indicating release into the cytoplasm fig 1 b c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49450 17634371 61755 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 cytochrome c release induced by ngf in the presence of nitric oxide was prevented by the addition of the nsmase inhibitor gw4869 fig 1 c indicating that cytochrome c release required ceramide production. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49451 17634371 61770 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 moreover p75 mediated apoptosis in sod1 motor neurons was prevented by nsmase inhibitors fig 3 b and involved mitochondrial production and cytochrome c release fig 3 c d . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49452 17634371 61772 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 1.0 although an exogenous source of nitric oxide is not required for ngf to induce sod1 motor neuron death n nitro l arginine methyl ester name 1 m m a general nitric oxide synthase nos inhibitor and 1 2 trifluoromethylphenyl imidazole trim 10 micro m a specific inhibitor of the neuronal isoform of nos prevented ngf induced apoptosis in sod1 motor neurons fig 3 e . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49453 17634371 61777 8204 4311 GCLC glutamate-cysteine ligase glutamate cysteine ligase 0 1.0 the decrease in nrf2 expression correlated with a decrease in the expression of nrf2 regulated genes including both subunits of glutamate cysteine ligase gcl gclc and gclm the rate limiting enzyme in reduced glutathione gsh biosynthesis fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49454 17634371 61784 7334 11936 FASLG fas ligand fas ligand 0 1.0 to determine whether augmented antioxidant defenses also protect neurons from apoptosis triggered by other death receptors we analyzed the effect of tbhq on apoptosis induced by fas ligand in sod1 expressing motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49455 17634371 61787 7334 11936 FASLG fas ligand fas ligand 0 1.0 the soluble extracellular domain of fas ligand sfasl in the presence of an enhancer antibody significantly reduced the survival of motor neurons in a dose response manner whereas the enhancer antibody alone did not affect neuronal survival data n 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49456 17634371 61798 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 enzyme inhibitors|nf e2 related factor 2|nfe2l2 protein rat|nitric oxide donors|nitroso compounds|oligodeoxyribonucleotides antisense|reactive oxygen species|receptor nerve growth factor|2 2'|cytochromes c|nerve growth factor|sod1 g93a protein|superoxide dismutase|sphingomyelin phosphodiesterase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49457 17634371 61798 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 |2 2'|cytochromes c|nerve growth factor|sod1 g93a protein|superoxide dismutase|sphingomyelin phosphodiesterase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51663 17678953 64378 15951 8548 P4HB protein disulfide isomerase protein disulfide isomerase 0 1.0 one such molecule affected is protein disulfide isomerase pdi an enzyme responsible for normal protein folding in the endoplasmic greticulum er . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51667 17678953 64382 16060 8607 PARK2 e3 ubiquitin ligase e3 ubiquitin ligase 0 1.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40761 17719032 50702 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in wild type animals immunoreactivity for the astrocytic glutamate transporter glt 1 was particularly strong around ventral horn mns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40762 17719032 50703 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 however a marked loss of ventral horn glt 1 was observed along with substantial mn damage prior to onset of symptoms 90_amp_#x2013;100_amp_#xa0;days in the g93a rats. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40763 17719032 50705 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 compared to sham treated g93a animals 30 day nas infusions starting at 67 _amp_#xb1; 2_amp_#xa0;days of age markedly diminished the loss of both mns and of astrocytic glt 1 labeling. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40764 17719032 50709 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 although the cause of most cases is unknown observations of deficiencies in glutamate uptake resulting from a selective loss of the astrocytic glutamate transporter glt 1 suggested an excitotoxic contribution [rothstein et al. 1992] and [rothstein et al. 1995] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40765 17719032 50712 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 likely contributing to this vulnerability mns possess substantial numbers of unusual ca 2+ permeable ampa type glutamate receptor channels ca ampa channels [carriedo et al. 1995] [carriedo et al. 1996] [van den bosch et al. 2000] and [vandenberghe et al. 2000] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40766 17719032 50713 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 currently the best animal models of als are provided by rodents harboring mutant forms of the enzyme cu zn superoxide dismutase sod1 which are associated with familial als in humans. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40767 17719032 50724 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 we find that this treatment slows not only mn loss in these animals but also slows the loss of glt 1 glutamate transporter in ventral horn regions near mns consistent with the idea that ca ampa channel activation on mns contributes to the loss of astrocytic glutamate transport. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40768 17719032 50743 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 stains were carried out on floating sections blocked 10% fbs 1_amp_#xa0;h and exposed to primary antibody in 10% fbs 0.3% triton x 100 smi 32 1:8000 ip 1:2000 if sternberger monoclonals berkeley ca; glt 1 1:1000 chemicon temecula ca; 3 nitrotyrosine 10_amp_#xa0;_amp_#x3bc;g/ml upstate biotechnology waltham ma . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40769 17719032 50748 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 for examination of nt and glt 1 labeling staining in the neuropil surrounding ventral horn mns care was taken to ensure that all slices from each experiment were labeled using identical primary and secondary antibody exposures and 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40770 17719032 50751 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 for glt 1 fluorescence was measured in 5 _amp_#x3bc;m zones surrounding the mns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40771 17719032 50752 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 for this measure non specific background fluorescence from the center of a neuron a region lacking specific glt 1 labeling was subtracted prior to normalization of values to wt as above. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40772 17719032 50755 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 antibodies were from the following sources: smi 32 sternberger monoclonals berkeley ca; glt 1 chemicon temecula ca; 3 nitrotyrosine upstate biotechnology waltham ma. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40773 17719032 50777 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 itrotyrosine labeling and loss of astrocytic glutamate transport in sod1 mutant rodent models of als [alexander et al. 2000] [ferrante et al. 1997] and [tu et al. 1996] and a specific decrease of the glt 1 glutamate transporter has been reported in ventral horn of the g93a rats that are the subject of this study howland et al. 2002 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40774 17719032 50787 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 finally there was a marked and consistent decrease in glt 1 staining most prominent in ventral horn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40775 17719032 50788 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 notably in wild type animals glt 1 labeling often showed a rim of particularly strong labeling immediately surrounding mn somata whereas even in the presymptomatic animals this rim was often conspicuously absent fig 2 c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40776 17719032 50790 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 quantification of glt 1 labeling in the neuropil surrounding mns revealed a sharp decrease in glt 1 labeling surrounding mns in sham treated transgenic animals tg s . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40777 17719032 50791 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 however in contrast to the paucity of effect of nas on nt labeling nas completely prevented the loss of glt 1 labeling fig 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40778 17719032 50794 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 in agreement with prior studies of these animals howland et al. 2002 we observe substantial loss of the glt 1 glutamate transporter most evident in the ventral horn in close proximity to mns in late presymptomatic animals 97_amp_#xa0;days shortly before an acceleration in the rate of mn death with developmen 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40779 17719032 50796 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 the primary new findings of present studies are that animals treated with the ca ampa channel blocker nas demonstrate a marked preservation not only of ventral horn mns but also of glt 1 labeling near ventral horn mns. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40780 17719032 50797 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 s generators in response to ca ampa channel activation taken together with present observations of strong oxidative damage in the vicinity of mns and protection by nas of mns themselves as well as of glt 1 levels in the adjacent astrocytes is most consistent with the primary relevant effect of nas being mn ca ampa channel blockade. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40781 17719032 50800 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 indeed observations that substantial loss of glt 1 preceded much of the mn loss howland et al. 2002 and that increasing the level of this transporter slows disease onset guo et al. 2003 whereas decreasing its levels accelerates disease in g93a transg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40782 17719032 50830 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 lumbar spinal cord sections were obtained from 97 _amp_#xb1; 2 day old wild type and g93a transgenic rats and stained for glial fibrillary acidic protein gfap green and smi 32 red a 3 nitrotyrosine b or the astrocytic glutamate transporter glt 1 green along with smi 32 red c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40783 17719032 50830 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 d from 97 _amp_#xb1; 2 day old wild type and g93a transgenic rats and stained for glial fibrillary acidic protein gfap green and smi 32 red a 3 nitrotyrosine b or the astrocytic glutamate transporter glt 1 green along with smi 32 red c . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40784 17719032 50833 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 finally note the rim of strong glt 1 labeling surrounding mns in wild type animals and the distinct loss of labeling surrounding mns in the transgenics. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40785 17719032 50835 8254 4235 GFAP glial fibrillary acidic protein glial fibrillary acidic protein 0 1.0 a photomicrographs show the ventral horn region of lumbar spinal cord sections derived from 97 _amp_#xb1; 2 day old rats upon termination of the 30 day intrathecal infusions stained for glial fibrillary acidic protein gfap; 400_amp_#xd7; or for 3 nitrotyrosine nt; 400_amp_#xd7; inserts 40_amp_#xd7; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40786 17719032 50843 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 fig. 4._amp_#xa0;loss of glt 1 in ventral horn astrocytes of g93a rats and preservation by nas. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40787 17719032 50844 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 a glt 1 immunofluorescence: photomicrographs show the ventral horn region of lumbar spinal cord sections derived from 97 _amp_#xb1; 2 day old rats upon termination of the 30 day intrathecal infusions stained 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40788 17719032 50844 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 nofluorescence: photomicrographs show the ventral horn region of lumbar spinal cord sections derived from 97 _amp_#xb1; 2 day old rats upon termination of the 30 day intrathecal infusions stained for glt 1 40 400_amp_#xd7; and for smi 32 right 400_amp_#xd7; . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40789 17719032 50845 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 note the strong glt 1 labeling surrounding mns and throughout ventral horn mn clusters in wild type wt animals in contrast to the preferential loss of ventral horn labeling with preservation of dorsal horn labeling in tra 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40790 17719032 50847 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 arrows show clusters of ventral horn motor neurons with strong astrocytic glt 1 labeling; arrowhead shows persistent strong glt 1 labeling in dorsal horn of untreated transgenic animals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40791 17719032 50849 20017 10940 SLC1A2 glt 1 glt 1 0 1.0 b quantification of labeling: graph shown quantification of glt 1 labeling in 5 _amp_#x3bc;m zones surrounding each mn compiled from 4 independent experiments _amp_#x3e; 100 surround regions for wt tg s and tg nas conditions; 3 animals _amp_#x3e; 60 regions for tg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40792 17719032 50852 20017 10940 SLC1A2 excitatory amino acid transporter 2 excitatory amino acid transporter 2 0 1.0 excitatory amino acid antagonists|excitatory amino acid transporter 2|glial fibrillary acidic protein|1 naphthylacetylspermine|spermine|sod1 g93a protein|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36249 17937892 44757 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 [sirt1/pgc 1: a neuroprotective axis?] 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36250 17937892 44760 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 since it has been recently demonstrated that activation of the sirt1/pgc 1 pathway in a metabolic context promotes mitochondrial function we performed a detailed literature review on the implication of this pathway in neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36251 17937892 44761 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 interestingly transgenic mice with impaired pgc 1 expression have neurodegenerative lesions and show behavioural abnormalities. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36252 17937892 44764 17035 9237 PPARGC1A pgc 1 pgc 1 0 1.0 taken together these results strongly suggest that the modulation of the sirt1/pgc 1 pathway which has not been well documented in the central nervous system could become the cornerstone for new therapeutical approaches to combat neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 36253 17937892 44766 926 620 APP amyloid-beta protein amyloid beta protein 0 1.0 amyloid beta protein|neuroprotective agents|reactive oxygen species|stilbenes|transcription factors|peroxisome proliferator activated receptor gamma coactivator 1|resveratrol|sirt1 protein human|sirt1 protein mouse|sirtu 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37378 17956327 46615 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 new synthesis and release of bdnf brain derived neurotrophic factor is necessary and sufficient for pltf in vivo [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37379 17956327 46615 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 new synthesis and release of bdnf brain derived neurotrophic factor is necessary and sufficient for pltf in vivo [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37382 17956327 46620 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 pkc protein kinase c activation] stimulating new protein synthesis including bdnf. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37383 17956327 46621 543 391 AKT1 protein kinase b protein kinase b 0 1.0 igh affinity receptor trkb tropomyosin receptor kinase b resulting in the phosphorylation of erk extracellular signal regulated kinase mapks mitogen activated protein kinases and akt [also called pkb protein kinase b ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37384 17956327 46621 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 released bdnf then activates its high affinity receptor trkb tropomyosin receptor kinase b resulting in the phosphorylation of erk extracellular signal regulated kinase mapks mitogen activated protein kinases and akt [also called pkb protein kinase b ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37385 17956327 46622 8789 4571 GRIA1 glutamate receptor glutamate receptor 0 1.0 we postulate that these activated kinases phosphorylate glutamate receptors inducing glutamate receptor trafficking inserting more receptors in the post synaptic membrane and strengthening synapses between glutamatergic brainstem respiratory neurons and phrenic motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37387 17956327 46636 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 for example pka protein kinase a and pkc both modulate basal respiratory drive currents in medullary respiratory neurons including expiratory neurons in the caudal medulla [ 31 32 ] inspiratory neurons in the pre b_amp_#246;tzinger 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37389 17956327 46651 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 ros are continuously generated in cells through enzymatic e.g nadph oxidase and xanthine oxidase and non enzymatic e.g mitochondrial electron transport chain and receptor activation processes [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37390 17956327 46651 24288 12805 XDH xanthine oxidase xanthine oxidase 0 1.0 ros are continuously generated in cells through enzymatic e.g nadph oxidase and xanthine oxidase and non enzymatic e.g mitochondrial electron transport chain and receptor activation processes [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37391 17956327 46654 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 sod superoxide dismutase ] prevent excessive ros accumulation [ 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37392 17956327 46660 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 nadph oxidase may generate the ros necessary for pltf since apocynin an nadph oxidase and superoxide anion inhibitor blocks pltf [ 24 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37393 17956327 46662 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 indeed putative phrenic motor neurons and nearby astrocytes express subunits of the nadph oxidase complex i satriotomo p.m macfarlane d.j harrigan and g.s mitchell unpublished work . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37394 17956327 46666 17177 9308 PPP2R4 protein phosphatase 2a protein phosphatase 2a 0 1.0 indeed in vitro application of h 2 o 2 to cervical spinal cord homogenates significantly inhibits the activity of the okadaic acid sensitive serine/threonine phosphatase protein phosphatase 2a j.e.r wilkerson and g.s mitchell unpublished work . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37395 17956327 46685 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 key words: brain derived neurotrophic factor bdnf 5 hydroxytryptamine 5 ht long term facilitation pattern sensitivity phosphorylation plasticity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37397 17956327 46685 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 key words: brain derived neurotrophic factor bdnf 5 hydroxytryptamine 5 ht long term facilitation pattern sensitivity phosphorylation plasticity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37398 17956327 46686 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxyg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37399 17956327 46686 17303 9391 PRKAR2A protein kinase a protein kinase a 0 1.0 ns used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37400 17956327 46686 543 391 AKT1 protein kinase b protein kinase b 0 1.0 ermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37401 17956327 46686 17305 9393 PRKCA protein kinase c protein kinase c 0 1.0 f brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37402 17956327 46686 12341 6879 MAPK6 extracellular signal-regulated kinase extracellular signal regulated kinase 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37404 17956327 46686 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxyg 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37405 17956327 46686 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 lar signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropomyosin receptor kinase b. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 39552 17987632 49317 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 optimizing separation efficiency of 2 de procedures for visualization of different superoxide dismutase forms in a cellular model of amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 39553 17987632 49319 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 in ad and pd patients superoxide dismutase sod1 was also indicated as a major target of oxidative damage. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22670 18210200 26911 1133 727 ARTN neurotrophic factor neurotrophic factor 0 1.0 another study also suggested that cnts functionalized with growth factors such as nerve growth factor or brain derived neurotrophic factor can stimulate growth of neurons on the nanotube scaffold matsumoto et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22671 18210200 26911 14373 7808 NGF nerve growth factor nerve growth factor 0 1.0 another study also suggested that cnts functionalized with growth factors such as nerve growth factor or brain derived neurotrophic factor can stimulate growth of neurons on the nanotube scaffold matsumoto et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22672 18210200 26911 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 another study also suggested that cnts functionalized with growth factors such as nerve growth factor or brain derived neurotrophic factor can stimulate growth of neurons on the nanotube scaffold matsumoto et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22673 18210200 26919 5284 19986 CYCS cytochrome c cytochrome c 0 1.0 for example a recent study reported a nanotube produced by a layer based assembly of cytochrome c poly sodium styrene sulfonate and poly ethylenimine pei . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22674 18210200 26997 10601 6081 INS insulin insulin 0 1.0 omes to the brain they can be additionally modified vectorized with monoclonal antibodies to glial fibrillary acidic proteins pardridge 1999 ; chekhonin et al 2005 transferrin receptors ox26 or human insulin receptors 83 14 mab; pardridge 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22675 18210200 26997 22023 11740 TF transferrin transferrin 0 1.0 to target pegylated liposomes to the brain they can be additionally modified vectorized with monoclonal antibodies to glial fibrillary acidic proteins pardridge 1999 ; chekhonin et al 2005 transferrin receptors ox26 or human insulin receptors 83 14 mab; pardridge 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22676 18210200 27013 10601 6081 INS insulin insulin 0 1.0 one study has shown that polymeric micelles of pluronic block copolymers after conjugation with an antibody against a 2 glycoprotein or insulin showed increased delivery of a drug haloperidol or a fluorescent probe to the brain in vivo kabanov et al 1989 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22677 18210200 27040 10601 6081 INS insulin insulin 0 1.0 the permeability of oligonucleotides with nanogels was enhanced when the nanogel surface was modified with polypeptides transferrin or insulin that bind receptors at the luminal side of the brain microvessel endothelial cells and transport to their abluminal side. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22678 18210200 27040 22023 11740 TF transferrin transferrin 0 1.0 the permeability of oligonucleotides with nanogels was enhanced when the nanogel surface was modified with polypeptides transferrin or insulin that bind receptors at the luminal side of the brain microvessel endothelial cells and transport to their abluminal side. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22679 18210200 27061 22023 11740 TF transferrin transferrin 0 1.0 gene transfer into brain capillary cells have been also shown using a transferrin conjugated peg modified pamam dendrimer huang et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22680 18210200 27065 551 399 ALB albumin albumin 0 1.0 notably several nanoscale drugs _amp_#8220;nanomedicines_amp_#8221; such as liposomal doxorubicin doxil gabizon et al 2006 or albumin bound paclitaxel abraxane gradishar 2006 have been used in clinic already for treatment of cancer and other diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22681 18210200 27081 3544 1516 CAT catalase catalase 0 1.0 based on this our laboratories developed cell mediated delivery of catalase nanozyme to the brain to mitigate production of ros and induce neuroprotection batrakova et al 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22682 18210200 27082 3544 1516 CAT catalase catalase 0 1.0 to preclude bmm mediated enzyme degradation catalase was packaged into a block ionomer complex with a cationic block copolymer pei peg. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22683 18210200 27083 3544 1516 CAT catalase catalase 0 1.0 the self assembled catalase/pei peg complexes were ca. 60 to 100 nm in size stable in ph and ionic strength and retained antioxidant activities. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22685 18210200 27089 8240 4232 GDNF glial derived neurotrophic factor glial derived neurotrophic factor 0 1.0 these diseases would collectively benefit from immunomodulation neurotrophic factors such as glial derived neurotrophic factor or brain derived neurotrophic factor and in the case of hiv 1 disease anti retroviral therapy kabanov and gendelman 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 22686 18210200 27089 1624 1033 BDNF brain-derived neurotrophic factor brain derived neurotrophic factor 0 1.0 these diseases would collectively benefit from immunomodulation neurotrophic factors such as glial derived neurotrophic factor or brain derived neurotrophic factor and in the case of hiv 1 disease anti retroviral therapy kabanov and gendelman 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23829 18219386 28332 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 in this issue of the jci harraz and colleagues demonstrate that sod1 mutants expressed in human cell lines directly stimulate nadph oxidase nox by binding to rac1 resulting in overproduction of damaging ros see the related article beginning on page 659 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23830 18219386 28334 14554 14874 NOX5 nadph oxidase nadph oxidase 0 1.0 footnotes nonstandard abbreviations used: als amyotrophic lateral sclerosis; nox nadph oxidase; o 2 _amp_#x02022;_amp_#x02013; superoxide; sod1 superoxide dismutase_amp_#x02013;1. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23831 18219386 28361 5281 2578 CYBB gp91 phox gp91 phox 0 1.0 the nox prototype nox2 is the phagocytic nox also known as gp91 phox that generates o 2 _amp_#x02022;_amp_#x02013; not as a byproduct but as a primary function of the enzyme 15 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23832 18219386 28363 5279 2577 CYBA p22-phox p22 phox 0 1.0 nox2 is constitutively associated with the transmembrane nox stabilizing protein p22 phox and recruitment of the activating cytosolic components p47 phox p67 phox and p40 phox are needed for function figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23833 18219386 28363 14170 7661 NCF2 p67 phox p67 phox 0 1.0 nox2 is constitutively associated with the transmembrane nox stabilizing protein p22 phox and recruitment of the activating cytosolic components p47 phox p67 phox and p40 phox are needed for function figure 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23834 18219386 28364 5279 2577 CYBA p22-phox p22 phox 0 1.0 upon cell activation p47 phox is phosphorylated thereby initiating translocation of the p47 phox /p67 phox /p40 phox complex to the membrane where phosphorylated p47 phox binds to p22 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23835 18219386 28364 14170 7661 NCF2 p67 phox p67 phox 0 1.0 upon cell activation p47 phox is phosphorylated thereby initiating translocation of the p47 phox /p67 phox /p40 phox complex to the membrane where phosphorylated p47 phox binds to p22 phox . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23836 18219386 28367 14170 7661 NCF2 p67 phox p67 phox 0 1.0 rac acts to coordinate the translocation of the p47 phox /p67 phox /p40 phox complex and is active only when bound to gtp not when bound to gdp. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23838 18219386 28404 14170 7661 NCF2 p67 phox p67 phox 0 1.0 apocynin is believed to block the translocation of p47 phox /p67 phox to nox 23 and would therefore inhibit only the nox proteins requiring these cytosolic activators which include nox1 and nox2. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23839 18219386 28415 14170 7661 NCF2 chronic granulomatous disease chronic granulomatous disease 0 1.0 mutations altering the activity of nox2 or other subunits of nox are known to cause chronic granulomatous disease cgd 15 which is characterized by severe and chronic infections that are hard to treat due to the incapacity of immune cells to produce o 2 _amp_#x02022;_amp_#x02013; and therefore to fight pathogens. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 26562 18270519 31491 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 the nitroxide radical by itself is also an antioxidant and can be used as a superoxide dismutase mimic krishna et al 1996a . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15784 18308427 18543 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced endogenously or exogenously. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15785 18308427 18543 3544 1516 CAT catalase catalase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced endogenously or 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15786 18308427 18543 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced en 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15787 18308427 18543 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 antioxidant defense enzymes: superoxide dismutase sod catalase cat glutathione peroxidase gshpx glutathione reductase gr and glucose 6 phosphate dehydrogenase g 6 pdh in the erythrocytes are capable of detoxifying reactive oxygen species produced endogenously or exogenously. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15788 18308427 18546 3544 1516 CAT catalase catalase 0 1.0 on the other hand catalase activity was found to be significantly lower p _amp_#x3c; 0.001 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15789 18308427 18547 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 the activities of glucose 6 phosphate dehydrogenase glutathione reductase and glutathione levels were also found to be significantly reduced in als patients compared to healthy subjects p _amp_#x3c; 0.001 p _amp_#x3c; 0.01 and p _amp_#x3c; 0.01 respectively . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15790 18308427 18547 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 the activities of glucose 6 phosphate dehydrogenase glutathione reductase and glutathione levels were also found to be significantly reduced in als patients compared to healthy subjects p _amp_#x3c; 0.001 p _amp_#x3c; 0.01 and p _amp_#x3c; 0.01 respec 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15791 18308427 18548 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 it was further observed that lipid peroxidation started to increase and catalase glutathione reductase glucose 6 phosphate dehydrogenase enzyme activities and glutathione levels started to decrease as amyotrophic lateral sclerosis progressed from 6 to 24 months suggesting a correlation between these p 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15792 18308427 18548 3544 1516 CAT catalase catalase 0 1.0 it was further observed that lipid peroxidation started to increase and catalase glutathione reductase glucose 6 phosphate dehydrogenase enzyme activities and glutathione levels started to decrease as amyotrophic lateral sclerosis progressed from 6 to 24 months suggesting a corre 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15793 18308427 18548 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 it was further observed that lipid peroxidation started to increase and catalase glutathione reductase glucose 6 phosphate dehydrogenase enzyme activities and glutathione levels started to decrease as amyotrophic lateral sclerosis progressed from 6 to 24 months suggesting a correlation between these parameters and duration of amyotrop 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15794 18308427 18561 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 these enzymes include superoxide dismutase sod e.c no 1.15.1.1 that remove o 2_amp_#x2212; by catalyzing its dismutation one o 2_amp_#x2212; being reduced to h 2 o 2 and another oxidized to o 2 [fridovich 1989] [halliwell 2001] and [liochev a 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15795 18308427 18562 3544 1516 CAT catalase catalase 0 1.0 catalase cat e.c no 1.11.1.6 catalyzes the conversion of hydrogen peroxide h 2 o 2 to water and molecular oxygen thereby protecting cells from the toxic effects of hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15796 18308427 18566 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 gsh recycling is catalyzed by glutathione reductase gr e.c no 1.8.1.10 which uses reducing equivalents from nadph to reconvert gssg to 2gsh. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15797 18308427 18568 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 low erythrocyte gsh is also manifest in hereditary nonspherocytic lymphocytic leukemia and glucose 6 phosphate dehydrogenase g 6 pdh e.c no 1.1.1.49 deficiency. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15798 18308427 18609 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 1.0 superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15799 18308427 18626 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 the 1 ml reaction mixture contained tris_amp_#x2013;hcl buffer 25 mm ph 7.6; nadph 0.12 mm; glutathione reductase 1 u/ml; reduced glutathione 1 mm; cumin hydroperoxide 0.1 mm and suitable amount of enzyme. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15801 18308427 18634 551 399 ALB serum albumin serum albumin 0 1.0 y using the method of brehe and burch 1976 with minor modifications. 200 _amp_#x3bc;l of 0.01n hcl was mixed with dtnb containing buffer 110 mm na 2 hpo 4 40 mm nah 2 po 4 15 mm edta 0.04% w/v bovine serum albumin bsa and 0.3 mm dtnb. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15802 18308427 18637 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 glutathione reductase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15803 18308427 18643 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 glucose 6 phosphate dehydrogenase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15804 18308427 18659 3544 1516 CAT catalase catalase 0 1.0 the rate of lpo in the erythrocytes of als patients was significantly increased with respect to control subjects p _amp_#x3c; 0.001 fig 1 whereas catalase activity in the rbc of als patients was significantly lower than the controls p _amp_#x3c; 0.01 fig 2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15805 18308427 18701 3544 1516 CAT catalase catalase 0 1.0 fig. 7._amp_#xa0;second degree polynomial regression plot showing the activity of catalase in the erythrocytes of als vs. duration of illness n = 10 at 6 months 5 at 12 months and 5 at 24 months . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15806 18308427 18705 8856 4623 GSR glutathione reductase glutathione reductase 0 1.0 fig. 9._amp_#xa0;second degree polynomial regression plot showing the activity of glutathione reductase vs. duration of illness in the erythrocytes of patients with als n = 10 at 6 months 5 at 12 months and 5 at 24 months . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 15807 18308427 18707 8008 4057 G6PD glucose-6-phosphate dehydrogenase glucose 6 phosphate dehydrogenase 0 1.0 fig. 10._amp_#xa0;second degree polynomial regression plot showing the activity of glucose 6 phosphate dehydrogenase vs. duration of illness in the erythrocytes of als patients n = 10 at 6 months 5 at 12 months and 5 at 24 months . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 18496 18349520 21380 12359 6876 MAPK14 p38 mitogen activated protein kinase p38 mitogen activated protein kinase 0 1.0 methods: reactive oxygen species production protein carbonylation and nitration susceptibility to hydrogen peroxide exposure p38 mitogen activated protein kinase activation and adenosine triphosphate intracellular content were evaluated. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9662 18414597 11013 10437 5992 IL1B il 1 il 1 0 1.0 pro inflammatory cytokines tnf alpha and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9663 18414597 11013 22551 11892 TNF tnf alpha tnf alpha 0 1.0 pro inflammatory cytokines tnf alpha and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9664 18414597 11015 10437 5992 IL1B il 1 il 1 0 1.0 tnf alpha and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9665 18414597 11015 22551 11892 TNF tnf alpha tnf alpha 0 1.0 tnf alpha and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9667 18414597 11018 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9668 18414597 11020 14569 7897 NPC1 niemann-pick disease niemann pick disease 0 1.0 niemann pick diseases a and b are due to acidic sphingomyelinase deficiency resulting in sphingomyelin accumulation while niemann pick disease c is due to mutations in either the npc1 or npc2 genes resulting in defective cholesterol transport and cholesterol accumulation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9762 18422522 11246 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 endothelial nitric oxide synthase overexpression by neuronal cells in neurodegeneration: a link between inflammation and neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9764 18422522 11247 14538 7876 NOS3 endothelial nitric oxide synthase endothelial nitric oxide synthase 0 1.0 the roles of neuronal and inducible nitric oxide synthases in neurones have been extensively investigated; by contrast the biological significance of endothelial nitric oxide synthase enos overexpression that occurs in several pathological conditions has not yet been studied. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9766 18422522 11249 22551 11892 TNF tnf alpha tnf alpha 0 1.0 we found that enos which is endogenously expressed by these cells was activated by tumour necrosis factor alpha tnf alpha a proinflammatory cytokine that plays important roles in als2 and several neurodegenerative diseases. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9767 18422522 11250 22551 11892 TNF tnf alpha tnf alpha 0 1.0 the tnf alpha dependent enos activation occurred through generation by sphingosine kinase 1 of sphingosine 1 phosphate stimulation of its membrane receptors and activation of akt as determined using small interfer 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9768 18422522 11250 22551 11892 TNF tnf alpha tnf alpha 0 1.0 hate stimulation of its membrane receptors and activation of akt as determined using small interference rna and dominant negative constructs specific for the enzymes and receptors. enos activation by tnf alpha conferred cytoprotection from excitotoxicity and neurotoxic cues such as reactive oxygen species endoplasmic reticulum stress dna damage and mutated alsin itself. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9769 18422522 11250 21157 11240 SPHK1 sphingosine kinase 1 sphingosine kinase 1 0 1.0 the tnf alpha dependent enos activation occurred through generation by sphingosine kinase 1 of sphingosine 1 phosphate stimulation of its membrane receptors and activation of akt as determined using small interference rna and dominant negative constructs specific for the enzymes and recepto 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 7740 18588875 8938 19680 14133 SEPX1 methionine sulfoxide reductase methionine sulfoxide reductase 0 1.0 this review will outline the potential role of mitochondrial function and redox balance in age related eye diseases and detail how the methionine sulfoxide reductase msr protein repair system and other redox systems play key roles in the function and maintenance of the aging eye. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2048 18751914 3073 10437 5992 IL1B il 1 il 1 0 1.0 pro inflammatory cytokines tnf _amp_#945; and il 1 secretory phospholipase a 2 iia and lipoprotein pla 2 are implicated in vascular inflammation. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2049 18751914 3071 10437 5992 IL1B il 1 il 1 0 1.0 tnf _amp_#945; and il 1 alter lipid metabolism and stimulate production of eicosanoids ceramide and reactive oxygen species that potentiate cns injuries and certain neurological disorders. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2051 18751914 3068 912 613 APOE apolipoprotein e apolipoprotein e 0 1.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2052 18751914 3066 14569 7897 NPC1 niemann-pick disease niemann pick disease 0 1.0 niemann pick diseases a and b are due to acidic sphingomyelinase deficiency resulting in sphingomyelin accumulation while niemann pick disease c is due to mutations in either the npc1 or npc2 genes resulting in defective cholesterol transport and cholesterol accumulation. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0