#sen2geneID pmid senID geneID hgncID approvedSymbol matchString actualString startPos score flankingText matchCodeID tag SciMinerVersion SciMinerMethod inExClude inExCludeCond phenotypeOnly conflictCode hgncIDbyNR NRText editTag editUser oldGeneID oldHgncID oldApprovedSymbol oldInExClude oldInExCludeCond 299736 7841373 429641 18723 10261 ROS1 ROS ROS 26 0.3 in neurones through reduced generation of reactive oxygen species (ROS) ROS 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 299737 7841373 429645 18723 10261 ROS1 ROS ROS-mediated 17 0.3 lipofuscinogenesis accumulation of bcl-2 may reflect a mechanism for counterbalancing ROS-mediated damage or it might represent the impairment of bcl-2-dependent protection 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 299738 7841373 429645 18723 10261 ROS1 ROS ROS 29 0.3 or it might represent the impairment of bcl-2-dependent protection from ROS 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 298742 8586987 427611 20996 11179 SOD1 ALS ALS 33 0.0 cord from 5 patients with sporadic amyotrophic lateral sclerosis (ALS) ALS and 5 age-matched controls using laser microprobe mass spectrometry (LMMS) 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000727349961528597<>ScoreDetail__5468|IGFALS|0.000285127737226277__11179|SOD1|0.000727349961528597__ 0 0 0 0 0 298743 8586987 427612 20996 11179 SOD1 ALS ALS 12 0.0 of Al was not altered in any area in the ALS samples 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000727349961528597<>ScoreDetail__5468|IGFALS|0.000285127737226277__11179|SOD1|0.000727349961528597__ 0 0 0 0 0 298744 8586987 427613 20996 11179 SOD1 ALS ALS 14 0.0 Ca were increased 1.5-2-fold in the nucleus and cytoplasm of ALS neurons but not in capillaries and neuropil 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000727349961528597<>ScoreDetail__5468|IGFALS|0.000285127737226277__11179|SOD1|0.000727349961528597__ 0 0 0 0 0 298745 8586987 427614 20996 11179 SOD1 ALS ALS 16 0.0 hypothesis that Al is enriched in spinal cord of sporadic ALS as has been reported for Guamanian ALS/Parkinson's ALS Parkinson's dementia 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000727349961528597<>ScoreDetail__5468|IGFALS|0.000285127737226277__11179|SOD1|0.000727349961528597__ 0 0 0 0 0 298746 8586987 427614 20996 11179 SOD1 ALS ALS 23 0.0 of sporadic ALS as has been reported for Guamanian ALS/Parkinson's ALS Parkinson's dementia 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000727349961528597<>ScoreDetail__5468|IGFALS|0.000285127737226277__11179|SOD1|0.000727349961528597__ 0 0 0 0 0 298747 8586987 427615 20996 11179 SOD1 ALS ALS 18 0.0 consistent with reports of increased Fe in bulk samples of ALS spinal cord 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000727349961528597<>ScoreDetail__5468|IGFALS|0.000285127737226277__11179|SOD1|0.000727349961528597__ 0 0 0 0 0 297950 8588576 425841 20996 11179 SOD1 ALS ALS 4 2.9 Reduced fecundity in male ALS gene-carriers 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000851657011290818<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.000851657011290818__ 0 0 0 0 0 297951 8588576 425842 20996 11179 SOD1 ALS ALS 13 2.9 genetic aspects in multicase families 89 amyotrophic lateral sclerosis (ALS) ALS and 214 Parkinson disease (PD) PD kindreds were analyzed in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000851657011290818<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.000851657011290818__ 0 0 0 0 0 297952 8588576 425844 20996 11179 SOD1 ALS ALS 19 2.9 gene-carrier female (3.25, 3.25 Student's t-test P _lt_ .0003 for ALS but not for other diseases 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000851657011290818<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.000851657011290818__ 0 0 0 0 0 297953 8588576 425845 20996 11179 SOD1 ALS ALS 8 2.9 The data taken together suggest that fecundity in ALS gene-carriers was reduced in males possibly as a result of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000851657011290818<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.000851657011290818__ 0 0 0 0 0 297954 8588576 425846 20996 11179 SOD1 ALS ALS 13 2.9 usually accomplished well before the onset of neurological symptoms in ALS and since reduced fecundity was found in male ALS gene-carriers 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000851657011290818<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.000851657011290818__ 0 0 0 0 0 297955 8588576 425846 20996 11179 SOD1 ALS ALS 22 2.9 in ALS and since reduced fecundity was found in male ALS gene-carriers these findings raise the possibility that an ALS gene 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000851657011290818<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.000851657011290818__ 0 0 0 0 0 297956 8588576 425846 20996 11179 SOD1 ALS ALS 31 2.9 male ALS gene-carriers these findings raise the possibility that an ALS gene might have a pleiotrophic effect on fertility in males 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000851657011290818<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.000851657011290818__ 0 0 0 0 0 297131 8841988 424206 20996 11179 SOD1 ALS ALS 21 1.4 of the spinal cord associated with amyotrophic lateral sclerosis (ALS) ALS has still not been elucidated 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00144115096667033<>ScoreDetail__5468|IGFALS|0.00119171756293758__11179|SOD1|0.00144115096667033__ 0 0 0 0 0 297133 8841988 424208 20996 11179 SOD1 ALS ALS 25 1.4 (CO) CO of the human spinal cord in patients with ALS in comparison with those in control patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00144115096667033<>ScoreDetail__5468|IGFALS|0.00119171756293758__11179|SOD1|0.00144115096667033__ 0 0 0 0 0 297135 8841988 424209 20996 11179 SOD1 ALS ALS 11 1.4 SOD activity in spinal cord transections from patients with sporadic ALS was not significantly different from the controls in ventral lateral 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00144115096667033<>ScoreDetail__5468|IGFALS|0.00119171756293758__11179|SOD1|0.00144115096667033__ 0 0 0 0 0 297136 8841988 424210 20996 11179 SOD1 ALS ALS 7 1.4 GSH-Px activity in the spinal cord of ALS patients was not very different from that in the control 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00144115096667033<>ScoreDetail__5468|IGFALS|0.00119171756293758__11179|SOD1|0.00144115096667033__ 0 0 0 0 0 297137 8841988 424211 20996 11179 SOD1 ALS ALS 18 1.4 all three regions of the spinal cord in patients with ALS although the reduction was more marked in the ventral region 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00144115096667033<>ScoreDetail__5468|IGFALS|0.00119171756293758__11179|SOD1|0.00144115096667033__ 0 0 0 0 0 295070 8922414 420713 9947 5468 IGFALS ALS ALS 20 0.3 some of the clinical features of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295071 8922414 420714 9947 5468 IGFALS ALS ALS 20 0.3 play a role in the pathogenesis of disorders such as ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295072 8922414 420714 18723 10261 ROS1 ROS ROS 8 0.0 It has been suggested that reactive oxygen species (ROS) ROS may play a role in the pathogenesis of disorders such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295074 8922414 420715 18723 10261 ROS1 ROS ROS 5 0.0 To examine the relationship between ROS and neural degeneration we have studied the effects of agents 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295078 8922414 420722 18723 10261 ROS1 ROS ROS 15 0.0 shown to elevate intracellular levels of reactive oxygen species (ROS), ROS which in turn enhance the rate of programmed cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295079 8922414 420724 18723 10261 ROS1 ROS ROS 3 0.0 The importance of ROS in programmed cell death also has been suggested from the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295080 8922414 420724 18723 10261 ROS1 ROS ROS-induced 26 0.0 of bcl-2 family proteins which seem to act by inhibiting ROS-induced cell damage (Kane Kane et al. 1993 Zhong et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295081 8922414 420725 9947 5468 IGFALS ALS ALS 27 0.3 disease infantile spinal muscular atrophy and amyotrophic lateral sclerosis (ALS; ALS Olanow and Arendash 1994 Beal 1995 Eisen 1995 Mattson and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295082 8922414 420725 18723 10261 ROS1 ROS ROS 3 0.0 In humans elevated ROS levels also have been linked to neuropathies such as Parkinson's 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295084 8922414 420726 18723 10261 ROS1 ROS ROS 12 0.0 N -acetyl-L -cysteine (NAC) NAC has been shown to inhibit ROS thus increasing the viability of cells in culture including spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295088 8922414 420730 18723 10261 ROS1 ROS ROS 24 0.0 examined the possibility that agents that inhibit the formation of ROS may be useful as therapeutic agents in vivo for certain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295092 8922414 420792 1617 1027 BDH1 BDH BDH 21 0.0 water supplemented with either 1% N -acetyl-L -cysteine (B24001-30, B24001-30 BDH Chemicals Poole UK L -alanine (A5824, A5824 Sigma St Louis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295126 8922414 420879 9947 5468 IGFALS ALS ALS 16 0.3 play an important role in several human neurodegenerative diseases including ALS a disorder that shares some of the features of the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295127 8922414 420879 18723 10261 ROS1 ROS ROS 1 0.0 However ROS have been suggested to play an important role in several 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295128 8922414 420880 18723 10261 ROS1 ROS ROS 6 0.0 Consistent with this agents that inhibit ROS have been shown to be neuroprotective both in vitro and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295132 8922414 420882 18723 10261 ROS1 ROS ROS 45 0.0 a means by which NAC may act to reduce local ROS levels 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295134 8922414 420883 18723 10261 ROS1 ROS ROS 16 0.0 directly supports glutathione synthesis in neural cells thus reducing intracellular ROS levels (Mayer Mayer and Noble 1994 kappa b (Brennan Brennan 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295138 8922414 420886 9947 5468 IGFALS ALS ALS 14 0.3 improvement was observed in patients treated with NAC segregation of ALS cases into bulbar and limb onset groups is informative 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295139 8922414 420887 9947 5468 IGFALS ALS ALS 1 0.3 In ALS cases of bulbar onset NAC did not improve survival 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295144 8922414 420891 9947 5468 IGFALS ALS ALS 9 0.3 For comparison one current therapy that shows promise for ALS patients is studies with the glutamate antagonist riluzole (100 100 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295145 8922414 420892 9947 5468 IGFALS ALS ALS 17 0.3 month period there are some indications of clinical improvements in ALS patients suggesting that aberrant glutamate metabolism (and and perhaps ROS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000941536966293652<>ScoreDetail__5468|IGFALS|0.000832372903060571__11179|SOD1|0.000941536966293652__ 0 0 0 0 0 295146 8922414 420892 18723 10261 ROS1 ROS ROS 26 0.0 ALS patients suggesting that aberrant glutamate metabolism (and and perhaps ROS may play a role in this disorder (Bensimon Bensimon et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 295160 8922414 420922 8306 4268 GIF GIF GIF 25 0.0 _lt_ 0.030 View Larger Version of this Image (61K 61K GIF file 1 JUMiner_v2.2 1 0 0 2 4268 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:4268|GIF|0.000666666666666667<>ScoreDetail__7097|MIF|0.0001038316122115__7408|MT3|0.000280701754385965__4268|GIF|0.000666666666666667__ 0 0 0 0 0 295163 8922414 420931 8306 4268 GIF GIF GIF 24 0.0 the mean View Larger Version of this Image (43K 43K GIF file 1 JUMiner_v2.2 1 0 0 2 4268 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:4268|GIF|0.000666666666666667<>ScoreDetail__7097|MIF|0.0001038316122115__7408|MT3|0.000280701754385965__4268|GIF|0.000666666666666667__ 0 0 0 0 0 295165 8922414 420936 8306 4268 GIF GIF GIF 28 0.0 wr group View Larger Version of this Image (65K 65K GIF file 1 JUMiner_v2.2 1 0 0 2 4268 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:4268|GIF|0.000666666666666667<>ScoreDetail__7097|MIF|0.0001038316122115__7408|MT3|0.000280701754385965__4268|GIF|0.000666666666666667__ 0 0 0 0 0 295167 8922414 420949 8306 4268 GIF GIF GIF 31 0.0 _lt_ 0.001 View Larger Version of this Image (50K 50K GIF file 1 JUMiner_v2.2 1 0 0 2 4268 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:4268|GIF|0.000666666666666667<>ScoreDetail__7097|MIF|0.0001038316122115__7408|MT3|0.000280701754385965__4268|GIF|0.000666666666666667__ 0 0 0 0 0 295169 8922414 420957 8306 4268 GIF GIF GIF 35 0.0 _lt_ 0.001 View Larger Version of this Image (55K 55K GIF file 1 JUMiner_v2.2 1 0 0 2 4268 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:4268|GIF|0.000666666666666667<>ScoreDetail__7097|MIF|0.0001038316122115__7408|MT3|0.000280701754385965__4268|GIF|0.000666666666666667__ 0 0 0 0 0 295171 8922414 420964 8306 4268 GIF GIF GIF 42 0.0 _lt_ 0.01 View Larger Version of this Image (66K 66K GIF file 1 JUMiner_v2.2 1 0 0 2 4268 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:4268|GIF|0.000666666666666667<>ScoreDetail__7097|MIF|0.0001038316122115__7408|MT3|0.000280701754385965__4268|GIF|0.000666666666666667__ 0 0 0 0 0 294098 9092140 418545 20996 11179 SOD1 ALS ALS 16 1.4 dismutase (CuZn-SOD) CuZn-SOD are associated with amyotrophic lateral sclerosis (ALS) ALS suggests that the disease arises from a perturbation of the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00171478594850555<>ScoreDetail__5468|IGFALS|0.000241298184231164__11179|SOD1|0.00171478594850555__ 0 0 0 0 0 294100 9092140 418549 20996 11179 SOD1 ALS ALS 14 1.4 important step for a better understanding of the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00171478594850555<>ScoreDetail__5468|IGFALS|0.000241298184231164__11179|SOD1|0.00171478594850555__ 0 0 0 0 0 294634 9172131 419809 20996 11179 SOD1 ALS ALS 16 2.7 central role in the pathogenesis of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294635 9172131 419810 18723 10261 ROS1 ROS ROS 21 0.0 cells counteract the deleterious effects of reactive oxygen species (ROS) ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294636 9172131 419811 18723 10261 ROS1 ROS ROS-induced 6 0.0 Neurons may be particularly vulnerable to ROS-induced oxidative DNA damage this is repaired by the base-excision repair 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294638 9172131 419812 20996 11179 SOD1 ALS ALS 20 2.7 endonuclease (APE) APE were determined in 11 patients with sporadic ALS and six age-matched control subjects 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294640 9172131 419813 20996 11179 SOD1 ALS ALS 16 2.7 and activity ( p _amp_#60 0.000007 were significantly lower in ALS subjects than in controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294641 9172131 419814 20996 11179 SOD1 ALS ALS 4 2.7 These findings suggest that ALS brain tissue is inefficient in repairing oxidative DNA damage 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294642 9172131 419815 20996 11179 SOD1 ALS ALS 3 2.7 Amyotrophic lateral sclerosis (ALS) ALS is a progressive age-related neurological disorder of unknown etiology associated 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294643 9172131 419815 20996 11179 SOD1 ALS ALS 28 2.7 motor neurons in the motor cortex and spinal cord 1 ALS occurs in both sporadic (~80-90_amp_#37; ~80-90_amp_#37 cases and familial (5-10_amp_#37; 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294645 9172131 419815 20996 11179 SOD1 ALS ALS 68 2.7 enzyme Cu/Zn Cu Zn superoxide dismutase (SOD1) SOD1 in familial ALS subjects 3 has initiated an intense investigation into the role 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294646 9172131 419815 20996 11179 SOD1 ALS ALS 86 2.7 into the role of oxidative stress in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294647 9172131 419816 20996 11179 SOD1 ALS ALS 23 2.7 oxidative damage to protein 4 5 have been identified in ALS subjects 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294648 9172131 419817 20996 11179 SOD1 ALS ALS 15 2.7 i.e 8-oxodeoxyguanosine has been detected in spinal cord tissue of ALS subjects 6 While these findings strongly support a role for 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294649 9172131 419817 20996 11179 SOD1 ALS ALS 39 2.7 mitochondrial dysfunction in the disease fewer than 20_amp_#37 of familial ALS cases map to the SOD1 gene 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294651 9172131 419818 20996 11179 SOD1 ALS ALS 7 2.7 Moreover the etiology and pathogenesis of sporadic ALS are unknown and Guam ALS has been epidemiologically associated with 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294652 9172131 419818 20996 11179 SOD1 ALS ALS 12 2.7 etiology and pathogenesis of sporadic ALS are unknown and Guam ALS has been epidemiologically associated with exposure to the DNAdamaging agent 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294653 9172131 419819 20996 11179 SOD1 ALS ALS 14 2.7 the hypothesis originally proposed by Bradley and Krasin 8 that ALS subjects have an abnormality (either either acquired or inherited in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294654 9172131 419820 20996 11179 SOD1 ALS ALS 11 2.7 levels of oxidative DNA damage in spinal cord tissue of ALS subjects 6 suggests that repair of oxidative DNA damage may 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294658 9172131 419822 20996 11179 SOD1 ALS ALS 73 2.7 cytoskeletal proteins and membrane (e.g e.g lipids all features of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294663 9172131 419826 20996 11179 SOD1 ALS ALS 17 2.7 the BER protein APE is deficient in the brains of ALS subjects 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294664 9172131 419828 20996 11179 SOD1 ALS ALS 13 2.7 first time that DNA repair has been directly examined in ALS brain tissue 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294665 9172131 419829 20996 11179 SOD1 ALS ALS 26 2.7 _amp_#177 4.8 years n _amp_#61 6 and subjects with sporadic ALS (66.4 66.4 _amp_#177 3.4 years n _amp_#61 11 was obtained 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294668 9172131 419836 3778 10620 CCL21 ECL ECL 21 0.0 using a HRP-conjugated goat anti-rabbit antibody and enhanced chemiluminescence (ECL, ECL Amersham according to the manufacturer_amp_#39 s instructions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294670 9172131 419842 19573 10691 SDS SDS SDS 11 0.0 reaction was stopped by the addition of loading buffer containing SDS and chilling samples were loaded onto a 0.9_amp_#37 agarose gel 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000519714331184849<>ScoreDetail__10691|SDS|0.000264830508474576__19440|SBDS|0.000519714331184849__ 0 0 0 0 0 294672 9172131 419844 20996 11179 SOD1 ALS ALS 27 2.7 extracts prepared from the frontal cortex of patients with sporadic ALS and age-matched controls with non-neurological disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294674 9172131 419845 20996 11179 SOD1 ALS ALS 19 2.7 APE levels in control ( r _amp_#61 _amp_#45 0.5 or ALS ( r _amp_#61 _amp_#45 0.2 tissue 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294676 9172131 419846 20996 11179 SOD1 ALS ALS 12 2.7 were reduced by 3-4_amp_#215 3 ( p _amp_#60 0.003 in ALS subjects compared with those in age-matched controls ( Fig 1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294677 9172131 419847 20996 11179 SOD1 ALS ALS 14 2.7 50 microg from several control ( n _amp_#61 4 and ALS ( n _amp_#61 3 subjects were analyzed by Western blotting 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294682 9172131 419848 20996 11179 SOD1 ALS ALS 9 2.7 In contrast to APE levels cortical MPG levels in ALS subjects were not significantly different ( p _amp_#60 0.47 from 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294685 9172131 419850 20996 11179 SOD1 ALS ALS 13 2.7 APE activity was significantly lower ( p _amp_#60 0.000007 in ALS subjects than in age-matched controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294686 9172131 419851 20996 11179 SOD1 ALS ALS 21 2.7 species ROS plays a central role in the pathogenesis of ALS 18 The hypothesis under study is that the variety of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294687 9172131 419851 20996 11179 SOD1 ALS ALS 39 2.7 the variety of biochemical and neuropathological changes that occur in ALS results from an underlying abnormality in repair of oxidative DNA 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294688 9172131 419851 18723 10261 ROS1 ROS ROS 12 0.0 to suggest that oxidative stress (e.g e.g reactive oxygen species ROS plays a central role in the pathogenesis of ALS 18 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294691 9172131 419852 20996 11179 SOD1 ALS ALS 56 2.7 apurinic site repaired by APE 8-Oxodeoxyguanosine levels are elevated in ALS spinal cord tissue 6 suggesting that repair of oxidative DNA 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294692 9172131 419852 18723 10261 ROS1 ROS ROS 3 0.0 Oxidative damage by ROS induces DNA strand breaks (e.g e.g apurinic sites DNA adduct 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 294694 9172131 419853 20996 11179 SOD1 ALS ALS 16 2.7 that the pivotal BER protein APE is severely deficient in ALS brain tissue 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294696 9172131 419854 20996 11179 SOD1 ALS ALS 12 2.7 of a similar reduction in the BER protein MPG in ALS brain tissue suggests a selective abnormality in APE 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294699 9172131 419855 20996 11179 SOD1 ALS ALS 23 2.7 ( n _amp_#61 3 and familial ( n _amp_#61 2 ALS using a double-stranded oligonucleotide probe containing a single AP site 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294701 9172131 419855 20996 11179 SOD1 ALS ALS 49 2.7 to be similarly reduced in lymphocytes of sporadic and familial ALS subjects when compared with age-matched nonneurological controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294703 9172131 419856 20996 11179 SOD1 ALS ALS 7 2.7 A similar reduction of APE in both ALS brain and lymphocyte tissue 22 suggests that the DNA repair 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294706 9172131 419857 20996 11179 SOD1 ALS ALS 17 2.7 22 in lymphocyte DNA from patients with sporadic and familial ALS suggests the latter may be the more likely mechanism 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294707 9172131 419858 20996 11179 SOD1 ALS ALS 10 2.7 The present findings and those of other investigators indicate that ALS brain and lymphocyte tissue are likely to be inefficient in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294708 9172131 419860 20996 11179 SOD1 ALS ALS 15 2.7 may explain the unexpected death of a significant number of ALS patients 2 years after they received irradiation therapy of the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 294709 9172131 419861 20996 11179 SOD1 ALS ALS 18 2.7 of BER in maintaining neuronal integrity and its importance in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000811179968626422<>ScoreDetail__5468|IGFALS|0.000600655497956466__11179|SOD1|0.000811179968626422__ 0 0 0 0 0 293717 9350962 417499 20996 11179 SOD1 ALS ALS 20 2.2 the spinal cord of transgenic familial amyotrophic lateral sclerosis (ALS) ALS mice and (2) 2 in the selectively vulnerable gerbil hippocampal 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293718 9350962 417499 3353 1368 CA1 CA1 CA1 30 0.0 mice and (2) 2 in the selectively vulnerable gerbil hippocampal CA1 region after a 5 min episode of forebrain ischemia and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293719 9350962 417503 20996 11179 SOD1 ALS ALS 36 2.2 1992 Smith et al. 1994 and amyotrophic lateral sclerosis (ALS) ALS ( Rosen et al. 1993 Gurney et al. 1996 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293720 9350962 417511 20996 11179 SOD1 ALS ALS 38 2.2 demonstrated its applicability in a transgenic mouse model of familial ALS and the gerbil model of transient forebrain ischemia 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293721 9350962 417519 8255 4236 GFER HPO HPO 14 0.0 ml of phosphate-buffered saline (PBS; PBS 10 mM Na 2 HPO 4 containing 0.9% NaCl and 0.01% EDTA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293722 9350962 417532 19988 17710 SIT1 sit sit 30 0.0 as a 3.34 mg/ml mg ml stock and allowed to sit at room temperature for 30 min 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>17710|SIT1|27240|No_GeneRif__18270|HHAT|55733|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 293723 9350962 417535 19988 17710 SIT1 sit sit 20 0.0 dilutions (1:125_amp_#x2013;1:10_amp_#xa0;000) 1 125_amp_#x2013 1 10_amp_#xa0 000 and allowed to sit for 45 min followed by two washes with 200 _amp_#x3bc 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>17710|SIT1|27240|No_GeneRif__18270|HHAT|55733|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 293724 9350962 417536 19988 17710 SIT1 sit sit 27 0.0 in 1% BSA/PBS BSA PBS and the plate allowed to sit at room temperature for 30 min 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>17710|SIT1|27240|No_GeneRif__18270|HHAT|55733|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 293725 9350962 417541 20996 11179 SOD1 ALS ALS 2 2.2 Transgenic familial ALS mice (G1H/+ G1H strain which highly express a mutant human 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293726 9350962 417552 20996 11179 SOD1 ALS ALS 2 2.2 The transgenic ALS mice and the gerbils subjected to forebrain ischemia were deeply 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293727 9350962 417552 3357 1377 CA5A CAVA cava 37 1.0 pH 7.2 until the venous effluent (sectioned sectioned superior vena cava was cleared of blood 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 293728 9350962 417565 3353 1368 CA1 CA1 CA1 32 0.0 counted over a 310 _amp_#x3bc m length of the hippocampal CA1 region 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293729 9350962 417569 20996 11179 SOD1 ALS ALS 23 2.2 various proteins in the spinal cords from the transgenic familial ALS and non-transgenic mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293730 9350962 417575 830 536 ANXA13 ISA ISA 12 0.0 proteins were separated on 4_amp_#x2013 20% gradient SDS-PAGE gels (ISA, ISA Natick MA at 10 _amp_#x3bc g of protein per lane 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293731 9350962 417580 19329 10524 SALL1 TBS TBS 6 0.0 The membranes were then washed in TBS (6_amp_#xd7;5 6_amp_#xd7 5 min and then treated with enhanced chemiluminescence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293732 9350962 417580 3778 10620 CCL21 ECL ECL 16 0.0 5 min and then treated with enhanced chemiluminescence reagents (ECL, ECL Amersham Buckinghamshire UK 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293733 9350962 417594 20996 11179 SOD1 ALS ALS 14 2.2 increase in MDA-derived immunostaining in the ventral horns of transgenic ALS mice at 120 days of age in comparison with that 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293734 9350962 417598 20996 11179 SOD1 ALS ALS 17 2.2 of spinal cord proteins from a non-transgenic and a transgenic ALS mouse (both both at 120 days of age shows that 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293735 9350962 417601 3353 1368 CA1 CA1 CA1 15 0.0 immunostaining (compared compared with cresyl violet-stained sections in the hippocampal CA1 region of gerbils subjected to 5 min of near complete 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293736 9350962 417604 3353 1368 CA1 CA1 CA1 14 0.0 figure the immunostaining was not confined to the more vulnerable CA1 region of the hippocampal formation but was also observed in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293737 9350962 417604 3355 1374 CA3 CA3 CA3 26 0.0 of the hippocampal formation but was also observed in the CA3 and CA4 subfields and the dentate gyrus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293738 9350962 417604 3356 1375 CA4 CA4 CA4 26 0.0 of the hippocampal formation but was also observed in the CA3 and CA4 subfields and the dentate gyrus 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293739 9350962 417604 3356 1375 CA4 CA4 CA4 28 0.0 hippocampal formation but was also observed in the CA3 and CA4 subfields and the dentate gyrus 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293740 9350962 417605 3353 1368 CA1 CA1 CA1 18 0.0 the MDA immunostaining is more widespread among the population of CA1 neurons compared with other hippocampal areas 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293741 9350962 417606 3353 1368 CA1 CA1 CA1 16 0.0 between the intensity of MDA-derived immunostaining and the loss of CA1 neurons as a function of the first 72 h after 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293742 9350962 417607 3353 1368 CA1 CA1 CA1 15 0.0 immunostaining is observed by 48 h when the loss of CA1 neurons is approximately 50% 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293743 9350962 417608 3353 1368 CA1 CA1 CA1 17 0.0 of increased MDA-related immunostaining is simultaneous with that of post-ischemic CA1 neuronal degeneration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293744 9350962 417620 3353 1368 CA1 CA1 CA1 13 0.0 scavenging or LP-inhibiting compounds are known to attenuate post-ischemic hippocampal CA1 degeneration ( Hall 1996 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293745 9350962 417621 20996 11179 SOD1 ALS ALS 6 2.2 Moreover recent studies with the transgenic ALS mouse model have shown a relative depletion in spinal cord 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293746 9350962 417624 3353 1368 CA1 CA1 CA1 19 0.0 ischemia model suggest that the time course of increasing hippocampal CA1 MDA-related immunostaining correlates with the progressive loss of neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293747 9350962 417625 3353 1368 CA1 CA1 CA1 15 0.0 significantly at the time point at which 50% of the CA1 neurons are lost 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293748 9350962 417640 20996 11179 SOD1 ALS ALS 15 2.2 the ventral horn of normal non-transgenic (A) A and transgenic ALS mice (B) B at 120 days of age 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293749 9350962 417641 20996 11179 SOD1 ALS ALS 15 2.2 of the ventral horn of the spinal cord of an ALS mouse showing that pre-adsorption of the primary anti-MDA antibody with 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293750 9350962 417643 20996 11179 SOD1 ALS ALS 8 2.2 Fig 5.Immunoblots of spinal cord proteins from transgenic ALS (G1H/+) G1H and non-transgenic ALS mice with anti-MDA-RSA antibody 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293751 9350962 417643 20996 11179 SOD1 ALS ALS 12 2.2 spinal cord proteins from transgenic ALS (G1H/+) G1H and non-transgenic ALS mice with anti-MDA-RSA antibody 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00101682528081854<>ScoreDetail__5468|IGFALS|0.000274530069116982__11179|SOD1|0.00101682528081854__ 0 0 0 0 0 293752 9350962 417648 3353 1368 CA1 CA1 CA1 7 0.0 Also shown are examples of cresyl violet-stained CA1 neurons in a sham (C) C and a 48 h 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293753 9350962 417650 3353 1368 CA1 CA1 CA1 12 0.0 comparison of the time courses of the loss of hippocampal CA1 neurons (counts counts of cresyl violet stained neurons in a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 293754 9350962 417650 3353 1368 CA1 CA1 CA1 28 0.0 stained neurons in a 315 micron segment of the medial CA1 region and the appearance of increased MDA-derived immunostaining (semi-quantitative semi-quantitative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290822 9437657 411969 20996 11179 SOD1 ALS ALS 22 0.0 neurodegenerative diseases including Alzheimer disease and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000654854754686994<>ScoreDetail__5468|IGFALS|0.00029915041282757__11179|SOD1|0.000654854754686994__ 0 0 0 0 0 290823 9437657 411975 18723 10261 ROS1 ROS ROS 6 0.0 The production of reactive oxygen species (ROS) ROS was examined using the fluorescent probe dichlorofluorescin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290824 9437657 411976 18723 10261 ROS1 ROS ROS 7 0.0 By itself AlCl3 had little effect on ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290825 9437657 411977 18723 10261 ROS1 ROS ROS 5 0.0 However AlCl3 pretreatment potentiated the ROS production induced by 50 microM Fe2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290826 9437657 411978 18723 10261 ROS1 ROS ROS 12 0.0 suggest that aluminum may facilitate increases in intracellular Ca2 and ROS and potentially contribute to neurotoxicity induced by other neurotoxicants 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290827 9441250 411984 20996 11179 SOD1 ALS ALS 10 0.9 presently the etiology and pathogenesis of amyotrophic lateral sclerosis (ALS) ALS are unknown 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160649814407188<>ScoreDetail__5468|IGFALS|8.02117590438758e-05__11179|SOD1|0.00160649814407188__ 0 0 0 0 0 290828 9441250 411986 20996 11179 SOD1 ALS ALS 21 0.9 of the pathogenesis of the familial and sporadic forms of ALS and thus provide a basis for rational therapeutic approaches 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160649814407188<>ScoreDetail__5468|IGFALS|8.02117590438758e-05__11179|SOD1|0.00160649814407188__ 0 0 0 0 0 290829 9441250 411987 20996 11179 SOD1 ALS ALS 13 0.9 recent findings on the pathogenesis of the familial form of ALS and their implications for the sporadic form are discussed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160649814407188<>ScoreDetail__5468|IGFALS|8.02117590438758e-05__11179|SOD1|0.00160649814407188__ 0 0 0 0 0 291073 9462746 412764 18723 10261 ROS1 ROS ROS 3 0.0 Reactive oxygen species (ROS) ROS have been implicated in a wide range of degenerative processes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 291074 9462746 412765 18723 10261 ROS1 ROS ROS 0 0.0 ROS are generated by mitochondria as the toxic by-products of oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 291076 9462746 412770 18723 10261 ROS1 ROS ROS 24 0.0 barrier progressive neuropathology is caused by excessive mitochondrial production of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 290128 9633809 410561 22055 11764 TG TGN TgN 14 0.3 mutated human CuZn superoxide dismutase (SOD1) SOD1 gene gly93-->ala TgN(SOD1-G93A)G1H TgN SOD1-G93A G1H line found in some patients with familial ALS 3 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 290132 9633809 410564 22055 11764 TG TGN TgN 34 0.3 to the course of motor neuron disease in the TgN(SOD1-G93A)G1H TgN SOD1-G93A G1H FALS mice 3 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 290133 9633809 410566 22055 11764 TG TGN TgN 5 0.3 Compared to non-transgenic littermates the TgN(SOD1-G93A)G1H TgN SOD1-G93A G1H mice showed significantly increased numbers of activated astrocytes 3 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 285024 9675268 403033 18723 10261 ROS1 ROS ROS 8 0.3 Previous studies have implicated mitochondria-derived reactive oxygen species (ROS) ROS in both the aging process and age-related diseases such as 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285025 9675268 403056 24185 29175 WDTC1 ADP ADP 34 0.0 water with a simultaneous production of ATP through phosphorylation of ADP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 285026 9675268 403058 18723 10261 ROS1 ROS ROS 33 0.3 been well established that mitochondrial macromolecules undergo damage by self-generated ROS 11 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285027 9675268 403059 18723 10261 ROS1 ROS ROS 25 0.3 under induced metabolic stress tend to form higher levels of ROS 3 4 12 13 14 and 15 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285028 9675268 403060 18723 10261 ROS1 ROS ROS 1 0.3 These ROS can contribute to oxidative damage of mitochondrial lipids proteins and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285029 9675268 403086 6791 3467 ESR1 ESR ESR 4 0.0 Succinate-induced mitochondrial stimulation and ESR spin labeling 2.4.1 5-NS lipid spin labeling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 285030 9675268 403167 18723 10261 ROS1 ROS ROS 19 0.3 of oxidative events thought to occur in the membrane following ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285033 9675268 403185 6554 3309 ELA2 HNE HNE 1 0.0 Since HNE adducts protrude from proteins into the hydrophobic domain of bilayers 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 285034 9675268 403187 18723 10261 ROS1 ROS ROS 7 0.3 This study also investigated the effect of ROS as generated by metabolic stimulation of mitochondria on cytoskeletal and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285036 9675268 403189 18723 10261 ROS1 ROS ROS 60 0.3 in cytoskeletal and transmembrane proteins due to an onslaught by ROS generated following succinate-induced stimulation of mitochondrial respiration 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285037 9675268 403190 18723 10261 ROS1 ROS ROS 11 0.3 of proteins can be a result of direct interaction with ROS like OH* radicals or possibly by interaction with toxic aldehydic 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285038 9675268 403193 18723 10261 ROS1 ROS ROS 16 0.3 AD amyotrophic lateral sclerosis and Parkinson_amp_#x2019 s disease have implicated ROS in their pathogenesis 37 40 41 and 42 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285040 9675268 403196 18723 10261 ROS1 ROS ROS-generating 19 0.0 redox metal ions (i.e i.e iron and copper and particular ROS-generating enzymes and peptides (e.g e.g nitric oxide synthase xanthine oxidase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 285041 9675268 403245 18723 10261 ROS1 ROS ROS 16 0.3 spin probe intercalated within it is susceptible to attack by ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 285042 9675268 403246 18723 10261 ROS1 ROS ROS 11 0.3 resultant more polar lipid hydroperoxides formed due to interaction with ROS move towards the aqueous phase creating a void in the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 286045 9711902 404620 20996 11179 SOD1 ALS ALS 34 0.0 conditions including Alzheimer's disease (AD), AD amyotrophic lateral sclerosis (ALS), ALS Parkinson's disease (PD), PD and ischemia 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000527289207775843<>ScoreDetail__5468|IGFALS|0.000158679784195493__11179|SOD1|0.000527289207775843__ 0 0 0 0 0 286046 9711902 404622 11961 6679 LPP LPP LPP 29 0.0 give rise to a variety of lipid peroxidation products (LPP), LPP including 4-hydroxynonenal (HNE) HNE and malondialdehyde (MD) MD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286047 9711902 404622 6554 3309 ELA2 HNE HNE 32 0.0 variety of lipid peroxidation products (LPP), LPP including 4-hydroxynonenal (HNE) HNE and malondialdehyde (MD) MD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286048 9711902 404624 11961 6679 LPP LPP LPP 6 0.0 Emerging data suggest that LP and LPP may underlie the neuronal alterations and neurotoxicity observed in numerous 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286049 9711902 404625 11961 6679 LPP LPP LPP 12 0.0 this involvement include the detection of LP and formation of LPP in a variety of neuropathological conditions including AD ALS PD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286050 9711902 404625 20996 11179 SOD1 ALS ALS 21 0.0 of LPP in a variety of neuropathological conditions including AD ALS PD and ischemia 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000527289207775843<>ScoreDetail__5468|IGFALS|0.000158679784195493__11179|SOD1|0.000527289207775843__ 0 0 0 0 0 286051 9711902 404626 11961 6679 LPP LPP LPP 4 0.0 Secondly direct application of LPP either in vivo or in vitro has been shown to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286052 9711902 404627 11961 6679 LPP LPP LPP 6 0.0 Furthermore prevention of LP and subsequent LPP formation have been demonstrated to be neuroprotective in a variety 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286053 9711902 404628 11961 6679 LPP LPP LPP 3 0.0 Additionally LP and LPP have been implicated in the modulation of a wide array 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286955 9745361 405750 19573 10691 SDS SDS SDS 24 0.0 gel electrophoresis (SDS-PAGE) SDS-PAGE if electrophoresed immediately after solubilization in SDS even when reducing agents are omitted ( Fig 3 lane 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000269526876667266<>ScoreDetail__10691|SDS|4.08897612037946e-05__19440|SBDS|0.000269526876667266__ 0 0 0 0 0 286956 9745361 405752 6181 3058 DTNB DTNB DTNB 43 0.0 the sulphydryl-specific oxidant 5,5_amp_#x2032;-dithio-bis(2-nitrobenzoic) 5 5_amp_#x2032 -dithio-bis 2-nitrobenzoic acid (DTNB) DTNB (lane lane 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286957 9745361 405765 20996 11179 SOD1 ALS ALS 27 1.4 others e.g spinal motoneurone synapses in amyotrophic lateral sclerosis (ALS)] ALS 47 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00169113875352655<>ScoreDetail__5468|IGFALS|0.000410583941605839__11179|SOD1|0.00169113875352655__ 0 0 0 0 0 286960 9745361 405780 20996 11179 SOD1 ALS ALS 3 1.4 The case of ALS illustrates the involvement of glutamate transporters in a neurodegenerative pathology 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00169113875352655<>ScoreDetail__5468|IGFALS|0.000410583941605839__11179|SOD1|0.00169113875352655__ 0 0 0 0 0 286961 9745361 405781 20996 11179 SOD1 ALS ALS 5 1.4 In the sporadic form of ALS (sALS), sALS a direct link between transporter defect and neurodegeneration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00169113875352655<>ScoreDetail__5468|IGFALS|0.000410583941605839__11179|SOD1|0.00169113875352655__ 0 0 0 0 0 286967 9745361 405785 20996 11179 SOD1 ALS ALS 9 1.4 Studies by Rosen and colleagues 53 linked ALS to reactive oxygen species toxicity since they showed that 15_amp_#x2013 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00169113875352655<>ScoreDetail__5468|IGFALS|0.000410583941605839__11179|SOD1|0.00169113875352655__ 0 0 0 0 0 286970 9745361 405786 20996 11179 SOD1 ALS ALS 13 1.4 for mutant SOD1 developed selective motoneurone pathology strongly resembling human ALS (Ref Ref 54 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00169113875352655<>ScoreDetail__5468|IGFALS|0.000410583941605839__11179|SOD1|0.00169113875352655__ 0 0 0 0 0 286974 9745361 405790 20996 11179 SOD1 ALS ALS-linked 14 1.4 result in defective glutamate transport since transgenic mice expressing an ALS-linked SOD1 mutation show increased tyrosine nitration of glutamate transporters 43 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00169113875352655<>ScoreDetail__5468|IGFALS|0.000410583941605839__11179|SOD1|0.00169113875352655__ 0 0 0 0 0 286980 9745361 405823 18723 10261 ROS1 ROS ROS 9 0.0 The reciprocal interactions between glutamate and reactive oxygen species (ROS)-mediated ROS -mediated events might start a vicious amplifying cycle of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286981 9745361 405828 18723 10261 ROS1 ROS ROS 0 0.0 ROS are among the products and mediators of these enzymatic processes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286983 9745361 405830 18723 10261 ROS1 ROS ROS 11 0.0 amyotrophic lateral sclerosis peroxynitrite (ONOO ONOO _amp_#x2212 or other noxious ROS can be formed as a result of altered function of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286984 9745361 405831 18723 10261 ROS1 ROS ROS 6 0.0 In addition to being directly neurotoxic ROS oxidize proteins crucial for excitatory synapse function such as the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286985 9745361 405838 6181 3058 DTNB DTNB DTNB 23 0.0 or saline plus 5,5_amp_#x2032;-dithio-bis(2-nitrobenzoic) 5 5_amp_#x2032 -dithio-bis 2-nitrobenzoic acid (DTNB; DTNB 500 _amp_#x3bc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286986 9745361 405840 6181 3058 DTNB DTNB DTNB 10 0.0 As shown at the top of the figure DTT and DTNB act specifically on the redox equilibrium of sulphydryl groups shifting 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286987 9745361 405840 6181 3058 DTNB DTNB DTNB 33 0.0 fully reduced (DTT) DTT or the fully oxidized state (DTNB) DTNB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286988 9745361 405842 6181 3058 DTNB DTNB DTNB 18 0.0 changes if the cells had been exposed to DTT and DTNB in sequence b Biological oxidants interact with the redox regulatory 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286989 9745361 405843 6181 3058 DTNB DTNB DTNB 33 0.0 and peroxynitrite (ONOO ONOO _amp_#x2212 nominally 300 _amp_#x3bc instead of DTNB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286990 9745361 405844 6181 3058 DTNB DTNB DTNB 10 0.0 Both H 2 O 2 and ONOO _amp_#x2212 like DTNB reversed DTT potentiation bringing the uptake current below control level 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286991 9745361 405848 19573 10691 SDS SDS SDS 26 0.0 solubilized with 10 mg ml -1 sodium dodecyl sulphate (SDS), SDS (lane lane 2 incubated 2 h on ice before solubilization 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000269526876667266<>ScoreDetail__10691|SDS|4.08897612037946e-05__19440|SBDS|0.000269526876667266__ 0 0 0 0 0 286992 9745361 405848 19573 10691 SDS SDS SDS 37 0.0 lane 2 incubated 2 h on ice before solubilization in SDS (lane lane 3 incubated for 2 h on ice with 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000269526876667266<>ScoreDetail__10691|SDS|4.08897612037946e-05__19440|SBDS|0.000269526876667266__ 0 0 0 0 0 286993 9745361 405848 6181 3058 DTNB DTNB DTNB 51 0.0 with 2 m 5,5_amp_#x2032;-dithio-bis(2-nitrobenzoic) 5 5_amp_#x2032 -dithio-bis 2-nitrobenzoic acid (DTNB) DTNB before solubilization in SDS (lane lane 4 incubated for 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286994 9745361 405848 19573 10691 SDS SDS SDS 55 0.0 5 5_amp_#x2032 -dithio-bis 2-nitrobenzoic acid (DTNB) DTNB before solubilization in SDS (lane lane 4 incubated for 2 h on ice with 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000269526876667266<>ScoreDetail__10691|SDS|4.08897612037946e-05__19440|SBDS|0.000269526876667266__ 0 0 0 0 0 286995 9745361 405848 19573 10691 SDS SDS SDS 72 0.0 ice with 30 m dithiothreitol (DTT) DTT before solubilization in SDS or (lane lane 5 incubated for 2 h on ice 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000269526876667266<>ScoreDetail__10691|SDS|4.08897612037946e-05__19440|SBDS|0.000269526876667266__ 0 0 0 0 0 286996 9745361 405848 6181 3058 DTNB DTNB DTNB 85 0.0 5 incubated for 2 h on ice with 2 mM DTNB and then for 30 min with 30 mM DTT before 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 286997 9745361 405848 19573 10691 SDS SDS SDS 98 0.0 for 30 min with 30 mM DTT before solubilization in SDS 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000269526876667266<>ScoreDetail__10691|SDS|4.08897612037946e-05__19440|SBDS|0.000269526876667266__ 0 0 0 0 0 286998 9745361 405850 19573 10691 SDS SDS SDS-resistant 7 0.5 Note that the oxidation dependent formation of SDS-resistant protein complexes shown here is different from the oxidation independent 3 JUMiner_v2.2 1 2 sds 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000269526876667266<>ScoreDetail__10691|SDS|4.08897612037946e-05__19440|SBDS|0.000269526876667266__ 0 0 0 0 0 284176 9856861 401486 18723 10261 ROS1 ROS ROS 7 0.0 Evidence is growing that reactive oxygen species (ROS), ROS by-products of (normal) normal cellular aerobic metabolism are involved in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284177 9856861 401487 20996 11179 SOD1 ALS ALS 8 0.8 One of these diseases is amyotrophic lateral sclerosis (ALS), ALS in which motoneurons die leading to paralysis and death 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000780065312741185<>ScoreDetail__5468|IGFALS|0.00016818594638232__11179|SOD1|0.000780065312741185__ 0 0 0 0 0 284178 9856861 401488 20996 11179 SOD1 ALS ALS 13 0.8 ROS are the cause of (apoptotic) apoptotic motoneuron death in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000780065312741185<>ScoreDetail__5468|IGFALS|0.00016818594638232__11179|SOD1|0.000780065312741185__ 0 0 0 0 0 284179 9856861 401488 18723 10261 ROS1 ROS ROS 4 0.0 It remains uncertain whether ROS are the cause of (apoptotic) apoptotic motoneuron death in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284180 9856861 401489 18723 10261 ROS1 ROS ROS 6 0.0 To further understand the role of ROS in motoneuron death we investigated the effects of ROS on 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284181 9856861 401489 18723 10261 ROS1 ROS ROS 15 0.0 of ROS in motoneuron death we investigated the effects of ROS on isolated spinal rat motoneurons in culture 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284182 9856861 401490 18723 10261 ROS1 ROS ROS 0 0.0 ROS were generated with a combination of iron(III) iron III and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284184 9856861 401493 18723 10261 ROS1 ROS ROS 0 0.0 ROS treatment caused apoptotic motoneuron death low doses of iron(III)/ iron 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284185 9856861 401493 18723 10261 ROS1 ROS ROS 26 0.0 complete apoptosis ending in nuclear fragmentation while high doses of ROS resulted in incomplete apoptosis (nuclear nuclear condensation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 284186 9856861 401494 18723 10261 ROS1 ROS ROS 6 0.0 Thus depending on the dose of ROS the motoneurons complete the apoptotic pathway (low low dose or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280277 10077670 394963 5344 2595 CYP1A1 CYP CyP 11 0.0 groups of drugs inhibit the rotamase activity of cyclophilins (CyP), CyP but only the immunosuppressant analogs inhibit calcineurin activity these data 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280292 10077670 394986 6741 3439 ERCC8 CSA CsA 5 0.0 Drugs included NMDA the immunosuppressants CsA (1 1 _amp_#x003bc M CsG (Nva-2-Cs, Nva-2-Cs 1 _amp_#x003bc M 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280293 10077670 394994 20247 20116 SLC25A29 CACL CaCl 39 1.0 calmodulin and 25 nM calyculin A and either 0.5 mM CaCl 2 or 1 mM EGTA without CaCl 2 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 280294 10077670 394994 20247 20116 SLC25A29 CACL CaCl 46 1.0 either 0.5 mM CaCl 2 or 1 mM EGTA without CaCl 2 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 280296 10077670 395000 6741 3439 ERCC8 CSA CsA 6 0.0 Cells were treated with 1 _amp_#x003bc M CsA 48 hr after infection and were harvested 24 hr later 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280298 10077670 395003 6741 3439 ERCC8 CSA CsA 4 0.0 Cells were treated with CsA and were harvested as described above for the rotamase assay 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280312 10077670 395026 6741 3439 ERCC8 CSA CsA 4 0.0 As expected treatment with CsA a calcineurin inhibitor dramatically decreased calcineurin in all cases by 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280317 10077670 395031 6741 3439 ERCC8 CSA CsA 2 0.0 Effect of CsA and CsA Analogs on Cell Death Induced by Mutant SOD 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280318 10077670 395031 6741 3439 ERCC8 CSA CsA 4 0.0 Effect of CsA and CsA Analogs on Cell Death Induced by Mutant SOD Expression or 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280320 10077670 395033 6741 3439 ERCC8 CSA CsA 9 0.0 In preliminary studies we treated cells expressing SODV148G with CsA and found that 1 and 3 _amp_#x003bc M concentrations significantly 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280321 10077670 395034 6741 3439 ERCC8 CSA CsA 5 0.0 Fig 3 A shows that CsA CsG and FK506 immunosuppressant drugs known to inhibit calcineurin and 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280322 10077670 395035 6741 3439 ERCC8 CSA CsA 6 0.0 The potentiation of cell death by CsA did not reach 100_amp_#x00025 because the viral infection efficiency was 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280323 10077670 395038 20996 11179 SOD1 SOD SOD-expressing 9 2.4 Although cell death was enhanced after treatment of mutant SOD-expressing cells (Fig Fig 3 A CsA dramatically decreased calcineurin activity 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 280324 10077670 395038 6741 3439 ERCC8 CSA CsA 15 0.0 after treatment of mutant SOD-expressing cells (Fig Fig 3 A CsA dramatically decreased calcineurin activity in all cases (Fig Fig 2 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280326 10077670 395041 6741 3439 ERCC8 CSA CsA 12 0.0 the effect of PKF 211_amp_#x02013 811 and PSC 833 nonimmunosuppressant CsA analogs that inhibit cyclophilin rotamase activity but not calcineurin ( 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280327 10077670 395043 6741 3439 ERCC8 CSA CsA 4 0.0 The results suggest that CsA enhances SODV148G-induced cell death by inhibiting cyclophilin rotamase activity and 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280328 10077670 395044 6741 3439 ERCC8 CSA CsA 15 0.0 that does not bind to cyclophilin and treatment with dansylated CsA which has relatively poor binding to cyclophilins at the 1 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280330 10077670 395045 6741 3439 ERCC8 CSA CsA 8 0.0 In contrast to the above results both immunosuppressants (CsA, CsA CsG and FK506 and nonimmunosuppressants (PKF PKF 211_amp_#x02013 811 and 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280332 10077670 395046 6741 3439 ERCC8 CSA CsA 5 0.0 As expected CsH and dansylated CsA had relatively little effect on cell death after NGF withdrawal 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280334 10077670 395049 6741 3439 ERCC8 CSA CsA 1 0.0 Both CsA and PKF 211_amp_#x02013 811 significantly enhanced the mutant SOD-induced death 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280335 10077670 395050 6741 3439 ERCC8 CSA CsA 3 0.0 In contrast both CsA and PKF211_amp_#x02013 811 protected hippocampal neurons from NMDA-induced death (Fig 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280336 10077670 395052 6741 3439 ERCC8 CSA CsA 2 0.0 Effect of CsA on Rotamase Activity Levels 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280338 10077670 395053 6741 3439 ERCC8 CSA CsA 5 0.0 The above studies suggested that CsA and its immunosuppressive analogs might enhance SOD mutant-induced cell death 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280339 10077670 395054 6741 3439 ERCC8 CSA CsA 31 0.0 and mock cells making the former cells more sensitive to CsA 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280340 10077670 395055 20996 11179 SOD1 SOD SOD-expressing 10 2.4 Therefore we measured rotamase activity in mock WT and mutant SOD-expressing cells before and after CsA treatment 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 280341 10077670 395055 6741 3439 ERCC8 CSA CsA 15 0.0 in mock WT and mutant SOD-expressing cells before and after CsA treatment 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280342 10077670 395056 6741 3439 ERCC8 CSA CsA 14 0.0 all cells had a similar amount of rotamase activity before CsA treatment and that CsA decreased rotamase activity to a similar 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280343 10077670 395056 6741 3439 ERCC8 CSA CsA 18 0.0 similar amount of rotamase activity before CsA treatment and that CsA decreased rotamase activity to a similar level in all three 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280344 10077670 395056 6741 3439 ERCC8 CSA CsA-treated 46 0.0 differences in this inhibition in the SODV148G-expressing cells vs other CsA-treated groups 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280345 10077670 395058 20996 11179 SOD1 SOD SOD-expressing 5 2.4 These results suggested that mutant SOD-expressing cells might be more sensitive to effects of decreased rotamase 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 280348 10077670 395059 20996 11179 SOD1 SOD SOD-expressing 40 2.4 SODWT-expressing cells than in mock uninfected cells and the mutant SOD-expressing cells had a slightly greater decrease in SOD activity than 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 280350 10077670 395059 6741 3439 ERCC8 CSA CsA 16 0.0 SOD activity was similar in mock SODWT- and SODV148G-expressing cells CsA caused a decrease in SOD activity that was significantly (albeit 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280374 10077670 395071 6741 3439 ERCC8 CSA CsA 19 0.0 rescue of mutant SOD-induced cell death would be decreased with CsA treatment 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280378 10077670 395072 6741 3439 ERCC8 CSA CsA 29 0.0 to 21.9_amp_#x00025 and that the CyPA rescue was decreased by CsA (changing changing cell death from 21.9_amp_#x00025 back to 54.6_amp_#x00025 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280379 10077670 395073 20996 11179 SOD1 SOD SOD-expressing 15 2.4 the rotamase activity is vital for the survival of mutant SOD-expressing cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 280388 10077670 395084 6741 3439 ERCC8 CSA CsA 18 0.0 in mutant SOD-induced cell death we tested the effect of CsA a calcineurin inhibitor on cell viability 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280389 10077670 395085 6741 3439 ERCC8 CSA CsA 0 0.0 CsA enhanced death of cells expressing SODV148G but not mock-infected cells 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280390 10077670 395085 6741 3439 ERCC8 CSA CsA 13 0.0 of cells expressing SODV148G but not mock-infected cells even though CsA treatment caused a greater decrease in calcineurin activity in mock-infected 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280392 10077670 395087 6741 3439 ERCC8 CSA CsA 3 0.0 We questioned whether CsA also might influence cell death by its ability to block 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280396 10077670 395090 6741 3439 ERCC8 CSA CsA 9 0.0 For NGF withdrawal and NMDA toxicity the ability of CsA and its analogs to block the MPTP and their ability 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280398 10077670 395091 6741 3439 ERCC8 CSA CsA 4 0.0 On the other hand CsA and its analogs enhanced death induced by mutant SOD 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280399 10077670 395093 6741 3439 ERCC8 CSA CsA 9 0.0 In addition to inhibiting calcineurin and blocking the MPTP CsA blocks peptidyl prolyl isomerase (rotamase) rotamase activity of cyclophilins 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280400 10077670 395095 6741 3439 ERCC8 CSA CsA 3 0.0 To test whether CsA enhanced SODV148G toxicity through rotamase inhibition we examined the effect 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280401 10077670 395095 6741 3439 ERCC8 CSA CsA 16 0.0 through rotamase inhibition we examined the effect of immunosuppressants (CsA CsA CsG and FK506 as well as nonimmunosuppressants (PKF PKF 211_amp_#x02013 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280403 10077670 395097 6741 3439 ERCC8 CSA CsA 17 0.0 apoptosis induced by mutant SOD indicating that the action of CsA may be related to rotamase inhibition and not to calcineurin 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280412 10077670 395102 20996 11179 SOD1 SOD SOD-expressing 27 2.4 similar rotamase activity after CsA treatment in WT- and mutant SOD-expressing cells suggests that cells expressing mutant SOD have a greater 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 280414 10077670 395102 6741 3439 ERCC8 CSA CsA 21 0.0 death and that there is roughly similar rotamase activity after CsA treatment in WT- and mutant SOD-expressing cells suggests that cells 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280425 10077670 395113 6741 3439 ERCC8 CSA CsA 30 0.0 enzyme was more sensitive than WT to the effects of CsA perhaps because the mutant SOD was more sensitive to a 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280428 10077670 395118 6741 3439 ERCC8 CSA CsA 11 0.0 do not believe that the enhancement of death seen after CsA treatment of PC12 cells expressing mutant SOD is related to 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280430 10077670 395119 6741 3439 ERCC8 CSA CsA 2 0.0 In addition CsA actually decreased cell death in PC12 cells after NGF withdrawal 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280432 10077670 395130 19573 10691 SDS SDS SDS 5 0.0 Cell lysates were subjected to SDS/PAGE, SDS PAGE were blotted (more more ... 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000342255913797283<>ScoreDetail__19440|SBDS|0.000342255913797283__10691|SDS|7.38606987222099e-05__ 0 0 0 0 0 280433 10077670 395131 6741 3439 ERCC8 CSA CsA 4 0.0 Figure 2 Assessment of CsA influence on calcineurin activity and immunoblot analysis of calcineurin at 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280436 10077670 395134 6741 3439 ERCC8 CSA CsA 2 0.0 Figure 3 CsA and its immunosuppressant and nonimmunosuppressant analogs potentiate cell death induced 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280437 10077670 395136 6741 3439 ERCC8 CSA CsA 7 0.0 Figure 4 The effect of the immunosuppressant CsA or its nonimmunosuppressive analog PKF211_amp_#x02013 811 on cell survival of 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280443 10077670 395142 6741 3439 ERCC8 CSA CsA 21 0.0 well as from the enhanced death seen in combination with CsA 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280444 10077670 395143 20996 11179 SOD1 ALS ALS 0 2.4 ALS amyotrophic lateral sclerosis SOD Cu/Zn Cu Zn superoxide dismutase-1 FALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00116678687263326<>ScoreDetail__5468|IGFALS|0.00044478157989652__11179|SOD1|0.00116678687263326__ 0 0 0 0 0 280446 10077670 395143 20996 11179 SOD1 ALS ALS 10 2.4 lateral sclerosis SOD Cu/Zn Cu Zn superoxide dismutase-1 FALS familial ALS CyP cyclophilin WT wild-type NGF nerve growth factor AdV adenovirus 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00116678687263326<>ScoreDetail__5468|IGFALS|0.00044478157989652__11179|SOD1|0.00116678687263326__ 0 0 0 0 0 280448 10077670 395143 5344 2595 CYP1A1 CYP CyP 11 0.2 sclerosis SOD Cu/Zn Cu Zn superoxide dismutase-1 FALS familial ALS CyP cyclophilin WT wild-type NGF nerve growth factor AdV adenovirus CsA 5 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 280449 10077670 395143 6741 3439 ERCC8 CSA CsA 21 0.0 CyP cyclophilin WT wild-type NGF nerve growth factor AdV adenovirus CsA cyclosporin A NMDA N -methyl-d -aspartate MPTP mitochondrial permeability transition 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280450 10077670 395144 20996 11179 SOD1 ALS ALS 3 2.4 Amyotrophic lateral sclerosis (ALS) ALS is a fatal progressive neurodegenerative disease that targets motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00116678687263326<>ScoreDetail__5468|IGFALS|0.00044478157989652__11179|SOD1|0.00116678687263326__ 0 0 0 0 0 280451 10077670 395145 20996 11179 SOD1 ALS ALS 3 2.4 Approximately 10_amp_#x02013 15_amp_#x00025 of ALS cases are familial and manifest an autosomal dominant inheritance pattern 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00116678687263326<>ScoreDetail__5468|IGFALS|0.00044478157989652__11179|SOD1|0.00116678687263326__ 0 0 0 0 0 280453 10077670 395146 20996 11179 SOD1 ALS ALS 19 2.4 found to be associated with 20_amp_#x00025 of cases of familial ALS (FALS) FALS ( 1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00116678687263326<>ScoreDetail__5468|IGFALS|0.00044478157989652__11179|SOD1|0.00116678687263326__ 0 0 0 0 0 280464 10077670 395154 6741 3439 ERCC8 CSA CsA 30 0.0 of calcineurin such as the immunosuppressant compounds cyclosporin A (CsA), CsA CsG and FK506 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 280465 10077670 395155 5344 2595 CYP1A1 CYP CyP 8 0.0 Immunosuppressants bind immunophilins _amp_#x0005b the drug receptor e.g. cyclophilins (CyP) CyP or FK binding protein_amp_#x0005d and the drug-immunophilin complex inhibits calcineurin 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 280468 10077670 395158 20996 11179 SOD1 SOD SOD-expressing 10 2.4 We asked whether the increase in O 2 in mutant SOD-expressing cells leads to calcineurin inactivation and contributes to FALS-related cell 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 280471 10077670 395160 6741 3439 ERCC8 CSA CsA 7 0.0 Most importantly we show that immunosuppressant drugs (CsA, CsA CsG and FK506 enhance cell death induced by mutant SOD 14 JUMiner_v2.2 1 0 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000747197048186507<>ScoreDetail__3439|ERCC8|0.000425891670957366__5244|HSPA9|0.000747197048186507__2440|CSH1|0.000657473878740493__ 0 0 0 0 0 281642 10190145 396301 18723 10261 ROS1 ROS ROS 6 0.0 In the CNS reactive oxygen species (ROS) ROS have been implicated in a wide range of degenerative processes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 281643 10190145 396302 18723 10261 ROS1 ROS ROS 15 0.0 unknown and there is little information on possible roles of ROS in cell injury and the process on recovery of astrocytes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 281644 10190145 396306 24185 29175 WDTC1 ADP ADP-ribose 3 0.0 Caffeine ryanodine cyclic ADP-ribose (endogenous endogenous ryanodine receptor agonist and beta-NAD (precursor precursor of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 281645 10190145 396306 24185 29175 WDTC1 ADP ADP-ribose 13 0.0 endogenous ryanodine receptor agonist and beta-NAD (precursor precursor of cyclic ADP-ribose suppressed partially the stimulatory effect of H2O2 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 281646 10190145 396308 24185 29175 WDTC1 ADP ADP-ribose 16 0.0 on H2O2-induced thymidine incorporation was suppressed by caffeine ryanodine cyclic ADP-ribose and beta-NAD 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 276496 10229967 388848 20996 11179 SOD1 ALS ALS 17 0.0 AD Parkinson's disease (PD) PD and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000790083845281272<>ScoreDetail__5468|IGFALS|0.00044089550776466__11179|SOD1|0.000790083845281272__ 0 0 0 0 0 276497 10229967 388850 21472 19420 STOML3 SRO SRO 12 0.0 presented here suggests that the species reactive to oxygen (SRO) SRO play a direct part in the aetiology and/or and or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277405 10385054 390304 20996 11179 SOD1 ALS ALS 20 2.7 from FALS patients with SOD-1 gene mutations patients with sporadic ALS and controls to handle oxidative stress induced by ionising radiation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277406 10385054 390305 20996 11179 SOD1 ALS ALS 22 2.7 fluorescence of a radical-reactive fluorochrome in the cells from familial ALS patients with SOD-1 gene mutations (2.14_amp_#xb1;1.06 2.14_amp_#xb1 1.06 Gy _amp_#x2212 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277408 10385054 390305 20996 11179 SOD1 ALS ALS 36 2.7 (2.14_amp_#xb1;1.06 2.14_amp_#xb1 1.06 Gy _amp_#x2212 1 and patients with sporadic ALS (1.38_amp_#xb1;0.21 1.38_amp_#xb1 0.21 Gy _amp_#x2212 1 were not significantly different 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277410 10385054 390310 18723 10261 ROS1 ROS ROS 12 0.3 much interest in the role of reactive oxygen species (ROS) ROS in the pathogenesis of neurodegenerative disease 1 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277417 10385054 390313 18723 10261 ROS1 ROS ROS-mediated 37 0.0 ( OH 4 and 5 lonising radiation results in increased ROS-mediated cell damage particularly by hydroxyl radicals 6 and it has 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 277419 10385054 390314 18723 10261 ROS1 ROS ROS 17 0.3 the SOD-1 gene might therefore have a reduced tolerance of ROS and in particular OH thus leading to the DNA damage 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277420 10385054 390315 18723 10261 ROS1 ROS ROS 8 0.3 Here we have used ionising radiation to generate ROS in lymphoblastoid cell-lines from FALS patients with mutations in the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277424 10385054 390318 20996 11179 SOD1 ALS ALS 54 2.7 Thr mutation in the SOD-1 gene 9 patients with sporadic ALS and matched spouse-controls were studied 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277425 10385054 390318 117 77 ABL2 ARG Arg 22 0.0 with Ala 4 Val ( n =2 and Gly 37 Arg ( n =1 SOD-1 gene mutations 8 and a known 2 JUMiner_v2.2 1 0 0 2 77 TotalCon:2<>77|ABL2|27|Complete__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:77|ABL2|0.000803001766603887<>ScoreDetail__77|ABL2|0.000803001766603887__9965|RERE|0__ 0 0 0 0 0 277426 10385054 390319 1759 1102 BRD1 BRL BRL 10 0.3 lines were maintained in Iscove-modified essential medium (IMEM, IMEM Gibco BRL supplemented with 10% (v/v) v v fetal bovine serum 2 1 JUMiner_v2.2 1 2 gibco brl 0 0 0 0 0 0 0 0 277427 10385054 390322 18723 10261 ROS1 ROS ROS 12 0.3 of fluorescence after the production of a standard level of ROS (here here produced by treatment with ionising radiation is related 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277428 10385054 390322 18723 10261 ROS1 ROS ROS 30 0.3 is related to the level of cellular species that neutralize ROS before they can react with DCFH thus providing a good 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277429 10385054 390322 18723 10261 ROS1 ROS ROS 50 0.3 good indicator of the ability of the cell to scavenge ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277431 10385054 390341 117 77 ABL2 ARG Arg 30 0.0 1.26 ( Ala 4 Val mutation 0.97 ( Gly 37 Arg mutation and 1.43 ( Ile 149 Thr mutation whereas FAR 2 JUMiner_v2.2 1 0 0 2 77 TotalCon:2<>77|ABL2|27|Complete__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:77|ABL2|0.000803001766603887<>ScoreDetail__77|ABL2|0.000803001766603887__9965|RERE|0__ 0 0 0 0 0 277432 10385054 390345 20996 11179 SOD1 ALS ALS 6 2.7 The mechanism of the neurodegeneration in ALS is unknown but may involve free radical induced damage which 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277435 10385054 390348 20996 11179 SOD1 ALS ALS 24 2.7 patients with SOD-1 gene mutations or from patients with sporadic ALS to cope with radiation-induced oxidative stress 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277437 10385054 390351 18723 10261 ROS1 ROS ROS 9 0.3 However these findings do not exclude a role for ROS in the pathogenesis of ALS as the results relate to 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277438 10385054 390351 20996 11179 SOD1 ALS ALS 14 2.7 not exclude a role for ROS in the pathogenesis of ALS as the results relate to ROS produced by ionising radiation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277439 10385054 390351 18723 10261 ROS1 ROS ROS 20 0.3 in the pathogenesis of ALS as the results relate to ROS produced by ionising radiation and other ROS may be involved 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277440 10385054 390351 18723 10261 ROS1 ROS ROS 27 0.3 results relate to ROS produced by ionising radiation and other ROS may be involved in ALS in response to other stresses 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277441 10385054 390351 20996 11179 SOD1 ALS ALS 32 2.7 by ionising radiation and other ROS may be involved in ALS in response to other stresses 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277444 10385054 390354 18723 10261 ROS1 ROS ROS 12 0.3 that lymphoblastoid cells maintain their capacity to deal with radiation-induced ROS supports the hypothesis that a gain of an adverse function 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277447 10385054 390356 18723 10261 ROS1 ROS ROS 22 0.3 differently from neuronal cells in their capacity to deal with ROS and further experiments in neuronal cell lines and primary cultures 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277448 10385054 390358 18723 10261 ROS1 ROS ROS 3 0.3 Intracellular levels of ROS shown as relative fluorescence of DCFH (RF, RF see text 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 277450 10385054 390361 20996 11179 SOD1 ALS ALS 21 2.7 patients with SOD-1 gene mutations (FALS), FALS patients with sporadic ALS (SALS) SALS and matched controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 277452 10385054 390367 20996 11179 SOD1 ALS ALS 20 2.7 patients with SOD-1 gene mutations (FALS), FALS patients with sporadic ALS (SALS) SALS and matched controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00104157303092804<>ScoreDetail__5468|IGFALS|0.00103269415823691__11179|SOD1|0.00104157303092804__ 0 0 0 0 0 274167 10448978 383978 20996 11179 SOD1 ALS ALS 8 0.0 Biological markers in the diagnosis and treatment of ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000601610416092762<>ScoreDetail__5468|IGFALS|0.000480610375176474__11179|SOD1|0.000601610416092762__ 0 0 0 0 0 274168 10448978 383979 20996 11179 SOD1 ALS ALS 8 0.0 The care of patients with amyotrophic lateral sclerosis (ALS), ALS which has classically focused on treatment of symptomatology has now 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000601610416092762<>ScoreDetail__5468|IGFALS|0.000480610375176474__11179|SOD1|0.000601610416092762__ 0 0 0 0 0 274169 10448978 383985 20996 11179 SOD1 ALS ALS 0 0.0 ALS patients were found to experience a significant increase in the 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000601610416092762<>ScoreDetail__5468|IGFALS|0.000480610375176474__11179|SOD1|0.000601610416092762__ 0 0 0 0 0 274170 10448978 383987 20996 11179 SOD1 ALS ALS 31 0.0 which to screen the efficacy of potential therapeutic agents for ALS and Hospital McGill University Canada 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000601610416092762<>ScoreDetail__5468|IGFALS|0.000480610375176474__11179|SOD1|0.000601610416092762__ 0 0 0 0 0 272908 10593879 381898 20996 11179 SOD1 ALS ALS 17 2.2 a role in the pathogenesis of amyotrophic lateral sclerosis (ALS), ALS a unique microdialysis or microcannula sampling technique was used in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272910 10593879 381898 20996 11179 SOD1 ALS ALS 41 2.2 Cu Zn-superoxide dismutase (SOD1) SOD1 gene from humans with familial ALS mice transfected with the normal human SOD1 gene and normal 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272912 10593879 381898 18723 10261 ROS1 ROS ROS 6 0.0 To explore whether reactive oxygen species (ROS) ROS play a role in the pathogenesis of amyotrophic lateral sclerosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272913 10593879 381899 20996 11179 SOD1 ALS ALS 40 2.2 the superoxide anion (O O 2 is significantly lower in ALS mutant mice than in controls supporting by in vivo evidence 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272914 10593879 381900 18723 10261 ROS1 ROS ROS 8 0.0 This removes doubts regarding the relevance of elevated ROS in FALS raised by in vitro experiments 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272916 10593879 381906 20996 11179 SOD1 ALS ALS 3 2.2 AMYOTROPHIC LATERAL SCLEROSIS (ALS) ALS is an untreatable age-related fatal motor neuron degenerative disease whose 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272918 10593879 381907 20996 11179 SOD1 ALS ALS 14 2.2 in the Cu Zn-superoxide dismutase (SOD1) SOD1 gene in familial ALS (FALS) FALS patients (2 2 3 linked this disease to 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272919 10593879 381908 20996 11179 SOD1 ALS ALS 43 2.2 radical ( OH play a role in neuronal degeneration in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272920 10593879 381908 18723 10261 ROS1 ROS ROS 17 0.0 with sound in vivo experiments whether reactive oxygen species (ROS), ROS including superoxide anion (O O 2 hydrogen peroxide (H H 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272923 10593879 381909 20996 11179 SOD1 ALS ALS 7 2.2 To explore how mutant SOD1 (mSOD1) mSOD1 causes ALS Gurney and colleagues (5) 5 produced a transgenic mouse model 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272924 10593879 381909 20996 11179 SOD1 ALS ALS 22 2.2 a transgenic mouse model by introducing a human (with with ALS disease mutant SOD1 (mSOD1) mSOD1 gene (Gly Gly 93 Ala 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272927 10593879 381909 20996 11179 SOD1 ALS ALS 41 2.2 G93A into mice these transfected mice developed symptoms resembling human ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272929 10593879 381911 20996 11179 SOD1 ALS ALS 26 2.2 whether free radicals play a role in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272932 10593879 381912 20996 11179 SOD1 ALS ALS 13 2.2 with reduced SOD1 activity in 16 of 73 (22%) 22% ALS families (7) 7 suggesting that a loss of SOD1 function 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272934 10593879 381912 20996 11179 SOD1 ALS ALS 27 2.2 suggesting that a loss of SOD1 function sometimes occurs in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272939 10593879 381915 20996 11179 SOD1 ALS ALS 41 2.2 while similar overexpression of normal human SOD1 did not produce ALS (5) 5 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272941 10593879 381917 20996 11179 SOD1 ALS ALS 17 2.2 of SOD1 mRNA in spinal cord motor neurons in sporadic ALS (13) 13 suggest that the mSOD1 protein gains a new 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272952 10593879 381924 11629 6493 LAMC2 CSF CSF 16 0.0 of OH is significantly higher in the cerebrospinal fluid (CSF) CSF in G93A transgenic mice than in normal and SOD1 transgenic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272959 10593879 381927 18723 10261 ROS1 ROS ROS 5 0.0 We determined the levels of ROS in the G93A transgenic mice (mSOD1 mSOD1 mice normal SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272961 10593879 381928 20996 11179 SOD1 ALS ALS 41 2.2 realistic pathway in vivo demonstrating a role of ROS in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272962 10593879 381928 18723 10261 ROS1 ROS ROS 39 0.1 is a realistic pathway in vivo demonstrating a role of ROS in ALS 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 272963 10593879 381931 20996 11179 SOD1 ALS ALS 16 2.2 concerning the role of oxidative stress in the pathogenesis of ALS (19 19 29 and the experimental results are contradictory 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272964 10593879 381932 20996 11179 SOD1 ALS ALS 21 2.2 increased in the spinal cord sections of FALS and sporadic ALS (SALS) SALS patients compared to control patients (30) 30 in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272966 10593879 381933 20996 11179 SOD1 ALS ALS 10 2.2 The antioxidants vitamin E and selenium delay the appearance of ALS symptoms in these mice (33) 33 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272967 10593879 381935 20996 11179 SOD1 ALS ALS 36 2.2 was also 10-fold higher in the spinal cord tissue in ALS patients than in controls (34) 34 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272968 10593879 381936 20996 11179 SOD1 ALS ALS 15 2.2 oxidation_amp_#151 was elevated by 85% in postmortem brain tissue from ALS patients (8) 8 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272977 10593879 381943 20996 11179 SOD1 ALS ALS 18 2.2 protein carbonyl content 8-OHdG and MDA the onset of the ALS symptoms in the mSOD1 mice we used was delayed due 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 272989 10593879 381948 11629 6493 LAMC2 CSF CSF 20 0.0 cistern in the intrathecal space of the mouse spinal cord CSF was sampled from there so as to avoid damage to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272990 10593879 381949 11629 6493 LAMC2 CSF CSF 10 0.0 The cauda equina in the terminal cistern is surrounded by CSF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 272992 10593879 381953 11629 6493 LAMC2 CSF CSF 15 0.0 2,3- and 2 5-DHBA measured in the dialysates sampled from CSF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273008 10593879 381958 20996 11179 SOD1 ALS ALS 37 2.2 is particularly important with significant implications about the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273017 10593879 381964 20996 11179 SOD1 ALS ALS 18 2.2 2 and OH should contribute to neuronal death in the ALS mice and possibly in human with FALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273031 10593879 381969 20996 11179 SOD1 ALS ALS 39 2.2 OH evidence that ROS are involved in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273032 10593879 381969 18723 10261 ROS1 ROS ROS 32 0.0 sequence O 2 H 2 O 2 OH evidence that ROS are involved in the pathogenesis of ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273041 10593879 381977 20996 11179 SOD1 ALS ALS 33 2.2 the hypothesis that ROS are involved in the pathogenesis of ALS (19) 19 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273042 10593879 381977 18723 10261 ROS1 ROS ROS 26 0.0 of the disease they strongly disagreed with the hypothesis that ROS are involved in the pathogenesis of ALS (19) 19 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273048 10593879 381980 20996 11179 SOD1 ALS ALS 25 2.2 pathway a crucial change whereby mutation of SOD1 leads to ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273049 10593879 381981 20996 11179 SOD1 ALS ALS 36 2.2 evidence against aberrant O 2 destruction being a cause of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273060 10593879 381993 11629 6493 LAMC2 CSF CSF 11 0.0 the higher level of H 2 O 2 measured in CSF may also indicate a higher level of H 2 O 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273066 10593879 381997 20996 11179 SOD1 ALS ALS 34 2.2 any possible effect of oxidative stress on the pathogenesis of ALS (19) 19 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273068 10593879 381998 20996 11179 SOD1 ALS ALS 15 2.2 the deleterious effect of mutant SOD1 on motor neurons in ALS is not related to increased oxidant stress caused by increased 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273074 10593879 382001 20996 11179 SOD1 ALS ALS 46 2.2 of free radicals in the selective degeneration of motoneurons in ALS because higher levels of mSOD1 are probably present in those 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273088 10593879 382076 8255 4236 GFER HPO HPO 28 0.0 0.9 Mg 1.3 Ca 132 Cl 21.0 HCO 3 2.5 HPO 4 and 3.5 glucose 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273089 10593879 382087 6335 17029 ECD ECD ECD 47 0.0 by high-performance liquid chromatography (HPLC HPLC with electrochemical detection (ECD) ECD 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>17029|ECD|11319|No_GeneRif__10845|SHFM1|7979|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 273090 10593879 382088 7625 3758 FLOT2 ESA ESA 36 0.0 column were used to separate these two isomers and an ESA Coulochem II ECD was used for detection 1 JUMiner_v2.2 1 0 0 2 9204 TotalCon:2<>3758|FLOT2|2319|Complete__9204|PON1|5444|Complete__<>AvaiableGeneRif=2<>BEST:9204|PON1|0.000460111132972805<>ScoreDetail__9204|PON1|0.000460111132972805__3758|FLOT2|0.000428948557840402__ 0 0 0 0 0 273091 10593879 382088 6335 17029 ECD ECD ECD 39 0.0 to separate these two isomers and an ESA Coulochem II ECD was used for detection 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>17029|ECD|11319|No_GeneRif__10845|SHFM1|7979|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 273092 10593879 382111 11629 6493 LAMC2 CSF CSF 11 0.0 MDA concentration was measured in the microdialysates sampled from the CSF in the terminal cistern of the mouse intrathecal space by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273093 10593879 382136 7625 3758 FLOT2 ESA ESA 12 0.0 for HPLC analysis was according to the standard method of ESA Inc 1 JUMiner_v2.2 1 0 0 2 9204 TotalCon:2<>3758|FLOT2|2319|Complete__9204|PON1|5444|Complete__<>AvaiableGeneRif=2<>BEST:9204|PON1|0.000460111132972805<>ScoreDetail__9204|PON1|0.000460111132972805__3758|FLOT2|0.000428948557840402__ 0 0 0 0 0 273094 10593879 382137 7625 3758 FLOT2 ESA ESA 10 0.0 A Shimadzu HPLC with a Waters ODS2 column and an ESA ECD was used 1 JUMiner_v2.2 1 0 0 2 9204 TotalCon:2<>3758|FLOT2|2319|Complete__9204|PON1|5444|Complete__<>AvaiableGeneRif=2<>BEST:9204|PON1|0.000460111132972805<>ScoreDetail__9204|PON1|0.000460111132972805__3758|FLOT2|0.000428948557840402__ 0 0 0 0 0 273095 10593879 382137 6335 17029 ECD ECD ECD 11 0.0 Shimadzu HPLC with a Waters ODS2 column and an ESA ECD was used 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>17029|ECD|11319|No_GeneRif__10845|SHFM1|7979|Complete__<>AvaiableGeneRif=1<> 0 0 0 0 0 273096 10593879 382139 7625 3758 FLOT2 ESA ESA 31 0.0 4 at a 1 ml/min ml min flow rate (ESA, ESA Inc. standard method 1 JUMiner_v2.2 1 0 0 2 9204 TotalCon:2<>3758|FLOT2|2319|Complete__9204|PON1|5444|Complete__<>AvaiableGeneRif=2<>BEST:9204|PON1|0.000460111132972805<>ScoreDetail__9204|PON1|0.000460111132972805__3758|FLOT2|0.000428948557840402__ 0 0 0 0 0 273122 10593879 382154 11629 6493 LAMC2 CSF CSF 15 0.0 vivo measurement of the levels of O 2 in the CSF and spinal cord 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 273126 10593879 382156 11629 6493 LAMC2 CSF CSF 13 0.1 the concentrations of MDA in the dialysates collected from the CSF in mSOD1 SOD1 and Nc mice 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 273152 10593879 382174 20996 11179 SOD1 ALS ALS 17 2.2 constituents supports that ROS-initiated processes lead to motoneuron degeneration in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00184180076460148<>ScoreDetail__5468|IGFALS|0.000606445861920314__11179|SOD1|0.00184180076460148__ 0 0 0 0 0 273153 10593879 382174 18723 10261 ROS1 ROS ROS-initiated 10 0.0 Our verification of increased oxidation of cellular constituents supports that ROS-initiated processes lead to motoneuron degeneration in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 266724 10621940 369909 13412 7214 MPHOSPH6 MPP MPP 2 0.0 Methylphenylpyridium ion (MPP+) MPP selectively enhances glutamate and NO cytotoxicity against dopaminergic neurons of 1 JUMiner_v2.2 1 0 0 2 7214 TotalCon:2<>7214|MPHOSPH6|10200|Complete__7225|MPZ|4359|Complete__<>AvaiableGeneRif=2<>BEST:7214|MPHOSPH6|0.000518134715025907<>ScoreDetail__7214|MPHOSPH6|0.000518134715025907__7225|MPZ|0.000307464556169219__ 0 0 0 0 0 267112 10627601 370968 20996 11179 SOD1 ALS ALS 13 0.3 selective vulnerability of motor neurons in amyotrophic lateral sclerosis (ALS) ALS is primarily unknown 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267113 10627601 370970 20996 11179 SOD1 ALS ALS 23 0.3 large numbers of these channels but do not degenerate in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267114 10627601 370976 18723 10261 ROS1 ROS ROS 18 0.0 depolarization assessed using tetramethylrhodamine ethylester and reactive oxygen species (ROS) ROS generation assessed using hydroethidine in motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267115 10627601 370978 18723 10261 ROS1 ROS ROS 30 0.0 neuron injury suggesting that the mitochondrial Ca uptake and consequent ROS generation are central to the injury process 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267116 10627601 370979 20996 11179 SOD1 ALS ALS 9 0.3 Key words glutamate kainate hydroethidine oxidative stress mitochondria GABA ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267117 10627601 370980 20996 11179 SOD1 ALS ALS 3 0.3 Amyotrophic lateral sclerosis (ALS) ALS is a neurodegenerative disease characterized by the progressive loss of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267118 10627601 370984 17319 9413 PRKDC HYRC Hyrc 31 1.0 injury (Hartley Hartley et al. 1993 Lu et al. 1996 Hyrc et al. 1997 2 JUMiner_v2.2 1 2 34 0 0 0 0 0 0 0 0 267119 10627601 370985 18723 10261 ROS1 ROS ROS 45 0.0 at the expense of triggering injurious reactive oxygen species (ROS) ROS production (Lafon-Cazal Lafon-Cazal et al. 1993 Dugan et al. 1995 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267120 10627601 370988 18723 10261 ROS1 ROS ROS 29 0.0 kainate exposures trigger high Ca i elevations and subsequent mitochondrial ROS production in GABAergic cortical neurons (Carriedo Carriedo et al. 1998 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267121 10627601 370990 20996 11179 SOD1 ALS ALS 28 0.3 injury (Yin Yin et al. 1994 do not degenerate in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267122 10627601 370992 18723 10261 ROS1 ROS ROS 23 0.0 focused on assessments of mitochondrial Ca buffering mitochondrial depolarization and ROS generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267125 10627601 371023 8255 4236 GFER HSS HSS 15 0.6 performed in room air using a HEPES-buffered salt solution (HSS) HSS with the following composition (in in m M Na 130 1 JUMiner_v2.2 1 2 UserEdit 0 2 10818 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:10818|SGSH|0.000133654103180968<>ScoreDetail__4236|GFER|8.03793907242183e-05__14524|SPAG9|0__10818|SGSH|0.000133654103180968__15894|PANK2|1.87202815530346e-05__ 1 1 0 0 0 267126 10627601 371032 8255 4236 GFER HSS HSS 10 0.6 agonist exposures were performed at room temperature (25degreeC) 25degreeC in HSS either constantly perfused or in a 1.5 ml static bath 1 JUMiner_v2.2 1 2 UserEdit 0 2 10818 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:10818|SGSH|0.000133654103180968<>ScoreDetail__4236|GFER|8.03793907242183e-05__14524|SPAG9|0__10818|SGSH|0.000133654103180968__15894|PANK2|1.87202815530346e-05__ 1 1 0 0 0 267127 10627601 371033 19254 10472 RUNX2 CCD CCD 38 0.0 and the emitted fluorescence was collected using a Hamamatsu intensified CCD camera 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267128 10627601 371036 8255 4236 GFER HSS HSS 21 0.6 in the dark with 5 micro M Fura-2FF AM in HSS containing 0.2% pluronic acid and 1.5% dimethylsulfoxide (DMSO) DMSO for 1 JUMiner_v2.2 1 2 UserEdit 0 2 10818 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:10818|SGSH|0.000133654103180968<>ScoreDetail__4236|GFER|8.03793907242183e-05__14524|SPAG9|0__10818|SGSH|0.000133654103180968__15894|PANK2|1.87202815530346e-05__ 1 1 0 0 0 267129 10627601 371037 8255 4236 GFER HSS HSS 5 0.6 Cultures were then washed in HSS (three three times and kept in the dark for an 1 JUMiner_v2.2 1 2 UserEdit 0 2 10818 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:10818|SGSH|0.000133654103180968<>ScoreDetail__4236|GFER|8.03793907242183e-05__14524|SPAG9|0__10818|SGSH|0.000133654103180968__15894|PANK2|1.87202815530346e-05__ 1 1 0 0 0 267130 10627601 371045 17497 9543 PSMB6 Delta Delta 8 1.0 ROS production and changes in mitochondrial polarization ( Delta Psi m were monitored using the oxidation-sensitive dye HEt (Bindokas 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267131 10627601 371045 17497 9543 PSMB6 Delta Delta 23 1.0 using the oxidation-sensitive dye HEt (Bindokas Bindokas et al. 1996 Delta Psi m -sensitive dye TMRE (Farkas Farkas et al. 1989 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267132 10627601 371045 18723 10261 ROS1 ROS ROS 0 0.0 ROS production and changes in mitochondrial polarization ( Delta Psi m 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267133 10627601 371046 18723 10261 ROS1 ROS ROS 41 0.0 intercalation of ethidium within nuclear DNA (increasing increasing sensitivity for ROS detection 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267134 10627601 371047 8255 4236 GFER HSS HSS 12 0.6 loaded in the dark with 5 micro M HEt in HSS (45 45 min 25degreeC or 0.5 micro M TMRE in 1 JUMiner_v2.2 1 2 UserEdit 0 2 10818 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:10818|SGSH|0.000133654103180968<>ScoreDetail__4236|GFER|8.03793907242183e-05__14524|SPAG9|0__10818|SGSH|0.000133654103180968__15894|PANK2|1.87202815530346e-05__ 1 1 0 0 0 267135 10627601 371048 8255 4236 GFER HSS HSS 12 0.6 were washed (four four times into a static bath of HSS containing either probe 1 JUMiner_v2.2 1 2 UserEdit 0 2 10818 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:10818|SGSH|0.000133654103180968<>ScoreDetail__4236|GFER|8.03793907242183e-05__14524|SPAG9|0__10818|SGSH|0.000133654103180968__15894|PANK2|1.87202815530346e-05__ 1 1 0 0 0 267136 10627601 371054 18723 10261 ROS1 ROS ROS 3 0.0 In HEt experiments ROS production causes an increase in somatic and nuclear fluorescence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267137 10627601 371055 18723 10261 ROS1 ROS ROS 8 0.0 Because HEt fluorescence is cumulative the rate of ROS generation was assessed as the rate of increase (or or 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267138 10627601 371055 18723 10261 ROS1 ROS ROS 31 0.0 F x / F 0 curves over time and net ROS production was assessed as the increase in F x / 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267140 10627601 371074 20996 11179 SOD1 ALS ALS 15 0.3 by motor neurons likely contributes to their high vulnerability in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267141 10627601 371080 18723 10261 ROS1 ROS ROS 15 0.0 to either AMPA or kainate triggered abrupt mitochondrial depolarization and ROS generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267142 10627601 371082 18723 10261 ROS1 ROS ROS 11 0.0 that both mitochondrial poisons (which which prevent Ca uptake and ROS scavengers are protective suggest that the mitochondrial Ca uptake and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267143 10627601 371082 18723 10261 ROS1 ROS ROS 23 0.0 are protective suggest that the mitochondrial Ca uptake and consequent ROS generation contribute directly to AMPA/kainate AMPA kainate receptor-mediated motor neuron 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267146 10627601 371091 18723 10261 ROS1 ROS ROS 6 0.0 Thus the substantial mitochondrial depolarization and ROS generation seen with kainate but not AMPA exposures in GABAergic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267147 10627601 371098 4918 2348 CREBBP CBP CBPs 28 0.3 i elevations is the presence of Ca -binding proteins (CBPs) CBPs 13 JUMiner_v2.2 1 2 UserEdit 0 2 3287 TotalCon:4<>9936|OPN1LW|5956|Complete__2348|CREBBP|1387|Complete__30043|PAG1|55824|Complete__3287|EIF4E|1977|Complete__<>AvaiableGeneRif=4<>BEST:3287|EIF4E|0.000328082258978219<>ScoreDetail__9936|OPN1LW|0.000141278151749356__30043|PAG1|0.000161835653706693__3287|EIF4E|0.000328082258978219__2348|CREBBP|0.000273162608013667__ 1 1 0 0 0 267148 10627601 371099 4918 2348 CREBBP CBP CBPs 10 0.3 Indeed GABAergic interneurons are characterized by the strong expression of CBPs including parvalbumin (Celio, Celio 1986 calretinin (Rogers, Rogers 1992 and 13 JUMiner_v2.2 1 2 UserEdit 0 2 3287 TotalCon:4<>9936|OPN1LW|5956|Complete__2348|CREBBP|1387|Complete__30043|PAG1|55824|Complete__3287|EIF4E|1977|Complete__<>AvaiableGeneRif=4<>BEST:3287|EIF4E|0.000328082258978219<>ScoreDetail__9936|OPN1LW|0.000141278151749356__30043|PAG1|0.000161835653706693__3287|EIF4E|0.000328082258978219__2348|CREBBP|0.000273162608013667__ 1 1 0 0 0 267149 10627601 371100 4918 2348 CREBBP CBP CBPs 4 0.3 Recent studies suggest that CBPs may serve important roles in protecting neurons from intracellular Ca 13 JUMiner_v2.2 1 2 UserEdit 0 2 3287 TotalCon:4<>9936|OPN1LW|5956|Complete__2348|CREBBP|1387|Complete__30043|PAG1|55824|Complete__3287|EIF4E|1977|Complete__<>AvaiableGeneRif=4<>BEST:3287|EIF4E|0.000328082258978219<>ScoreDetail__9936|OPN1LW|0.000141278151749356__30043|PAG1|0.000161835653706693__3287|EIF4E|0.000328082258978219__2348|CREBBP|0.000273162608013667__ 1 1 0 0 0 267150 10627601 371101 20996 11179 SOD1 ALS ALS 10 0.3 Motor neuron subpopulations that are relatively resistant to degeneration in ALS express high levels of CBPs suggesting that the expression of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267151 10627601 371101 4918 2348 CREBBP CBP CBPs 15 0.3 relatively resistant to degeneration in ALS express high levels of CBPs suggesting that the expression of CBPs may modulate motor neuron 13 JUMiner_v2.2 1 2 UserEdit 0 2 3287 TotalCon:4<>9936|OPN1LW|5956|Complete__2348|CREBBP|1387|Complete__30043|PAG1|55824|Complete__3287|EIF4E|1977|Complete__<>AvaiableGeneRif=4<>BEST:3287|EIF4E|0.000328082258978219<>ScoreDetail__9936|OPN1LW|0.000141278151749356__30043|PAG1|0.000161835653706693__3287|EIF4E|0.000328082258978219__2348|CREBBP|0.000273162608013667__ 1 1 0 0 0 267152 10627601 371101 4918 2348 CREBBP CBP CBPs 21 0.3 express high levels of CBPs suggesting that the expression of CBPs may modulate motor neuron vulnerability (Alexianu Alexianu et al. 1994 13 JUMiner_v2.2 1 2 UserEdit 0 2 3287 TotalCon:4<>9936|OPN1LW|5956|Complete__2348|CREBBP|1387|Complete__30043|PAG1|55824|Complete__3287|EIF4E|1977|Complete__<>AvaiableGeneRif=4<>BEST:3287|EIF4E|0.000328082258978219<>ScoreDetail__9936|OPN1LW|0.000141278151749356__30043|PAG1|0.000161835653706693__3287|EIF4E|0.000328082258978219__2348|CREBBP|0.000273162608013667__ 1 1 0 0 0 267153 10627601 371102 4918 2348 CREBBP CBP CBPs 4 0.3 Thus a lack of CBPs in most motor neurons may compel them to resort to 13 JUMiner_v2.2 1 2 UserEdit 0 2 3287 TotalCon:4<>9936|OPN1LW|5956|Complete__2348|CREBBP|1387|Complete__30043|PAG1|55824|Complete__3287|EIF4E|1977|Complete__<>AvaiableGeneRif=4<>BEST:3287|EIF4E|0.000328082258978219<>ScoreDetail__9936|OPN1LW|0.000141278151749356__30043|PAG1|0.000161835653706693__3287|EIF4E|0.000328082258978219__2348|CREBBP|0.000273162608013667__ 1 1 0 0 0 267154 10627601 371104 17497 9543 PSMB6 Delta Delta 23 1.0 activity to mitochondrial energy production (McCormack McCormack and Denton 1990 Delta Psi m with the consequent cessation of ATP production (Beatrice 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267155 10627601 371105 18723 10261 ROS1 ROS ROS 40 0.0 K channels (Carriedo Carriedo et al. 1998 can trigger mitochondrial ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267156 10627601 371107 18723 10261 ROS1 ROS ROS 12 0.0 present finding that either inhibitors of mitochondrial Ca uptake or ROS scavengers can protect motor neurons against injury resulting from Ca 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267157 10627601 371108 20996 11179 SOD1 ALS ALS 7 0.3 Are the present findings of relevance to ALS pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267158 10627601 371109 20996 11179 SOD1 ALS ALS 12 0.3 implicates a role for excitotoxicity in the pathogenesis of sporadic ALS (Leigh Leigh and Meldrum 1996 Rothstein 1996 Shaw and Ince 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267159 10627601 371111 20996 11179 SOD1 ALS ALS 16 0.3 receptor-mediated injury contributes to the loss of motor neurons in ALS the present findings may well pertain to their high susceptibility 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267160 10627601 371113 20996 11179 SOD1 ALS ALS 24 0.3 induction of cumulative motor neuron injury that may occur in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267161 10627601 371117 20996 11179 SOD1 ALS ALS 79 0.3 Volterra et al. 1994 Trotti et al. 1999 seen in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267162 10627601 371117 18723 10261 ROS1 ROS ROS 8 0.0 In addition repeated mitochondrial Ca loading and consequent ROS generation could be relevant to the findings of mitochondrial dysfunction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267164 10627601 371170 18723 10261 ROS1 ROS ROS 4 0.0 Kainate exposure triggers preferential ROS generation in motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267165 10627601 371172 18723 10261 ROS1 ROS ROS 7 0.0 To assess involvement of mitochondria in the ROS generation in some cultures we added the electron transport chain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267166 10627601 371177 18723 10261 ROS1 ROS ROS 5 0.0 AMPA/kainate AMPA kainate receptor activation causes greater ROS generation in motor neurons than in GABAergic cortical neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267167 10627601 371197 17319 9413 PRKDC HYRC Hyrc 55 1.0 like fura-2 may markedly underestimate true Ca i levels (Hyrc Hyrc et al. 1997 Carriedo et al. 1998 Khodorov et al. 2 JUMiner_v2.2 1 2 34 0 0 0 0 0 0 0 0 267168 10627601 371214 18723 10261 ROS1 ROS ROS 7 0.0 AMPA exposure causes strong mitochondrial depolarization and ROS generation in motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267169 10627601 371216 17497 9543 PSMB6 Delta Delta 12 1.0 AMPA kainate receptor-mediated changes in the mitochondrial membrane potential ( Delta Psi m that might occur in response to mitochondrial Ca 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267170 10627601 371216 17497 9543 PSMB6 Delta Delta 58 1.0 cellular domains rich in mitochondria is indicative of loss of Delta Psi m (Farkas Farkas et al. 1989 Delta Psi m 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267171 10627601 371216 17497 9543 PSMB6 Delta Delta 65 1.0 loss of Delta Psi m (Farkas Farkas et al. 1989 Delta Psi m in GABAergic cortical neurons reflecting the rapid Ca 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267172 10627601 371220 17497 9543 PSMB6 Delta Delta 38 1.0 more rapid fluorescence decreases resulting from Ca -dependent loss of Delta Psi m 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267173 10627601 371221 17497 9543 PSMB6 Delta Delta 30 1.0 control indicating that the signal is caused by loss of Delta Psi m because kainate induces Na -dependent neuronal depolarization in 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267174 10627601 371223 18723 10261 ROS1 ROS ROS 23 0.0 responses to AMPA/kainate AMPA kainate receptor activation we examined kainate-induced ROS production using the oxidation-sensitive dye HEt that readily permeates living 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267175 10627601 371227 18723 10261 ROS1 ROS ROS 1 0.0 Basal ROS production was minimal as evidenced by the stable but small 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267176 10627601 371230 18723 10261 ROS1 ROS ROS 19 0.0 was used to examine the role of mitochondria in kainate-triggered ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267177 10627601 371232 18723 10261 ROS1 ROS ROS 25 0.0 kainate receptor activation we used HEt to compare directly the ROS generation triggered by identical 10 min AMPA or kainate exposures 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267178 10627601 371236 17497 9543 PSMB6 Delta Delta 1 1.0 (1997) 1997 Delta Psi m might cause a voltage-dependent release of oxidized ethidium 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267179 10627601 371236 18723 10261 ROS1 ROS ROS 32 0.0 examine the degree to which observed kainate-triggered HEt signals reflect ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267180 10627601 371238 17497 9543 PSMB6 Delta Delta 1 1.0 (1997) 1997 Delta Psi m (Carriedo Carriedo et al. 1998 Delta Psi m 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267181 10627601 371238 17497 9543 PSMB6 Delta Delta 8 1.0 (1997) 1997 Delta Psi m (Carriedo Carriedo et al. 1998 Delta Psi m assessed using the Delta Psi m -sensitive dye 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267182 10627601 371238 17497 9543 PSMB6 Delta Delta 14 1.0 Carriedo et al. 1998 Delta Psi m assessed using the Delta Psi m -sensitive dye TMRE (Carriedo Carriedo et al. 1998 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267183 10627601 371238 17497 9543 PSMB6 Delta Delta 24 1.0 Psi m -sensitive dye TMRE (Carriedo Carriedo et al. 1998 Delta Psi m and most likely reflects ROS production 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 267184 10627601 371238 18723 10261 ROS1 ROS ROS 31 0.0 et al. 1998 Delta Psi m and most likely reflects ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267185 10627601 371239 18723 10261 ROS1 ROS ROS 13 0.0 to motor neurons is dependent on mitochondrial Ca loading and ROS generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267186 10627601 371240 18723 10261 ROS1 ROS ROS 13 0.0 the hypothesis that Ca accumulation within the mitochondria and consequent ROS generation contribute directly to AMPA/kainate AMPA kainate receptor-mediated motor neuron 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267187 10627601 371246 18723 10261 ROS1 ROS ROS 5 0.0 To test the role of ROS in AMPA/kainate AMPA kainate receptor-mediated motor neuron injury we performed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267188 10627601 371251 20996 11179 SOD1 ALS ALS 21 0.3 (J.H.W.) J.H.W. and AG00919 (S.L.S.), S.L.S. a grant from the ALS Association (J.H.W.), J.H.W. and the National Research Service Award Predoctoral 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000782634140781008<>ScoreDetail__5468|IGFALS|0.00029671829565011__11179|SOD1|0.000782634140781008__ 0 0 0 0 0 267189 10627601 371252 832 549 AOC2 RAO Rao 12 0.0 Simin Amindari for her assistance in cell culture and Shyam Rao and Jade Jeng for their thoughtful comments on this manuscript 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267887 10643818 372656 14714 8022 NT5C2 GMP GMP-dependent 1 0.0 Cyclic GMP-dependent kinase also induces expression of c-Fos possibly via activation of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267919 10643818 372690 14714 8022 NT5C2 GMP GMP 23 0.0 the generation of reactive oxygen species nitric oxide and cyclic GMP 25 and 26 even though the two signal transduction pathways 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267922 10643818 372740 5438 2666 DAG1 DAG DAG 10 0.0 PLA 2 phopholipase A 2 PLC phospholipase C DAG diacyl glycerol AA arachidonic acid PKC protein kinase C GPX 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 267925 10643818 372751 5135 2528 CTSC HMS HMS 10 0.0 the involvement of glutathione in the hexose monophosphate shunt (HMS) HMS is pointed out and the relationships of glutamate with the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268186 10671549 373530 14532 7871 NONO NONO NONO 12 0.6 3 inhibitor I (Ac-DEVD-CHO Ac-DEVD-CHO Hoechst 33342 diethylamine NONOate (NONO NONO and 3-[(_amp_#177;)-( 3- _amp_#177 - E )-ethyl-2'-[( -ethyl-2'- E -hydroxyimino 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268187 10671549 373540 6895 3530 F12 F12 F12 18 0.0 of Cell Culture and grown in Dulbecco's modified Eagle's/F12 Eagle's F12 medium supplemented with 15% fetal calf serum at 37 degreeC 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268190 10671549 373555 14532 7871 NONO NONO NONO 2 0.6 Diethylamine NONOate (NONO NONO and NOR-4 were used at concentration of 0.5 m M 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268191 10671549 373555 14532 7871 NONO NONO NONO 26 0.6 the rapid half-life of these compounds (16 16 min for NONO and 60 min for NOR-4 we treated the cells for 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268192 10671549 373560 18723 10261 ROS1 ROS ROS 4 0.3 For detection of intracellular ROS cells were incubated with 50 micro M DCF-DA (dissolved dissolved 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 268193 10671549 373563 18723 10261 ROS1 ROS ROS 12 0.3 of 2' 7'-dichlorofluorescein formed by the reaction of DCF-DA with ROS of more than 10 000 viable cells from each sample 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268194 10671549 373564 22000 11730 TERT TERT tert 19 0.0 the sample for gating out dead cells 100 micro M tert -butylhydroperoxide treatment was used as a positive control 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268195 10671549 373577 19573 10691 SDS SDS SDS-polyacrylamide 42 0.3 protein extracts were loaded onto each lane of a 12% SDS-polyacrylamide gel separated and then blotted to nitrocellulose membrane (Bio-Rad) Bio-Rad 11 JUMiner_v2.2 1 2 sds 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000368543577206808<>ScoreDetail__19440|SBDS|0.000368543577206808__10691|SDS|4.84566555216359e-05__ 0 0 0 0 0 268204 10671549 373618 14532 7871 NONO NONO NONO 12 0.6 Presentation--All experiments were done with n = 6 those with NONO NOR-4 and bathocuproine were done with n = 4 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268205 10671549 373631 14532 7871 NONO NONO NONO 19 0.6 of transfected cell lines to pure NO donors such as NONO and NOR-4 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268207 10671549 373639 14532 7871 NONO NONO NONO 30 0.6 upon treatment with commercially available pure NO donors such as NONO ( 27 we studied in detail the molecular mechanisms involved 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268228 10671549 373677 18723 10261 ROS1 ROS ROS 34 0.3 SOD mutant despite high dismutating activity increased intracellular flux of ROS 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268229 10671549 373679 18723 10261 ROS1 ROS ROS 12 0.3 molecule has been extensively utilized to demonstrate intracellular production of ROS 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268230 10671549 373682 18723 10261 ROS1 ROS ROS 20 0.3 for aberrant copper chemistry of the mutant enzyme both in ROS production and in NO-increased apoptosis in G93A cells as already 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268232 10671549 373687 18723 10261 ROS1 ROS ROS 24 0.3 the G93A mutant may be the amplification factor leading to ROS unbalance in G93A cells and may explain how and why 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268233 10671549 373687 20996 11179 SOD1 ALS ALS 36 1.4 in G93A cells and may explain how and why an ALS mutant cause a pro-apoptotic response 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000800634691463152<>ScoreDetail__5468|IGFALS|0.000370322031614254__11179|SOD1|0.000800634691463152__ 0 0 0 0 0 268234 10671549 373693 14532 7871 NONO NONO NONO 19 0.6 ( B 0.5 m M NOR-4 or 0.5 m M NONO ( C 5 microg/ml microg ml puromycin ( D for 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268235 10671549 373696 14532 7871 NONO NONO NONO-treated 10 0.6 C lane 1 SH-SY5Y cells lane 2 NOR-4-treated lane 3 NONO-treated lane 4 G93A cells lane 5 NOR-4-treated lane 6 NONO-treated 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268236 10671549 373696 14532 7871 NONO NONO NONO-treated 20 0.6 NONO-treated lane 4 G93A cells lane 5 NOR-4-treated lane 6 NONO-treated lane 7 WT cells lane 8 NOR-4-treated lane 9 NONO-treated 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268237 10671549 373696 14532 7871 NONO NONO NONO-treated 30 0.6 NONO-treated lane 7 WT cells lane 8 NOR-4-treated lane 9 NONO-treated 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268238 10671549 373697 14532 7871 NONO NONO NONO 11 0.6 are expressed as means _amp_#177 S.D. n = 4 for NONO and NOR-4 n = 6 for GSNO and puromycin * 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268243 10671549 373716 18723 10261 ROS1 ROS ROS 5 0.3 Correlation between intracellular production of ROS and increased cell susceptibility to apoptosis 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268244 10671549 373720 22000 11730 TERT TERT tert 13 0.0 cells empty GSNO-treated cells Tb cells-treated with 100 micro M tert -butyl-hydroperoxide as a positive control 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 268272 10671549 373764 18723 10261 ROS1 ROS ROS 8 0.3 However we found evidence for different levels of ROS in the three cell lines used during the GSNO treatment 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268274 10671549 373772 18723 10261 ROS1 ROS ROS 4 0.3 An increased flux of ROS may lead to increased peroxynitrite levels 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 268276 10671549 373783 14532 7871 NONO NONO NONO 29 0.6 Zn-SOD Cu Zn-SOD copper zinc superoxide dismutase GSNO S -nitrosoglutathione NONO diethylamine NONOate NOR-4 3-[(_amp_#177;)-( 3- _amp_#177 - E )-ethyl-2'-[( -ethyl-2'- 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 268277 10671549 373783 18723 10261 ROS1 ROS ROS 52 0.3 Ac-Asp-Glu-Val-Asp-AMC caspase-3 substrate II fluorogenic Ac-DEVD-CHO Ac-Asp-Glu-Val-Asp-CHO caspase-3 inhibitor I ROS reactive oxygen species FALS familial amyotrophic lateral sclerosis PIPES piperazine-N 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 263999 10742195 364679 18723 10261 ROS1 ROS ROS 12 0.0 intimately associated with glutathione the chief reactive oxygen species (ROS) ROS scavenger of the cytosol 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264044 10742195 364741 117 77 ABL2 ARG Arg 14 0.0 (with with substitutions of Arg_amp_#x2192 Gly Tyr_amp_#x2192 Phe and His_amp_#x2192 Arg at positions 5 10 and 13 respectively is unaffected by 2 JUMiner_v2.2 1 0 0 2 77 TotalCon:2<>77|ABL2|27|Complete__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:77|ABL2|0.000647132654365927<>ScoreDetail__77|ABL2|0.000647132654365927__9965|RERE|0.0001717858860716__ 0 0 0 0 0 264051 10742195 364765 17345 9449 PRNP CJD CJD 2 0.8 Creutzfeldt_amp_#x2013 Jakob disease (CJD) CJD and related transmissible spongioform encephalopathies (TSEs), TSEs like AD are 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 264052 10742195 364765 17345 9449 PRNP CJD CJD 19 0.8 like AD are characterized by neuroamyloid formation and dementia but CJD is a far more aggressive disease and is contagious 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 264054 10742195 364766 17345 9449 PRNP CJD CJD-affected 13 0.8 particle is a protein PrP Sc that collects in the CJD-affected brain and is a modified and protease-resistant form of a 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 264064 10742195 364771 17345 9449 PRNP CJD CJD 15 0.8 is also intriguing because of the neuropathological similarities between CJD/TSE, CJD TSE AD and FALS 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 264066 10742195 364772 17345 9449 PRNP CJD CJD 14 0.8 and A_amp_#x3b2 are indeed also physiological SOD-type antioxidants then FALS CJD and AD might all share a common cause the corruption 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 264067 10742195 364773 17345 9449 PRNP CJD CJD 11 0.8 far there is only indirect evidence of oxidative neuropathology in CJD and TSE but this evidence probably will emerge with time 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 264074 10742195 364778 17345 9449 PRNP CJD CJD 6 0.8 It is intriguing to contemplate that CJD/TSE, CJD TSE FALS and AD may be caused by an abnormality 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 264075 10742195 364779 18723 10261 ROS1 ROS ROS 16 0.0 be expected to be exposed to constitutively high concentrations of ROS O 2 _amp_#x2212 and H 2 O 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264084 10742195 364802 18723 10261 ROS1 ROS ROS 17 0.0 subsequent early neonatal death of the SOD2 knockout mice the ROS produced within the developing brain reach sufficient levels to uncover 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264086 10742195 364804 18723 10261 ROS1 ROS ROS 5 0.0 These findings demonstrate that mitochondrial ROS can be deleterious to the brain and can give rise 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 264087 10742195 364806 17345 9449 PRNP CJD CJD 10 0.8 From the study of the abnormal biochemistry of AD FALS CJD and cataracts I propose a triad of features shared by 1 JUMiner_v2.2 1 2 creutzfeldt 0 0 0 0 0 0 0 0 262245 10930589 361583 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is a paralytic disorder characterized by degeneration of large motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262246 10930589 361584 20996 11179 SOD1 ALS ALS 3 2.2 A subset of ALS is inherited (familial familial ALS FALS and is associated with 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262247 10930589 361584 20996 11179 SOD1 ALS ALS 7 2.2 A subset of ALS is inherited (familial familial ALS FALS and is associated with more than 70 different mutations 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262250 10930589 361585 18723 10261 ROS1 ROS ROS 26 0.3 gene exhibit significant increase of intracellular reactive oxygen species (ROS) ROS compared with sporadic ALS (SALS) SALS and normal controls (spouses 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262251 10930589 361585 20996 11179 SOD1 ALS ALS 30 2.2 of intracellular reactive oxygen species (ROS) ROS compared with sporadic ALS (SALS) SALS and normal controls (spouses spouses of ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262252 10930589 361585 20996 11179 SOD1 ALS ALS 37 2.2 sporadic ALS (SALS) SALS and normal controls (spouses spouses of ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262253 10930589 361586 18723 10261 ROS1 ROS ROS 1 0.3 The ROS generation did not correlate with SOD1 activity 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262255 10930589 361587 18723 10261 ROS1 ROS ROS 13 0.3 with vitamin C catalase or the flavinoid quercetin significantly reduced ROS in all groups 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262256 10930589 361588 18723 10261 ROS1 ROS ROS 10 0.3 inhibitor 3-amino-1 2 4-triazole resulted in a ten-fold increase of ROS in all groups 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262257 10930589 361589 18723 10261 ROS1 ROS ROS 12 0.3 a nitric oxide synthase inhibitor or vitamin E altered the ROS levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262258 10930589 361590 18723 10261 ROS1 ROS ROS 15 0.3 hydrogen peroxide (H H 2 O 2 is a major ROS elevated in FALS lymphoblasts and it may contribute to the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262260 10930589 361594 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS), ALS also known as Lou Gehrig disease is characterized by degeneration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262261 10930589 361596 20996 11179 SOD1 ALS ALS 3 2.2 About 2% of ALS cases are associated with missense mutations in the gene for 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262271 10930589 361602 20996 11179 SOD1 ALS ALS 4 2.2 Decreased SOD1 activity in ALS patients would be expected to lead to an ambient increase 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262278 10930589 361607 18723 10261 ROS1 ROS ROS 8 0.3 We therefore investigated levels of reactive oxygen species (ROS) ROS in lymphoblast cell lines derived from patients with SOD1 linked 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262280 10930589 361607 20996 11179 SOD1 ALS ALS 21 2.2 cell lines derived from patients with SOD1 linked FALS sporadic ALS and normal controls (spouses spouses of FALS patients using two 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235023118796336<>ScoreDetail__5468|IGFALS|0.000716283511835732__11179|SOD1|0.00235023118796336__ 0 0 0 0 0 262281 10930589 361608 18723 10261 ROS1 ROS ROS 16 0.3 inhibitors of intracellular antioxidant enzymes which influence the metabolism of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262283 10930589 361629 7329 16460 FARP2 FRG FRG 27 0.0 Elmer LS-5 luminescence spectrometer (Boden Boden Swerk Perkin-Elmer _amp_#xc5 berlingen FRG using excitation and emission slits of 5 nm bandwidth 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262287 10930589 361640 18723 10261 ROS1 ROS ROS 6 0.3 Intracellular elevation of reactive oxygen species (ROS) ROS in FALS cells 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262288 10930589 361641 18723 10261 ROS1 ROS ROS 13 0.3 lymphoblast cell lines from FALS patients generate increased levels of ROS we used the fluorescent probe C-DCDHF-DA-AM 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262291 10930589 361650 18723 10261 ROS1 ROS ROS 12 0.3 to test whether O 2 ._amp_#x2212 caused an increase in ROS we used HE a fluorescent probe specific for O 2 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262293 10930589 361654 18723 10261 ROS1 ROS ROS 3 0.3 Decreased generation of ROS in cells incubated with diethyldithiocarbamate (DDC) DDC 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262294 10930589 361654 5532 2719 DDC DDC DDC 9 0.0 Decreased generation of ROS in cells incubated with diethyldithiocarbamate (DDC) DDC 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262296 10930589 361655 5532 2719 DDC DDC DDC 21 0.0 of metal chelating agents e.g cyanide azide o -phenanthroline and DDC 19 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262299 10930589 361656 5532 2719 DDC DDC DDC 4 0.1 Reaction of SOD1 with DDC requires two molecule of DDC (i) i one molecule interacts 6 JUMiner_v2.2 1 2 diethyldithiocarbamate 0 0 0 0 0 0 0 0 262300 10930589 361656 5532 2719 DDC DDC DDC 9 0.0 Reaction of SOD1 with DDC requires two molecule of DDC (i) i one molecule interacts with the copper center of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262301 10930589 361657 5532 2719 DDC DDC DDC 3 0.0 To test whether DDC affects free radical generation in cells we examined C-DCF fluorescence 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262302 10930589 361657 5532 2719 DDC DDC DDC 23 0.0 fluorescence in cells preincubated with 0.01 0.05 and 0.1 mM DDC 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262303 10930589 361658 5532 2719 DDC DDC DDC 7 0.0 Fluorescence in the presence of 0.01 mM DDC ( Fig 3A was significantly less inhibited in FALS cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262304 10930589 361660 5532 2719 DDC DDC DDC 9 0.0 Fluorescence was comparable inhibited with 0.05 and 0.1 mM DDC in all three groups 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262305 10930589 361661 5532 2719 DDC DDC DDC 11 0.0 menadione stimulated FALS lymphoblasts were not inhibited by 0.01 mM DDC and significantly less inhibited (38%) 38% than normal control lymphoblasts 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262306 10930589 361661 5532 2719 DDC DDC DDC 29 0.0 60% and SALS lymphoblasts (38_amp_#x2013;57%) 38_amp_#x2013 57% at 0.05 mM DDC ( P _amp_#x3c 0.006 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262309 10930589 361662 5532 2719 DDC DDC DDC 5 0.0 This suggests the interaction of DDC with mutant SOD1 may be altered and that wildtype SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262310 10930589 361664 18723 10261 ROS1 ROS ROS 8 0.3 Effect of the antioxidants and agents involved in ROS metabolism 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262324 10930589 361691 5532 2719 DDC DDC DDC 5 0.0 Previous study has shown that DDC reacts with Cu(II) Cu II of SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262325 10930589 361692 5532 2719 DDC DDC DDC 1 0.0 Further DDC did not react with apoenzyme and gave no indication of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262327 10930589 361693 5532 2719 DDC DDC DDC 3 0.1 The reaction of DDC with SOD1 was shown to occur in two phases 6 JUMiner_v2.2 1 2 diethyldithiocarbamate 0 0 0 0 0 0 0 0 262328 10930589 361694 5532 2719 DDC DDC DDC 10 0.0 Phase 1 is associated with ligation of one molecule of DDC to Cu(II), Cu II leaving Cu(II) Cu II still attached 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262330 10930589 361695 5532 2719 DDC DDC DDC 12 0.0 of the reaction occurs slowly at a modest concentration of DDC (0.1_amp_#x2013;1.0 0.1_amp_#x2013 1.0 mM and SOD1 retains its full dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262333 10930589 361697 5532 2719 DDC DDC DDC 6 0.0 In this phase two molecules of DDC and one Cu(II) Cu II polymerize into colloidal particles stabilized 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262335 10930589 361698 5532 2719 DDC DDC DDC 7 0.0 This phase of the reaction requires a DDC concentration greater or equal to 10 mM and leads to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262337 10930589 361699 5532 2719 DDC DDC DDC 14 0.0 to C-DCF fluorescence in our studies was demonstrated by using DDC concentrations of phase 1 reaction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262340 10930589 361701 5532 2719 DDC DDC DDC 5 0.0 However the lower concentrations of DDC showed less inhibitory effect in FALS cells suggesting either altered 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 262341 10930589 361701 5532 2719 DDC DDC DDC 24 0.1 either altered interaction or modified stoichiometry between mutant SOD1 and DDC 6 JUMiner_v2.2 1 2 diethyldithiocarbamate 0 0 0 0 0 0 0 0 262344 10930589 361703 18723 10261 ROS1 ROS ROS 23 0.3 and -nitroarginine (inhibitor inhibitor of NOS showed no effect in ROS levels of all groups tested suggesting that lipid peroxides and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262347 10930589 361715 18723 10261 ROS1 ROS ROS 12 0.3 test the role of H 2 O 2 and increased ROS studies are in progress to determine if increased glutathione peroxidase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262348 10930589 361717 18723 10261 ROS1 ROS ROS 22 0.3 with SALS and normal control cells (B) B Menadione elevated ROS in all three groups with the highest levels recorded in 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262349 10930589 361729 18723 10261 ROS1 ROS ROS 3 0.3 Diethyldithiocarbamate (DDC) DDC inhibited ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 262350 10930589 361729 5532 2719 DDC DDC DDC 1 0.1 Diethyldithiocarbamate (DDC) DDC inhibited ROS generation 6 JUMiner_v2.2 1 2 diethyldithiocarbamate 0 0 0 0 0 0 0 0 262351 10930589 361730 5532 2719 DDC DDC DDC 12 0.0 of fluorescence was calculated relative to samples without addition of DDC 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 255941 11020331 350858 976 662 ARFRP1 ARP ARP 4 0.0 A biotinylated aldehyde-specific reagent ARP has been shown to react specifically with the aldehyde group 1 JUMiner_v2.2 1 2 UserEdit 0 3 9965 TotalCon:4<>662|ARFRP1|10139|Complete__15461|ARMET|7873|No_GeneRif__304|CRISP1|167|No_GeneRif__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:9965|RERE|0<>ScoreDetail__662|ARFRP1|0__9965|RERE|0__ 1 1 0 0 1 arp; 255942 11020331 350860 976 662 ARFRP1 ARP ARP 1 0.0 The ARP assay is thus a simple rapid and sensitive method for 1 JUMiner_v2.2 1 2 UserEdit 0 3 9965 TotalCon:4<>662|ARFRP1|10139|Complete__15461|ARMET|7873|No_GeneRif__304|CRISP1|167|No_GeneRif__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:9965|RERE|0<>ScoreDetail__662|ARFRP1|0__9965|RERE|0__ 1 1 0 0 1 arp; 255943 11020331 350861 976 662 ARFRP1 ARP ARP 17 0.0 N-glycosylases generates AP sites that can be measured by the ARP reagent 1 JUMiner_v2.2 1 2 UserEdit 0 3 9965 TotalCon:4<>662|ARFRP1|10139|Complete__15461|ARMET|7873|No_GeneRif__304|CRISP1|167|No_GeneRif__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:9965|RERE|0<>ScoreDetail__662|ARFRP1|0__9965|RERE|0__ 1 1 0 0 1 arp; 255946 11020331 350862 976 662 ARFRP1 ARP ARP 3 0.0 By coupling the ARP assay with either endonuclease III from Escherichia coli or 8-oxoguanine 1 JUMiner_v2.2 1 2 UserEdit 0 3 9965 TotalCon:4<>662|ARFRP1|10139|Complete__15461|ARMET|7873|No_GeneRif__304|CRISP1|167|No_GeneRif__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:9965|RERE|0<>ScoreDetail__662|ARFRP1|0__9965|RERE|0__ 1 1 0 0 1 arp; 255947 11020331 350864 976 662 ARFRP1 ARP ARP 6 0.0 The sensitivity and simplicity of the ARP assay thus make it a valuable method for investigators who 1 JUMiner_v2.2 1 2 UserEdit 0 3 9965 TotalCon:4<>662|ARFRP1|10139|Complete__15461|ARMET|7873|No_GeneRif__304|CRISP1|167|No_GeneRif__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:9965|RERE|0<>ScoreDetail__662|ARFRP1|0__9965|RERE|0__ 1 1 0 0 1 arp; 257587 11050436 352943 18723 10261 ROS1 ROS ROS 26 0.3 a new problem _amp_#x2013 that of reactive oxygen species (ROS) ROS produced as a byproduct of normal metabolism 1 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 257591 11050436 352960 18723 10261 ROS1 ROS ROS 5 0.3 Damage caused by mitochondrially generated ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 257605 11050436 352980 20996 11179 SOD1 ALS ALS 19 0.9 when mutations in CuZnSOD predisposing to amyotrophic lateral sclerosis (ALS) ALS are present 29 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000605951449456795<>ScoreDetail__5468|IGFALS|0.000329364523693537__11179|SOD1|0.000605951449456795__ 0 0 0 0 0 257606 11050436 352981 20996 11179 SOD1 ALS ALS 8 0.9 Although only a small proportion of patients with ALS have such mutations their existence has led to a number 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000605951449456795<>ScoreDetail__5468|IGFALS|0.000329364523693537__11179|SOD1|0.000605951449456795__ 0 0 0 0 0 257607 11050436 352982 20996 11179 SOD1 ALS ALS 6 0.9 The mutations seen in CuZnSOD in ALS patients are odd in that they do not destroy superoxide 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000605951449456795<>ScoreDetail__5468|IGFALS|0.000329364523693537__11179|SOD1|0.000605951449456795__ 0 0 0 0 0 257608 11050436 352987 18723 10261 ROS1 ROS ROS-induced 2 0.0 Evidence for ROS-induced mitochondrial damage associated with ageing 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257609 11050436 352989 18723 10261 ROS1 ROS ROS 66 0.3 more rapid rates of basal metabolism have faster rates of ROS production and a shorter life span 30 34 and 35 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 257610 11050436 352997 20996 11179 SOD1 ALS ALS 9 0.9 In transgenic mice bearing CuZnSOD mutations known to cause ALS in humans the protective bcl-2 protein when overexpressed transgenically can 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000605951449456795<>ScoreDetail__5468|IGFALS|0.000329364523693537__11179|SOD1|0.000605951449456795__ 0 0 0 0 0 257611 11050436 352997 20996 11179 SOD1 ALS ALS 27 0.9 overexpressed transgenically can protect against neuronal death brought about by ALS mutations in experimental animals 37 and 38 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000605951449456795<>ScoreDetail__5468|IGFALS|0.000329364523693537__11179|SOD1|0.000605951449456795__ 0 0 0 0 0 257612 11050436 352998 18723 10261 ROS1 ROS ROS-generating 8 0.0 One intriguing example of the link between the ROS-generating function of the respiratory chain and life span is that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 257615 11050436 353017 18723 10261 ROS1 ROS ROS 4 0.3 Clearly the role of ROS in ageing needs to be put into context with respect 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 257616 11050436 353028 18723 10261 ROS1 ROS ROS 12 0.3 telomere length was reduced significantly by peroxide-induced damage suggesting that ROS actively attack telomeric DNA and cause increased shortening as DNA 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 257625 11050436 353061 18723 10261 ROS1 ROS ROS 6 0.3 The generation of reactive oxygen species (ROS) ROS by mitochondria 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 257635 11050436 353067 13744 7475 MT-TA TRNA tRNA 2 2.1 Positions of tRNA genes in mtDNA which feature prominently in mutations prevalent in 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 257636 11050436 353067 13744 7475 MT-TA TRNA tRNA 34 2.1 single-letter amino acid code corresponding to the specificity of the tRNA 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 253639 11223912 347838 20996 11179 SOD1 ALS ALS 28 0.9 part associated with the pathogenesis of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000878945190887426<>ScoreDetail__5468|IGFALS|0.000293036389791678__11179|SOD1|0.000878945190887426__ 0 0 0 0 0 253640 11223912 347842 18723 10261 ROS1 ROS ROS 16 0.0 elevated promptly with subsequent accumulation of reactive oxygen species (ROS) ROS in the mitochondria 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 253641 11223912 347843 18723 10261 ROS1 ROS ROS 17 0.0 the increase in fluorescence of mitochondrial Ca(2+) Ca 2 and ROS indicators 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 253642 11223912 347844 18723 10261 ROS1 ROS ROS 16 0.0 neurons is mediated by mitochondrial Ca(2+) Ca 2 overload and ROS generation through the activation of NMDA receptors 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 251203 11375746 342604 20996 11179 SOD1 ALS ALS 20 0.0 such as Parkinson's disease (PD), PD amyotrophic lateral sclerosis (ALS), ALS and Huntington's disease are characterized by the deposition of abnormal 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000785386566356046<>ScoreDetail__5468|IGFALS|0.000129764801297648__11179|SOD1|0.000785386566356046__ 0 0 0 0 0 242773 11513882 330579 20996 11179 SOD1 ALS ALS 11 2.2 has been implicated in a wide range of diseases including ALS 6 7 8 and 9 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000714625490208973<>ScoreDetail__5468|IGFALS|0.000311934618503962__11179|SOD1|0.000714625490208973__ 0 0 0 0 0 242779 11513882 330614 408 307 AES AES AES 4 0.2 For atomic emission spectrometry (AES), AES SOD proteins were washed five times in refolding buffer (Centrex 5 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 242780 11513882 330615 19254 10472 RUNX2 CCD CCD 21 0.3 added and the samples were analyzed with a ICP-VISTA RL CCD simultaneous ICP-AES 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 242781 11513882 330618 20247 20116 SLC25A29 CACL CaCl 16 1.0 addition of 20 _amp_#x3bc l substrate buffer (0.67 0.67 mM CaCl 2 final concentration 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 242784 11513882 330633 20996 11179 SOD1 ALS ALS 22 2.2 classic (G93A) G93A or a benign (D90A) D90A course of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000714625490208973<>ScoreDetail__5468|IGFALS|0.000311934618503962__11179|SOD1|0.000714625490208973__ 0 0 0 0 0 242786 11513882 330642 20996 11179 SOD1 ALS ALS 16 2.2 more benign form of fALS which only gives rise to ALS in homozygous individuals conveyed the most protection of calcineurin activity 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000714625490208973<>ScoreDetail__5468|IGFALS|0.000311934618503962__11179|SOD1|0.000714625490208973__ 0 0 0 0 0 242823 11513882 330678 20996 11179 SOD1 ALS ALS 5 2.2 Independent of its relevance for ALS our data give additional information that calcineurin is regulated not 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000714625490208973<>ScoreDetail__5468|IGFALS|0.000311934618503962__11179|SOD1|0.000714625490208973__ 0 0 0 0 0 242828 11513882 330687 20996 11179 SOD1 ALS ALS 16 2.2 may therefore be a therapeutic approach in the treatment of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000714625490208973<>ScoreDetail__5468|IGFALS|0.000311934618503962__11179|SOD1|0.000714625490208973__ 0 0 0 0 0 245292 11562447 333621 7552 3690 FGFR3 ACH ACh 32 0.0 al. 1993 where it can interfere with the acetylcholine (ACh) ACh release mechanism after diffusion and participates in the control of 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245293 11562447 333623 12361 18752 MAPKAP1 SIN1 SIN-1 15 0.3 for the last 30 years is hydrolyzed to 3-morpholinosydnonimine (SIN-1), SIN-1 which has been shown to release consecutively O 2 and 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245294 11562447 333632 7552 3690 FGFR3 ACH ACh 25 0.0 endings of T marmorata electroneurons and showed that NO increased ACh release whereas ONOO inhibited ACh synthesis (Morot Morot Gaudry-Talarmain et 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245295 11562447 333632 7552 3690 FGFR3 ACH ACh 30 0.0 and showed that NO increased ACh release whereas ONOO inhibited ACh synthesis (Morot Morot Gaudry-Talarmain et al. 1997 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245296 11562447 333633 7552 3690 FGFR3 ACH ACh 0 0.0 ACh in neuromuscular junctions is synthesized from two extracellular precursors 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245297 11562447 333636 7552 3690 FGFR3 ACH ACh 2 0.0 Synthesis of ACh from choline and acetyl-CoA is performed by choline acetyltransferase (ChAT), 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245298 11562447 333637 7552 3690 FGFR3 ACH ACh 6 0.0 In a subsequent step newly synthesized ACh is transported into synaptic vesicles by the energy-dependent vesicular ACh 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245299 11562447 333637 7552 3690 FGFR3 ACH ACh 16 0.0 ACh is transported into synaptic vesicles by the energy-dependent vesicular ACh transporter 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245300 11562447 333638 12361 18752 MAPKAP1 SIN1 SIN-1 9 0.3 This article presents the inhibitory effects of ONOO and SIN-1 a donor of ONOO on high-affinity choline uptake ACh synthesis 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245301 11562447 333638 7552 3690 FGFR3 ACH ACh 19 0.0 and SIN-1 a donor of ONOO on high-affinity choline uptake ACh synthesis from radiolabeled acetate and ChAT activity 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245302 11562447 333648 12361 18752 MAPKAP1 SIN1 SIN-1 3 0.3 Stock Solutions of SIN-1 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245303 11562447 333649 12361 18752 MAPKAP1 SIN1 SIN-1 0 0.3 SIN-1 was obtained from BIOMOL (Plymouth Plymouth Meeting PA 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245304 11562447 333650 12361 18752 MAPKAP1 SIN1 SIN-1 3 0.3 Aqueous solutions of SIN-1 (100 100 mM were stored at 20degreeC before use 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245305 11562447 333653 12705 7097 MIF GIF Gif-sur-Yvette 31 0.3 Nicolas Morel (Laboratoire Laboratoire de Neurobiologie Cellulaire et Moleculaire CNRS Gif-sur-Yvette France 11 JUMiner_v2.2 1 2 UserEdit 0 2 7408 TotalCon:3<>4268|GIF|2694|Complete__7097|MIF|4282|Complete__7408|MT3|4504|Complete__<>AvaiableGeneRif=3<>BEST:7408|MT3|0.00045766590389016<>ScoreDetail__7097|MIF|0.000263290488741501__7408|MT3|0.00045766590389016__4268|GIF|0.000296442687747036__ 1 1 0 0 0 245306 11562447 333668 12361 18752 MAPKAP1 SIN1 SIN-1 12 0.3 Synaptosomes Synaptic Vesicles and Bovine Brain ChAT to ONOO or SIN-1 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245307 11562447 333669 12361 18752 MAPKAP1 SIN1 SIN-1 26 0.3 in 50 mM sodium-phosphate buffer pH 7.3 with ONOO or SIN-1 was carried out at room temperature for 1 to 2 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245308 11562447 333670 12361 18752 MAPKAP1 SIN1 SIN-1 3 0.3 For ONOO and SIN-1 incubations various increasing concentrations of drugs were added in one 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245309 11562447 333680 7552 3690 FGFR3 ACH ACh 4 0.0 Synthesis and Compartmentalization of ACh 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245310 11562447 333681 7552 3690 FGFR3 ACH ACh 2 0.0 Synthesis of ACh by 400 microl of synaptosomes was measured using C acetate 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245311 11562447 333681 7552 3690 FGFR3 ACH ACh 20 0.0 acetate (100 100 microM and choline (100 100 microM as ACh precursors 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245312 11562447 333683 7552 3690 FGFR3 ACH ACh 5 0.0 Formation of newly synthesized radioactive ACh in synaptosomes (180 180 microl was stopped by the addition 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245313 11562447 333683 7552 3690 FGFR3 ACH ACh 28 0.0 TCA whereas in the other aliquot (180 180 microl radioactive ACh accumulation in the vesicular pool was determined after one freezing 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245314 11562447 333684 7552 3690 FGFR3 ACH ACh 17 0.0 from all the samples by three ether washes and radioactive ACh was extracted by an allylcyanide-tetraphenylboron organic extraction procedure (Fonnum, Fonnum 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245315 11562447 333685 7552 3690 FGFR3 ACH ACh 6 0.0 The organic lipophilic phase containing radioactive ACh was collected and radioactivity was counted in Lipoluma scintillation liquid 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245316 11562447 333691 7552 3690 FGFR3 ACH ACh 1 0.0 Radioactive ACh was extracted and determined according to the method used by 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245317 11562447 333695 12361 18752 MAPKAP1 SIN1 SIN-1 31 0.3 freshly prepared synaptosomes (300 300 microl were pretreated with ONOO SIN-1 or vehicle (0.1 0.1 N NaOH for 45 min 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245318 11562447 333699 19573 10691 SDS SDS SDS-polyacrylamide 10 0.0 -treated samples (synaptosomes synaptosomes or purified enzymes were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) SDS-PAGE in reducing conditions ( beta-mercaptoethanol 10% 11 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.00029764887082707<>ScoreDetail__10691|SDS|2.63504611330698e-05__19440|SBDS|0.00029764887082707__ 0 0 0 0 0 245319 11562447 333701 3778 10620 CCL21 ECL ECL 18 0.0 horseradish peroxidase and visualized by the enhanced chemiluminescence kit (ECL; ECL Amersham Pharmacia Biotech AB Uppsala Sweden 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245320 11562447 333702 12361 18752 MAPKAP1 SIN1 SIN-1 3 0.3 Exogenous ONOO or SIN-1 Inhibits High-Affinity Choline Uptake and C ACh Synthesis from C 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245321 11562447 333702 7552 3690 FGFR3 ACH ACh 10 0.0 Exogenous ONOO or SIN-1 Inhibits High-Affinity Choline Uptake and C ACh Synthesis from C Acetate 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245322 11562447 333703 12361 18752 MAPKAP1 SIN1 SIN-1 14 0.3 1 increasing concentrations of ONOO (Fig Fig 1 A or SIN-1 (Fig Fig 1 B in the preincubation medium of synaptosomes 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245323 11562447 333704 12361 18752 MAPKAP1 SIN1 SIN-1 16 0.3 at approximately 500 microM for ONOO and 800 microM for SIN-1 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245324 11562447 333707 12361 18752 MAPKAP1 SIN1 SIN-1 28 0.3 a dose of the chemically synthesized ONOO or a donor SIN-1 which released ONOO by a regular flux associated with molecular 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245325 11562447 333711 7552 3690 FGFR3 ACH ACh 26 0.0 powerful inhibitor of two major cholinergic processes choline transport and ACh synthesis 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245326 11562447 333713 7552 3690 FGFR3 ACH ACh 6 0.0 In cholinergic neurons the synthesis of ACh by ChAT is dependent on intracellular pools of choline provided 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245327 11562447 333716 12361 18752 MAPKAP1 SIN1 SIN-1 18 0.3 be inactivated in a concentration-dependent manner both by ONOO and SIN-1 but not by millimolar ranges of H 2 O 2 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245328 11562447 333724 12361 18752 MAPKAP1 SIN1 SIN-1 8 0.3 ACh synthesis was inhibited by either ONOO or SIN-1 but neither was inhibited by H 2 O 2 up 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245329 11562447 333724 7552 3690 FGFR3 ACH ACh 0 0.0 ACh synthesis was inhibited by either ONOO or SIN-1 but neither 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245331 11562447 333731 12361 18752 MAPKAP1 SIN1 SIN-1 20 0.3 synaptic vesicles and synaptosomes in the presence of ONOO and SIN-1 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245333 11562447 333755 12361 18752 MAPKAP1 SIN1 SIN-1 2 0.3 ONOO and SIN-1 but not H 2 O 2 inhibit high-affinity choline uptake 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245334 11562447 333756 12361 18752 MAPKAP1 SIN1 SIN-1 14 0.3 (10 10 microM to 8 mM of ONOO (A), A SIN-1 (B), B or H 2 O 2 (C) C for 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245335 11562447 333759 12361 18752 MAPKAP1 SIN1 SIN-1 2 0.3 ONOO and SIN-1 inhibit ACh synthesis and ChAT activity but not compartmentalization of 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245336 11562447 333759 7552 3690 FGFR3 ACH ACh 4 0.1 ONOO and SIN-1 inhibit ACh synthesis and ChAT activity but not compartmentalization of ACh into 6 JUMiner_v2.2 1 2 acetylcholine 0 0 0 0 0 0 0 0 245337 11562447 333759 7552 3690 FGFR3 ACH ACh 13 0.0 inhibit ACh synthesis and ChAT activity but not compartmentalization of ACh into synaptic vesicles 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245338 11562447 333760 12361 18752 MAPKAP1 SIN1 SIN-1 28 0.3 synaptosomes with either chemically synthesized ONOO (open open symbols or SIN-1 (filled filled symbols 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245339 11562447 333761 7552 3690 FGFR3 ACH ACh 4 0.0 A A' total C ACh synthesis measured for 60 min after treatment using C acetate 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245340 11562447 333762 7552 3690 FGFR3 ACH ACh 6 0.0 B and B' incorporation of C ACh in synaptic vesicles measured for the same time after a 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245341 11562447 333762 7552 3690 FGFR3 ACH ACh 30 0.0 and expressed as a percentage of total newly synthesized C ACh 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245342 11562447 333765 12361 18752 MAPKAP1 SIN1 SIN-1 2 0.3 ONOO and SIN-1 inhibit purified bovine brain ChAT 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245343 11562447 333766 12361 18752 MAPKAP1 SIN1 SIN-1 7 0.3 After a 60-min preincubation with ONOO or SIN-1 the activity of 10 microl of bovine brain ChAT diluted 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245344 11562447 333774 3778 10620 CCL21 ECL ECL-peroxidase 18 0.0 antibody raised against nitrotyrosine (1/1000) 1 1000 and revealed by ECL-peroxidase system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245345 11562447 333776 3778 10620 CCL21 ECL ECL-peroxidase 8 0.0 The immunoreactivity for ChAT was similarly revealed by ECL-peroxidase system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245346 11562447 333784 3778 10620 CCL21 ECL ECL-peroxidase 30 0.0 incubated with different antibodies against neuronal proteins and revealed by ECL-peroxidase system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245350 11562447 333805 7552 3690 FGFR3 ACH ACh 13 0.0 in Fig 2 increasing concentrations of ONOO dose-dependently inhibited C ACh synthesis (IC IC 50 = 300 microM Fig 2 A 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245351 11562447 333806 12361 18752 MAPKAP1 SIN1 SIN-1 3 0.3 Continuous infusion with SIN-1 (Fig Fig 2A' 2B' led to similar results with a 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245352 11562447 333807 7552 3690 FGFR3 ACH ACh 18 0.0 induce any significant changes in the synthesis and incorporation of ACh (data data not shown 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245353 11562447 333809 7552 3690 FGFR3 ACH ACh 3 0.0 Having shown that ACh synthesis from acetate was defective in ONOO -treated synaptosomes we 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245354 11562447 333809 7552 3690 FGFR3 ACH ACh 27 0.0 whether the enzymatic activity of ChAT the enzyme responsible for ACh synthesis from acetyl-CoA and choline was altered or if this 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245355 11562447 333809 7552 3690 FGFR3 ACH ACh 51 0.0 to the inactivation of choline uptake which provides the other ACh precursor choline 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245356 11562447 333810 12361 18752 MAPKAP1 SIN1 SIN-1 6 0.3 Therefore synaptosomes pretreated with ONOO or SIN-1 were lysed by Triton X-100 (0.02%) 0.02% and assessed for 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245357 11562447 333810 7552 3690 FGFR3 ACH ACh 29 0.0 intracellular ChAT at the end of the measurement of the ACh synthesis 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 245358 11562447 333811 12361 18752 MAPKAP1 SIN1 SIN-1 14 0.3 by ONOO (IC IC 50 = 350 microM and by SIN-1 (IC IC 50 = 40 microM (Fig Fig 2 C 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245359 11562447 333812 12361 18752 MAPKAP1 SIN1 SIN-1 0 0.3 SIN-1 was surprisingly a more potent inhibitor of ChAT activity of 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245360 11562447 333813 12361 18752 MAPKAP1 SIN1 SIN-1 25 0.3 of the cytosol which leads to better oxygen accessibility during SIN-1 decomposition 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245361 11562447 333814 12361 18752 MAPKAP1 SIN1 SIN-1 1 0.3 Moreover SIN-1 decomposition in tissues can lead to the continuous formation of 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245362 11562447 333818 12361 18752 MAPKAP1 SIN1 SIN-1 22 0.3 an inhibition of the activity of ChAT by ONOO and SIN-1 we investigated the effect of ONOO and SIN-1 on partially 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245363 11562447 333818 12361 18752 MAPKAP1 SIN1 SIN-1 30 0.3 ONOO and SIN-1 we investigated the effect of ONOO and SIN-1 on partially purified bovine brain ChAT in the presence of 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245364 11562447 333819 12361 18752 MAPKAP1 SIN1 SIN-1 12 0.3 was inhibited by ONOO and to a lesser extent by SIN-1 possibly because of a lack of oxygen in the medium 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245365 11562447 333834 12361 18752 MAPKAP1 SIN1 SIN-1 7 0.3 We were unable to detect nitration by SIN-1 and no significant change in the immunoreactivity for ChAT was 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245366 11562447 333834 12361 18752 MAPKAP1 SIN1 SIN-1 20 0.3 significant change in the immunoreactivity for ChAT was noticed after SIN-1 treatment 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245367 11562447 333847 19573 10691 SDS SDS SDS 15 0.0 immunoreactivity of a 30- to 32-kDa VAMP-containing complex resistant to SDS beta-mercaptoethanol and boiling increased after ONOO treatment of synaptic vesicles 11 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.00029764887082707<>ScoreDetail__10691|SDS|2.63504611330698e-05__19440|SBDS|0.00029764887082707__ 0 0 0 0 0 245368 11562447 333852 12361 18752 MAPKAP1 SIN1 SIN-1 8 0.3 When synaptosomes were treated with increasing concentrations of SIN-1 (100-4000 100-4000 microM for 1 h under continuous agitation and 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245369 11562447 333852 12361 18752 MAPKAP1 SIN1 SIN-1 35 0.3 was detected and only faint bands appeared at 4 mM SIN-1 (data data not shown 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245373 11562447 333874 12361 18752 MAPKAP1 SIN1 SIN-1 5 0.3 ONOO peroxynitrite ACh acetylcholine SIN-1 3-morpholinosydnonimine CoA Coenzyme A ChAT choline acetyltransferase VAMP/synaptobrevin, VAMP synaptobrevin 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 245374 11562447 333874 7552 3690 FGFR3 ACH ACh 3 0.1 ONOO peroxynitrite ACh acetylcholine SIN-1 3-morpholinosydnonimine CoA Coenzyme A ChAT choline acetyltransferase VAMP/synaptobrevin, 6 JUMiner_v2.2 1 2 acetylcholine 0 0 0 0 0 0 0 0 245375 11562447 333874 3778 10620 CCL21 ECL ECL 28 0.0 trichloroacetic acid BSA bovine serum albumin PAGE polyacrylamide gel electrophoresis ECL enhanced chemiluminescence GSH glutathione NAC N -acetylcysteine DTT dithiothreitol 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238884 11679167 325565 20996 11179 SOD1 ALS ALS 25 1.9 oxygen species in diseases related to oxidative stress such as ALS or FRDA (see see Sections 4.3 and 4.4 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000541303533462508<>ScoreDetail__5468|IGFALS|0.000329558764810429__11179|SOD1|0.000541303533462508__ 0 0 0 0 0 238889 11679167 325627 14948 8140 OPA1 NTG ntg 3 0.0 The triple mutant ntg 1_amp_#x394 ntg 2_amp_#x394 rad 1_amp_#x394 shows an increased rate of 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238890 11679167 325627 14948 8140 OPA1 NTG ntg 5 0.0 The triple mutant ntg 1_amp_#x394 ntg 2_amp_#x394 rad 1_amp_#x394 shows an increased rate of spontaneous and 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238891 11679167 325627 22000 11730 TERT TERT tert 28 0.0 mutagenesis which is correlated to a hypersensitivity to hydrogen peroxide tert -butylhydroperoxide and superoxide generating drugs ( Gellon et al. 2001 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238892 11679167 325628 23725 29369 UNK UNK Unk 48 0.0 the apurinic or apyrimidinic site ( Girard and Boiteux 1997 Unk et al. 2001 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238893 11679167 325629 23725 29369 UNK UNK Unk 15 0.0 3 _amp_#x2032 -blocking groups present at single strand breaks ( Unk et al. 2001 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238915 11679167 325717 13705 7373 MSN MSN msn 18 0.0 61 genes upregulated at the diauxic shift and stationary phase msn 2_amp_#x394 msn 4_amp_#x394 mutants are resistant to several stress conditions 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238916 11679167 325717 13705 7373 MSN MSN msn 20 0.0 upregulated at the diauxic shift and stationary phase msn 2_amp_#x394 msn 4_amp_#x394 mutants are resistant to several stress conditions 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238918 11679167 325730 23451 12434 TXK TKL tkl 29 0.6 of the pentose phosphate pathway ( zwf 1_amp_#x394 rpe 1_amp_#x394 tkl 1_amp_#x394 tkl 2_amp_#x394 tal 1_amp_#x394 and gnd 1_amp_#x394 which exhibit 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 238919 11679167 325730 23451 12434 TXK TKL tkl 31 0.6 pentose phosphate pathway ( zwf 1_amp_#x394 rpe 1_amp_#x394 tkl 1_amp_#x394 tkl 2_amp_#x394 tal 1_amp_#x394 and gnd 1_amp_#x394 which exhibit a higher 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 238920 11679167 325730 12082 25135 LRSAM1 TAL tal 33 0.6 pathway ( zwf 1_amp_#x394 rpe 1_amp_#x394 tkl 1_amp_#x394 tkl 2_amp_#x394 tal 1_amp_#x394 and gnd 1_amp_#x394 which exhibit a higher sensitivity to 14 JUMiner_v2.2 1 2 UserEdit 0 2 25135 TotalCon:2<>25135|LRSAM1|90678|Complete__11559|TALDO1|6888|Complete__<>AvaiableGeneRif=2<>BEST:25135|LRSAM1|0.000722499849479198<>ScoreDetail__11559|TALDO1|0.000288691179172244__25135|LRSAM1|0.000722499849479198__ 1 1 0 0 0 238921 11679167 325730 18750 10293 RPE RPE rpe 27 0.1 in enzymes of the pentose phosphate pathway ( zwf 1_amp_#x394 rpe 1_amp_#x394 tkl 1_amp_#x394 tkl 2_amp_#x394 tal 1_amp_#x394 and gnd 1_amp_#x394 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 238923 11679167 325747 18752 10295 RPGR CRD CRD 11 0.0 second cysteine rich domain at the N terminus ( n -CRD also containing three cysteine residues is important for hydrogen peroxide 11 JUMiner_v2.2 1 0 0 2 2383 TotalCon:2<>10295|RPGR|6103|Complete__2383|CRX|1406|Complete__<>AvaiableGeneRif=2<>BEST:2383|CRX|0.000351519287036175<>ScoreDetail__10295|RPGR|0.000261942790384866__2383|CRX|0.000351519287036175__ 0 0 0 0 0 238924 11679167 325749 18752 10295 RPGR CRD CRD 3 0.0 Both the n -CRD and the c-CRD contain nuclear export signals 11 JUMiner_v2.2 1 0 0 2 2383 TotalCon:2<>10295|RPGR|6103|Complete__2383|CRX|1406|Complete__<>AvaiableGeneRif=2<>BEST:2383|CRX|0.000351519287036175<>ScoreDetail__10295|RPGR|0.000261942790384866__2383|CRX|0.000351519287036175__ 0 0 0 0 0 238925 11679167 325750 18752 10295 RPGR CRD CRD 6 0.0 Oxidation of cysteine residues at the CRD inhibits the Crm1p-dependent nuclear export of Yap1p but not the 11 JUMiner_v2.2 1 0 0 2 2383 TotalCon:2<>10295|RPGR|6103|Complete__2383|CRX|1406|Complete__<>AvaiableGeneRif=2<>BEST:2383|CRX|0.000351519287036175<>ScoreDetail__10295|RPGR|0.000261942790384866__2383|CRX|0.000351519287036175__ 0 0 0 0 0 238931 11679167 325768 9652 23316 HSD17B6 HSE HSE 45 0.3 to hydrogen peroxide through binding to heat shock elements (HSE) HSE ( Raitt et al. 2000 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 238933 11679167 325772 4985 2411 CRYGD CCP ccp 20 0.0 and Yap1p-dependent and is lower in respiration deficient mutants and ccp 1_amp_#x394 cells ( Charizanis et al. 1999 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238934 11679167 325775 13812 32159 MTG1 GTP GTP 9 0.3 is an essential protein that contains a putative ATP/GTP ATP GTP binding domain and activates the Skn7p factor in cells exposed 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 238937 11679167 325809 14334 7773 NF2 SCH sch 7 0.0 The increased life-span of cyr 1_amp_#x394 and sch 9_amp_#x394 mutants is correlated with a delay in the reversible 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238946 11679167 325827 23890 12666 VCP VCP VCP 20 0.0 putative ATPase homologous to the mammalian anti-apoptotic valosine-containing protein (VCP) VCP ( Shirogane et al. 1999 also induces both apoptosis and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238954 11679167 325845 20996 11179 SOD1 ALS ALS 3 1.9 Amyotrophic lateral sclerosis (ALS) ALS is a neurodegenerative disease characterised by the selective degeneration of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000541303533462508<>ScoreDetail__5468|IGFALS|0.000329558764810429__11179|SOD1|0.000541303533462508__ 0 0 0 0 0 238955 11679167 325846 20996 11179 SOD1 ALS ALS 28 1.9 al. 1993 the yeast Saccharomyces cerevisiae has been utilised for ALS research on clarifying the role of SOD mutations 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000541303533462508<>ScoreDetail__5468|IGFALS|0.000329558764810429__11179|SOD1|0.000541303533462508__ 0 0 0 0 0 238957 11679167 325848 117 77 ABL2 ARG Arg 4 0.0 While the Gly 85_amp_#x2192 Arg CuZnSOD failed to rescue the phenotype the other mutant proteins 2 JUMiner_v2.2 1 0 0 2 77 TotalCon:2<>77|ABL2|27|Complete__9965|RERE|473|Complete__<>AvaiableGeneRif=2<>BEST:77|ABL2|0.00127258881129552<>ScoreDetail__77|ABL2|0.00127258881129552__9965|RERE|3.79089427195876e-05__ 0 0 0 0 0 238958 11679167 325851 20996 11179 SOD1 ALS ALS 3 1.9 The ability of ALS mutant CuZnSOD proteins to bind copper and zinc has been 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000541303533462508<>ScoreDetail__5468|IGFALS|0.000329558764810429__11179|SOD1|0.000541303533462508__ 0 0 0 0 0 238964 11679167 325908 18752 10295 RPGR CRD CRD 2 0.0 Cysteine-rich domains (CRD), CRD containing the nuclear export signal (NES) NES that binds the 11 JUMiner_v2.2 1 0 0 2 2383 TotalCon:2<>10295|RPGR|6103|Complete__2383|CRX|1406|Complete__<>AvaiableGeneRif=2<>BEST:2383|CRX|0.000351519287036175<>ScoreDetail__10295|RPGR|0.000261942790384866__2383|CRX|0.000351519287036175__ 0 0 0 0 0 238965 11679167 325908 14307 7756 NES NES NES 8 0.0 Cysteine-rich domains (CRD), CRD containing the nuclear export signal (NES) NES that binds the Crm1p transporter controls intracellular localisation of Yap1p 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238966 11679167 325909 14307 7756 NES NES NES 12 0.0 non-stress conditions thioredoxin reduces the cysteine residues and exposes the NES 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 238967 11679167 325911 18752 10295 RPGR CRD CRD 4 0.0 (b) b Oxidation of the CRD by hydrogen peroxide impairs binding of Crm1p 11 JUMiner_v2.2 1 0 0 2 2383 TotalCon:2<>10295|RPGR|6103|Complete__2383|CRX|1406|Complete__<>AvaiableGeneRif=2<>BEST:2383|CRX|0.000351519287036175<>ScoreDetail__10295|RPGR|0.000261942790384866__2383|CRX|0.000351519287036175__ 0 0 0 0 0 234232 11795894 317427 18723 10261 ROS1 ROS ROS 6 0.0 Free radicals and reactive oxygen species (ROS) ROS have been associated with the etiology and/or and or progression 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 234233 11796206 317437 20996 11179 SOD1 ALS ALS 3 1.9 Amyotrophic lateral sclerosis (ALS) ALS is a neurodegenerative disorder leading to loss of motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00233181408547475<>ScoreDetail__5468|IGFALS|0.000334828902430858__11179|SOD1|0.00233181408547475__ 0 0 0 0 0 234234 11796206 317438 20996 11179 SOD1 ALS ALS 11 1.9 previously characterized the enhanced peroxidative activity of the human familial ALS (FALS) FALS mutants of copper-zinc superoxide dismutase (CuZnSOD) CuZnSOD A4V 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00233181408547475<>ScoreDetail__5468|IGFALS|0.000334828902430858__11179|SOD1|0.00233181408547475__ 0 0 0 0 0 234235 11796206 317446 20996 11179 SOD1 ALS ALS 3 1.9 Amyotrophic lateral sclerosis (ALS) ALS is a progressive neurodegenerative disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00233181408547475<>ScoreDetail__5468|IGFALS|0.000334828902430858__11179|SOD1|0.00233181408547475__ 0 0 0 0 0 234236 11796206 317448 20996 11179 SOD1 ALS ALS 6 1.9 In the vast majority of cases ALS is sporadic and has no known cause (sporadic sporadic ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00233181408547475<>ScoreDetail__5468|IGFALS|0.000334828902430858__11179|SOD1|0.00233181408547475__ 0 0 0 0 0 234237 11796206 317448 20996 11179 SOD1 ALS ALS 15 1.9 ALS is sporadic and has no known cause (sporadic sporadic ALS or SALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00233181408547475<>ScoreDetail__5468|IGFALS|0.000334828902430858__11179|SOD1|0.00233181408547475__ 0 0 0 0 0 234238 11796206 317449 20996 11179 SOD1 ALS ALS 5 1.9 However in approximately 10% of ALS cases the disease is inherited 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00233181408547475<>ScoreDetail__5468|IGFALS|0.000334828902430858__11179|SOD1|0.00233181408547475__ 0 0 0 0 0 234239 11796206 317450 20996 11179 SOD1 ALS ALS 2 1.9 Most familial ALS (FALS) FALS shows autosomal dominant inheritance approximately one fifth of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00233181408547475<>ScoreDetail__5468|IGFALS|0.000334828902430858__11179|SOD1|0.00233181408547475__ 0 0 0 0 0 230203 11884366 310521 18723 10261 ROS1 ROS ROS 7 0.0 The endogenous production of reactive oxygen species (ROS) ROS is a major limiter of life as illustrated by studies 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230204 11884366 310522 18723 10261 ROS1 ROS ROS 10 0.0 Mitochondria have received considerable attention as a principal source---and target---of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 230205 11884366 310524 20996 11179 SOD1 ALS ALS 23 0.0 disease Parkinson's disease prion diseases and amyotrophic lateral sclerosis (ALS) ALS as well as aging itself 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000720144431201565<>ScoreDetail__5468|IGFALS|0.00025762129669386__11179|SOD1|0.000720144431201565__ 0 0 0 0 0 230678 11905995 311194 20996 11179 SOD1 ALS ALS 13 2.2 selective motor neuron degeneration in human amyotrophic lateral sclerosis (ALS) ALS disease remain largely unknown and effective therapies are not currently 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0025256035507245<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.0025256035507245__ 0 0 0 0 0 230680 11905995 311195 20996 11179 SOD1 ALS ALS 26 2.2 SOD 1 gene and mitochondrial abnormality is observed in human ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0025256035507245<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.0025256035507245__ 0 0 0 0 0 230688 11905995 311202 20996 11179 SOD1 ALS ALS 24 2.2 can be potentially useful in the clinical management of human ALS disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0025256035507245<>ScoreDetail__5468|IGFALS|0.000668635426533683__11179|SOD1|0.0025256035507245__ 0 0 0 0 0 232190 11978481 313813 20996 11179 SOD1 ALS ALS 29 2.5 Parkinson_amp_#x2019 s disease (PD), PD and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232191 11978481 313816 18723 10261 ROS1 ROS ROS 8 0.3 Oxidative modification of proteins by reactive oxygen species (ROS) ROS or reactive nitrogen species (RNS) RNS is implicated in the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 232192 11978481 313816 6981 22140 FAM20C RNS RNS 13 0.0 reactive oxygen species (ROS) ROS or reactive nitrogen species (RNS) RNS is implicated in the pathogenesis of both normal aging and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 232193 11978481 313817 18723 10261 ROS1 ROS ROS 3 0.3 The generation of ROS and RNS may occur by a large number of physiological 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 232194 11978481 313817 6981 22140 FAM20C RNS RNS 5 0.1 The generation of ROS and RNS may occur by a large number of physiological and nonphysiological 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 232199 11978481 313856 1647 1044 BGN PGI PGI 2 0.0 Prostacyclin synthase (PGI PGI 2 is another heme protein that is nitrated and inactivated 1 JUMiner_v2.2 1 0 0 2 1044 TotalCon:2<>1044|BGN|633|Complete__4458|GPI|2821|Complete__<>AvaiableGeneRif=2<>BEST:1044|BGN|0.000754795967232975<>ScoreDetail__1044|BGN|0.000754795967232975__4458|GPI|0.000362550550905676__ 0 0 0 0 0 232204 11978481 313915 20996 11179 SOD1 ALS ALS 0 2.5 ALS is a rapidly progressive neurodegenerative disease leading to progressive motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232205 11978481 313917 20996 11179 SOD1 ALS ALS 4 2.5 In amyotrophic lateral sclerosis (ALS) ALS there is a large amount of evidence implicating oxidative damage 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232206 11978481 313919 20996 11179 SOD1 ALS ALS 15 2.5 were increased by 119% in spinal cord tissue of sporadic ALS patients 59 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232207 11978481 313920 20996 11179 SOD1 ALS ALS 14 2.5 there was no change in levels of protein carbonyls in ALS motor cortex 60 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232208 11978481 313921 20996 11179 SOD1 ALS ALS 12 2.5 of hydroxynonenal modified protein by immunohistochemistry showed an increase in ALS spinal cord motor neurons and immunoprecipitation showed that one of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232209 11978481 313922 20996 11179 SOD1 ALS ALS 9 2.5 There is substantial evidence for increased protein nitration in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232210 11978481 313923 20996 11179 SOD1 ALS ALS 17 2.5 in spinal cord motor neurons of both sporadic and familial ALS patients 5 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232211 11978481 313924 20996 11179 SOD1 ALS ALS 19 2.5 significant increases in the lumbar and thoracic spinal cord of ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232212 11978481 313925 20996 11179 SOD1 ALS ALS 20 2.5 nitrated manganese superoxide dismutase in the cerebrospinal fluid of sporadic ALS patients 42 and 62 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232213 11978481 313926 20996 11179 SOD1 ALS ALS 5 2.5 In transgenic mouse models of ALS protein carbonyls are significantly increased in the spinal cord and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232214 11978481 313927 20996 11179 SOD1 ALS ALS 11 2.5 found significant decreases in creatine kinase activity in the transgenic ALS mice that were mimicked by exposure of brain extracts of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232215 11978481 313928 20996 11179 SOD1 ALS ALS 16 2.5 showed increased 3-nitrotyrosine staining in spinal cord motor neurons of ALS patients 64 65 and 66 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232219 11978481 313930 20996 11179 SOD1 ALS ALS 21 2.5 but showed an increase in nNOS in reactive astrocytes in ALS spinal cord and subcortical white matter 68 and 69 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232220 11978481 313931 20996 11179 SOD1 ALS ALS 8 2.5 A potential source of O 2 _amp_#x2022 _amp_#x2212 in ALS is the proinflammatory enzyme cyclooxygenase-2 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 232221 11978481 313932 20996 11179 SOD1 ALS ALS 11 2.5 activity is dramatically increased in spinal cord tissue of sporadic ALS patients and immunochemistry shows increased staining in glial cells 70 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00132794317255692<>ScoreDetail__5468|IGFALS|0.000920251814360111__11179|SOD1|0.00132794317255692__ 0 0 0 0 0 224375 12215226 300341 20996 11179 SOD1 ALS ALS 10 0.0 Impaired oxidative metabolism and lipid peroxidation in exercising muscle from ALS patients 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00085447710120969<>ScoreDetail__5468|IGFALS|0.000718580991641769__11179|SOD1|0.00085447710120969__ 0 0 0 0 0 224376 12215226 300342 20996 11179 SOD1 ALS ALS 15 0.0 selective loss of motor neurons in amyotrophic lateral sclerosis (ALS) ALS are unknown there is increasing evidence for the hypothesis of 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00085447710120969<>ScoreDetail__5468|IGFALS|0.000718580991641769__11179|SOD1|0.00085447710120969__ 0 0 0 0 0 224377 12215226 300342 20996 11179 SOD1 ALS ALS 68 0.0 in-vivo oxidative metabolism in exercising muscle in patients affected by ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00085447710120969<>ScoreDetail__5468|IGFALS|0.000718580991641769__11179|SOD1|0.00085447710120969__ 0 0 0 0 0 224378 12215226 300344 20996 11179 SOD1 ALS ALS 4 0.0 RESULTS At rest the ALS patients had higher than normal levels of both lactate (2.82 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00085447710120969<>ScoreDetail__5468|IGFALS|0.000718580991641769__11179|SOD1|0.00085447710120969__ 0 0 0 0 0 224379 12215226 300347 20996 11179 SOD1 ALS ALS 23 0.0 free radical pool in resting conditions and during exercise in ALS patients 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00085447710120969<>ScoreDetail__5468|IGFALS|0.000718580991641769__11179|SOD1|0.00085447710120969__ 0 0 0 0 0 224380 12215226 300348 20996 11179 SOD1 ALS ALS 25 0.0 a tight link between mitochondrial function and oxidative stress in ALS gsicilia@med.unip.it publication of the World Federation of Neurology Research Group 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00085447710120969<>ScoreDetail__5468|IGFALS|0.000718580991641769__11179|SOD1|0.00085447710120969__ 0 0 0 0 0 224452 12218958 300515 20996 11179 SOD1 ALS ALS-like 10 1.9 Transgenic mice expressing multiple copies of FALS-mutant SOD1s develop an ALS-like motor neuron disease 11 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00235510122660674<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00235510122660674__ 0 0 0 0 0 226058 12368231 302531 18723 10261 ROS1 ROS ROS 39 0.0 chronic exposure to high levels of reactive oxygen species (ROS) ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226060 12368231 302532 18723 10261 ROS1 ROS ROS 16 0.2 spinal cord injury (SCI); SCI however the involvement of SOD1 ROS and apoptosis in their death has not been clarified 5 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 226063 12368231 302538 18723 10261 ROS1 ROS ROS-initiated 5 0.0 These results suggest that the ROS-initiated mitochondrial signaling pathway possibly plays a pivotal role in apoptotic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226207 12373523 302675 20996 11179 SOD1 ALS ALS 44 0.0 PD Alzheimer's disease (AD) AD and amyotrophic lateral sclerosis (ALS)] ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000484159394309067<>ScoreDetail__5468|IGFALS|0.000252133681277813__11179|SOD1|0.000484159394309067__ 0 0 0 0 0 226208 12373523 302676 18723 10261 ROS1 ROS ROS 12 0.0 tyrosine per se can interact with reactive oxygen species (ROS) ROS and reactive nitrogen species (RNS) RNS via radical mechanisms and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226209 12373523 302676 6981 22140 FAM20C RNS RNS 17 0.0 reactive oxygen species (ROS) ROS and reactive nitrogen species (RNS) RNS via radical mechanisms and chain propagating reactions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226210 12373523 302677 18723 10261 ROS1 ROS ROS 6 0.0 The concentration of TyrO _amp_#8226 ROS and RNS can increase dramatically under conditions of generalized stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226211 12373523 302677 6981 22140 FAM20C RNS RNS 8 0.0 The concentration of TyrO _amp_#8226 ROS and RNS can increase dramatically under conditions of generalized stress oxidative nitrative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226212 12373523 302682 18723 10261 ROS1 ROS ROS 27 0.0 in brain and/or and or imbalance of the ratios ROS/RNS/TyrO ROS RNS TyrO _amp_#8226 may be all important in defining whether 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 226213 12373523 302682 6981 22140 FAM20C RNS RNS 27 0.0 brain and/or and or imbalance of the ratios ROS/RNS/TyrO ROS RNS TyrO _amp_#8226 may be all important in defining whether oxidative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218344 12392777 291978 20996 11179 SOD1 ALS ALS 20 2.4 Parkinson_amp_#x2019 s disease (PD), PD and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218345 12392777 291979 18723 10261 ROS1 ROS ROS 7 0.0 An unbalanced overproduction of reactive oxygen species (ROS) ROS may give rise to oxidative stress which can induce neuronal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218346 12392777 291980 20996 11179 SOD1 ALS ALS 18 2.4 stress is involved in the pathogenesis of AD PD and ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218347 12392777 291981 20996 11179 SOD1 ALS ALS 35 2.4 in animal models of neurodegenerative diseases including AD PD and ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218348 12392777 291982 20996 11179 SOD1 ALS ALS 16 2.4 antioxidants might exert some protective effect against AD PD and ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218349 12392777 291984 20996 11179 SOD1 ALS ALS 29 2.4 the pathogenesis of neurodegenerative disorders such as AD PD and ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218350 12392777 291985 18723 10261 ROS1 ROS ROS 3 0.0 The effects of ROS and antioxidants on NF-_amp_#x3ba B function and their relevance in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218351 12392777 291988 20996 11179 SOD1 ALS ALS 21 2.4 Parkinson_amp_#x2019 s disease (PD), PD and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218352 12392777 291991 20996 11179 SOD1 ALS ALS 25 2.4 the only one that is common to AD PD and ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218353 12392777 291993 20996 11179 SOD1 ALS ALS 35 2.4 characteristic of several different neurodegenerative disorders including AD PD and ALS 33 124 125 127 and 197 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218354 12392777 292000 18723 10261 ROS1 ROS ROS 10 0.0 these molecules are referred to as reactive oxygen species (ROS) ROS to signify their ability to lead to oxidative changes within 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218355 12392777 292001 18723 10261 ROS1 ROS ROS 6 0.0 Problems occur when the production of ROS exceeds the ability of cells to defend themselves against these 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218356 12392777 292002 18723 10261 ROS1 ROS ROS 6 0.0 This imbalance between cellular production of ROS and the ability of cells to defend themselves against them 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218357 12392777 292003 18723 10261 ROS1 ROS ROS 7 0.0 Oxidative stress can cause cellular damage and ROS oxidize critical cellular components such as membrane lipids proteins and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218358 12392777 292005 18723 10261 ROS1 ROS ROS 10 0.0 There is a large scientific literature regarding the relation between ROS production the induction of apoptosis (or or necrosis and the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218359 12392777 292006 20996 11179 SOD1 ALS ALS 27 2.4 may occur primarily by apoptotic mechanisms in AD PD and ALS 129 178 190 193 and 263 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218360 12392777 292007 20996 11179 SOD1 ALS ALS 13 2.4 shows signs of apoptosis in patients with AD PD and ALS 8 193 263 and 264 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218363 12392777 292018 18723 10261 ROS1 ROS ROS 10 0.0 Antioxidant defense mechanisms can be upregulated in response to increased ROS or peroxide production 42 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218364 12392777 292019 18723 10261 ROS1 ROS ROS 9 0.0 Although upregulating antioxidant defense systems may confer protection against ROS they are not completely effective in preventing oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218365 12392777 292021 18723 10261 ROS1 ROS ROS 9 0.0 As already mentioned the brain is especially vulnerable to ROS damage because of its high oxygen consumption rate abundant lipid 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218366 12392777 292022 18723 10261 ROS1 ROS ROS 10 0.0 the increased demand on the cell_amp_#x2019 s capacity to detoxify ROS is not met alterations such as aldehydes or isoprostanes from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218367 12392777 292025 18723 10261 ROS1 ROS ROS 8 0.0 These findings suggest that in addition to direct ROS damage to phospholipid membranes there is an indirect mechanism involving 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218368 12392777 292027 20996 11179 SOD1 ALS ALS 24 2.4 262 which was found to be elevated in AD and ALS patients 108 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218369 12392777 292029 20996 11179 SOD1 ALS ALS 31 2.4 levels of nitrotyrosine have been found in AD PD and ALS 1 18 84 85 109 257 and 265 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218370 12392777 292030 20996 11179 SOD1 ALS ALS 19 2.4 8-OHdG which is elevated in patients with AD PD and ALS 5 69 74 185 and 291 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218371 12392777 292032 18723 10261 ROS1 ROS ROS 8 0.0 Thus a large body of evidences indicate that ROS can act as second messengers mediating intracellular responses including NF-_amp_#x3ba 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218373 12392777 292034 18723 10261 ROS1 ROS ROS 22 0.0 feed-back mechanism that operates to regulate the intracellular concentration of ROS trying to dampen an excessive accumulation of ROS which can 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218374 12392777 292034 18723 10261 ROS1 ROS ROS 30 0.0 concentration of ROS trying to dampen an excessive accumulation of ROS which can be dangerous for the cell 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218377 12392777 292037 20996 11179 SOD1 ALS ALS 29 2.4 regions of the central nervous system of AD PD and ALS 117 133 and 189 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218378 12392777 292047 18723 10261 ROS1 ROS ROS 11 0.0 capability of these compounds to counteract the damaging effects of ROS and the relevance of this biochemical effect in their putative 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218379 12392777 292048 18723 10261 ROS1 ROS ROS 6 0.0 Among the numerous biochemical effects of ROS and antioxidants particular emphasis will be given to their interference 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218380 12392777 292049 20996 11179 SOD1 ALS ALS 22 2.4 in animal models and in patients with AD PD and ALS will be reviewed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218381 12392777 292065 18723 10261 ROS1 ROS ROS 25 0.0 and lipid hydroperoxides 220 and may stabilize catecholamines from forming ROS _amp_#x3b1 -Tocopherol is a powerful chain-breaking antioxidant that inhibits lipid 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218382 12392777 292066 18723 10261 ROS1 ROS ROS 10 0.0 Carotenoids can scavenge singlet oxygen and a range of other ROS in vitro but there is still little evidence that they 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218383 12392777 292079 18723 10261 ROS1 ROS ROS 6 0.0 Flavonoids can prevent injury caused by ROS in various ways 38 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218384 12392777 292082 18723 10261 ROS1 ROS ROS 5 0.0 In other words flavonoids stabilize ROS by reacting with the compound of the radical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 218385 12392777 292087 20996 11179 SOD1 ALS ALS 19 2.4 an important role in the pathogenesis of AD PD and ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218386 12392777 292091 20996 11179 SOD1 ALS ALS 23 2.4 of multiple antioxidants in the treatment of AD PD and ALS 213 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218387 12392777 292094 20996 11179 SOD1 ALS ALS 25 2.4 the fact that when overt symptomatology of AD PD and ALS occurs a certain amount of neuronal death has already occurred 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 218388 12392777 292100 20996 11179 SOD1 ALS ALS 28 2.4 relative risk for neurodegenerative disorders such as AD PD and ALS will throw more light on this very important aspect of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000626428838975498<>ScoreDetail__5468|IGFALS|0.000459486425458174__11179|SOD1|0.000626428838975498__ 0 0 0 0 0 221215 12447931 295853 20996 11179 SOD1 ALS ALS 15 0.0 neurons and prolongs survival in a transgenic mouse model of ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136489846894967<>ScoreDetail__5468|IGFALS|0.000444303395747382__11179|SOD1|0.00136489846894967__ 0 0 0 0 0 221216 12447931 295854 20996 11179 SOD1 ALS ALS 9 0.0 The pathogenesis of cell death in amyotrophic lateral sclerosis (ALS) ALS may involve glutamate-mediated excitotoxicity oxidative damage and apoptosis 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136489846894967<>ScoreDetail__5468|IGFALS|0.000444303395747382__11179|SOD1|0.00136489846894967__ 0 0 0 0 0 221217 12447931 295855 20996 11179 SOD1 ALS ALS 7 0.0 We used a transgenic mouse model of ALS to determine the effect of inhibition of cyclooxygenase-2 in treating 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136489846894967<>ScoreDetail__5468|IGFALS|0.000444303395747382__11179|SOD1|0.00136489846894967__ 0 0 0 0 0 221218 12447931 295858 20996 11179 SOD1 ALS ALS 18 0.0 inhibited production of prostaglandin E2 in the spinal cords of ALS mice 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136489846894967<>ScoreDetail__5468|IGFALS|0.000444303395747382__11179|SOD1|0.00136489846894967__ 0 0 0 0 0 221219 12447931 295860 20996 11179 SOD1 ALS ALS 4 0.0 Spinal cords of treated ALS mice showed significant preservation of spinal neurons and diminished astrogliosis 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136489846894967<>ScoreDetail__5468|IGFALS|0.000444303395747382__11179|SOD1|0.00136489846894967__ 0 0 0 0 0 221220 12447931 295861 20996 11179 SOD1 ALS ALS 8 0.0 Our results suggest that cyclooxygenase-2 inhibition may benefit ALS patients of Medicine Meyer 6-109 600 N Wolfe Street Baltimore 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00136489846894967<>ScoreDetail__5468|IGFALS|0.000444303395747382__11179|SOD1|0.00136489846894967__ 0 0 0 0 0 216910 12548704 290247 18723 10261 ROS1 ROS ROS 17 0.0 protects spinal motor neurons against acute reactive oxygen species (ROS)-induced ROS -induced toxicity but not against chronic ROS-induced or glutamate (Glu)-induced 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216911 12548704 290247 18723 10261 ROS1 ROS ROS-induced 23 0.0 oxygen species (ROS)-induced ROS -induced toxicity but not against chronic ROS-induced or glutamate (Glu)-induced Glu -induced toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216912 12548704 290248 567 877 ALDH7A1 PDE PDE 9 0.0 In this study we investigated the effects of phosphodiesterase (PDE) PDE inhibitors on the survival of cultured spinal motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216914 12548704 290249 567 877 ALDH7A1 PDE PDE 12 0.0 (dipyridamole, dipyridamole T-1032 and zaprinast as well as a nonselective PDE inhibitor (aminophylline) aminophylline protected motor and nonmotor neurons against both 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216915 12548704 290249 18723 10261 ROS1 ROS ROS-induced 23 0.0 (aminophylline) aminophylline protected motor and nonmotor neurons against both acute ROS-induced and chronic Glu-induced neurotoxicity whereas selective inhibitors of PDE1-4 offered 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 216916 12548704 290249 18723 10261 ROS1 ROS ROS-induced 49 0.0 cGMP analogue protected both motor and nonmotor neurons against acute ROS-induced toxicity but protected only nonmotor neurons against chronic Glu-induced toxicity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 207521 12614931 278042 18723 10261 ROS1 ROS ROS 11 0.6 was accompanied by enhanced generation of reactive oxygen species (ROS) ROS with a peak after 2 h of exposure and by 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207522 12614931 278043 18723 10261 ROS1 ROS ROS 3 0.6 The increase in ROS and the MTT reduction were both EA concentration-dependent 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207524 12614931 278049 20996 11179 SOD1 ALS ALS 23 0.9 spinal cord injury (SCI) SCI and amyotrophic lateral sclerosis (ALS), ALS where motor neurons are the vulnerable population and oxidative stress 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207525 12614931 278052 18723 10261 ROS1 ROS ROS 25 0.6 role both as a scavenger of reactive oxygen species (ROS), ROS reactive nitrogen species (RNS) RNS and potentially toxic oxidation products 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207526 12614931 278052 6981 22140 FAM20C RNS RNS 29 0.3 of reactive oxygen species (ROS), ROS reactive nitrogen species (RNS) RNS and potentially toxic oxidation products and as a substrate for 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 207527 12614931 278057 20996 11179 SOD1 ALS ALS 20 0.9 pathogenic factor in neurodegenerative diseases including amyotrophic lateral sclerosis (ALS), ALS Parkinson's disease (PD) PD and Alzheimer's disease (AD) AD and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207528 12614931 278058 20996 11179 SOD1 ALS ALS 11 0.9 neurons are selectively vulnerable in some neurodegenerative conditions such as ALS and spinal cord injury (SCI) SCI 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207530 12614931 278061 20996 11179 SOD1 ALS ALS 5 0.9 An altered GSH metabolism in ALS could contribute to motor neuron degeneration 10 11 and 12 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207531 12614931 278062 20996 11179 SOD1 ALS ALS 9 0.9 GSH binding sites increase in the spinal cord of ALS patients 13 and this may be interpreted as an upregulation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207532 12614931 278063 20996 11179 SOD1 ALS ALS 24 0.9 14 in a mouse model of the familial form of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207534 12614931 278067 18723 10261 ROS1 ROS ROS 15 0.6 appears to be a factor in motor neuron death and ROS formation and a decrease in mitochondrial membrane potential (MMP) MMP 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207535 12614931 278075 7361 20442 FBRS FBS FBS 18 0.0 (DMEM, DMEM Biochrom Berlin Germany supplemented with 5% heat-inactivated defined FBS (defined defined FBS Hyclone Logan UT 1 mM glutamine and 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 207536 12614931 278075 7361 20442 FBRS FBS FBS 20 0.0 Berlin Germany supplemented with 5% heat-inactivated defined FBS (defined defined FBS Hyclone Logan UT 1 mM glutamine and antibiotics (100 100 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 207537 12614931 278090 19573 10691 SDS SDS SDS 9 0.0 Then an equal volume of 20% sodium dodecyl sulphate (SDS) SDS in 50% dimethylformamide was added to each well and the 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000278596972932662<>ScoreDetail__10691|SDS|0.000112815884476534__19440|SBDS|0.000278596972932662__ 0 0 0 0 0 207540 12614931 278102 18723 10261 ROS1 ROS ROS 0 0.6 ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207541 12614931 278103 18723 10261 ROS1 ROS ROS 4 0.6 For determination of intracellular ROS control and EA-treated cells were exposed during the last 30 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207542 12614931 278105 18723 10261 ROS1 ROS ROS 11 0.6 the fluorescence intensity is proportional to the level of intracellular ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207549 12614931 278144 18723 10261 ROS1 ROS ROS 8 0.6 Since GSH depletion leads to the generation of ROS in different experimental conditions we measured the level of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207550 12614931 278144 18723 10261 ROS1 ROS ROS 18 0.6 ROS in different experimental conditions we measured the level of ROS by adding the probe DCFH-DA to the cultures 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207551 12614931 278145 18723 10261 ROS1 ROS ROS 0 0.6 ROS were rapidly raised by 100 _amp_#x3bc M EA_amp_#x2014 about twice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207552 12614931 278146 18723 10261 ROS1 ROS ROS 3 0.6 The increase in ROS formation after 90 min of exposure to EA was concentration-dependent 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207555 12614931 278166 18723 10261 ROS1 ROS ROS 23 0.6 of almost 80% in GSH was accompanied by mitochondrial impairment ROS formation and a limited decrease of MMP 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207556 12614931 278168 18723 10261 ROS1 ROS ROS 16 0.6 a steady drop in mitochondrial function and MMP while increased ROS formation remains a burst limited to the initial phase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207557 12614931 278170 18723 10261 ROS1 ROS ROS 9 0.6 Impaired mitochondrial respiration was probably the major source of ROS since Wullner et al 23 showed that ROS formation after 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207558 12614931 278170 18723 10261 ROS1 ROS ROS 19 0.6 source of ROS since Wullner et al 23 showed that ROS formation after EA exposure of cerebellar granule cells was almost 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207559 12614931 278171 18723 10261 ROS1 ROS ROS 2 0.6 In mitochondria ROS derive from the conversion of oxygen to superoxide and hydrogen 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207560 12614931 278178 20996 11179 SOD1 ALS ALS 11 0.9 treatment with catalase was beneficial in a mouse model of ALS 28 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207561 12614931 278181 18723 10261 ROS1 ROS ROS 4 0.6 The increase of intracellular ROS was accompanied by a decrease in MMP indicating the opening 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207562 12614931 278182 18723 10261 ROS1 ROS ROS 6 0.6 This phenomenon can be induced by ROS electron transport chain inhibition and oxidation of GSH 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207563 12614931 278184 18723 10261 ROS1 ROS ROS 12 0.6 support this since only the initial depolarization was concomitant with ROS formation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207564 12614931 278185 18723 10261 ROS1 ROS ROS 0 0.6 ROS could cause the initial opening of the MPTP while later 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207565 12614931 278191 20996 11179 SOD1 ALS ALS 16 0.9 levels were found in the motor nerve terminals of sporadic ALS patients 35 and in motor neurons of transgenic mouse models 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207566 12614931 278191 20996 11179 SOD1 ALS ALS 30 0.9 35 and in motor neurons of transgenic mouse models of ALS at the early stages of the disease 36 37 and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207567 12614931 278194 20996 11179 SOD1 ALS ALS 13 0.9 evidence that motor neurons die by an apoptotic pathway in ALS (for for a review see 40 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207574 12614931 278200 20996 11179 SOD1 ALS ALS 13 0.9 for HO-1 and p38MAPK were detected in human and mouse ALS 47 48 and 49 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207575 12614931 278202 20996 11179 SOD1 ALS ALS 1 0.9 In ALS there is evidence of oxidative stress coupled to mitochondrial damage 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109400288314422<>ScoreDetail__5468|IGFALS|0.000604077523282155__11179|SOD1|0.00109400288314422__ 0 0 0 0 0 207576 12614931 278220 18723 10261 ROS1 ROS ROS 8 0.6 Effect of ethacrynic acid on the generation of ROS in NSC-34 cells 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207577 12614931 278221 18723 10261 ROS1 ROS ROS 26 0.6 different EA concentrations for 90 min (panel panel B and ROS generation of was measured from the conversion of DCFH-DA to 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 207986 12618129 278644 20996 11179 SOD1 ALS ALS 3 1.8 Amyotrophic lateral sclerosis (ALS) ALS is a devastating neurodegenerative disease which affects the anterior horn 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207987 12618129 278645 20996 11179 SOD1 ALS ALS 19 1.8 on the finding that cybrids obtained from mitochondria of sporadic ALS patients exhibited impaired respiratory chain activities increased free radical scavenging 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207988 12618129 278646 20996 11179 SOD1 ALS ALS 9 1.8 To date however no distinct mtDNA alterations associated with ALS have been reported 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207989 12618129 278647 20996 11179 SOD1 ALS ALS 10 1.8 Therefore we reexamined the hypotheses that mtDNA mutations accumulate in ALS and that cybrids generated from ALS patients_amp_#x2019 blood have impaired 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207990 12618129 278647 20996 11179 SOD1 ALS ALS 16 1.8 mtDNA mutations accumulate in ALS and that cybrids generated from ALS patients_amp_#x2019 blood have impaired mitochondrial respiration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207991 12618129 278648 20996 11179 SOD1 ALS ALS 16 1.8 143B osteosarcoma _amp_#x3c1 0 cells and platelet mitochondria of sporadic ALS patients or age-matched controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207992 12618129 278649 20996 11179 SOD1 ALS ALS 10 1.8 We found no statistically significant differences in mitochondrial respiration between ALS and control cybrids even when the electron transport chain was 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207993 12618129 278650 20996 11179 SOD1 ALS ALS 9 1.8 Mitochondrial respiratory chain enzyme activities were also normal in ALS cybrids and there was no increase in free radical production 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207994 12618129 278651 20996 11179 SOD1 ALS ALS 8 1.8 Therefore we showed that mtDNA from platelets of ALS patients was able to restore normal respiratory function in _amp_#x3c1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207995 12618129 278653 20996 11179 SOD1 ALS ALS 3 1.8 Amyotrophic lateral sclerosis (ALS) ALS is a devastating neurodegenerative disease that affects the anterior horn 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207996 12618129 278654 20996 11179 SOD1 ALS ALS 4 1.8 The annual incidence of ALS is 1 in 100 000 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207997 12618129 278656 20996 11179 SOD1 ALS ALS 16 1.8 a potential role of mitochondrial dysfunction in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207998 12618129 278657 20996 11179 SOD1 ALS ALS 7 1.8 In anterior horn cells of patients with ALS accumulations of abnormal mitochondria were observed 16 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 207999 12618129 278658 20996 11179 SOD1 ALS ALS 24 1.8 and 25 and in spinal cord 4 and 24 from ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208000 12618129 278659 20996 11179 SOD1 ALS ALS 21 1.8 a mutant form of superoxide dismutase 1 associated with familial ALS 15 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208001 12618129 278660 20996 11179 SOD1 ALS ALS 20 1.8 on biochemical studies of cybrids obtained from mitochondria of sporadic ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208002 12618129 278662 20996 11179 SOD1 ALS ALS 9 1.8 To date however no distinct mtDNA alterations associated with ALS have been reported 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208003 12618129 278663 20996 11179 SOD1 ALS ALS 14 1.8 of mtDNA mutations and their role in the pathogenesis of ALS remains the subject of debate 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208004 12618129 278664 20996 11179 SOD1 ALS ALS 13 1.8 work we reexamine the hypothesis that mtDNA mutations accumulate in ALS and seek confirmation that cybrids generated from ALS patients_amp_#x2019 blood 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208005 12618129 278664 20996 11179 SOD1 ALS ALS 21 1.8 accumulate in ALS and seek confirmation that cybrids generated from ALS patients_amp_#x2019 blood exhibit impaired mitochondrial respiration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208006 12618129 278667 20996 11179 SOD1 ALS ALS 8 1.8 The patient cohort consisted of 23 subjects 13 ALS patients (mean mean age 59.7 _amp_#xb1 15.3 SD and 10 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208007 12618129 278669 20996 11179 SOD1 ALS ALS 16 1.8 and El Escorial electrophysiological 5 criteria for the diagnosis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208009 12618129 278694 20996 11179 SOD1 ALS ALS 3 1.8 For each assay ALS and control cybrids were compared using unpaired Student_amp_#x2019 s t 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208010 12618129 278696 20996 11179 SOD1 ALS ALS 0 1.8 ALS cybrids have normal mitochondrial respiration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208011 12618129 278701 20996 11179 SOD1 ALS ALS 3 1.8 Under basal conditions ALS and control cybrid mass cultures showed no differences in respiration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208012 12618129 278702 20996 11179 SOD1 ALS ALS 14 1.8 a statistically significant deficit in oxygen consumption under basal conditions ALS cybrids might still harbor deleterious mutations present at low levels 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208017 12618129 278709 20996 11179 SOD1 ALS ALS 9 1.8 Even with this degree of respiratory inhibition by KCN ALS and control cybrid mass cultures showed no differences in respiration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208018 12618129 278710 20996 11179 SOD1 ALS ALS 29 1.8 increased proportion of cybrid cells with reduced respiration within the ALS group hidden among cells with normal respiration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208019 12618129 278712 20996 11179 SOD1 ALS ALS 14 1.8 was no statistically significant difference in the average respiration of ALS cybrid clones ( n = 130 and control clones ( 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208020 12618129 278713 20996 11179 SOD1 ALS ALS 23 1.8 5 _amp_#x3bc M KCN induced a decrease in respiration in ALS cybrid clones 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208021 12618129 278716 20996 11179 SOD1 ALS ALS 9 1.8 Therefore we compared the number of low-respiring clones in ALS subjects to the number found in control subjects 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208022 12618129 278719 20996 11179 SOD1 ALS ALS 5 1.8 We found no difference between ALS and controls in the number of low-respiring clones with or 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208023 12618129 278720 20996 11179 SOD1 ALS ALS 28 1.8 of the occurrence of these clones was the same in ALS and control cybrids 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208024 12618129 278721 20996 11179 SOD1 ALS ALS 6 1.8 Finally to determine whether any individual ALS subject had defective mitochondrial respiration we compared the average of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208025 12618129 278721 20996 11179 SOD1 ALS ALS 21 1.8 respiration we compared the average of 10 clones from each ALS subject to the average of 100 control clones 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208026 12618129 278722 20996 11179 SOD1 ALS ALS 16 1.8 in cell respiration in any of the individual groups of ALS clones (data data not shown 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208027 12618129 278723 20996 11179 SOD1 ALS ALS 0 1.8 ALS cybrids have normal respiratory chain activities 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208029 12618129 278725 20996 11179 SOD1 ALS ALS 24 1.8 mitochondrial content the activities of mitochondrial respiratory chain enzymes in ALS cybrids were the same as those of controls in both 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208030 12618129 278726 20996 11179 SOD1 ALS ALS 7 1.8 In addition no differences were found between ALS and controls when activities were normalized by those of 143B 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208031 12618129 278727 20996 11179 SOD1 ALS ALS 30 1.8 1 SD of the average of 100 control clones between ALS and control clones (data data not shown 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208032 12618129 278728 20996 11179 SOD1 ALS ALS 7 1.8 Reactive oxygen species production is unchanged in ALS cybrids 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208033 12618129 278729 20996 11179 SOD1 ALS ALS 9 1.8 Intracellular reactive oxygen species (ROS) ROS production was measured in ALS and control cybrid mass cultures loaded with H 2 DCFDA 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208035 12618129 278729 18723 10261 ROS1 ROS ROS 4 0.0 Intracellular reactive oxygen species (ROS) ROS production was measured in ALS and control cybrid mass cultures 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 208036 12618129 278730 18723 10261 ROS1 ROS ROS 5 0.0 As expected the levels of ROS detected increased with time ( Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 208037 12618129 278731 20996 11179 SOD1 ALS ALS 6 1.8 However no statistically significant differences between ALS and control cybrids were evident in medium without inhibitors 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208038 12618129 278734 20996 11179 SOD1 ALS ALS 20 1.8 of KCN was very small and did not differ between ALS and control cybrids further confirming that ALS cybrids did not 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208039 12618129 278734 20996 11179 SOD1 ALS ALS 27 1.8 not differ between ALS and control cybrids further confirming that ALS cybrids did not harbor respiration defects predisposing to enhanced oxidative 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208040 12618129 278734 18723 10261 ROS1 ROS ROS 5 0.0 As expected the increase in ROS production in the presence of KCN was very small and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 208041 12618129 278736 20996 11179 SOD1 ALS ALS 35 1.8 disease 10 19 and 20 Alzheimer_amp_#x2019 s disease 9 and ALS 18 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208042 12618129 278738 20996 11179 SOD1 ALS ALS 20 1.8 _amp_#x3c1 0 cells repopulated with mtDNA from platelets of sporadic ALS patients had reduced electron transfer chain activities increased free radical 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208043 12618129 278739 20996 11179 SOD1 ALS ALS 17 1.8 putative mtDNA mutations responsible for the defective biochemical phenotypes in ALS cybrids as well as in cybrids from other diseases has 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208044 12618129 278740 20996 11179 SOD1 ALS ALS 19 1.8 mtDNA genomes in blood from an independent series of sporadic ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208045 12618129 278749 20996 11179 SOD1 ALS ALS 15 1.8 to detect any statistically significant decrease in respiratory function in ALS cybrids compared to controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208046 12618129 278751 20996 11179 SOD1 ALS ALS 10 1.8 the frequency of _amp_#x201c defective_amp_#x201d clones was the same in ALS and control cybrids 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208047 12618129 278752 20996 11179 SOD1 ALS ALS 8 1.8 These results suggested that the mtDNA derived from ALS platelets did not contain enough pathogenic mutations to prevent the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208048 12618129 278753 20996 11179 SOD1 ALS ALS 16 1.8 cause of the occurrence of low respiring clones in both ALS and control groups 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208049 12618129 278756 20996 11179 SOD1 ALS ALS 20 1.8 found approximately a 20% defect in complex I activity of ALS cybrids compared to controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208050 12618129 278757 20996 11179 SOD1 ALS ALS 2 1.8 Obviously the ALS patients who participated in our study were different 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208051 12618129 278758 20996 11179 SOD1 ALS ALS 5 1.8 However the size of the ALS groups in the two studies (11 11 and 13 in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208052 12618129 278763 20996 11179 SOD1 ALS ALS 15 1.8 functions are impaired in muscle and spinal cord from sporadic ALS patients 4 Vielhaber et al. 2000 25 and 24 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208053 12618129 278764 20996 11179 SOD1 ALS ALS 22 1.8 abundant although at very low levels in spinal cord from ALS patients 24 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208054 12618129 278768 20996 11179 SOD1 ALS ALS 29 1.8 affected tissues may play a role in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208055 12618129 278769 20996 11179 SOD1 ALS ALS 20 1.8 that pathogenic mtDNA mutations are more abundant in platelets from ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208056 12618129 278775 20996 11179 SOD1 ALS ALS 24 1.8 the hypothesis that there are pathogenically significant mtDNA mutations in ALS as well as other neurodegenerative diseases 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208057 12618129 278778 20996 11179 SOD1 ALS ALS 3 1.8 Isolated platelets from ALS patients and controls were fused to mtDNA-less osteosarcoma 143B _amp_#x3c1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208058 12618129 278781 20996 11179 SOD1 ALS ALS 4 1.8 (A) A Cybrid mass culture (ALS ALS n = 13 controls n = 10 and clone (ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208059 12618129 278781 20996 11179 SOD1 ALS ALS 14 1.8 n = 13 controls n = 10 and clone (ALS ALS n = 130 controls n = 100 respiration rates in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208060 12618129 278784 20996 11179 SOD1 ALS ALS 4 1.8 (C) C Cybrid mass culture (ALS ALS n = 13 controls n = 10 and clone (ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208061 12618129 278784 20996 11179 SOD1 ALS ALS 14 1.8 n = 13 controls n = 10 and clone (ALS ALS n = 130 controls n = 100 respiration rates with 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208062 12618129 278790 20996 11179 SOD1 ALS ALS 8 1.8 (A) A Respiratory chain activities in cybrid mass cultures (ALS ALS n = 13 controls n = 10 normalized by the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 208063 12618129 278791 20996 11179 SOD1 ALS ALS 7 1.8 (B) B Respiratory chain activities in cybrid clones (ALS ALS n = 130 controls n = 100 normalized by the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000636756930857386<>ScoreDetail__5468|IGFALS|0.000422082241807246__11179|SOD1|0.000636756930857386__ 0 0 0 0 0 209621 12654515 280252 20996 11179 SOD1 ALS ALS 17 1.7 SOD1 is associated with motor neuron degeneration in both human ALS and transgenic mice expressing mutant SOD1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209642 12654515 280264 20996 11179 SOD1 ALS ALS 3 1.7 Amyotrophic lateral sclerosis (ALS), ALS commonly known as Lou Gehrig_amp_#x2019 s disease is a progressive 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209643 12654515 280265 20996 11179 SOD1 ALS ALS 11 1.7 etiological and pathological factors causing motor neuron degeneration in the ALS have not been identified and there is no effective treatment 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209645 12654515 280266 20996 11179 SOD1 ALS ALS 18 1.7 dismutase (SOD1) SOD1 gene cause a portion of human familial ALS and that transgenic animal models expressing mutant SOD1 mimic human 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209647 12654515 280266 20996 11179 SOD1 ALS ALS 29 1.7 and that transgenic animal models expressing mutant SOD1 mimic human ALS have contributed significantly to our understanding of human ALS 5 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209648 12654515 280266 20996 11179 SOD1 ALS ALS 38 1.7 human ALS have contributed significantly to our understanding of human ALS 5 18 37 41 and 51 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209650 12654515 280267 20996 11179 SOD1 ALS ALS 17 1.7 one of the 90 currently known mutations that cause human ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209654 12654515 280270 20996 11179 SOD1 ALS ALS 19 1.7 VEGF promoter region develop a motor neuron-like disease mimicking human ALS 40 suggesting that hypoxia-mediated VEGF expression may be associated with 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209659 12654515 280271 5009 2433 CSF1R FMS fms-like 18 0.0 a dimeric glycoprotein that binds to endothelial cell specific receptors fms-like tyrosine kinase (Flt-1) Flt-1 and fetal liver kinase (Flk-1) Flk-1 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209671 12654515 280278 20996 11179 SOD1 ALS ALS 9 1.7 The G93A-SOD1 mutation that occurs frequently in the human ALS population and causes severe disease onset and progression was used 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209689 12654515 280292 7361 20442 FBRS FBS FBS 47 0.0 (DMEM) DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS), FBS 100 units/ml units ml penicillin and 100 _amp_#x3bc;g/ml _amp_#x3bc g 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 209695 12654515 280300 1759 1102 BRD1 BRL BRL 21 0.3 vector containing target gene in 0.4 ml Opti-MEM (Gibco Gibco BRL at room temperature for 10 min then cells were electroporated 1 JUMiner_v2.2 1 2 gibco brl 0 0 0 0 0 0 0 0 209698 12654515 280326 3778 10620 CCL21 ECL ECL 9 0.0 The immunoreactive protein was then detected by enhanced chemiluminescence (ECL) ECL 2.9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209704 12654515 280332 16561 8947 PI3 PI3 PI3-kinase 0 0.3 PI3-kinase activity assay 11 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 209711 12654515 280344 23910 12680 VEGFA VEGF VEGF-treated 5 3.8 Briefly lysates from vehicle- and VEGF-treated cells were separated by SDS_amp_#x2013 PAGE transferred probed with anti-phospho-Akt 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 209712 12654515 280344 3778 10620 CCL21 ECL ECL 19 0.0 SDS_amp_#x2013 PAGE transferred probed with anti-phospho-Akt antibody and detected with ECL 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209780 12654515 280378 20996 11179 SOD1 ALS ALS 81 1.7 of motor neuron degeneration that markedly resembles that of human ALS in a mouse model 40 and (iv) iv mutations of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209793 12654515 280386 20996 11179 SOD1 ALS ALS 20 1.7 effects in the prevention of motor neuron degeneration in human ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209800 12654515 280388 12297 6840 MAP2K1 MEK1 MEK1-treated 32 2.2 proliferation of motor neuron-like cells because PD98059 and dominant negative MEK1-treated cells reduced cell proliferation (data data not shown 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 209843 12654515 280409 20996 11179 SOD1 ALS ALS 20 1.7 interventional strategies aiming to alleviate motor neuron degeneration in human ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00211663176525962<>ScoreDetail__5468|IGFALS|0.000441164674741317__11179|SOD1|0.00211663176525962__ 0 0 0 0 0 209846 12654515 280413 3778 10620 CCL21 ECL ECL 26 0.0 a nitrocellulose membrane immunoreacted with anti-SOD1 antibody and detected by ECL 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 209848 12654515 280415 18723 10261 ROS1 ROS ROS 3 0.3 DCF assay of ROS production in NSC34 cells infected with vector control WT-SOD1 or 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 211262 12663085 281718 1607 1014 BCR CML CML 7 0.9 characterized major AGE are N -(carboxymethyl)lysine - carboxymethyl lysine (CML) CML 18 pentosidine 16 pyrraline 57 and imidazolon 63 ( Fig 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211263 12663085 281724 20996 11179 SOD1 ALS ALS 36 1.4 AD Parkinson_amp_#x2019 s disease 10 and amyotrophic lateral sclerosis (ALS) ALS 15 and 88 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211264 12663085 281727 20996 11179 SOD1 ALS ALS 21 1.4 product an early compound in the glycation reaction in the ALS spinal cord 39 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211265 12663085 281728 20996 11179 SOD1 ALS ALS 11 1.4 number of other reports indicate an association of glycation with ALS 15 and 88 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211266 12663085 281738 20996 11179 SOD1 ALS ALS 8 1.4 Finally we review the evidence of glycation in ALS spinal cords and then discuss its neurotoxicity on cultured spinal 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211267 12663085 281765 1607 1014 BCR CML CML 5 0.9 Structure-identified AGE include N -(carboxymethyl)lysine - carboxymethyl lysine (CML) CML 18 pentosidine 16 and 23 pyrraline 57 imidazolon 63 crosslin 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211268 12663085 281766 1607 1014 BCR CML CML 0 0.9 CML is formed from fructose lysine (one one of the Amadori 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211269 12663085 281767 1607 1014 BCR CML CML 7 0.9 In addition to glucose other sources of CML include unsaturated fatty acids such as oleic acid and linoleic 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211270 12663085 281768 1607 1014 BCR CML CML 3 0.9 The idea that CML is a marker of oxidation rather than of glycation is 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211272 12663085 281777 1607 1014 BCR CML CML 0 0.9 CML and pyrraline in contrast do not provide cross-linkage 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211273 12663085 281788 20996 11179 SOD1 ALS ALS 5 1.4 A common pathological finding in ALS is the presence of an abnormal accumulation of neurofilaments (hyaline 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211284 12663085 281801 20996 11179 SOD1 ALS ALS 22 1.4 1993 it has been considered a possible cause of familial ALS (FALS) FALS 76 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211286 12663085 281802 20996 11179 SOD1 ALS ALS 12 1.4 the possibility that SOD-1 even plays a role in sporadic ALS 7 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211308 12663085 281845 18723 10261 ROS1 ROS ROS 13 0.0 A_amp_#x3b2 can form aggregates and produce reactive oxygen species (ROS) ROS even if it is not modified by AGE 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211309 12663085 281853 1607 1014 BCR CML CML 0 0.9 CML is reported to increase with aging in the pyramidal neurons 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211310 12663085 281857 1607 1014 BCR CML CML 6 0.9 In AD brains the presence of CML was confirmed both inside and outside the cytoplasm of neurons 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211311 12663085 281858 1607 1014 BCR CML CML 1 0.9 However CML is also present in the cytoplasm of neurons of healthy 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211312 12663085 281859 1607 1014 BCR CML CML 3 0.9 In addition the CML outside the cytoplasm of neurons was not related to senile 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211313 12663085 281860 1607 1014 BCR CML CML 3 0.9 AGE (pentosidine pentosidine and CML are co-localized with lipofuscin outside the cytoplasm of neurons 26 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211314 12663085 281862 1607 1014 BCR CML CML 6 0.9 The presence of extraneuroperikaryal pentosidine and CML was finally confirmed in astrocytes and microglias and this was 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211315 12663085 281863 1607 1014 BCR CML CML 0 0.9 CML and pentosidine have recently become to be considered as markers 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211316 12663085 281864 3355 1374 CA3 CA3 CA3 20 0.0 identified in the perikaryon of hippocampal neurons (especially especially forms CA3 and CA4 in all subjects (AD AD and diabetes mellitus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211317 12663085 281864 3356 1375 CA4 CA4 CA4 20 0.0 identified in the perikaryon of hippocampal neurons (especially especially forms CA3 and CA4 in all subjects (AD AD and diabetes mellitus 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211318 12663085 281864 3356 1375 CA4 CA4 CA4 22 0.0 the perikaryon of hippocampal neurons (especially especially forms CA3 and CA4 in all subjects (AD AD and diabetes mellitus (DM) DM 15 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211320 12663085 281880 1607 1014 BCR CML CML 7 0.9 This antibody does not recognize pyrraline pentosidine CML FFP 2-furoyl-4 5 - 2-furanyl -1-H -imidazole or AFGP (1-alkyl-2-formyl-3,4-diglycosyl-pyrroles) 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211321 12663085 281884 1607 1014 BCR CML CML 15 0.9 Castellani et al 11 concerned in situ techniques to assess CML the predominant advanced glycation end-product that accumulates in vivo along 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211322 12663085 281885 1607 1014 BCR CML CML 4 0.9 The levels of both CML and hexitol-lysine increased in the neurons especially in those cases 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211323 12663085 281886 1607 1014 BCR CML CML 10 0.9 findings of concurrent increases in both the end-stage modification (CML) CML and the initial Amadori products of sugar adduction provide evidence 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211324 12663085 281887 1607 1014 BCR CML CML 3 0.9 In addition because CML can result from either lipid peroxidation or advanced glycation whereas 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211325 12663085 281887 6554 3309 ELA2 HNE HNE 31 0.3 study together with studies demonstrating the presence of 4-hydroxy-2-nonenal (HNE) HNE adducts and pentosidine provides evidence of two distinct processes acting 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 211327 12663085 281889 1607 1014 BCR CML CML 22 0.9 senile plaques showed no staining or only faint immunoreactivity for CML 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211328 12663085 281890 1607 1014 BCR CML CML 16 0.9 both AD cases and in the controls with antibodies to CML and hexigtol-lysine 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211329 12663085 281892 1607 1014 BCR CML CML 18 0.9 control subject also showed strong labeling with the antibodies to CML and hexitol-lysine supporting the hypothesis that glycation is an early 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211330 12663085 281895 1607 1014 BCR CML CML 11 0.9 other studies the distribution of neuronal and glial deposits of CML did not correspond with the distribution of AD pathology causing 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211331 12663085 281895 1607 1014 BCR CML CML 27 0.9 distribution of AD pathology causing those authors to conclude that CML does not directly cause the formation of neurofibrillary tangles or 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211332 12663085 281900 11629 6493 LAMC2 CSF CSF 0 1.6 CSF studies 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211333 12663085 281901 11629 6493 LAMC2 CSF CSF 19 1.6 early glycation product an Amadori product in cerebrospinal fluid (CSF) CSF in aging and late-onset AD 93 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211334 12663085 281902 11629 6493 LAMC2 CSF CSF 7 1.6 The concentration of the Amadori product in CSF correlated with the CSF glucose concentration but did not change 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211335 12663085 281902 11629 6493 LAMC2 CSF CSF 11 1.6 concentration of the Amadori product in CSF correlated with the CSF glucose concentration but did not change with age ( n 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211336 12663085 281903 11629 6493 LAMC2 CSF CSF 5 1.6 In contrast the level of CSF Amadori product was 1.7 times greater in AD patients ( 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211337 12663085 281904 11629 6493 LAMC2 CSF CSF 14 1.6 Amadori products was found in all major proteins of the CSF of AD patients including albumin apoE and transthyretin 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211339 12663085 281905 11629 6493 LAMC2 CSF CSF 19 1.6 times greater in AD patients than in controls (total total CSF glycation of the samples was 8.9 and 3.1 arbitrary units/_amp_#x3bc;g 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211340 12663085 281906 11629 6493 LAMC2 CSF CSF 4 1.6 This demonstrated that increased CSF glycation in AD is not due to a specific protein 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211341 12663085 281906 11629 6493 LAMC2 CSF CSF 19 1.6 not due to a specific protein modification because all major CSF proteins of different origin are involved in the process (albumin 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211343 12663085 281908 11629 6493 LAMC2 CSF CSF 1 1.6 The CSF is likely to be at least one of the sites 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211344 12663085 281908 11629 6493 LAMC2 CSF CSF 24 1.6 glycation based on the hypothesis of the involvement of impaired CSF circulation in AD 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211346 12663085 281910 11629 6493 LAMC2 CSF CSF 10 1.6 Shuvaev et al proposed that the increased early glycation of CSF proteins in AD patients might stimulate the formation and subsequent 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211347 12663085 281919 1607 1014 BCR CML CML 14 0.9 such as _amp_#x2018 glycoxidation_amp_#x2019 and _amp_#x2018 glycoxidation products_amp_#x2019 (pentosidine, pentosidine CML etc. is also used 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211348 12663085 281939 1607 1014 BCR CML CML 59 0.9 of AGE 16 and 62 3-DG-derived AGE are imidazolone pyrraline CML and pentosidine of which imidazolone is the most specific AGE 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211349 12663085 281948 1607 1014 BCR CML CML 11 0.9 cultured dorsal root ganglion (DRG) DRG cells the generation of CML was detected after exposure to 3-DG and glyoxal 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211351 12663085 281954 18723 10261 ROS1 ROS ROS 5 0.0 This suggests that not only ROS but also reactive nitrogen species contribute to AGE-mediated cytotoxicity ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211355 12663085 281967 18723 10261 ROS1 ROS ROS 21 0.0 the co-substrate required to eliminate hydroperoxides resulting in protection from ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211359 12663085 281972 1607 1014 BCR CML CML 12 0.9 al reported that 3-DG and glyoxal accelerated the formation of CML in explant-cultured neurons in explant of dorsal root ganglia 62 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211360 12663085 281973 1607 1014 BCR CML CML 15 0.9 fully explain the involvement of glycation in their system since CML is produced by lipid peroxidation under conditions of oxidative stress 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211361 12663085 281973 1607 1014 BCR CML CML 33 0.9 of oxidative stress and the direct pathway from 3-DG to CML is a minor pathway 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211362 12663085 281974 1607 1014 BCR CML CML 8 0.9 Even though glyoxal is a known precursor of CML glyoxal itself is also formed during lipid peroxidation 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211363 12663085 281978 1607 1014 BCR CML CML 4 0.9 Does this mean that CML is not sufficiently toxic to cause neuronal death 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211365 12663085 281995 17575 9583 PTBP1 PTB PTB 3 0.3 N -Phenacylthiazolium bromide (PTB) PTB and ALT711 are known as AGE cross-link breakers 111 1 JUMiner_v2.2 1 2 phenacylthiazolium bromide 0 2 9583 TotalCon:2<>9583|PTBP1|5725|Complete__17662|PTBP2|58155|Complete__<>AvaiableGeneRif=2<>BEST:9583|PTBP1|0.000413367179834246<>ScoreDetail__9583|PTBP1|0.000413367179834246__17662|PTBP2|0.000234977031384217__ 0 0 0 0 0 211367 12663085 282006 20996 11179 SOD1 ALS ALS 5 1.4 Glycation in amyotrophic lateral sclerosis (ALS) ALS 12.1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211368 12663085 282007 20996 11179 SOD1 ALS ALS 1 1.4 Familial ALS 12.1.1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211369 12663085 282008 20996 11179 SOD1 ALS ALS 1 1.4 Familial ALS and SOD-1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211371 12663085 282009 20996 11179 SOD1 ALS ALS 3 1.4 Amyotrophic lateral sclerosis (ALS) ALS is a progressive fatal neurodegenerative disorder that involves the motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211372 12663085 282010 20996 11179 SOD1 ALS ALS 3 1.4 Approximately 10% of ALS cases (familial familial ALS or FALS are inherited the other 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211373 12663085 282010 20996 11179 SOD1 ALS ALS 6 1.4 Approximately 10% of ALS cases (familial familial ALS or FALS are inherited the other 90% are sporadic 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211377 12663085 282012 20996 11179 SOD1 ALS ALS-like 23 1.4 different SOD-1 mutants in both mice and rats causes an ALS-like syndrome independently of whether SOD-1 catalytic activity is changed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211386 12663085 282021 20996 11179 SOD1 ALS ALS 6 1.4 Similar findings were observed in other ALS families with different mutations and a two base-pair deletion 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211388 12663085 282024 1607 1014 BCR CML CML 8 0.9 Shibata et al investigated the immunohistochemical localization of CML one of the major AGE structures in spinal cords from 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211390 12663085 282025 1607 1014 BCR CML CML 18 0.9 NHIs were intensely stained by a monoclonal antibody specific for CML 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211391 12663085 282026 1607 1014 BCR CML CML 5 0.9 Immunoelectron microscopy revealed that the CML determinants were restricted to the granule-associated thick linear structures that 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211392 12663085 282027 1607 1014 BCR CML CML 5 0.9 No focal collection of either CML or SOD-1 was found in neurons of the controls 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211395 12663085 282028 1607 1014 BCR CML CML 23 0.9 to the Maillard reaction the finding of the coexistence of CML and SOD-1 in NHIs points to the possibility that CML-modified 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211397 12663085 282028 1607 1014 BCR CML CML-modified 33 0.3 CML and SOD-1 in NHIs points to the possibility that CML-modified SOD-1 is deposited in NHIs 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211399 12663085 282029 1607 1014 BCR CML CML 5 0.9 However the target protein of CML modification in NHIs remains unclear because NHIs seen in patients 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211400 12663085 282029 20996 11179 SOD1 ALS ALS 18 1.4 NHIs remains unclear because NHIs seen in patients with familial ALS have been shown to contain not only SOD-1 but also 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211406 12663085 282034 1607 1014 BCR CML CML 9 0.9 AHIs were also immunoreactive for insoluble AGE such as CML pyrraline and pentosidine and similar to NHIs were ultrastructurally composed 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211407 12663085 282034 1607 1014 BCR CML CML 27 0.9 were ultrastructurally composed of granule-coated fibrils that exhibited immunoreactivity to CML and pyrraline 12.2 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211408 12663085 282035 20996 11179 SOD1 ALS ALS 1 1.4 Sporadic ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211409 12663085 282036 20996 11179 SOD1 ALS ALS 4 1.4 In cases of sporadic ALS as well as FALS Chou et al 15 demonstrated the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211410 12663085 282040 20996 11179 SOD1 ALS ALS 14 1.4 Chou et al. no staining was detected in NHIs in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211411 12663085 282041 1607 1014 BCR CML CML 44 0.9 antibodies used those of Chou et al do not recognize CML and the AGE detected by Shibata et al consisted of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211412 12663085 282041 1607 1014 BCR CML CML 55 0.9 and the AGE detected by Shibata et al consisted of CML 12.3 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211413 12663085 282042 20996 11179 SOD1 ALS ALS 3 1.4 Familial vs sporadic ALS/non-oxidative ALS non-oxidative vs oxidative glycation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211414 12663085 282043 1607 1014 BCR CML CML 0 0.9 CML is thought to be a major epitope for many of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211415 12663085 282044 1607 1014 BCR CML CML 10 0.9 However recent findings have indicated that a major source of CML may be derived from pathways other than glycation 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211416 12663085 282045 1607 1014 BCR CML CML 10 0.9 Fu et al clearly demonstrated that the major source of CML was lipid peroxidation not glycation 18 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211417 12663085 282046 1607 1014 BCR CML CML 0 0.9 CML does not contain the reactive groups involved in cross-linking and 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211418 12663085 282047 1607 1014 BCR CML CML 1 0.9 Thus CML is considered to be a marker of oxidation rather than 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211419 12663085 282048 1607 1014 BCR CML CML 4 0.9 Accordingly the existence of CML is not decisive evidence of the involvement of glycation in 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211420 12663085 282048 20996 11179 SOD1 ALS ALS 18 1.4 evidence of the involvement of glycation in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211421 12663085 282051 20996 11179 SOD1 ALS ALS 7 1.4 To clarify the involvement of glycation in ALS and the interplay between glycation and oxidative stress several studies 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211422 12663085 282052 1607 1014 BCR CML CML 8 0.9 Shibata et al analyzed the immunohistochemical localization of CML as a lipid peroxidation or protein glycoxidation product pentosidine as 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211424 12663085 282054 20996 11179 SOD1 ALS ALS 18 1.4 FALS patients with the SOD-1 mutation (A4V) A4V in sporadic ALS patients and in age-matched control individuals 86 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211425 12663085 282055 1607 1014 BCR CML CML 9 0.9 In the FALS cases intense immunoreactivities for pyrraline and CML were confined to the characteristic NHIs and imidazolone immunoreactivity was 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211426 12663085 282057 20996 11179 SOD1 ALS ALS 3 1.4 In the sporadic ALS cases intense immunoreactivities for pentosidine CML and the HNE_amp_#x2013 protein 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211427 12663085 282057 1607 1014 BCR CML CML 9 0.9 In the sporadic ALS cases intense immunoreactivities for pentosidine CML and the HNE_amp_#x2013 protein adduct were found in the cytoplasm 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211428 12663085 282058 6554 3309 ELA2 HNE HNE 15 0.3 markers of oxidation and/or and or glycoxidation (adducts adducts of HNE crotoaldehyde CML and pentosidine were localized in the gray matter 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 211429 12663085 282058 1607 1014 BCR CML CML 17 0.9 oxidation and/or and or glycoxidation (adducts adducts of HNE crotoaldehyde CML and pentosidine were localized in the gray matter neuropil of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211430 12663085 282059 1607 1014 BCR CML CML 10 0.9 In addition Kato et al found that AHIs immunoreactive for CML pyrraline and pentosidine were negative for stress-response proteins (SRPs), SRPs 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211431 12663085 282059 6554 3309 ELA2 HNE HNE 20 0.3 pyrraline and pentosidine were negative for stress-response proteins (SRPs), SRPs HNE acrolein NOSs and nitrotyrosine as representative markers of oxidative stress 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 211433 12663085 282059 23630 18414 UCN2 SRP SRPs 19 0.2 CML pyrraline and pentosidine were negative for stress-response proteins (SRPs), SRPs HNE acrolein NOSs and nitrotyrosine as representative markers of oxidative 5 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211434 12663085 282060 20996 11179 SOD1 ALS ALS 14 1.4 oxidative reactions are involved in the disease processes of sporadic ALS while there is no evidence for increased oxidative damage except 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211435 12663085 282060 1607 1014 BCR CML CML 26 0.9 there is no evidence for increased oxidative damage except for CML deposition in the FALS spinal cord 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211437 12663085 282064 20996 11179 SOD1 ALS ALS 15 1.4 we first confirmed the initial stage of glycation in sporadic ALS spinal cords 12.4 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211438 12663085 282065 20996 11179 SOD1 ALS ALS 6 1.4 An Amadori product 1-hexitol-lysine in sporadic ALS spinal cord 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211439 12663085 282066 20996 11179 SOD1 ALS ALS 16 1.4 Amadori product the initial reaction product of glycation in the ALS spinal cord by the presence of an anti-1-hexitol-lysine (1-HL) 1-HL 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211440 12663085 282067 20996 11179 SOD1 ALS ALS 20 1.4 Amadori compound was detected in axonal spheroids of the sporadic ALS spinal cord 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211441 12663085 282068 20996 11179 SOD1 ALS ALS 24 1.4 not merely correlate with physiological aging but is specific to ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211442 12663085 282072 20996 11179 SOD1 ALS ALS 25 1.4 motoneurons our cases of BSMA as well as of sporadic ALS showed no impairment of glucose tolerance 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211443 12663085 282073 20996 11179 SOD1 ALS ALS 12 1.4 showed the presence of an Amadori product 1-hexitol-lysine in the ALS and BSMA spinal cord 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211444 12663085 282075 20996 11179 SOD1 ALS ALS 15 1.4 as a modulator of the death pathway of motoneurons in ALS and BSMA because glycation of essential components such as antioxidative 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211445 12663085 282076 20996 11179 SOD1 ALS ALS 5 1.4 Late-stage glycation reaction in sporadic ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211446 12663085 282077 20996 11179 SOD1 ALS ALS 23 1.4 the production of AGE following the early reaction in sporadic ALS spinal cords the presence of CML and non-CML AGE was 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211447 12663085 282077 1607 1014 BCR CML CML 29 0.9 early reaction in sporadic ALS spinal cords the presence of CML and non-CML AGE was examined 41 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211448 12663085 282078 1607 1014 BCR CML CML 13 0.9 research we elicited antibodies that clearly distinguished non-CML AGE from CML 108 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211449 12663085 282079 1607 1014 BCR CML CML 6 0.9 Anti-non-CML antibody does not react with CML pyrraline pentosidine or Amadori compounds but possibly recognizes all other 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211450 12663085 282080 1607 1014 BCR CML CML 0 0.9 CML is thought to be a major epitope for many of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211451 12663085 282081 1607 1014 BCR CML CML 10 0.9 However recent findings have indicated that a major source of CML may be derived from pathways other than glycation 18 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211452 12663085 282086 20996 11179 SOD1 ALS ALS 12 1.4 anti-non-CML AGE antibodies faintly stained vascular endothelial cells from both ALS and age-matched control subjects 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211453 12663085 282088 20996 11179 SOD1 ALS ALS 12 1.4 of non-CML AGE was evident in the anterior horn of ALS spinal cords demonstrating the existence of the late stage of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211454 12663085 282088 20996 11179 SOD1 ALS ALS 27 1.4 existence of the late stage of the glycation reaction in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211455 12663085 282089 1607 1014 BCR CML CML 3 0.9 The existence of CML was also confirmed suggesting that augmented oxidative stress was also 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211456 12663085 282090 20996 11179 SOD1 ALS ALS 3 1.4 AGE receptors in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211459 12663085 282092 20996 11179 SOD1 ALS ALS 17 1.4 these receptors in conglomerates of cortical motor neurons in eight ALS brains (five five sporadic ALS and three FALS and three 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211460 12663085 282092 20996 11179 SOD1 ALS ALS 21 1.4 cortical motor neurons in eight ALS brains (five five sporadic ALS and three FALS and three control brains with antibodies against 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211466 12663085 282094 20996 11179 SOD1 ALS ALS 6 1.4 AGE in an animal model of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211467 12663085 282100 20996 11179 SOD1 ALS ALS 22 1.4 activity in the brain region (precentral precentral gyrus affected in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211469 12663085 282101 20996 11179 SOD1 ALS ALS 19 1.4 specific defects of the GSH system are more important in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211471 12663085 282109 20996 11179 SOD1 ALS ALS 8 1.4 Since AGE accumulate in the spinal cords of ALS patients 14 and 84 further studies are needed to address 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211472 12663085 282117 20996 11179 SOD1 ALS ALS 4 1.4 After reviewing glycation in ALS spinal cords its neurotoxicity to cultured spinal motor neurons was 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000730585365101325<>ScoreDetail__5468|IGFALS|0.000325134524409474__11179|SOD1|0.000730585365101325__ 0 0 0 0 0 211473 12663085 282126 18723 10261 ROS1 ROS ROS 3 0.0 Reactive oxygen species (ROS) ROS are produced via a glycation reaction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 211474 12663085 282133 1607 1014 BCR CML CML 5 0.9 Chemical structures of various AGE CML N -(carboxymethyl)lysine; - carboxymethyl lysine CEL N -(carboxyethyl)lysine; - carboxyethyl 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 211475 12663085 282136 18723 10261 ROS1 ROS ROS 0 0.0 ROS reactive oxygen species NO nitric oxide RNOS reactive NO species 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212169 12684448 283316 20996 11179 SOD1 ALS ALS 9 2.2 Observations of elevated CSF glutamate in amyotrophic lateral sclerosis (ALS), ALS together with findings that motor neurons are selectively vulnerable to 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212170 12684448 283316 11629 6493 LAMC2 CSF CSF 3 0.0 Observations of elevated CSF glutamate in amyotrophic lateral sclerosis (ALS), ALS together with findings 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212171 12684448 283318 18723 10261 ROS1 ROS ROS 11 0.0 find that glutamate induces far greater reactive oxygen species (ROS) ROS generation in cultured motor neurons than in other spinal neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212172 12684448 283319 18723 10261 ROS1 ROS ROS 6 0.0 In addition we found that the ROS seem to be able to leave the motor neurons and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212173 12684448 283320 20996 11179 SOD1 ALS ALS 7 2.2 Correspondingly in a transgenic mouse model of ALS protein oxidation was increased in regions immediately surrounding motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212174 12684448 283322 20996 11179 SOD1 ALS ALS 23 2.2 motor neurons and glia which may prove useful in understanding ALS pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212176 12684448 283323 18723 10261 ROS1 ROS ROS 7 0.0 Key words motor neuron amyotrophic lateral sclerosis ROS glutamate excitotoxicity glutamate transport cell culture free radicals SOD nitrotyrosine 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212177 12684448 283324 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is a devastating neurodegenerative disease characterized by the selective loss 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212179 12684448 283328 20996 11179 SOD1 ALS ALS 53 2.2 glutamate transport in spinal cord and motor cortex of sporadic ALS patients (Rothstein Rothstein et al. 1992 1996 Shaw et al. 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212180 12684448 283328 11629 6493 LAMC2 CSF CSF 20 0.0 in acute conditions of ischemia or epilepsy observations of elevated CSF glutamate levels (Rothstein Rothstein et al. 1990 Shaw et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212181 12684448 283332 18723 10261 ROS1 ROS ROS 39 0.0 intracellular Ca increases and consequent mitochondrial reactive oxygen species (ROS) ROS generation (Carriedo Carriedo et al. 1998 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212182 12684448 283333 20996 11179 SOD1 ALS ALS 41 2.2 may limit mitochondrial Ca uptake seem to be spared in ALS (Alexianu Alexianu et al. 1994 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212183 12684448 283336 20996 11179 SOD1 ALS ALS 10 2.2 Although this astrocytic dysfunction can explain excitotoxic MN injury in ALS and thus might be considered to be the primary defect 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212184 12684448 283337 18723 10261 ROS1 ROS ROS 10 0.0 The present study aims to explore the connection between MN ROS generation and astroglial transport 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212185 12684448 283338 18723 10261 ROS1 ROS ROS 44 0.0 that exposure to AMPA or kainate induced strong and selective ROS generation in cultured MNs (Carriedo Carriedo et al. 2000 the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212186 12684448 283339 18723 10261 ROS1 ROS ROS 9 0.0 The first is to determine whether MNs produce more ROS than other spinal neurons during activation with the endogenous excitatory 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212187 12684448 283340 18723 10261 ROS1 ROS ROS 10 0.0 In addition we sought to examine the hypothesis that such ROS generated within MNs in response to excitotoxic activation can pass 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212194 12684448 283360 21063 14524 SPAG9 HSS HSS 30 0.3 in a static bath consisting of HEPES-buffered salt solution (HSS) HSS (in in m M 120 NaCl 5.4 KCl 1.8 CaCl 1 JUMiner_v2.2 1 2 UserEdit 0 2 4236 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:4236|GFER|0.000310135303327289<>ScoreDetail__4236|GFER|0.000310135303327289__14524|SPAG9|0.000243143357323478__10818|SGSH|0.000185467491167676__15894|PANK2|0.0002572409200608__ 1 1 0 0 0 212195 12684448 283360 20247 20116 SLC25A29 CACL CaCl 40 1.0 HSS (in in m M 120 NaCl 5.4 KCl 1.8 CaCl 2 0.8 MgCl 2 20 HEPES 15 glucose and 10 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 212196 12684448 283361 19254 10472 RUNX2 CCD CCD 30 0.0 and fluorescence signals were collected using a 12-bit cooled digital CCD camera (Orca-100; Orca-100 Hamamatsu Bridgewater NJ and analyzed after background 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212197 12684448 283362 17497 9543 PSMB6 Delta Delta 15 1.0 of the oxidation-sensitive dyes HEt (Bindokas Bindokas et al. 1996 Delta F was monitored only in mitochondria-rich perinuclear regions of the 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212198 12684448 283362 18723 10261 ROS1 ROS ROS 0 0.0 ROS generation was monitored by use of the oxidation-sensitive dyes HEt 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212199 12684448 283363 17497 9543 PSMB6 Delta Delta 3 1.0 In HEt experiments Delta F was measured in the soma and nucleus of neurons 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212200 12684448 283363 17497 9543 PSMB6 Delta Delta 16 1.0 measured in the soma and nucleus of neurons whereas astrocytic Delta F was measured only over nuclei because nuclear HEt signals 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212202 12684448 283365 21063 14524 SPAG9 HSS HSS 47 0.3 incubation in H glutamate (2 2 microCi/ml) microCi ml in HSS for 5 min 1 JUMiner_v2.2 1 2 UserEdit 0 2 4236 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:4236|GFER|0.000310135303327289<>ScoreDetail__4236|GFER|0.000310135303327289__14524|SPAG9|0.000243143357323478__10818|SGSH|0.000185467491167676__15894|PANK2|0.0002572409200608__ 1 1 0 0 0 212203 12684448 283366 21063 14524 SPAG9 HSS HSS 16 0.3 was terminated by washes (three three times in Na -free HSS with excess unlabeled glutamate 1 JUMiner_v2.2 1 2 UserEdit 0 2 4236 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:4236|GFER|0.000310135303327289<>ScoreDetail__4236|GFER|0.000310135303327289__14524|SPAG9|0.000243143357323478__10818|SGSH|0.000185467491167676__15894|PANK2|0.0002572409200608__ 1 1 0 0 0 212204 12684448 283371 18723 10261 ROS1 ROS ROS 2 0.0 Glutamate triggered ROS generation in cultured motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212205 12684448 283372 18723 10261 ROS1 ROS ROS 1 0.0 MN ROS generation was examined in a dissociated cell culture model 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212206 12684448 283379 20996 11179 SOD1 ALS ALS 13 2.2 builds on and integrates clues to possible mechanisms involved in ALS pathogenesis suggested by a number of previous studies 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212207 12684448 283380 18723 10261 ROS1 ROS ROS 15 0.0 excitotoxic exposures (generally generally mediated through NMDA receptors can induce ROS generation in central neurons (Lafon-Cazal Lafon-Cazal et al. 1993 Dugan 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212208 12684448 283380 18723 10261 ROS1 ROS ROS 51 0.0 to indicate that the nonselective endogenous excitatory transmitter glutamate induces ROS quite selectively with strong generation in MNs and minimal ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212209 12684448 283380 18723 10261 ROS1 ROS ROS 61 0.0 ROS quite selectively with strong generation in MNs and minimal ROS production in other spinal neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212210 12684448 283381 18723 10261 ROS1 ROS ROS 16 0.0 that glutamate transporters are sensitive to inhibition by exogenously applied ROS (Trotti Trotti et al. 1998 this is the first to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212211 12684448 283381 18723 10261 ROS1 ROS ROS 29 0.0 et al. 1998 this is the first to demonstrate that ROS generated within MNs (or or within any neuron in fact 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212212 12684448 283382 20996 11179 SOD1 ALS ALS 16 2.2 oxidative changes in MNs and in spinal cord astrocytes in ALS (Abe Abe et al. 1995 Beal et al. 1997 Ferrante 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212214 12684448 283383 20996 11179 SOD1 ALS ALS 22 2.2 pattern immediately surrounding MNs in the SOD mouse model of ALS is novel and lends support to the hypothesis that the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212215 12684448 283383 18723 10261 ROS1 ROS ROS 36 0.0 lends support to the hypothesis that the oxidation results from ROS emanating directly out of MNs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212216 12684448 283384 18723 10261 ROS1 ROS ROS 18 0.0 the feasibility of a previously untested mechanism in which MN ROS contributes directly to transporter dysfunction in surrounding astrocytes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212217 12684448 283388 18723 10261 ROS1 ROS ROS 18 0.0 in intact spinal cord it is not possible to isolate ROS emanation to individual neurons or to assess its effects on 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212218 12684448 283391 18723 10261 ROS1 ROS ROS 4 0.0 Thus the relatively selective ROS generation we observe in cultured MNs in response to glutamate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212219 12684448 283391 18723 10261 ROS1 ROS ROS 22 0.0 response to glutamate receptor activation and the ability of this ROS to escape the cell and affect the surrounding microenvironment is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212220 12684448 283392 18723 10261 ROS1 ROS ROS 11 0.0 we reported previously that AMPA or kainate exposures cause selective ROS generation in MNs it is striking that such a high 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212221 12684448 283393 18723 10261 ROS1 ROS ROS 27 0.0 might be expected to induce a more uniform pattern of ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212222 12684448 283394 18723 10261 ROS1 ROS ROS 12 0.0 the case of AMPA or kainate exposures this highly selective ROS generation is probably best explained by rapid Ca entry through 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212223 12684448 283395 18723 10261 ROS1 ROS ROS 10 0.0 In addition as with AMPA or kainate exposures the glutamate-triggered ROS generation appears to require Ca influx and is inhibited by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212224 12684448 283396 18723 10261 ROS1 ROS ROS-sensitive 4 0.0 Subsequent experiments using the ROS-sensitive dye HEt revealed that excitotoxic exposures causing strong ROS generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212225 12684448 283396 18723 10261 ROS1 ROS ROS 13 0.0 the ROS-sensitive dye HEt revealed that excitotoxic exposures causing strong ROS generation within MNs also induce increases in fluorescence of astrocyte 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212226 12684448 283397 18723 10261 ROS1 ROS ROS 23 0.0 (Aeschbacher Aeschbacher et al. 1986 this observation suggests that the ROS passes across two plasma membranes both exiting the MN and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212228 12684448 283398 18723 10261 ROS1 ROS ROS 20 0.0 (SOD) SOD provides strong support for the idea that the ROS passes through the extracellular space in which it can be 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212229 12684448 283399 18723 10261 ROS1 ROS ROS 6 0.0 Additional experiments examined the ability of ROS generated in MNs to affect the function of nearby glutamate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212230 12684448 283401 18723 10261 ROS1 ROS ROS 6 0.0 Indeed beyond being selective producers of ROS the present observations suggest that MNs if stimulated strongly can 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212231 12684448 283401 18723 10261 ROS1 ROS ROS 18 0.0 present observations suggest that MNs if stimulated strongly can produce ROS in sufficient quantities to induce a rapid disruption of glutamate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212232 12684448 283402 20996 11179 SOD1 ALS ALS 6 2.2 In studies of glutamate transporters in ALS and SOD mutant mouse models there has been discussion as 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212234 12684448 283403 20996 11179 SOD1 ALS ALS 38 2.2 that similar oxidative dysfunction might contribute to transport loss in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212235 12684448 283404 18723 10261 ROS1 ROS ROS 7 0.0 Although determination of the precise forms of ROS that may mediate disruption of glutamate transport is beyond the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212236 12684448 283406 20996 11179 SOD1 ALS ALS 13 2.2 increased nitrotyrosine labeling in motor neurons and ventral horn in ALS and/or and or SOD mutant mouse models (Abe Abe et 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212239 12684448 283407 20996 11179 SOD1 ALS ALS 8 2.2 Novel support for a feedforward mechanism contributing to ALS pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212240 12684448 283408 20996 11179 SOD1 ALS ALS 19 2.2 has been suggested to underlie excitotoxic damage to MNs in ALS could reflect a primary astrocytic deficit 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212241 12684448 283409 18723 10261 ROS1 ROS ROS 14 0.0 suggesting that disruption of astrocytic transport is induced specifically by ROS generated within MNs provides support for an alternative model in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212242 12684448 283411 20996 11179 SOD1 ALS ALS 15 2.2 local changes predicted by the present model and observed in ALS a primary global loss of astrocytic glutamate transport capacity induces 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212244 12684448 283412 20996 11179 SOD1 ALS ALS 16 2.2 both cell types in the mutant SOD1 mouse models of ALS development of disease seems to require the mutant enzyme to 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212245 12684448 283413 20996 11179 SOD1 ALS ALS 16 2.2 for the close association of affected MNs and astrocytes in ALS the present model presents a mechanistic framework that can explain 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212246 12684448 283414 20996 11179 SOD1 ALS ALS 26 2.2 with the pronounced oxidative damage and mitochondrial abnormalities seen in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212247 12684448 283414 18723 10261 ROS1 ROS ROS 10 0.0 First the apparent ability of glutamate to cause selective mitochondrial ROS generation in MNs is compatible with the pronounced oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212249 12684448 283415 20996 11179 SOD1 ALS ALS 28 2.2 previous reports of oxidative modifications of the GLT-1 transporter in ALS (Pedersen Pedersen et al. 1998 Trotti et al. 1999 Deitch 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212250 12684448 283415 18723 10261 ROS1 ROS ROS 6 0.0 In addition the suggestion that the ROS can exit MNs and affect surrounding astrocytes provides an explanation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212251 12684448 283416 18723 10261 ROS1 ROS ROS 25 0.0 al. 2000 and thus should be readily accessible to MN ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212252 12684448 283417 18723 10261 ROS1 ROS ROS-induced 2 0.0 Finally because ROS-induced disruption of glutamate transport would be expected to cause additional 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212253 12684448 283417 18723 10261 ROS1 ROS ROS 28 0.0 which in turn would result in increased excitotoxic activation and ROS generation in the local population of MNs the present observations 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212255 12684448 283419 20996 11179 SOD1 ALS ALS 13 2.2 the nature of reciprocal interactions between MNs and astrocytes in ALS could powerfully impact the development of new therapeutic strategies 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212256 12684448 283427 18723 10261 ROS1 ROS ROS 4 0.0 Glutamate exposure causes preferential ROS generation in cultured MNs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212257 12684448 283436 18723 10261 ROS1 ROS ROS 3 0.0 Mechanisms of MN ROS generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212258 12684448 283438 18723 10261 ROS1 ROS ROS 6 0.0 A Ca dependence of MN ROS generation ( circles was examined by exposing cultures to glutamate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212259 12684448 283439 18723 10261 ROS1 ROS ROS 8 0.0 B The role of mitochondria in MN ROS generation was tested by addition of the electron transport blocker 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212260 12684448 283443 18723 10261 ROS1 ROS ROS 1 0.0 MN ROS generation induces oxidation in neighboring astrocytes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212264 12684448 283454 18723 10261 ROS1 ROS ROS 1 0.0 MN ROS can disrupt glutamate uptake in surrounding astrocytes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212267 12684448 283472 17497 9543 PSMB6 Delta Delta 29 1.0 was highly selective for MNs (Carriedo Carriedo et al. 2000 Delta F in MNs (most most evident over the nuclei than 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212268 12684448 283472 18723 10261 ROS1 ROS ROS 11 0.0 our previous studies using these cultures we found that the ROS generation induced by exposure to AMPA or kainate was highly 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212269 12684448 283473 17497 9543 PSMB6 Delta Delta 13 1.0 mitochondrially sequestered oxidation-sensitive fluorophore DHR (Dugan Dugan et al. 1995 Delta F was most notable in the perinuclear mitochondria-rich regions of 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212270 12684448 283474 18723 10261 ROS1 ROS ROS 12 0.0 using HEt-loaded cultures were performed to examine the mechanisms of ROS generation in MNs (Fig Fig 3 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212271 12684448 283475 17497 9543 PSMB6 Delta Delta 2 1.0 The glutamate-induced Delta F was dependent on the presence of Ca in the 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212272 12684448 283475 18723 10261 ROS1 ROS ROS 24 0.0 medium and suggesting a central role for mitochondria in the ROS generation it was blocked by addition of the electron transport 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212273 12684448 283476 18723 10261 ROS1 ROS ROS 2 0.0 Motor neuron ROS generation induces oxidation in neighboring astrocytes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212274 12684448 283477 18723 10261 ROS1 ROS ROS 6 0.0 We next sought to determine whether ROS generated in MNs was capable of inducing oxidation in surrounding 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212275 12684448 283479 17497 9543 PSMB6 Delta Delta 26 1.0 response in other spinal neurons (Carriedo Carriedo et al. 2000 Delta F in astrocytic nuclei permits highly sensitive ROS detection Before 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212276 12684448 283479 18723 10261 ROS1 ROS ROS 10 0.0 This exposure paradigm which we found previously to cause strong ROS generation in MNs with virtually no response in other spinal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212277 12684448 283479 18723 10261 ROS1 ROS ROS 34 0.0 al. 2000 Delta F in astrocytic nuclei permits highly sensitive ROS detection Before imaging a microscope field (400_amp_#215;) 400_amp_#215 was selected 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212278 12684448 283480 17497 9543 PSMB6 Delta Delta 12 1.0 kainate (100 100 micro M plus 10 micro M MK-801 Delta F was measured in astrocytes at various distances from the 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212279 12684448 283481 17497 9543 PSMB6 Delta Delta 35 1.0 results initially only from regions surrounding strongly responding MNs ( Delta F >3 a level of response seen in one-half of 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212280 12684448 283481 18723 10261 ROS1 ROS ROS 17 0.0 oxidation in astrocytes would be proportionate to the intensity of ROS generation in the central MN we compiled results initially only 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212281 12684448 283482 17497 9543 PSMB6 Delta Delta 18 1.0 50 microm of the strongly responding MNs showed significantly greater Delta F than those farther away ( p _lt_ 0.001 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212283 12684448 283483 17497 9543 PSMB6 Delta Delta 15 1.0 (SOD, SOD 100 U/ml), U ml despite closely matched MN Delta F the astrocytic response was eliminated 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>9543|PSMB6|5694|No_GeneRif__12856|YY1|7528|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 212286 12684448 283484 18723 10261 ROS1 ROS ROS 13 0.0 of extracellular SOD on astrocytic responses suggests strongly that the ROS generated in MNs passes into the extracellular bath (in in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212287 12684448 283486 18723 10261 ROS1 ROS ROS 2 0.0 Motor neuron ROS can disrupt glutamate uptake in surrounding astrocytes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212288 12684448 283487 18723 10261 ROS1 ROS ROS 4 0.0 The ability of this ROS to affect glutamate transport in nearby glia was assessed using 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212290 12684448 283497 18723 10261 ROS1 ROS ROS 14 0.0 simplified culture system enabled us to perform real-time examination of ROS generated in MNs and their effects in local glia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 212292 12684448 283498 20996 11179 SOD1 ALS ALS 34 2.2 G93A mutant form of SOD1 associated with familial forms of ALS (Gurney Gurney et al. 1994 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 212293 12684448 283500 20996 11179 SOD1 ALS ALS 1 2.2 In ALS MNs protein oxidative damage has been well documented by 3-nitrotyrosine 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000873395958961213<>ScoreDetail__5468|IGFALS|0.000354695988201691__11179|SOD1|0.000873395958961213__ 0 0 0 0 0 203906 12718737 273319 20996 11179 SOD1 ALS ALS 23 1.4 stroke Parkinson's disease (PD) PD and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113487316397057<>ScoreDetail__5468|IGFALS|0.000151280208766688__11179|SOD1|0.00113487316397057__ 0 0 0 0 0 203909 12718737 273326 20996 11179 SOD1 ALS ALS 25 1.4 in treating some neurodegenerative diseases such as stroke PD and ALS but also the pitfalls that have met antioxidant molecules in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113487316397057<>ScoreDetail__5468|IGFALS|0.000151280208766688__11179|SOD1|0.00113487316397057__ 0 0 0 0 0 205385 12769802 275504 20996 11179 SOD1 ALS ALS 20 0.0 AD Parkinson's disease (PD), PD and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000785712250190322<>ScoreDetail__5468|IGFALS|0.000463445718920171__11179|SOD1|0.000785712250190322__ 0 0 0 0 0 205386 12769802 275505 18723 10261 ROS1 ROS ROS 7 0.0 An unbalanced overproduction of reactive oxygen species (ROS) ROS may give rise to oxidative stress which can induce neuronal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 205387 12769802 275506 20996 11179 SOD1 ALS ALS 18 0.0 stress is involved in the pathogenesis of AD PD and ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000785712250190322<>ScoreDetail__5468|IGFALS|0.000463445718920171__11179|SOD1|0.000785712250190322__ 0 0 0 0 0 205388 12769802 275507 20996 11179 SOD1 ALS ALS 33 0.0 in animal models of neurodegenerative diseases including AD PD and ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000785712250190322<>ScoreDetail__5468|IGFALS|0.000463445718920171__11179|SOD1|0.000785712250190322__ 0 0 0 0 0 205389 12769802 275508 20996 11179 SOD1 ALS ALS 16 0.0 antioxidants might exert some protective effect against AD PD and ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000785712250190322<>ScoreDetail__5468|IGFALS|0.000463445718920171__11179|SOD1|0.000785712250190322__ 0 0 0 0 0 205391 12769802 275510 20996 11179 SOD1 ALS ALS 30 0.0 the pathogenesis of neurodegenerative disorders such as AD PD and ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000785712250190322<>ScoreDetail__5468|IGFALS|0.000463445718920171__11179|SOD1|0.000785712250190322__ 0 0 0 0 0 205393 12769802 275511 18723 10261 ROS1 ROS ROS 3 0.0 The effects of ROS and antioxidants on NF-kB function and their relevance in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 200564 12873154 268347 20996 11179 SOD1 ALS ALS 7 0.0 Biomedical researchers interested in amyotrophic lateral sclerosis (ALS) ALS must invoke newly developing technologies if we are to discover 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000806067489832558<>ScoreDetail__5468|IGFALS|0.000401058795219379__11179|SOD1|0.000806067489832558__ 0 0 0 0 0 200565 12873154 268348 20996 11179 SOD1 ALS ALS 3 0.0 The focus of ALS research over the last 10 years has been on reactive 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000806067489832558<>ScoreDetail__5468|IGFALS|0.000401058795219379__11179|SOD1|0.000806067489832558__ 0 0 0 0 0 200566 12873154 268348 18723 10261 ROS1 ROS ROS 16 0.0 last 10 years has been on reactive oxygen species (ROS) ROS and glutamate excitotoxicity resulting in several clinical trials and the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 200567 12873154 268348 20996 11179 SOD1 ALS ALS 38 0.0 of the only drug currently available for the treatment of ALS riluzole 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000806067489832558<>ScoreDetail__5468|IGFALS|0.000401058795219379__11179|SOD1|0.000806067489832558__ 0 0 0 0 0 200568 12873154 268349 20996 11179 SOD1 ALS ALS 15 0.0 been minimal at best and the prognosis for patients with ALS has not improved beyond very modest retardation of the disease 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000806067489832558<>ScoreDetail__5468|IGFALS|0.000401058795219379__11179|SOD1|0.000806067489832558__ 0 0 0 0 0 200569 12873154 268350 18723 10261 ROS1 ROS ROS 2 0.0 By emphasising ROS and glutamate excitotoxicity current ALS research has only partially been 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 200570 12873154 268350 20996 11179 SOD1 ALS ALS 7 0.0 By emphasising ROS and glutamate excitotoxicity current ALS research has only partially been able to attenuate the rate 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000806067489832558<>ScoreDetail__5468|IGFALS|0.000401058795219379__11179|SOD1|0.000806067489832558__ 0 0 0 0 0 200571 12873154 268354 20996 11179 SOD1 ALS ALS 10 0.0 Oxidative stress seen in both familial and sporadic forms of ALS may be only one post-translational mechanism likely to affect specific 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000806067489832558<>ScoreDetail__5468|IGFALS|0.000401058795219379__11179|SOD1|0.000806067489832558__ 0 0 0 0 0 200572 12873154 268356 20996 11179 SOD1 ALS ALS 18 0.0 specific cells represent the kinds of advances needed to combat ALS in the third millennium 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000806067489832558<>ScoreDetail__5468|IGFALS|0.000401058795219379__11179|SOD1|0.000806067489832558__ 0 0 0 0 0 201128 12893007 269197 18723 10261 ROS1 ROS ROS 13 0.3 stress in which production of highly reactive oxygen species (ROS) ROS overwhelms antioxidant defenses is a feature of many neurological diseases 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201129 12893007 269198 20996 11179 SOD1 ALS ALS 40 2.9 s disease Lewy bodies related diseases amyotrophic lateral sclerosis (ALS), ALS and Huntington disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201130 12893007 269200 20996 11179 SOD1 ALS ALS 5 2.9 In some familiar cases of ALS mutation in the gene for Cu/Zn Cu Zn superoxide dismutase 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201132 12893007 269201 18723 10261 ROS1 ROS ROS 4 0.3 In other neurodegenerative diseases ROS have some usually not clear role in early pathogenesis or 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201133 12893007 269203 6554 3309 ELA2 HNE HNE 21 0.8 aldehydes among which one of most important is 4-hydroxynonenal (HNE) HNE 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201134 12893007 269204 6554 3309 ELA2 HNE HNE 3 0.8 The presence of HNE is increased in brain tissue and cerebrospinal fluid of AD 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201135 12893007 269204 20996 11179 SOD1 ALS ALS 20 2.9 cerebrospinal fluid of AD patients and in spinal cord of ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201136 12893007 269205 6554 3309 ELA2 HNE HNE 5 0.8 Immunohistochemical studies show presence of HNE in neurofibrilary tangles and in senile plaques in AD in 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201137 12893007 269205 20996 11179 SOD1 ALS ALS 25 2.9 in the cytoplasm of the residual motor neurons in sporadic ALS in Lewy bodies in neocortical and brain stem neurons in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201138 12893007 269206 6554 3309 ELA2 HNE HNE 4 0.8 Thus increased levels of HNE in neurodegenerative disorders and immunohistochemical distribution of HNE in brain 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201139 12893007 269206 6554 3309 ELA2 HNE HNE 12 0.8 levels of HNE in neurodegenerative disorders and immunohistochemical distribution of HNE in brain tissue indicate pathophysiological role of oxidative stress in 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201140 12893007 269206 6554 3309 ELA2 HNE HNE 27 0.8 pathophysiological role of oxidative stress in these diseases and especially HNE in formation of abnormal filament deposites 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201141 12893007 269213 18723 10261 ROS1 ROS ROS 0 0.3 ROS induce peroxidation of the lipids (cellular cellular membrane lipids or 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201142 12893007 269214 18723 10261 ROS1 ROS ROS 13 0.3 with macromolecules the aldehydes are much more stable than the ROS so they can spread from site of origin and act 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201143 12893007 269215 6554 3309 ELA2 HNE HNE 19 0.8 fatty acids PUFAs peroxidation is highly reactive aldehyde 4-hydroxynonenal (HNE) HNE ( Uchida and Stadtman 1992 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201144 12893007 269216 18723 10261 ROS1 ROS ROS 23 0.3 conditions based on the production of reactive oxygen species (ROS) ROS ([ Esterbauer et al Wataya et al 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201145 12893007 269218 6554 3309 ELA2 HNE HNE 24 0.8 chronic and acute oxidative stress with evidence for contribution of HNE to pathogenesis of specific pathomorphologies in neuronal degeneration 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201146 12893007 269220 6554 3309 ELA2 HNE HNE 3 0.8 Lipid peroxidation and HNE in Alzheimer_amp_#x2019 s disease 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201153 12893007 269230 19965 24624 SIL1 BAP BAP 0 0.0 BAP is derived by proteolysis from a much larger APP 1 JUMiner_v2.2 1 0 0 2 24624 TotalCon:2<>24624|SIL1|64374|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:24624|SIL1|0.000219298245614035<>ScoreDetail__24624|SIL1|0.000219298245614035__30306|PHB2|0__ 0 0 0 0 0 201155 12893007 269231 19965 24624 SIL1 BAP BAP 13 0.0 APP involves a proteolytic cleavage in the middle of the BAP domain with the release of fragment in the extracellular fluid 1 JUMiner_v2.2 1 0 0 2 24624 TotalCon:2<>24624|SIL1|64374|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:24624|SIL1|0.000219298245614035<>ScoreDetail__24624|SIL1|0.000219298245614035__30306|PHB2|0__ 0 0 0 0 0 201158 12893007 269232 19965 24624 SIL1 BAP BAP 12 0.0 the APP molecule is cut at both ends of the BAP domain releasing an intact BAP molecule which is toxic and 1 JUMiner_v2.2 1 0 0 2 24624 TotalCon:2<>24624|SIL1|64374|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:24624|SIL1|0.000219298245614035<>ScoreDetail__24624|SIL1|0.000219298245614035__30306|PHB2|0__ 0 0 0 0 0 201159 12893007 269232 19965 24624 SIL1 BAP BAP 17 0.0 at both ends of the BAP domain releasing an intact BAP molecule which is toxic and accumulates in neuritic plaques as 1 JUMiner_v2.2 1 0 0 2 24624 TotalCon:2<>24624|SIL1|64374|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:24624|SIL1|0.000219298245614035<>ScoreDetail__24624|SIL1|0.000219298245614035__30306|PHB2|0__ 0 0 0 0 0 201167 12893007 269245 18723 10261 ROS1 ROS ROS 18 0.3 docosahexenoic acid which build the brains phospholipids are vulnerable to ROS because of their double bonds that allow easy hydrogen abstraction 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201168 12893007 269249 11629 6493 LAMC2 CSF CSF 6 0.0 Concentration of F2-IsoP and f4-NP in CSF of AD patients are significantly elevated if compared with controls 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201169 12893007 269253 6554 3309 ELA2 HNE HNE 1 0.8 Determing HNE presence appears to be good solution to show specific onset 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201170 12893007 269254 6554 3309 ELA2 HNE HNE 0 0.8 HNE is neurotoxic 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201171 12893007 269256 6554 3309 ELA2 HNE HNE 4 0.8 After administration at forebrain HNE damages cholinergic neurons and impairs visuospatial memory in rats ( 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201172 12893007 269257 6554 3309 ELA2 HNE HNE 0 0.8 HNE is capable of inducing apoptosis in PC12 cells and cultured 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201173 12893007 269258 6554 3309 ELA2 HNE HNE 8 0.8 There are numerous findings supporting important role of HNE in development of AD 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201174 12893007 269259 6554 3309 ELA2 HNE HNE 5 0.8 Thus significant increase of free HNE in cerebrospinal fluid ([ Lovell et al amygdala hippocampus and 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201175 12893007 269260 6554 3309 ELA2 HNE HNE 5 0.8 Moreover immunocytochemical studies demonstrated that HNE immunoreactivity is present in NFT but only in some SP 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201176 12893007 269261 6554 3309 ELA2 HNE HNE 0 0.8 HNE modification of BAP results in a progressively selective and efficient 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201177 12893007 269261 19965 24624 SIL1 BAP BAP 3 0.0 HNE modification of BAP results in a progressively selective and efficient inhibition of degradation 1 JUMiner_v2.2 1 0 0 2 24624 TotalCon:2<>24624|SIL1|64374|Complete__30306|PHB2|11331|Complete__<>AvaiableGeneRif=2<>BEST:24624|SIL1|0.000219298245614035<>ScoreDetail__24624|SIL1|0.000219298245614035__30306|PHB2|0__ 0 0 0 0 0 201178 12893007 269262 6554 3309 ELA2 HNE HNE 18 0.8 in AD suggests dysfunction of proteasome system while co-existence of HNE immunoreactivity in the same cells suggests the essential role of 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201179 12893007 269263 6554 3309 ELA2 HNE HNE 0 0.8 HNE immunopositivity seems to be associated with the inheritance of apolipoprotein 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201182 12893007 269265 6554 3309 ELA2 HNE HNE 0 0.8 HNE is more potent crosslinker than malondialdehyde (MDA) MDA for purified 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201183 12893007 269265 6554 3309 ELA2 HNE HNE 21 0.8 and APOE4 and APOE3 is more susceptible to crosslinking by HNE then APOE4 in vitro in P19 neuroglial cell culture ( 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201184 12893007 269265 4062 1787 CDKN2A P19 P19 27 0.3 susceptible to crosslinking by HNE then APOE4 in vitro in P19 neuroglial cell culture ( Montine et al 1 JUMiner_v2.2 1 2 p19 cell 0 2 9951 TotalCon:4<>1787|CDKN2A|1029|Complete__1790|CDKN2D|1032|Complete__15488|IL23A|51561|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=4<>BEST:9951|REG1A|0.000525519415942411<>ScoreDetail__1787|CDKN2A|0.000347301415512588__9951|REG1A|0.000525519415942411__1790|CDKN2D|0.000392098174199341__15488|IL23A|0.00043057392578076__ 0 0 0 0 0 201185 12893007 269266 6554 3309 ELA2 HNE HNE 0 0.8 HNE is toxic for P19 cells causing cross-linking of tau into 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201186 12893007 269266 4062 1787 CDKN2A P19 P19 4 0.3 HNE is toxic for P19 cells causing cross-linking of tau into high molecular weight substances 1 JUMiner_v2.2 1 2 32 0 2 9951 TotalCon:4<>1787|CDKN2A|1029|Complete__1790|CDKN2D|1032|Complete__15488|IL23A|51561|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=4<>BEST:9951|REG1A|0.000525519415942411<>ScoreDetail__1787|CDKN2A|0.000347301415512588__9951|REG1A|0.000525519415942411__1790|CDKN2D|0.000392098174199341__15488|IL23A|0.00043057392578076__ 0 0 0 0 0 201188 12893007 269267 6554 3309 ELA2 HNE HNE 13 0.8 enzymes which inactivate the toxic products of oxygen metabolism including HNE ([ Danielson et al 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201189 12893007 269269 6554 3309 ELA2 HNE HNE 8 0.8 This could lead to more pronounced effects of HNE in these brain regions 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201190 12893007 269270 6554 3309 ELA2 HNE HNE 1 0.8 However HNE cannot be considered as the only causative agent in protein 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201191 12893007 269275 6554 3309 ELA2 HNE HNE 14 0.8 a time and concentration dependent manner and more toxic than HNE at 5 _amp_#x3bc M concentration for hippocampal tissue cultures ( 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201193 12893007 269278 6554 3309 ELA2 HNE HNE 3 0.8 Thus not only HNE but also acrolein is likely to be causative factor in 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201194 12893007 269280 6554 3309 ELA2 HNE HNE 3 0.8 Lipid peroxidation and HNE in amyotrophic lateral sclerosis 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201195 12893007 269281 20996 11179 SOD1 ALS ALS 3 2.9 Amyotrophic lateral sclerosis (ALS) ALS is a progressive neurodegenerative disorder characterized by weakness and spasticity 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201196 12893007 269283 20996 11179 SOD1 ALS ALS 0 2.9 ALS is further classified into sporadic (sALS) sALS and familial (fALS) 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201197 12893007 269284 20996 11179 SOD1 ALS ALS 1 2.9 Sporadic ALS is one of the commonest adult-onset neurodegenerative disorders with a 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201199 12893007 269286 20996 11179 SOD1 ALS ALS 9 2.9 The primary pathogenic processes underlying motor neuron injury in ALS are multifactorial and the precise molecular pathways of the motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201200 12893007 269287 20996 11179 SOD1 ALS ALS 4 2.9 Approximately 10% of all ALS cases are fALS inherited by autosomal dominant or recessive transmission 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201211 12893007 269300 18723 10261 ROS1 ROS ROS 1 0.3 Overproduced ROS react with proteins nucleic acids and lipids 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201212 12893007 269301 6554 3309 ELA2 HNE HNE 7 0.8 The end products of lipid peroxidation like HNE are able to react with protein amino groups and cross-link 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201213 12893007 269302 6554 3309 ELA2 HNE HNE 6 0.8 An in vitro study showed that HNE impaires the glutamate and glucose transport and the choline acetyltransferase 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201214 12893007 269303 6554 3309 ELA2 HNE HNE 10 0.8 A study of autopsy materials indicated that increased level of HNE was cause of modification of astrocytic glutamate transporter EAAT2 and 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201216 12893007 269303 20996 11179 SOD1 ALS ALS 25 2.9 of astrocytic glutamate transporter EAAT2 and impaired glutamate transport in ALS ( Pedersen et al 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201217 12893007 269304 6554 3309 ELA2 HNE HNE 6 0.8 In the sALS intense immunoreactivity for HNE protein adducts and nepsiloncarboxymethyl-lisine (CML), CML as a lipid peroxidation 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201218 12893007 269304 1607 1014 BCR CML CML 11 0.3 sALS intense immunoreactivity for HNE protein adducts and nepsiloncarboxymethyl-lisine (CML), CML as a lipid peroxidation or protein glycoxidation products present in 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 201219 12893007 269305 20996 11179 SOD1 ALS ALS 15 2.9 not detectable in the spinal cord of sporadic or familial ALS patients ( Shibata et al 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201221 12893007 269309 20996 11179 SOD1 ALS ALS 30 2.9 motor neurons needs to be base for understanding pathomechanisms of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00118312467196082<>ScoreDetail__5468|IGFALS|0.000361573749745768__11179|SOD1|0.00118312467196082__ 0 0 0 0 0 201222 12893007 269311 6554 3309 ELA2 HNE HNE 3 0.8 Lipid peroxidation and HNE in Parkinson_amp_#x2019 s disease 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201223 12893007 269327 18723 10261 ROS1 ROS ROS 7 0.3 Oxidative cascade leads to further generation of ROS which induce oxidative damage of DNA particularly in substantia nigra 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201224 12893007 269328 6554 3309 ELA2 HNE HNE 8 0.8 The end products of lipid peroxidation such as HNE are responsible for cytotoxicity in conjunction with oxidative stress acting 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201225 12893007 269329 6554 3309 ELA2 HNE HNE 0 0.8 HNE is present in Lewy bodies in PD and diffuse Lewy 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201226 12893007 269332 6554 3309 ELA2 HNE HNE 16 0.8 synaptosomes with ascorbic acid induced the production of TBARS and HNE ([ Morel et al 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201227 12893007 269333 6554 3309 ELA2 HNE HNE 6 0.8 Further incubation with ranging concentrations of HNE induced a dose-dependent decrease of dopamine uptake and Na /K 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201228 12893007 269334 6554 3309 ELA2 HNE HNE 4 0.8 These data suggest that HNE is an important mediator of oxidative stress that alters dopamine 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201229 12893007 269335 6554 3309 ELA2 HNE HNE 4 0.8 Such toxic effects of HNE may contribute to the onset and progression of Parkinson_amp_#x2019 s 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201230 12893007 269336 6554 3309 ELA2 HNE HNE 3 0.8 However pathophysiology of HNE in PD as well as in other neurodegenerative diseases should 3 JUMiner_v2.2 1 2 4-hydroxy-2-nonenal 0 0 0 0 0 0 0 0 201635 12901835 269760 18723 10261 ROS1 ROS ROS 40 0.3 increase in both cytosolic and mitochondrial reactive oxygen species (ROS) ROS production in human neuroblastoma SH-SY5Y cells compared to cells overexpressing 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201637 12901835 269761 18723 10261 ROS1 ROS ROS 4 0.3 Exposure to N-acetylcysteine lowers ROS production and returns mitochondrial functional assays to control levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201639 12901835 269763 20996 11179 SOD1 SOD1 SOD1 4 2.4 After proteasome activity inhibition SOD1 aggregates can be detected exclusively in G93A-SOD1 cells even though 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 201641 12901835 269764 18723 10261 ROS1 ROS ROS 11 0.3 findings indicate that mitochondrial homeostasis is affected by mutant SOD1-generated ROS independently from the formation of aggregates and that this alteration 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201642 12901835 269766 20996 11179 SOD1 ALS ALS 3 1.9 Amyotrophic lateral sclerosis (ALS) ALS is a progressive and devastating neurological syndrome due to upper 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201643 12901835 269768 20996 11179 SOD1 ALS ALS 13 1.9 1990s it has been demonstrated that about 20% of familial ALS (FALS) FALS patients possess point mutations in the gene coding 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201648 12901835 269772 18723 10261 ROS1 ROS ROS 8 0.3 One is that imbalance of reactive oxygen species (ROS) ROS metabolism might be elicited by FALS-SOD1 mutants because of modification 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201656 12901835 269782 20996 11179 SOD1 ALS ALS 13 1.9 is most probable that CCS is not directly involved in ALS mishandling of copper is still held as the major culprit 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201658 12901835 269783 20996 11179 SOD1 ALS ALS 37 1.9 were shown in postmortem brain tissue of FALS and sporadic ALS (SALS) SALS patients Bowling et al 1993 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201660 12901835 269784 20996 11179 SOD1 ALS ALS 60 1.9 damage occurring both in patients and in animal models of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201661 12901835 269785 18723 10261 ROS1 ROS ROS 19 0.3 the electron transport mitochondria are the major intracellular source of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201662 12901835 269786 18723 10261 ROS1 ROS ROS 17 0.3 chain enzymes and impairment of energy metabolism contributing to further ROS generation as a result of electron leak at respiratory complexes 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201664 12901835 269789 20996 11179 SOD1 ALS ALS 11 1.9 increased number of mtDNA point mutations in spinal cord of ALS patients has been recently reported Wiedemann et al 2002 and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201666 12901835 269790 18723 10261 ROS1 ROS ROS 10 0.3 In the present study we investigated the subcellular production of ROS and mitochondrial function in human neuroblastoma SH-SY5Y cell lines expressing 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201669 12901835 269819 18723 10261 ROS1 ROS ROS 6 0.3 Whole-cell and mitochondrial reactive oxygen species (ROS) ROS levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201670 12901835 269820 18723 10261 ROS1 ROS ROS 29 0.3 2001 were used to quantify levels of whole-cell and mitochondrial ROS respectively 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201671 12901835 269821 20247 20116 SLC25A29 CACL CaCl 27 1.0 NaCl 5.6 mM KCl 3.6 mM NaHCO 3 2.3 mM CaCl 2 5.6 mM glucose 5 mM Hepes 1.2 mM MgCl 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 201673 12901835 269827 3778 10620 CCL21 ECL ECL 5 0.0 Labeled proteins were detected using ECL Western blotting analysis system (Amersham Amersham Pharmacia Biotech 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201675 12901835 269844 18723 10261 ROS1 ROS ROS 3 0.3 Whole-cell and mitochondrial ROS production Intracellular levels of free radicals were tested using the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201676 12901835 269845 18723 10261 ROS1 ROS ROS 13 0.3 the ionized free acid (DCFH), DCFH which then reacts with ROS in particular cytosolic peroxides to form the fluorescent 2_amp_#x2032 7_amp_#x2032 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201677 12901835 269846 18723 10261 ROS1 ROS ROS 36 0.3 signal of diffuse extranuclear fluorescence suggesting both cytosolic and mitochondrial ROS accumulation ( Fig 2B and C 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201678 12901835 269847 18723 10261 ROS1 ROS ROS 7 0.3 WT cells showed a reduced production of ROS compared to SH cells ( P _amp_#x3c 0.05 in line 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201680 12901835 269848 18723 10261 ROS1 ROS ROS 12 0.3 (1 1 mM 24 h determined a marked decrease in ROS levels exclusively in G93A cells ( P _amp_#x3c 0.001 compared 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201682 12901835 269849 18723 10261 ROS1 ROS ROS 3 0.3 Mitochondrial production of ROS in particular superoxide anions and peroxynitrite was determined using DHR 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201683 12901835 269852 18723 10261 ROS1 ROS ROS 5 0.3 After exposure to NAC mitochondrial ROS significantly decreased only in G93A cells ( P _amp_#x3c 0.05 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201697 12901835 269873 20996 11179 SOD1 ALS ALS 34 1.9 biochemical parameters that appear to be altered also in sporadic ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201699 12901835 269875 18723 10261 ROS1 ROS ROS 28 0.3 or apoptosis under basal growth conditions a significant increase in ROS production was found to occur both in cytosol and mitochondria 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201701 12901835 269878 20996 11179 SOD1 ALS ALS 10 1.9 Previous studies reported a certain degree of mitochondrial dysfunction in ALS experimental models as well as in the central nervous system 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201702 12901835 269878 20996 11179 SOD1 ALS ALS 25 1.9 as in the central nervous system and peripheral tissues from ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 201704 12901835 269881 24185 29175 WDTC1 ADP ADP 19 0.0 complex II and IV and no changes in the ATP ADP ratio in a motor neuron cell line transfected with G93A 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 201706 12901835 269885 18723 10261 ROS1 ROS ROS 25 0.3 indeed the use of NAC promptly reverts both increase in ROS levels and mitochondrial alterations 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201717 12901835 269896 18723 10261 ROS1 ROS ROS 11 0.3 conclusion our data indicate that altered mitochondrial function and increased ROS production might be the primary effect of FALS-linked G93A mutation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 201718 12901835 269897 20996 11179 SOD1 ALS ALS 12 1.9 suggest that the use of antioxidants in the therapy of ALS should be further examined with the specific aim to protect 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00149003823824291<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.00149003823824291__ 0 0 0 0 0 202210 12909279 270734 20996 11179 SOD1 ALS ALS 23 2.8 observed both in post-mortem samples and in experimental models for ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202211 12909279 270739 20996 11179 SOD1 ALS ALS 15 2.8 neurones is the typical feature of amyotrophic lateral sclerosis (ALS), ALS a progressive lethal disease occurring both sporadically (sALS) sALS and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202212 12909279 270740 20996 11179 SOD1 ALS ALS 0 2.8 ALS is one of the most common neurodegenerative disorders with an 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202213 12909279 270741 20996 11179 SOD1 ALS ALS 5 2.8 Recent epidemiological evidences indicate that ALS occurrence is growing in many countries a fact that may 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202214 12909279 270743 20996 11179 SOD1 ALS ALS 1 2.8 Although ALS patients show some degree of heterogeneity as far as symptoms 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202215 12909279 270745 20996 11179 SOD1 ALS ALS 8 2.8 Present evidence indicates that loss of neurones in ALS results from a complex interplay among oxidative injury excitotoxic stimulation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202216 12909279 270746 20996 11179 SOD1 ALS ALS 10 2.8 The roles of excitotoxicity cytoskeletal abnormalities and protein aggregates in ALS have been recently and exhaustively reviewed by others 17 40 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202217 12909279 270747 20996 11179 SOD1 ALS ALS 19 2.8 oxidative stress is a major culprit in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202218 12909279 270751 20996 11179 SOD1 ALS ALS 9 2.8 A role for oxidative stress in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202219 12909279 270752 18723 10261 ROS1 ROS ROS 18 0.9 (physiological) physiological production of potentially toxic reactive oxygen species (ROS) ROS such as superoxide hydrogen peroxide and hydroxyl radical and the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202220 12909279 270754 18723 10261 ROS1 ROS ROS 25 0.9 of ROS-generating electron leakage (2) 2 interception of potentially dangerous ROS i.e scavenging by antioxidant molecules and (3) 3 repair of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202221 12909279 270754 18723 10261 ROS1 ROS ROS 42 0.9 3 repair of damage i.e removal of molecules damaged by ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202222 12909279 270754 18723 10261 ROS1 ROS ROS-generating 17 0.0 three levels (1) 1 prevention of damage i.e prevention of ROS-generating electron leakage (2) 2 interception of potentially dangerous ROS i.e 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202223 12909279 270755 18723 10261 ROS1 ROS ROS 33 0.9 redox cycling_amp_#x201d i.e alternative oxidisation and reduction during which toxic ROS are generated 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202224 12909279 270757 18723 10261 ROS1 ROS ROS 46 0.9 e.g membrane polyunsaturated lipids and an inherently high flux of ROS generated during neurochemical reactions such as dopamine oxidation 39 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202225 12909279 270759 20996 11179 SOD1 ALS ALS 7 2.8 A role for ROS-mediated oxidative stress in ALS was proposed by many investigators who reported that typical oxidation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202226 12909279 270759 20996 11179 SOD1 ALS ALS 36 2.8 and membrane phospholipids are elevated both in sporadic and familial ALS patients and in several model systems as well 4 6 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202227 12909279 270759 18723 10261 ROS1 ROS ROS-mediated 3 0.0 A role for ROS-mediated oxidative stress in ALS was proposed by many investigators who 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202228 12909279 270760 18723 10261 ROS1 ROS ROS 14 0.9 become prominent in mitochondria in which the majority of cellular ROS is produced and targets mitochondrial proteins lipids as well as 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202229 12909279 270762 20996 11179 SOD1 ALS ALS 17 2.8 death of motor neurones which is likely to occur in ALS 35 and 59 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202230 12909279 270763 18723 10261 ROS1 ROS ROS 2 0.9 In fact ROS are very well known inducers of cell death they regulate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202231 12909279 270763 18723 10261 ROS1 ROS ROS 22 0.9 regulate early and late steps of apoptosis and inhibition of ROS production also protects against apoptosis ( 29 and references therein 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202232 12909279 270764 20996 11179 SOD1 ALS ALS 13 2.8 the concept that oxidative stress plays a major role in ALS as in other neurodegenerative diseases is provided by the observation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202236 12909279 270766 18723 10261 ROS1 ROS ROS 28 0.9 the removal of superoxide and prevention of further generation of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202251 12909279 270786 18723 10261 ROS1 ROS ROS 12 0.9 of evidence indicate that fALS-SOD1s_amp_#x2019 novel properties involve imbalance of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202253 12909279 270788 18723 10261 ROS1 ROS ROS 2 0.9 Imbalance of ROS metabolism may be elicited by fALS-SOD1 mutants because of their 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202256 12909279 270793 18723 10261 ROS1 ROS ROS 42 0.9 but still active mutant SOD1 may mediate the formation of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202257 12909279 270794 18723 10261 ROS1 ROS ROS 18 0.9 proposed that misfolded fALS-SOD1 may contribute to generation of intracellular ROS simply by loosing their copper-buffering ability (see see below 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202258 12909279 270796 20996 11179 SOD1 ALS ALS 10 2.8 Coping with copper are copper buffering and transport altered in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202275 12909279 270814 18723 10261 ROS1 ROS ROS 54 0.9 SOD1 A4V and G93A in vitro 100 rescue elevation of ROS levels in lymphoblasts from fALS patients 82 and revert the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202276 12909279 270824 20996 11179 SOD1 ALS ALS 22 2.8 reported in only one investigation in a limited sample of ALS patients 96 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202281 12909279 270831 24231 12780 WNT2 IRP IRP 21 0.0 mitochondria respiratory chain but also of the so-called _amp_#x201c IRE_amp_#x2013 IRP machinery_amp_#x201d (iron-responsive iron-responsive element_amp_#x2013 iron regulatory protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202282 12909279 270833 24231 12780 WNT2 IRP IRPs 0 0.0 IRPs are cytosolic factors binding to a mRNA-hairpin structure known as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202283 12909279 270834 24231 12780 WNT2 IRP IRP 11 0.0 of low Fe availability the Fe_amp_#x2013 S cluster in the IRP is open therefore allowing the IRP to bind to the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202284 12909279 270834 24231 12780 WNT2 IRP IRP 17 0.0 S cluster in the IRP is open therefore allowing the IRP to bind to the IRE 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202285 12909279 270835 24231 12780 WNT2 IRP IRP 16 0.0 the 3_amp_#x2032 untranslated region of the mRNA the binding of IRP usually causes an up-regulation of the coded protein as for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202286 12909279 270836 24231 12780 WNT2 IRP IRP 3 0.0 Conversely binding of IRP to an IRE in the 5_amp_#x2032 untranslated region of the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202288 12909279 270838 20996 11179 SOD1 ALS ALS 1 2.8 In ALS patients an imbalance in ROS production_amp_#x2014 either caused directly by 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202289 12909279 270838 18723 10261 ROS1 ROS ROS 6 0.9 In ALS patients an imbalance in ROS production_amp_#x2014 either caused directly by mutant SOD1 or indirectly by 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202291 12909279 270838 24231 12780 WNT2 IRP IRP 34 0.0 in turn this could cause inactivation both of the IRE_amp_#x2013 IRP machinery and of mitochondrial enzymes ( Fig 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202293 12909279 270839 20996 11179 SOD1 ALS ALS 44 2.8 altered iron homeostasis may be implicated in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202295 12909279 270842 20996 11179 SOD1 ALS ALS 35 2.8 been studied in patients suffering from fALS or in any ALS model system 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202296 12909279 270843 20996 11179 SOD1 ALS ALS 6 2.8 That metal homeostasis is altered in ALS is indicated also by observations on the level of expression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202298 12909279 270846 20996 11179 SOD1 ALS ALS 5 2.8 Finally a possible link between ALS and metal homeostasis is represented by modulation of proteasome functionality 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202299 12909279 270849 18723 10261 ROS1 ROS ROS 47 0.9 depending on the cell type or on the extent of ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202302 12909279 270853 18723 10261 ROS1 ROS ROS 24 0.9 within the cell which_amp_#x2014 as mentioned for copper_amp_#x2014 can generate ROS causing oxidative stress and inactivating other crucial enzymes (e.g e.g 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202304 12909279 270856 20996 11179 SOD1 ALS ALS 34 2.8 thought to be potentially useful for a general understanding of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202307 12909279 270858 20996 11179 SOD1 ALS ALS 25 2.8 to restrict the field of possible pathogenic mechanisms operating in ALS to a few plausible pathways possibly converging to two common 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202308 12909279 270858 18723 10261 ROS1 ROS ROS 42 0.9 converging to two common steps represented by the alteration of ROS ( Fig 4 and of calcium homeostasis 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202309 12909279 270860 18723 10261 ROS1 ROS ROS 23 0.9 in part by a defect in intracellular protection against increased ROS production and calcium levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 202310 12909279 270861 20996 11179 SOD1 ALS ALS 13 2.8 the understanding of the selective vulnerability of motor neurones in ALS has been made using the fALS-mice model 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202313 12909279 270865 20996 11179 SOD1 ALS ALS 21 2.8 pathogenic effect of SOD1 mutation (and, and more in general ALS pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202314 12909279 270867 20996 11179 SOD1 ALS ALS 17 2.8 factor involved in inflammatory response is altered in astrocytes from ALS patients 62 and in human cells expressing mutant fALS-SOD1 14 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202317 12909279 270868 20996 11179 SOD1 ALS ALS 37 2.8 of inflammation-mediated neurodegeneration and be crucial in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202320 12909279 270869 20996 11179 SOD1 ALS ALS 15 2.8 are dramatically increased in post-mortem spinal cord samples from sporadic ALS patients and in astrocytes from fALS-mice 2 and 15 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202322 12909279 270870 20996 11179 SOD1 ALS ALS 17 2.8 pro-inflammatory prostaglandin PGE2 were found in the cerebrospinal fluid from ALS patients 3 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202324 12909279 270871 20996 11179 SOD1 ALS ALS 16 2.8 markedly inhibits production of PGE2 in the spinal cord of ALS mice protecting motor neurones and significantly prolonging survival 23 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202325 12909279 270872 20996 11179 SOD1 ALS ALS 20 2.8 response oxidative stress and apoptotic events in the pathogenesis of ALS is still unclear and the contributions of different cellular types 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202326 12909279 270872 20996 11179 SOD1 ALS ALS 35 2.8 the contributions of different cellular types to the pathogenesis of ALS are unknown 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202327 12909279 270876 20996 11179 SOD1 ALS ALS 6 2.8 Which is the main alteration preluding ALS is still actively debated 17 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202328 12909279 270877 20996 11179 SOD1 ALS ALS 27 2.8 one of the main mechanisms operating in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 202329 12909279 270878 18723 10261 ROS1 ROS ROS-induced 8 0.0 Neurodegeneration may arise by converging pathways such as ROS-induced damage of critical molecular targets proteasomal inhibition and consequent accumulation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 202332 12909279 270882 20996 11179 SOD1 ALS ALS 7 2.8 Interestingly this concept is not exclusive of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000818801693862644<>ScoreDetail__5468|IGFALS|0.000607639548219996__11179|SOD1|0.000818801693862644__ 0 0 0 0 0 196436 14572730 262121 20996 11179 SOD1 ALS ALS 11 1.4 scientific evidence of a link between amyotrophic lateral sclerosis (ALS) ALS and soccer is lacking new cases of the disease in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196437 14572730 262123 20996 11179 SOD1 ALS ALS 24 1.4 an inquiry in 1999 to investigate the high incidence of ALS and other diseases_amp_#x2014 such as liver tumours and leukaemia_amp_#x2014 in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196438 14572730 262124 20996 11179 SOD1 ALS ALS 15 1.4 who played between 1960 and 1997 eight have died from ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196439 14572730 262126 20996 11179 SOD1 ALS ALS 7 1.4 The details of any current cases of ALS diagnosed since 1997 are protected under pretrial investigation secrecy but 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196440 14572730 262126 20996 11179 SOD1 ALS ALS 33 1.4 number of players who have died or are affected by ALS is now more than 30 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196441 14572730 262127 20996 11179 SOD1 ALS ALS 4 1.4 The other peculiarity of ALS in Italian soccer players is that age at disease onset 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196442 14572730 262129 20996 11179 SOD1 ALS ALS 4 1.4 The potential link between ALS and soccer might offer new perspectives on the cause of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196443 14572730 262130 20996 11179 SOD1 ALS ALS 9 1.4 The elucidation of the underlying mechanisms and cause of ALS is of overwhelming importance for finding new effective treatments 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196444 14572730 262131 20996 11179 SOD1 ALS ALS 6 1.4 To date the risk factors for ALS that are supported by epidemiological observations are age family history 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196445 14572730 262132 20996 11179 SOD1 ALS ALS 27 1.4 yet been thoroughly investigated are suspected as possible causes of ALS in soccer professionals 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196446 14572730 262133 20996 11179 SOD1 ALS ALS 8 1.4 Why should soccer players be more prone to ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196447 14572730 262134 18723 10261 ROS1 ROS ROS 8 0.0 Previous studies have reported that reactive oxygen species (ROS) ROS are generated during exercise although most evidence for this is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 196448 14572730 262134 18723 10261 ROS1 ROS ROS 28 0.0 is indirect 3 In soccer players an increased production of ROS may result from the combination of strenuous exercise with other 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 196449 14572730 262136 20996 11179 SOD1 ALS ALS 18 1.4 one of many causative factors in several neurodegenerative diseases including ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196450 14572730 262137 18723 10261 ROS1 ROS ROS 23 0.0 of easily oxidized substrates and an inherently high production of ROS during high respiratory activity and during neurochemical reactions such as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 196451 14572730 262138 18723 10261 ROS1 ROS ROS 8 0.0 Furthermore metal ions which facilitate the production of ROS accumulate in the CNS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 196452 14572730 262140 20996 11179 SOD1 ALS ALS 9 1.4 In light of this neuronal loss in patients with ALS might result from a complex interplay of excitotoxic stimulation genetic 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196453 14572730 262141 20996 11179 SOD1 ALS ALS 1 1.4 In ALS the neurotoxic effect of increased ROS production seems not to 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196455 14572730 262141 20996 11179 SOD1 ALS ALS 53 1.4 zinc superoxide dismutase (SOD) SOD 1 in patients with familial ALS which supports a crucial role of glia in the pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196456 14572730 262141 20996 11179 SOD1 ALS ALS 65 1.4 supports a crucial role of glia in the pathogenesis of ALS 6 7 and 8 Several findings indicate that neuroinflammatory processes 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196457 14572730 262141 20996 11179 SOD1 ALS ALS 78 1.4 7 and 8 Several findings indicate that neuroinflammatory processes mediate ALS pathogenesis and markers of neuroinflammation such as concentrations of cyclooxygenase-2 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196458 14572730 262141 20996 11179 SOD1 ALS ALS 96 1.4 concentrations of cyclooxygenase-2 and prostaglandin E2 are substantially increased in ALS 9 and 10 If activated glial cells participate directly in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196459 14572730 262141 20996 11179 SOD1 ALS ALS 113 1.4 cells participate directly in the death of motor neurons in ALS chronic use of anti-inflammatory drugs should prevent this damage in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196460 14572730 262141 18723 10261 ROS1 ROS ROS 7 0.0 In ALS the neurotoxic effect of increased ROS production seems not to be simply mediated by damage to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 196461 14572730 262145 20996 11179 SOD1 ALS ALS 11 1.4 evidence of the occurrence of apoptotic death of neurons in ALS is accumulating 11 but the association between inflammatory response oxidative 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 196462 14572730 262145 20996 11179 SOD1 ALS ALS 30 1.4 response oxidative stress and apoptotic events in the pathogenesis of ALS is still unclear 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00061475931389728<>ScoreDetail__5468|IGFALS|0.000264668189669583__11179|SOD1|0.00061475931389728__ 0 0 0 0 0 186252 14625013 249324 20996 11179 SOD1 ALS ALS 3 1.4 Amyotrophic lateral sclerosis (ALS) ALS is a devastating neurodegenerative disease characterized by a loss of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00120429707745792<>ScoreDetail__5468|IGFALS|0.000628468385575624__11179|SOD1|0.00120429707745792__ 0 0 0 0 0 186254 14625013 249325 20996 11179 SOD1 ALS ALS 23 1.4 Zn-superoxide dismutase (SOD1) SOD1 are found in approximately 2% of ALS patients 12 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00120429707745792<>ScoreDetail__5468|IGFALS|0.000628468385575624__11179|SOD1|0.00120429707745792__ 0 0 0 0 0 186257 14625013 249326 20996 11179 SOD1 ALS ALS 28 1.4 motor neuron degeneration and serve as an animal model for ALS 6 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00120429707745792<>ScoreDetail__5468|IGFALS|0.000628468385575624__11179|SOD1|0.00120429707745792__ 0 0 0 0 0 186280 14625013 249379 20996 11179 SOD1 ALS ALS 41 1.4 a good therapeutic approach to confer neuroprotection in patients with ALS but may also shed a new light on the role 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00120429707745792<>ScoreDetail__5468|IGFALS|0.000628468385575624__11179|SOD1|0.00120429707745792__ 0 0 0 0 0 187160 14648077 250303 18723 10261 ROS1 ROS ROSs 7 0.0 Abstract Living cells produce reactive oxygen species (ROSs) ROSs 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187167 14648077 250304 18723 10261 ROS1 ROS ROSs 5 0.0 To protect themselves from these ROSs the cells have developed both an antioxidant system containing superoxide 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187197 14648077 250310 18723 10261 ROS1 ROS ROSs 7 0.0 Introduction Living cells produce reactive oxygen species (ROSs) ROSs during physiological processes and in response to external stimuli such 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187198 14648077 250311 18723 10261 ROS1 ROS ROSs 6 0.0 To protect itself from potentially destructive ROSs each cell of living organisms has developed a sophisticated antioxidant 13 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187228 14648077 250331 18723 10261 ROS1 ROS ROSs 4 0.1 To cope with destructive ROSs even SOD1-mutated motor neurons induce mutant and wild-type SOD1 as 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 187260 14648077 250354 9028 4818 HAS1 HAS HAS 13 0.1 recognizes the HSA-conjugated Prx2 peptide but does not react with HAS ( Prx2 peroxiredoxin2 ELISA enzyme-linked immunosorbent assay HAS human serum 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 187261 14648077 250354 9028 4818 HAS1 HAS HAS 21 0.0 react with HAS ( Prx2 peroxiredoxin2 ELISA enzyme-linked immunosorbent assay HAS human serum albumin 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187264 14648077 250360 19701 8723 SERPINA5 PCI PCI 24 0.0 superoxide dismutase LBHI Lewy body-like hyaline inclusion 2-bp two-base pair PCI posterior column involvement type detected ND not determined As asphyxia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187277 14648077 250382 19701 8723 SERPINA5 PCI PCI 19 0.0 revealed a subtype of FALS with posterior column involvement (PCI) PCI 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187278 14648077 250384 19701 8723 SERPINA5 PCI PCI 28 0.0 multisystem degeneration in addition to the features of FALS with PCI 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 187401 14648077 250462 18723 10261 ROS1 ROS ROSs 2 0.2 To eliminate ROSs SOD1-mutated motor neurons in mutant SOD1-linked FALS and transgenic rats 5 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 188327 14660707 251169 20996 11179 SOD1 ALS ALS 29 1.1 during pathophysiological states like hypoxia and amyotrophic lateral sclerosis (ALS), ALS a fatal neurodegenerative disorder 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188328 14660707 251172 18723 10261 ROS1 ROS ROS 38 0.0 _amp_#x003bc m indicating an involvement of reactive oxygen species (ROS) ROS in the activation mechanism 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188329 14660707 251180 20247 20116 SLC25A29 CACL CaCl 36 1.3 2 25 NaHCO 3 1 NaH 2 PO 4 1.5 CaCl 2 30 glucose pH 7.4 325 mosmol l _amp_#x02212 1 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 188330 14660707 251195 19254 10472 RUNX2 CCD CCD 11 0.0 Fluorescence measurements For fluorescence measurements a modified version of the CCD camera system (TILL TILL Photonics Planegg Germany was employed as 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188331 14660707 251197 19254 10472 RUNX2 CCD CCD 3 0.0 A 12 bit CCD camera (PCO, PCO Germany was employed to monitor fluorescence changes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188332 14660707 251215 4841 2296 CPA1 CPA CPA 2 0.0 Cyclopiazonic acid (CPA) CPA and oligomycin were dissolved in DMSO (250 250 m m 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188333 14660707 251222 20996 11179 SOD1 ALS ALS 23 1.1 for hypoxia (_amp_#x02018;chemical _amp_#x02018 chemical hypoxia_amp_#x02019 and (ii) ii in ALS a notable decrease in complex IV activity has been observed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188334 14660707 251261 18723 10261 ROS1 ROS ROS 6 0.0 Superoxide and related reactive oxygen species (ROS) ROS may act as signalling molecules by shifting redox pairs to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188335 14660707 251262 18723 10261 ROS1 ROS ROS 6 0.0 We tested the potential involvement of ROS in mediating I CN by the ability of the antioxidants 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188336 14660707 251262 18723 10261 ROS1 ROS ROS 18 0.0 mediating I CN by the ability of the antioxidants and ROS scavengers ascorbic acid and Trolox to interfere with the induction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188337 14660707 251267 18723 10261 ROS1 ROS ROS 12 0.0 the experiments suggested that an increase in the formation of ROS following complex IV inhibition was involved in the activation of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188338 14660707 251293 4841 2296 CPA1 CPA CPA 19 0.0 inhibited the ER Ca 2 -ATPase with 50 _amp_#x003bc m CPA for at least 5 min which released Ca 2 from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188339 14660707 251294 4841 2296 CPA1 CPA CPA 31 0.0 2003 did not invoke a rise in Ca 2 when CPA incubation preceded its action indicating that CPA largely depleted the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188340 14660707 251294 4841 2296 CPA1 CPA CPA 38 0.0 Ca 2 when CPA incubation preceded its action indicating that CPA largely depleted the ER Ca 2 content (not not shown 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188341 14660707 251295 4841 2296 CPA1 CPA CPA 6 0.0 When CN was then added after CPA preincubation it still produced an increase in Ca 2 i 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188343 14660707 251313 20996 11179 SOD1 ALS ALS 81 1.1 is typically tolerant to hypoxia and resistant to damage in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188344 14660707 251323 20996 11179 SOD1 ALS ALS 37 1.1 and in motoneurone disease such as amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188345 14660707 251331 18723 10261 ROS1 ROS ROS 16 0.0 possibly induced by increased levels of reactive oxygen species (ROS), ROS which originate at the respiratory chain when complex IV activity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188346 14660707 251332 18723 10261 ROS1 ROS ROS 4 0.0 However the involvement of ROS is challenged by the fact that the activation of I 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188347 14660707 251333 18723 10261 ROS1 ROS ROS 6 0.0 Although a very localized production of ROS that was not represented by the global NADH signal could 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188348 14660707 251337 18723 10261 ROS1 ROS ROS 7 0.0 Taken together despite the plausible involvement of ROS in activation of I CN more experiments are necessary to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 188349 14660707 251350 20996 11179 SOD1 ALS ALS 19 1.1 are tolerant to hypoxia and also resistant to degeneration in ALS hyperpolarize under the same conditions 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188350 14660707 251354 20996 11179 SOD1 ALS ALS 45 1.1 hypoxia and their selective degeneration in amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188351 14660707 251355 20996 11179 SOD1 ALS ALS-related 24 1.1 response to CN over a time range of minutes whereas ALS-related motoneurone degeneration occurs over months the experimental protocol of mitochondrial 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188352 14660707 251355 20996 11179 SOD1 ALS ALS-related 42 1.1 protocol of mitochondrial inhibition may still have interesting implications for ALS-related motoneurone pathologies 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188355 14660707 251358 20996 11179 SOD1 ALS ALS-related 15 1.1 motoneurone responses to mitochondrial inhibition and their selective vulnerability during ALS-related motoneurone disease will be an interesting area for future investigation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188356 14660707 251375 20996 11179 SOD1 ALS ALS 18 1.1 in MNs to the neurodegenerative disorder amyotrophic lateral sclerosis (ALS), ALS where selective MN degeneration leads to death usually within 5 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188357 14660707 251376 20996 11179 SOD1 ALS ALS 18 1.1 azide or malonate is an accepted in vitro model for ALS based on the selective pattern of neuronal degeneration in spinal 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188358 14660707 251377 20996 11179 SOD1 ALS ALS 6 1.1 Also in a familial form of ALS dysfunction of oxidative phosphorylation induced by a mutated Cu/Zn Cu 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 188360 14660707 251378 20996 11179 SOD1 ALS ALS 18 1.1 metabolism have been proposed as causative or modifying factors in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000974854894232857<>ScoreDetail__5468|IGFALS|0.00017504244779359__11179|SOD1|0.000974854894232857__ 0 0 0 0 0 189415 14690536 252559 20996 11179 SOD1 ALS ALS 11 2.7 is implicated in the aetiology of amyotrophic lateral sclerosis (ALS) ALS with impairment of glutamate transport into astrocytes a possible cause 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0015800604610682<>ScoreDetail__5468|IGFALS|0.000454708627497906__11179|SOD1|0.0015800604610682__ 0 0 0 0 0 189417 14690536 252560 20996 11179 SOD1 ALS ALS 16 2.7 superoxide dismutase (SOD1), SOD1 responsible for about 20% of familial ALS down-regulates glutamate transporters via oxidative stress 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0015800604610682<>ScoreDetail__5468|IGFALS|0.000454708627497906__11179|SOD1|0.0015800604610682__ 0 0 0 0 0 189698 14698606 252855 20996 11179 SOD1 ALS ALS 21 2.2 crucial role in the pathogenesis of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189699 14698606 252860 20996 11179 SOD1 ALS ALS 7 2.2 These observations provide a new understanding of ALS pathogenesis that integrates diverse clues into a unified model that 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189700 14698606 252861 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is a degenerative disease characterized by progressive paralysis usually leading 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189703 14698606 252870 20996 11179 SOD1 ALS ALS 7 2.2 Rather than examining one particular subset of ALS we hope to suggest an integrative framework applicable to all 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189704 14698606 252872 18723 10261 ROS1 ROS ROS 17 0.0 motor neurons produce large quantities of reactive oxygen species (ROS) ROS which in addition to damaging the motor neurons in which 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189705 14698606 252873 18723 10261 ROS1 ROS ROS 10 0.0 Consequently ambient glutamate levels rise further inducing more motor neuron ROS and setting off a progressive feedforward cascade of selective motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189706 14698606 252879 20996 11179 SOD1 ALS ALS 2 2.2 Excitotoxicity in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189707 14698606 252884 20996 11179 SOD1 ALS ALS 33 2.2 it also plays a role in the slow neurodegeneration in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189708 14698606 252885 20996 11179 SOD1 ALS ALS 9 2.2 First abnormalities in glutamate metabolism have been reported in ALS patients 9 with elevated glutamate levels in the cerebrospinal fluid 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189709 14698606 252888 20996 11179 SOD1 ALS ALS 11 2.2 the only drug proven to slow the course of human ALS is the anti-excitotoxic compound Riluzole 16 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189711 14698606 252898 18723 10261 ROS1 ROS ROS 17 0.0 through Ca-A/K Ca-A K channels has been found to induce ROS generation of mitochondrial origin 17 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189712 14698606 252900 20996 11179 SOD1 ALS ALS 16 2.2 strong cytosolic Ca 2 -binding-protein expression might be resistant in ALS 28 and 29 and overexpression of Ca 2 -binding proteins 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189713 14698606 252900 20996 11179 SOD1 ALS ALS 41 2.2 neurons both in vitro and in an animal model of ALS 30 and 31 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189714 14698606 252901 20996 11179 SOD1 ALS ALS 26 2.2 a subpopulation of motor neurons that is relatively resistant to ALS seems to buffer intracellular Ca 2 more effectively 32 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189715 14698606 252902 18723 10261 ROS1 ROS ROS 37 0.0 caused particularly rapid mitochondrial Ca 2 overload and strong mitochondrial ROS generation 33 ( Figure 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189716 14698606 252904 20996 11179 SOD1 ALS ALS 6 2.2 How is glutamate transport damaged in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189719 14698606 252907 20996 11179 SOD1 ALS ALS 5 2.2 Thus a crucial aspect of ALS that remains to be explained is the cause or causes 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189720 14698606 252912 20996 11179 SOD1 ALS ALS 12 2.2 idea decreased levels of transporter have been reported in end-stage ALS 34 as well as in some SOD1 transgenic mice 37 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189722 14698606 252913 20996 11179 SOD1 ALS ALS 6 2.2 These mice provide excellent models of ALS reproducing numerous features of the disease including oxidative damage and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189723 14698606 252918 20996 11179 SOD1 ALS ALS 33 2.2 oxidative modifications of transporter peptides have been reported in both ALS and the SOD1 mutant mouse model 46 and 47 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189725 14698606 252921 20996 11179 SOD1 ALS ALS 17 2.2 to transport that leads to excitotoxic motor neuron damage in ALS the question then arises as to the source of the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189726 14698606 252922 18723 10261 ROS1 ROS ROS 9 0.0 One idea that has received attention recently is that ROS might derive from inflammatory processes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189729 14698606 252924 18723 10261 ROS1 ROS ROS 18 0.0 human and transgenic mouse models these cells can directly produce ROS and might release factors that can trigger glutamate release from 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189731 14698606 252927 18723 10261 ROS1 ROS ROS 9 0.0 However this mechanism would seem unlikely to bear upon ROS generation in the predominant sporadic forms of the disease 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189732 14698606 252928 18723 10261 ROS1 ROS ROS 10 0.0 In light of observations that excitotoxic activation causes relatively selective ROS production in motor neurons ( Figure 1e f we propose 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189733 14698606 252928 18723 10261 ROS1 ROS ROS 35 0.0 that motor neurons might be an important source of the ROS that damages astrocytic glutamate transport 33 and 54 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189735 14698606 252929 20996 11179 SOD1 ALS ALS 8 2.2 Indeed the GLT-1 transporter which is damaged in ALS is concentrated in astrocytic processes directly abutting motor neurons 55 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189736 14698606 252930 18723 10261 ROS1 ROS ROS 37 0.0 them particularly susceptible to damage or inhibition by motor neuron ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189737 14698606 252931 18723 10261 ROS1 ROS ROS 28 0.0 to excitotoxic activation motor neurons produce particularly large quantities of ROS which can exit the motor neurons and cause oxidation in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189738 14698606 252932 18723 10261 ROS1 ROS ROS 9 0.0 Furthermore experiments using glutamate uptake autoradiography found that the ROS appears able to induce a rapid disruption of glutamate uptake 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189739 14698606 252933 20996 11179 SOD1 ALS ALS 15 2.2 motor neurons are a principal source of ROS in the ALS spinal cord they show intense labeling for nitrotyrosine a marker 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189740 14698606 252933 18723 10261 ROS1 ROS ROS 12 0.0 the idea that motor neurons are a principal source of ROS in the ALS spinal cord they show intense labeling for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189742 14698606 252934 18723 10261 ROS1 ROS ROS 6 0.0 In addition supporting the hypothesis that ROS emanation from motor neurons contributes to loss of astrocytic glutamate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189743 14698606 252936 20996 11179 SOD1 ALS ALS 18 2.2 motor neurons and astrocytes might play a crucial role in ALS pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189744 14698606 252937 20996 11179 SOD1 ALS ALS 17 2.2 of mechanism that might pertain to motor neuron damage in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189745 14698606 252939 18723 10261 ROS1 ROS ROS 38 0.0 2 buffering results in mitochondrial Ca 2 overload and strong ROS generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189746 14698606 252940 20996 11179 SOD1 ALS ALS 23 2.2 towards explaining the oxidative damage and mitochondrial abnormalities observed in ALS motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189747 14698606 252941 20996 11179 SOD1 ALS ALS 13 2.2 compatible with possible apoptotic contributions to motor neuron loss in ALS 58 because mitochondria which contain cytochrome c and other apoptotic 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189748 14698606 252942 20996 11179 SOD1 ALS ALS 7 2.2 Other pathological features of motor neurons in ALS such as the presence of protein aggregates and neurofilamentous abnormalities 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189749 14698606 252942 18723 10261 ROS1 ROS ROS 24 0.0 aggregates and neurofilamentous abnormalities could be a consequence of the ROS generation resulting after oxidative modification of these proteins 53 59 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189750 14698606 252943 18723 10261 ROS1 ROS ROS 9 0.0 The second idea is that it is specifically the ROS generated within motor neurons in response to excitotoxic activation that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189751 14698606 252945 20996 11179 SOD1 ALS ALS 13 2.2 ideas provide the basis for a feedforward cycle contributing to ALS progression as increases in extracellular glutamate concentration will result in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189752 14698606 252945 18723 10261 ROS1 ROS ROS 27 0.0 in extracellular glutamate concentration will result in greater motor neuron ROS generation and more disruption of astrocytic glutamate transport causing further 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189756 14698606 252951 20996 11179 SOD1 ALS ALS 9 2.2 Specifically if such a feedforward cycle is crucial for ALS progression it would lend support the idea that no single 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 189757 14698606 252952 18723 10261 ROS1 ROS ROS 23 0.0 glutamate release activation of Ca-A/K Ca-A K channels mitochondrial disruption ROS generation and transporter damage is likely to provide greater benefit 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 189758 14698606 252953 20996 11179 SOD1 ALS ALS 3 2.2 Satisfactory models of ALS should provide an explanation for the selective vulnerability of motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000895981189262454<>ScoreDetail__5468|IGFALS|0.000255740849272737__11179|SOD1|0.000895981189262454__ 0 0 0 0 0 190795 14739060 254283 6981 22140 FAM20C RNS RNS 19 0.3 reactive oxygen species (ROS) ROS and reactive nitrogen species (RNS) RNS 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190796 14739060 254283 18723 10261 ROS1 ROS ROS 14 0.0 as accountable for redox regulation involving reactive oxygen species (ROS) ROS and reactive nitrogen species (RNS) RNS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190797 14739060 254289 18723 10261 ROS1 ROS ROS 7 0.0 ATP synthesis is responsible for most of ROS and notably the first produced superoxide anion ( 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190798 14739060 254290 20996 11179 SOD1 ALS ALS 35 1.3 Parkinson_amp_#x2019 s disease (PD) PD and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190799 14739060 254290 18723 10261 ROS1 ROS ROS 10 0.0 Mitochondrial dysfunction i.e cell energy impairment apoptosis and overproduction of ROS is a final common pathogenic mechanism in aging and in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190800 14739060 254291 6981 22140 FAM20C RNS RNS 5 0.3 Nitric oxide (NO NO an RNS which can be produced by three isoforms of NO-synthase in 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190801 14739060 254292 20996 11179 SOD1 ALS ALS 9 1.3 The research on the genetics of inherited forms notably ALS AD PD has improved our understanding of the pathobiology of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190802 14739060 254293 6981 22140 FAM20C RNS RNS 2 0.3 ROS and RNS i.e oxidative stress are not the origin of neuronal death 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190803 14739060 254293 18723 10261 ROS1 ROS ROS 0 0.1 ROS and RNS i.e oxidative stress are not the origin of 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190804 14739060 254311 18723 10261 ROS1 ROS ROS 14 0.0 is responsible for most of the reactive oxygen species (ROS) ROS and notably the first produced superoxide anion ( in human 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190805 14739060 254312 18723 10261 ROS1 ROS ROS 14 0.0 1_amp_#x2013 2% of the O 2 consumed is converted to ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190806 14739060 254313 6981 22140 FAM20C RNS RNS 11 0.3 is nitric oxide (NO NO a reactive nitrogen species (RNS) RNS 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190811 14739060 254315 6981 22140 FAM20C RNS RNS 15 0.3 peroxynitrite (ONOO ONOO _amp_#x2013 _amp_#x2013 which is the most reactive RNS 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190812 14739060 254316 6981 22140 FAM20C RNS RNS 2 0.3 ROS and RNS are the cause of oxidative stress in nervous system 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190813 14739060 254316 18723 10261 ROS1 ROS ROS 0 0.1 ROS and RNS are the cause of oxidative stress in nervous 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190816 14739060 254318 18723 10261 ROS1 ROS ROS 4 0.0 The main sources of ROS in inflammatory process are both damaged mitochondria and activated microglia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190817 14739060 254319 6981 22140 FAM20C RNS RNS 15 0.3 as an imbalance between generation and elimination of ROS and RNS 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190818 14739060 254319 18723 10261 ROS1 ROS ROS 13 0.1 is described as an imbalance between generation and elimination of ROS and RNS 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190820 14739060 254321 18723 10261 ROS1 ROS ROS 8 0.0 It is now recognized that redox regulation involving ROS is key to the modulation of critical cellular functions notably 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190821 14739060 254330 6981 22140 FAM20C RNS RNS 2 0.3 ROS and RNS are involved in both apoptosis and excitotoxicity 27 and 28 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190822 14739060 254330 18723 10261 ROS1 ROS ROS 0 0.1 ROS and RNS are involved in both apoptosis and excitotoxicity 27 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190824 14739060 254346 6981 22140 FAM20C RNS RNS 10 0.3 The last three (phospholipase phospholipase A 2 produce ROS and RNS by triggering acide arachidonic cascade 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190825 14739060 254346 18723 10261 ROS1 ROS ROS 8 0.1 The last three (phospholipase phospholipase A 2 produce ROS and RNS by triggering acide arachidonic cascade 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190826 14739060 254361 6981 22140 FAM20C RNS RNS 13 0.3 result in overproduction of proteolytic enzymes lipid peroxidation ROS and RNS formation 33 and in triggering programmed cell death i.e apoptosis 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190827 14739060 254361 18723 10261 ROS1 ROS ROS 11 0.1 intracellular responses result in overproduction of proteolytic enzymes lipid peroxidation ROS and RNS formation 33 and in triggering programmed cell death 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190828 14739060 254366 6981 22140 FAM20C RNS RNS 32 0.3 as that triggered by excitotoxicity _amp_#x2022 elevated levels of ROS_amp_#x2013 RNS 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190831 14739060 254369 18723 10261 ROS1 ROS ROS 4 0.0 When the level of ROS exceeds the capacity of the mitochondria and cell to detoxify 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190833 14739060 254378 20996 11179 SOD1 ALS ALS 46 1.3 neurons obtained by cyclooxygenase 2_amp_#xa0 in transgenic mouse model of ALS 15 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190834 14739060 254380 20996 11179 SOD1 ALS ALS 36 1.3 heterozygote gene diseases for example familial amyotrophic lateral sclerosis (ALS), ALS familial Parkinson_amp_#x2019 s disease (PD), PD familial Alzheimer_amp_#x2019 s disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190835 14739060 254383 20996 11179 SOD1 ALS ALS 0 1.3 ALS a neurodegenerative disease characterized by the degeneration of motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190839 14739060 254384 20996 11179 SOD1 ALS ALS 15 1.3 human mutant SOD1 gene syndrome develops with many features of ALS including specific cell death of motor neurons progressive weakness and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190846 14739060 254392 20996 11179 SOD1 ALS ALS 13 1.3 peripherin is found in neuronal inclusions in patients with sporadic ALS and in transgenic mice with SOD1 mutations 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190850 14739060 254398 20996 11179 SOD1 ALS ALS 12 1.3 of other neurodegenerative diseases with familial and sporadic forms like ALS display numerous similitudes 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 190865 14739060 254464 6981 22140 FAM20C RNS RNS 15 0.3 of aging i.e progressive damage to mtDNA by ROS/RNS ROS RNS 42 and induced changes in redox state of the cell 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190866 14739060 254464 18723 10261 ROS1 ROS ROS 15 0.3 theory of aging i.e progressive damage to mtDNA by ROS/RNS ROS RNS 42 and induced changes in redox state of the 4 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190867 14739060 254468 18723 10261 ROS1 ROS ROS 44 0.0 reflect either decreased mitochondrial biogenesis or turnover secondary to cumulative ROS inflicted mitochondrial damage 11 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 190869 14739060 254479 6981 22140 FAM20C RNS RNS 32 0.3 neurotoxins such as cytokine (TNF, TNF IL1 eicosanoides ROS and RNS 9 and 13 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 190871 14739060 254479 18723 10261 ROS1 ROS ROS 30 0.1 production of neurotoxins such as cytokine (TNF, TNF IL1 eicosanoides ROS and RNS 9 and 13 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 190873 14739060 254490 20996 11179 SOD1 ALS ALS 3 1.3 Animal models for ALS 17 and 19 AD PD 5 and aging brain 35 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00160093311530149<>ScoreDetail__5468|IGFALS|0.000534659909805198__11179|SOD1|0.00160093311530149__ 0 0 0 0 0 182318 15009657 243177 18723 10261 ROS1 ROS ROS 18 0.0 oxidative stress (OS), OS resulting in reactive oxygen species (ROS) ROS generation from H2O2 and inflammatory processes trigger a cascade of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 182319 15009657 243177 20996 11179 SOD1 ALS ALS 51 0.0 (AD) AD and Huntington's diseases and amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000500389948233718<>ScoreDetail__5468|IGFALS|8.93788172203188e-05__11179|SOD1|0.000500389948233718__ 0 0 0 0 0 182320 15009657 243178 18723 10261 ROS1 ROS ROS 14 0.0 aimed at neutralization of OS-induced neurotoxicity support the application of ROS scavengers transition metals (e.g e.g iron and copper chelators and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183135 15031734 244210 20996 11179 SOD1 ALS ALS 14 1.9 AD Parkinson's disease (PD) PD and amyotrophic lateral sclerosis (ALS), ALS are defined by the progressive loss of specific neuronal cell 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183136 15031734 244212 18723 10261 ROS1 ROS ROS 12 3.3 the result of unregulated production of reactive oxygen species (ROS), ROS such as hydrogen peroxide nitric oxide superoxide and the highly 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183137 15031734 244217 6554 3309 ELA2 HNE HNE 12 0.0 to the formation of breakdown products including 4-hydroxy-2 3-nonenal (HNE), HNE acrolein malondialdehyde and F 2 -isoprostanes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183138 15031734 244218 20996 11179 SOD1 ALS ALS 27 1.9 has been observed in the cerebrospinal fluid (CSF) CSF of ALS patients 4 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183139 15031734 244218 6554 3309 ELA2 HNE HNE 1 0.0 Elevated HNE levels have been observed in AD 1 2 and PD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183140 15031734 244218 6554 3309 ELA2 HNE HNE 17 0.0 AD 1 2 and PD 3 brain tissue whereas increased HNE has been observed in the cerebrospinal fluid (CSF) CSF of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183141 15031734 244218 11629 6493 LAMC2 CSF CSF 25 0.1 increased HNE has been observed in the cerebrospinal fluid (CSF) CSF of ALS patients 4 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 183142 15031734 244220 20996 11179 SOD1 ALS ALS 18 1.9 whereas increased TBARs have been observed in the plasma of ALS patients 6 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183145 15031734 244224 18723 10261 ROS1 ROS ROS 2 3.3 How do ROS kill cells 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183146 15031734 244225 18723 10261 ROS1 ROS ROS 4 3.3 As their name suggests ROS are very reactive and will react with a multitude of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183147 15031734 244228 6554 3309 ELA2 HNE HNE 6 0.0 The oxidatively modified lipids acrolein and HNE induce toxicity by crosslinking to cystine lysine and histidine residues 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183149 15031734 244229 6554 3309 ELA2 HNE HNE 14 0.0 uptake of glutamate and glucose from cell culture 12 whereas HNE modifies proteins resulting in a multitude of effects including inhibition 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183152 15031734 244230 6554 3309 ELA2 HNE HNE 0 0.1 HNE activates c-Jun aminoterminal kinases and mitogen-activated protein kinase-1 (also also 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 183153 15031734 244231 18723 10261 ROS1 ROS ROS 16 3.3 of enzymes (for for example glutamine synthase superoxide dismutase whereas ROS interactions with DNA lead to mutations 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183154 15031734 244232 18723 10261 ROS1 ROS ROS 4 3.3 The excessive generation of ROS leads to dysregulation of intracellular calcium signalling and such dysregulation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183155 15031734 244233 18723 10261 ROS1 ROS ROS-induced 11 0.0 of the downstream events that occurs in response to an ROS-induced calcium influx is an excitotoxic response 19 20 that is 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183156 15031734 244234 20996 11179 SOD1 ALS ALS 22 1.9 and stroke as well as the neurodegenerative diseases AD PD ALS and Huntington's disease (reviewed reviewed in Ref 21 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183157 15031734 244235 18723 10261 ROS1 ROS ROS 2 3.3 How are ROS generated 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183158 15031734 244236 18723 10261 ROS1 ROS ROS 3 3.3 The generation of ROS requires the activation of molecular oxygen 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183159 15031734 244239 18723 10261 ROS1 ROS ROS 24 3.3 O 2 and metal ions to activate molecular oxygen as ROS the subsequent free radicals are an intrinsic part of normal 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183160 15031734 244240 18723 10261 ROS1 ROS ROS 1 3.3 As ROS are also toxic cells have developed highly elaborate means of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183161 15031734 244240 18723 10261 ROS1 ROS ROS 21 3.3 of regulating both metal ion interactions and the generation of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183162 15031734 244242 18723 10261 ROS1 ROS ROS 0 3.3 ROS are produced by a number of different pathways including direct 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183163 15031734 244246 18723 10261 ROS1 ROS ROS 11 3.3 example of this is the interplay between calcium signalling and ROS generation although increases in intracellular calcium have been reported to 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183164 15031734 244246 18723 10261 ROS1 ROS ROS 26 3.3 intracellular calcium have been reported to induce the production of ROS 22 at subtoxic levels ROS have been shown to be 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183165 15031734 244246 18723 10261 ROS1 ROS ROS 32 3.3 to induce the production of ROS 22 at subtoxic levels ROS have been shown to be important cell signallers and will 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183166 15031734 244247 18723 10261 ROS1 ROS ROS 21 3.3 disruption of calcium homeostasis is a cause or consequence of ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183167 15031734 244248 18723 10261 ROS1 ROS ROS 11 3.3 a general principle the chemical origin of the majority of ROS is the reaction of molecular oxygen with the redox-active metals 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183168 15031734 244250 18723 10261 ROS1 ROS ROS 11 3.3 unregulated redox-active metals will inappropriately react with oxygen to generate ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183170 15031734 244251 20996 11179 SOD1 ALS ALS 21 1.9 (A A beta in AD alpha-synuclein in PD SOD1 in ALS frataxin in Friedreich's ataxia ( Box 1 and alpha-B-crystallin in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183171 15031734 244254 18723 10261 ROS1 ROS ROS 21 3.3 biometals to foster the release of inappropriate redox activity and ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183177 15031734 244272 11629 6493 LAMC2 CSF CSF 17 0.0 includes a 2.2-times increase in the concentration of Cu in CSF 45 and an accompanying increase of plasma Cu in AD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 183181 15031734 244287 18723 10261 ROS1 ROS ROS 46 3.3 them is redox active 51 and might be important in ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183185 15031734 244315 18723 10261 ROS1 ROS ROS 29 3.3 accumulation of dopamine in the cytoplasm and subsequent generation of ROS through its interaction with iron a process that increases with 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183186 15031734 244323 20996 11179 SOD1 ALS ALS 0 1.9 ALS is distinguished by the loss of the lower motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183187 15031734 244324 20996 11179 SOD1 ALS ALS 5 1.9 Like the other neurodegenerative diseases ALS is characterized by the deposition of a misfolded protein in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183193 15031734 244327 18723 10261 ROS1 ROS ROS 40 3.3 the other proposes that SOD becomes a pro-oxidant protein generating ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183195 15031734 244329 18723 10261 ROS1 ROS ROS 8 3.3 Mutations of SOD a cupro-enzyme that detoxifies the ROS superoxide can convert the protein from an anti-oxidant to a 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183196 15031734 244330 20996 11179 SOD1 ALS ALS 12 1.9 inappropriate metal-mediated redox chemistry is central to the progression of ALS includes the observation that copper chelators inhibit the course of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183203 15031734 244333 20996 11179 SOD1 ALS ALS 14 1.9 Subramaniam 97 crossed CCS knockout mice with an SOD mutant ALS mouse model the phenotype of this cross showed reduced SOD 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183205 15031734 244333 20996 11179 SOD1 ALS ALS 44 1.9 in the active site but the mice still developed the ALS phenotype 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183206 15031734 244334 20996 11179 SOD1 ALS ALS 4 1.9 These results indicate that ALS is not due to a corruption of the active site 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183209 15031734 244336 20996 11179 SOD1 ALS ALS 30 1.9 studies 99 with an H46R mutant SOD linked to familial ALS and which has no SOD activity have shown that a 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183212 15031734 244337 18723 10261 ROS1 ROS ROS 42 3.3 aberrant redox chemistry ( Fig 4 and the generation of ROS and subsequent toxicity remains untested 100 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183213 15031734 244340 18723 10261 ROS1 ROS ROS 7 3.3 Antioxidants are molecules that react preferentially with ROS to inactivate them and have excited great interest because of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183214 15031734 244346 18723 10261 ROS1 ROS ROS 3 3.3 One consequence of ROS generation is the initiation of excitotoxicity this is modulated through 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183215 15031734 244351 20996 11179 SOD1 ALS ALS 9 1.9 Riluzole is the only drug presently used to treat ALS with any proven efficacy _amp_#8212 the effects of Riluzole are 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183216 15031734 244357 18723 10261 ROS1 ROS ROS 12 3.3 effects attained with antioxidants and therapies targeting downstream effects of ROS generation such as those targeting excitotoxicity are not too surprising 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183217 15031734 244358 18723 10261 ROS1 ROS ROS 18 3.3 to be more effective if it targets the origin of ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183218 15031734 244385 20996 11179 SOD1 ALS ALS 19 1.9 with key proteins in the neurodegenerative diseases AD PD and ALS and the subsequent induction of oxidative stress leading to neurodegeneration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000956632653061224<>ScoreDetail__5468|IGFALS|0.000456204379562044__11179|SOD1|0.000956632653061224__ 0 0 0 0 0 183219 15031734 244387 18723 10261 ROS1 ROS ROS 2 3.3 Antioxidants targeting ROS and MPACs targeting the upstream metal-protein interactions that generate ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183220 15031734 244387 18723 10261 ROS1 ROS ROS 12 3.3 ROS and MPACs targeting the upstream metal-protein interactions that generate ROS have shown promise in preliminary clinical studies 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183223 15031734 244397 18723 10261 ROS1 ROS ROS 3 3.3 Figure 1 ROS generation by abnormal reaction of O 2 with protein-bound Fe 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183224 15031734 244400 18723 10261 ROS1 ROS ROS 15 3.3 at a loading site _amp_#8212 will increase the likelihood that ROS are generated inappropriately as illustrated leading to the oxidative stress 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183225 15031734 244401 18723 10261 ROS1 ROS ROS 4 3.3 A beta amyloid-beta ROS reactive oxygen species SOD superoxide dismutase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183227 15031734 244406 18723 10261 ROS1 ROS ROS 13 3.3 pivotal in signal transduction it can induce further production of ROS and elicit an excitotoxicity response 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183228 15031734 244409 18723 10261 ROS1 ROS ROS 4 3.3 Antioxidants deactivate the generated ROS and MPACs seek to inhibit metal interactions with A beta 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183229 15031734 244409 18723 10261 ROS1 ROS ROS 21 3.3 interactions with A beta and prevent the subsequent formation of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183230 15031734 244410 18723 10261 ROS1 ROS ROS 4 3.3 MPACs metal-protein attenuating compound ROS reactive oxygen species 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183231 15031734 244413 18723 10261 ROS1 ROS ROS 44 3.3 formation of neuromelanin (NM) NM and reactive oxygen species (ROS) ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183232 15031734 244414 18723 10261 ROS1 ROS ROS 7 3.3 Neuromelanin will also coordinate Fe and produce ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 183233 15031734 244417 13412 7214 MPHOSPH6 MPP MPP 0 0.0 MPP 1-methyl-4-phenyl pyridine 1 JUMiner_v2.2 1 0 0 2 7225 TotalCon:2<>7214|MPHOSPH6|10200|Complete__7225|MPZ|4359|Complete__<>AvaiableGeneRif=2<>BEST:7225|MPZ|0.000439956797035246<>ScoreDetail__7214|MPHOSPH6|0.000306582506762849__7225|MPZ|0.000439956797035246__ 0 0 0 0 0 183236 15031734 244422 18723 10261 ROS1 ROS ROS 33 3.3 to aberrant redox chemistry and subsequent reactive oxygen species (ROS) ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 177200 15105254 236597 20996 11179 SOD1 ALS ALS 7 0.9 Increased MAOS occurs in amyotrophic lateral sclerosis (ALS) ALS as the result of genetic abnormalities (e.g., e.g. Cu/Zn-superoxide Cu 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000774752820126889<>ScoreDetail__5468|IGFALS|0.000151541939231682__11179|SOD1|0.000774752820126889__ 0 0 0 0 0 177201 15105254 236599 20996 11179 SOD1 ALS ALS 30 0.9 functional outcome in animal models of AD PD HD and ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000774752820126889<>ScoreDetail__5468|IGFALS|0.000151541939231682__11179|SOD1|0.000774752820126889__ 0 0 0 0 0 172853 15266948 231013 18723 10261 ROS1 ROS ROS 21 0.0 greater risk of damage mediated by reactive oxygen species (ROS) ROS resulting in molecular and cellular dysfunction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 172996 15289674 231348 20996 11179 SOD1 ALS ALS-associated 16 2.7 neuronal death in an in vitro co-culture model of familial ALS-associated Cu/Zn Cu Zn superoxide dismutase 11 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00289837185937401<>ScoreDetail__5468|IGFALS|0.000274408649360628__11179|SOD1|0.00289837185937401__ 0 0 0 0 0 172999 15289674 231354 20996 11179 SOD1 SOD1 SOD1 12 2.7 vitro disease model confirmed the extracellular toxicity of the mutant SOD1 cells on the adjacent neurons by generating oxidative stress 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 166644 15480846 223891 18723 10261 ROS1 ROS ROS 15 0.0 initiate oxidative stress via generation of reactive oxygen species (ROS), ROS such as hydroxyl radical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 166653 15480846 223905 16315 30012 PDF PDF PDF 2 0.3 Contribution in PDF 1 JUMiner_v2.2 1 2 UserEdit 0 2 30012 TotalCon:3<>30012|PDF|64146|Complete__30142|GDF15|9518|Complete__8866|PFDN1|5201|Complete__<>AvaiableGeneRif=3<>BEST:30012|PDF|0.000922849760059062<>ScoreDetail__8866|PFDN1|0.000344530577088717__30142|GDF15|0.000259680304691558__30012|PDF|0.000922849760059062__ 1 1 0 0 0 160367 15535033 214700 20996 11179 SOD1 ALS ALS 12 0.0 proteins in the spinal cord in amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 160368 15535033 214701 20996 11179 SOD1 ALS ALS 3 0.0 Amyotrophic lateral sclerosis (ALS) ALS is a neurodegenerative disease which has been linked to the 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 160369 15535033 214702 20996 11179 SOD1 ALS ALS 17 0.0 suggested to be a contributory factor to neuronal death in ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 160370 15535033 214704 20996 11179 SOD1 ALS ALS 9 0.0 The material consisted of spinal cords of 8 sporadic ALS cases and 5 controls 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 160371 15535033 214706 19573 10691 SDS SDS SDS-polyacrylamide 5 0.0 Afterwards proteins were separated by SDS-polyacrylamide gel electrophoresis and the protein bound DNPH moieties were detected 11 JUMiner_v2.2 1 0 0 2 10691 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:10691|SDS|0.00116959064327485<>ScoreDetail__10691|SDS|0.00116959064327485__19440|SBDS|0.000411827691293963__ 0 0 0 0 0 160372 15535033 214708 20996 11179 SOD1 ALS ALS 6 0.0 The protein carbonyl content of the ALS spinal cords significantly increased in all examined cases 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 160373 15535033 214709 20996 11179 SOD1 ALS ALS 2 0.0 In most ALS patients proteins with 125 kDa 70 kDa and 36kDa were 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 160374 15535033 214711 20996 11179 SOD1 ALS ALS 4 0.0 The morphological examination of ALS spinal cords indicated a pronounced anti-DNPH immune reaction in neurones 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 160375 15535033 214714 20996 11179 SOD1 ALS ALS 14 0.0 successfully examined the neurochemical features accompanying motor neuron injury in ALS and the results may help to develop a rationale anti-oxidative 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124230571941523<>ScoreDetail__5468|IGFALS|0.000638686131386861__11179|SOD1|0.00124230571941523__ 0 0 0 0 0 151460 15812313 199890 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is an adult-onset neurodegenerative disease that is characterized by a 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00175123126780039<>ScoreDetail__5468|IGFALS|0.000428007912362488__11179|SOD1|0.00175123126780039__ 0 0 0 0 0 151462 15812313 199891 20996 11179 SOD1 ALS ALS 17 2.2 SOD1 gene is known to be associated with the familial ALS (FALS) FALS because of some undefined property of mutant SOD1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00175123126780039<>ScoreDetail__5468|IGFALS|0.000428007912362488__11179|SOD1|0.00175123126780039__ 0 0 0 0 0 151481 15812313 199909 6895 3530 F12 F12 F-12 30 0.0 USA were maintained in Dulbecco_amp_#39 s modified Eagles_amp_#39 s medium_amp_#47 F-12 growth medium (Gibco, Gibco Grand Island New York USA containing 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151490 15812313 199936 20996 11179 SOD1 SOD1 SOD1 5 3.2 However the death of mutant SOD1 cells was significantly attenuated by trolox Z-VAD-FMK and calpeptin ( 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 151492 15812313 199940 20996 11179 SOD1 SOD1 SOD1 5 3.2 The fluorescence staining of mutant SOD1 cells using Hoechst 33342 dye also showed a reduction in 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 151493 15812313 199942 18723 10261 ROS1 ROS ROS 10 0.0 2_amp_#43 treatment was found to increase reactive oxygen species (ROS) ROS in both WT and mutant cells whereas cotreatment with 4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151494 15812313 199942 18723 10261 ROS1 ROS ROS 36 0.0 Cu 2_amp_#43 significantly reduced this Cu 2_amp_#43 -induced increase in ROS only in mutant cells ( Fig 3a and b 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151495 15812313 199945 20996 11179 SOD1 SOD1 SOD1 35 3.2 both convert hydrogen peroxide to oxygen and water protected mutant SOD1 cells from Cu 2_amp_#43 toxicity 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 151497 15812313 199947 18723 10261 ROS1 ROS ROS 43 0.0 effects of this Cu 2_amp_#43 by inhibiting a build-up of ROS and thus apoptotic cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151500 15812313 199954 20996 11179 SOD1 SOD1 SOD1 22 3.2 and calpain and the formation of hydroxyl radicals in mutant SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 151501 15812313 199958 20996 11179 SOD1 SOD1 SOD1 15 3.2 we found that only pyruvate attenuates the death of mutant SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 151502 15812313 199959 20996 11179 SOD1 SOD1 SOD1 17 3.2 may be related to the depletion of pyruvate in mutant SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 151503 15812313 199960 20996 11179 SOD1 ALS ALS 11 2.2 metabolism impairment has previously been reported in neurodegenerative diseases including ALS Huntington_amp_#39 s or Alzheimer_amp_#39 s diseases _amp_#91 12 _amp_#93 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00175123126780039<>ScoreDetail__5468|IGFALS|0.000428007912362488__11179|SOD1|0.00175123126780039__ 0 0 0 0 0 151505 15812313 199966 20996 11179 SOD1 SOD1 SOD1 18 3.2 2_amp_#43 -induced ROS formation and apoptotic cell death in mutant SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 151506 15812313 199966 18723 10261 ROS1 ROS ROS 10 0.0 In addition we found that pyruvate reduces Cu 2_amp_#43 -induced ROS formation and apoptotic cell death in mutant SOD1 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 151508 15812313 199970 20996 11179 SOD1 ALS ALS 26 2.2 our findings suggest that pyruvate may have therapeutic benefits in ALS pathologies involving Cu 2_amp_#43 -induced toxicity 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00175123126780039<>ScoreDetail__5468|IGFALS|0.000428007912362488__11179|SOD1|0.00175123126780039__ 0 0 0 0 0 153883 15850589 203863 20996 11179 SOD1 SOD1 SOD1 30 5.7 was significantly higher in living G93ASOD1 cells compared to wt SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 153885 15850589 203870 20996 11179 SOD1 ALS ALS 3 2.4 Amyotrophic lateral sclerosis (ALS) ALS is an adult-onset neurodegenerative disease with a very poor prognosis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0011578060308504<>ScoreDetail__5468|IGFALS|0.000250260688216893__11179|SOD1|0.0011578060308504__ 0 0 0 0 0 153886 15850589 203873 20996 11179 SOD1 ALS ALS 2 2.4 Treatments for ALS tested in clinical trials to date have proved largely ineffective 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0011578060308504<>ScoreDetail__5468|IGFALS|0.000250260688216893__11179|SOD1|0.0011578060308504__ 0 0 0 0 0 153887 15850589 203874 20996 11179 SOD1 ALS ALS 0 2.4 ALS is usually sporadic (SALS), SALS but approximately 10% of cases 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0011578060308504<>ScoreDetail__5468|IGFALS|0.000250260688216893__11179|SOD1|0.0011578060308504__ 0 0 0 0 0 153902 15850589 203891 18723 10261 ROS1 ROS ROS 26 0.0 the human disease can cause motor neuron death with increased ROS formation and a decrease in mitochondrial membrane potential (MMP) MMP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153904 15850589 203898 7361 20442 FBRS FBS FBS 12 0.0 maintained in DMEM (Biochrom, Biochrom Berlin Germany with 5% heat-inactivated FBS (defined defined FBS Hyclone Logan Utah 1 mM glutamine and 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 153905 15850589 203898 7361 20442 FBRS FBS FBS 14 0.0 (Biochrom, Biochrom Berlin Germany with 5% heat-inactivated FBS (defined defined FBS Hyclone Logan Utah 1 mM glutamine and antibiotics (100 100 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 153909 15850589 203902 7361 20442 FBRS FBS FBS 23 0.0 medium (0.5 0.5 mg/mL mg mL of G-418 containing 5% FBS 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 153911 15850589 203905 19573 10691 SDS SDS SDS 0 0.0 SDS PAGE and Western blotting of SOD1 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000431905855939419<>ScoreDetail__10691|SDS|0.000168861870989531__19440|SBDS|0.000431905855939419__ 0 0 0 0 0 153912 15850589 203907 6603 3331 EMD EMD EMD 15 0.0 superoxide dismutase (Cu/Zn) Cu Zn antibody (1:1000; 1 1000 Calbiochem EMD Biosciences Inc La Jolla CA USA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153914 15850589 203910 951 644 AR AIS AIS 9 0.0 Films were scanned and band intensities obtained by an AIS Image Analyzer (Imaging Imaging Research Inc. Ontario Canada 1 JUMiner_v2.2 1 0 0 2 15979 TotalCon:2<>644|AR|367|Complete__15979|TP63|8626|Complete__<>AvaiableGeneRif=2<>BEST:15979|TP63|0.000706588244582166<>ScoreDetail__15979|TP63|0.000706588244582166__644|AR|0.00055126884276987__ 0 0 0 0 0 153917 15850589 203919 18723 10261 ROS1 ROS ROS 6 0.0 Measurement of viability reactive oxygen species (ROS) ROS and mitochondrial membrane potential (MMP) MMP by flow cytometry 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153918 15850589 203932 18723 10261 ROS1 ROS ROS 1 0.0 Intracellular ROS were measured with 2_amp_#x2032 7_amp_#x2032 -dichlorodihydrofluorescein diacetate (H H 2 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153927 15850589 203960 18723 10261 ROS1 ROS ROS 8 0.0 Effect of G93ASOD1 on cell proliferation and viability ROS formation and MMP of motor neuron-like NSC-34 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153928 15850589 203970 18723 10261 ROS1 ROS ROS 26 0.0 transfected with the mutant protein had a different level of ROS an effector of cell death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153932 15850589 203974 20996 11179 SOD1 SOD1 SOD1 22 5.7 the G93ASOD1 cells while it was lower in the wt SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 153934 15850589 203977 18723 10261 ROS1 ROS ROS 6 0.0 A cell death pathway mediated by ROS might involve some alteration of MMP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153938 15850589 203989 7361 20442 FBRS FBS FBS 7 0.0 Growth in a culture medium not containing FBS for 3 days limited the MTT reduction in NSC-34 expressing 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 153940 15850589 203996 20996 11179 SOD1 SOD1 SOD1 10 5.7 NaB did not affect MTT conversion of untransfected or wt SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 153941 15850589 203999 20996 11179 SOD1 ALS ALS 0 2.4 ALS is a pathology of motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0011578060308504<>ScoreDetail__5468|IGFALS|0.000250260688216893__11179|SOD1|0.0011578060308504__ 0 0 0 0 0 153950 15850589 204011 18723 10261 ROS1 ROS ROS 6 0.0 One such event is the enhanced ROS formation in cells containing mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153952 15850589 204012 18723 10261 ROS1 ROS ROS 18 0.0 SOD1 might in fact afford protection since it lowered intracellular ROS even in comparison with untransfected NSC-34 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153953 15850589 204013 18723 10261 ROS1 ROS ROS 1 0.0 Enhanced ROS formation might come from the _amp_#x201c gain of function_amp_#x201d attributed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153954 15850589 204014 20996 11179 SOD1 ALS ALS 37 2.4 in vivo it could activate neuro-inflammatory processes also documented in ALS (for for a review see Ref 22 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0011578060308504<>ScoreDetail__5468|IGFALS|0.000250260688216893__11179|SOD1|0.0011578060308504__ 0 0 0 0 0 153955 15850589 204014 18723 10261 ROS1 ROS ROS 4 0.0 The higher production of ROS might directly damage the motor neuron cells in which they 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153957 15850589 204018 18723 10261 ROS1 ROS ROS 7 0.0 Together with the reduced viability and increased ROS formation in G93ASOD1 cells this initial permeabilization might be the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153963 15850589 204025 20996 11179 SOD1 ALS ALS 20 2.4 observed in motor nerve terminals 28 and liver 29 of ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0011578060308504<>ScoreDetail__5468|IGFALS|0.000250260688216893__11179|SOD1|0.0011578060308504__ 0 0 0 0 0 153965 15850589 204029 18723 10261 ROS1 ROS ROS 9 0.0 Rotenone a specific mitochondrial complex I inhibitor boosts mitochondrial ROS production 30 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153966 15850589 204031 18723 10261 ROS1 ROS ROS 3 0.0 EA increases intracellular ROS and causes mitochondrial dysfunction and death in NSC-34 cells 17 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153969 15850589 204033 18723 10261 ROS1 ROS ROS 8 0.0 ETC components can be inactivated by exposure to ROS or to peroxynitrite 33 and 34 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153970 15850589 204034 18723 10261 ROS1 ROS ROS 5 0.0 ETC impairment could cause further ROS production and oxidative damage setting up a vicious circle with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153971 15850589 204036 20996 11179 SOD1 ALS ALS 3 2.4 Also relevant to ALS is the notion that mitochondrial dysfunction increases the sensitivity of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0011578060308504<>ScoreDetail__5468|IGFALS|0.000250260688216893__11179|SOD1|0.0011578060308504__ 0 0 0 0 0 153973 15850589 204038 18723 10261 ROS1 ROS ROS 12 0.0 did not investigate the intracellular source of the excess of ROS in viable G93ASOD1 cells although it is tempting to speculate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153974 15850589 204039 18723 10261 ROS1 ROS ROS 15 0.0 ETC these organelles are considered the main source of intracellular ROS including superoxide 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153979 15850589 204043 18723 10261 ROS1 ROS ROS 12 0.0 shows that overexpression of wt SOD1 did indeed reduce the ROS level in viable motor neurons while the opposite effect was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153980 15850589 204044 18723 10261 ROS1 ROS ROS 8 0.0 Assuming that mitochondria were the main source of ROS the increased ROS formation in G93ASOD1 mitochondria is one possible 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153981 15850589 204044 18723 10261 ROS1 ROS ROS 11 0.0 that mitochondria were the main source of ROS the increased ROS formation in G93ASOD1 mitochondria is one possible mechanism through which 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153993 15850589 204062 18723 10261 ROS1 ROS ROS 6 0.0 Fig 3._amp_#xa0 Effect of G93ASOD1 on cellular ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153994 15850589 204063 18723 10261 ROS1 ROS ROS 11 0.0 5 days in culture without any change of medium intracellular ROS were measured from the conversion of H 2 DCFDA to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 153995 15850589 204074 7361 20442 FBRS FBS FBS 14 0.0 and transfected NSC-34 cells was evaluated in cells grown without FBS (Panel Panel A or after exposure to 100 _amp_#x3bc M 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 142717 15863242 187980 20996 11179 SOD1 ALS ALS 19 1.7 syndrome (trisomy trisomy 21 and familial amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000845010227974227<>ScoreDetail__5468|IGFALS|0.000599878681251777__11179|SOD1|0.000845010227974227__ 0 0 0 0 0 142733 15863242 188037 15911 8524 OVGP1 OGP OGP 24 0.0 (consisting consisting of 5 mM octyl _amp_#x3b2 -d -glucopyranoside (OGP) OGP and 10 mM ammonium bicarbonate and incubated for 4 h 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142734 15863242 188038 6883 3541 F3 TFA TFA 9 0.0 Peptide extraction was performed with 10 _amp_#x3bc l of 1% TFA in 5 mM OGP and directly applied onto a target 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142735 15863242 188038 15911 8524 OVGP1 OGP OGP 13 0.0 with 10 _amp_#x3bc l of 1% TFA in 5 mM OGP and directly applied onto a target (AnchorChip_amp_#x2122;, AnchorChip_amp_#x2122 Bruker Daltonics 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142736 15863242 188039 7509 13506 FEZF2 TOF TOF 10 0.0 mass spectrometer used in this work was an Ultraflex_amp_#x2122 TOF/TOF TOF TOF (Bruker Bruker Daltonics Germany operated in the reflector mode 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142737 15863242 188039 7509 13506 FEZF2 TOF TOF 10 0.0 spectrometer used in this work was an Ultraflex_amp_#x2122 TOF/TOF TOF TOF (Bruker Bruker Daltonics Germany operated in the reflector mode 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 142753 15863242 188086 2578 23512 C10orf28 PSORT PSORT 9 1.3 Putative cellular localizations of hypothetical proteins were determined by PSORT II using of k-nearest neighbor (k-NN) k-NN algorithm for assessing 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 142761 15863242 188099 18723 10261 ROS1 ROS ROS 10 0.0 underlying cause may be activation of reactive oxygen species (ROS) ROS with subsequent oxidation and modification of transcription neurodegeneration per se 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144556 15896810 189879 6981 22140 FAM20C RNS RNS 38 0.6 species (ROS) ROS and/or and or reactive nitrogen species (RNS) RNS associated with mitochondrial dysfunction 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144557 15896810 189879 18723 10261 ROS1 ROS ROS 33 0.0 sclerosis may involve the generation of reactive oxygen species (ROS) ROS and/or and or reactive nitrogen species (RNS) RNS associated with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144560 15896810 189884 18723 10261 ROS1 ROS ROS 7 0.0 Recent evidence suggests that frataxin might detoxify ROS via activation of glutathione peroxidase and elevation of thiols and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144565 15896810 189890 20996 11179 SOD1 ALS ALS 13 1.4 (AD), AD Parkinson's disease (PD), PD amyotrophic lateral sclerosis (ALS), ALS multiple sclerosis (MS), MS Huntington's disease (HD) HD and FRDA 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000583925481347638<>ScoreDetail__5468|IGFALS|0.000392536404970433__11179|SOD1|0.000583925481347638__ 0 0 0 0 0 144570 15896810 189897 20996 11179 SOD1 ALS ALS 15 1.4 mitochondrial involvement in neurodegenerative diseases including Alzheimer's and Parkinson's diseases ALS MS and FRDA 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000583925481347638<>ScoreDetail__5468|IGFALS|0.000392536404970433__11179|SOD1|0.000583925481347638__ 0 0 0 0 0 144582 15896810 189917 18723 10261 ROS1 ROS ROS 10 0.0 There is now evidence to suggest that frataxin might detoxify ROS via activation of glutathione peroxidase and elevation of thiols 10 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144588 15896810 189927 8012 4065 GAA GAA GAA 9 0.3 The causative mutation of FRDA is an abnormally expanded GAA triplet repeat in the first intron of the FRDA gene 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144591 15896810 189928 8012 4065 GAA GAA GAA 9 0.3 Ninety-eight percent of FRDA patients are homozygous for the GAA expansion the remainder carrying a repeat expansion in one FRDA 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144593 15896810 189929 8012 4065 GAA GAA GAA 4 0.3 The size of the GAA expansion in FRDA patients ranges from about 100 repeats to 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144596 15896810 189930 8012 4065 GAA GAA GAA 16 0.3 signs in FRDA is dependent upon the length of the GAA repeat expansion in the smaller allele 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144597 15896810 189931 8012 4065 GAA GAA GAA 24 0.3 of progression of the disease positively with the number of GAA repeats in the smaller allele 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144598 15896810 189932 8012 4065 GAA GAA GAA 13 0.3 severity of hypertrophic cardiomyopathy increases with the size of the GAA expansion in the smaller allele 12 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144600 15896810 189933 8012 4065 GAA GAA GAA 6 0.3 Mutations in the FRDA gene either GAA expansions or point mutations result in reduced expression of a 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144603 15896810 189935 8012 4065 GAA GAA GAA 15 0.3 in lymphoblastoid cell lines from FRDA patients correlates with the GAA expansion size in the smaller allele 16 and likely represents 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144604 15896810 189935 8012 4065 GAA GAA GAA 33 0.3 and likely represents the molecular basis of the relationship between GAA expansion size and phenotypic expression of the disease 12 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144605 15896810 189938 6981 22140 FAM20C RNS RNS 36 0.6 of reactive oxygen species (ROS), ROS reactive nitrogen species (RNS) RNS and mitochondrial dysfunction 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144606 15896810 189938 18723 10261 ROS1 ROS ROS 32 0.0 sclerosis may involve the generation of reactive oxygen species (ROS), ROS reactive nitrogen species (RNS) RNS and mitochondrial dysfunction 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144607 15896810 189940 18723 10261 ROS1 ROS ROS 25 0.0 10-fold increase in iron within the mitochondria along with increased ROS production 17 and 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144610 15896810 189944 18723 10261 ROS1 ROS ROS 7 0.0 Recent evidence suggests that frataxin might detoxify ROS via activation of glutathione peroxidase and elevation of thiols 10 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144611 15896810 189945 18723 10261 ROS1 ROS ROS 28 0.0 thiols thereby reducing the incidence of malignant transformation induced by ROS as observed by soft agar assays and tumour formation in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144617 15896810 189954 8012 4065 GAA GAA GAA 15 0.3 of wild type frataxin levels by virtue of a (GAA) GAA 230 expansion inserted in the first intron of the mouse 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144619 15896810 189959 24185 29175 WDTC1 ADP ADP 3 0.0 Free (metabolically metabolically active ADP the major regulator of the oxidative phosphorylation can be calculated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144627 15896810 189969 8012 4065 GAA GAA GAA 23 0.3 synthesis rate was strongly dependent on the size of the GAA repeats in the smaller allele the higher the number of 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144628 15896810 189969 8012 4065 GAA GAA GAA 34 0.3 repeats in the smaller allele the higher the number of GAA repeats the lower the mitochondrial ATP synthesis rate 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144629 15896810 189970 8012 4065 GAA GAA GAA 6 0.3 This is compelling evidence that the GAA expansion is the cause of the mitochondrial deficit and suggests 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144630 15896810 189971 8012 4065 GAA GAA GAA 4 0.3 The length of the GAA expansion has been shown to determine the amount of frataxin 3 JUMiner_v2.2 1 2 gaa triplet 0 0 0 0 0 0 0 0 144632 15896810 190043 8306 4268 GIF INF INF-_amp_#x3b3 1 0.0 Cytokines (INF-_amp_#x3b3;) INF-_amp_#x3b3 which are present in normal brain are elevated in numerous 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144647 15896810 190057 17461 9508 PSEN1 FAD FAD 26 0.3 depends also on cofactors such as tetrahydrobiopterin (BH BH 4 FAD FMN and NADPH 92 1 JUMiner_v2.2 1 2 nadph 0 2 3585 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:3585|FANCD2|0.00060856279987548<>ScoreDetail__1101|BRCA2|0.000299281490752651__9508|PSEN1|0.000575250281324742__3585|FANCD2|0.00060856279987548__ 0 0 0 0 0 144656 15896810 190062 16440 8884 PGA PGA PGA 14 0.3 drugs (dexamethasone), dexamethasone inhibitory cytokines (interleukin-4, interleukin-4 interleukin-10 prostaglandins (PGA PGA 2 tissue growth factors or inhibitors of protein synthesis e.g. 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144666 15896810 190111 18723 10261 ROS1 ROS ROS 9 0.0 Glutathione is the predominant defense against reactive oxygen species (ROS), ROS which are reduced by GSH in the presence of GSH 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144667 15896810 190118 18723 10261 ROS1 ROS ROS 5 0.0 In addition to protection against ROS glutathione is an excellent scavenger of lipid peroxidation products such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144668 15896810 190118 6554 3309 ELA2 HNE HNE 17 0.0 is an excellent scavenger of lipid peroxidation products such as HNE and acrolein both of which have been found to bind 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144669 15896810 190126 6554 3309 ELA2 HNE HNE 30 0.0 peroxynitrite and reactive aldehydic products of lipid peroxidation 4-hydroxy-2-nonenal (HNE) HNE or 2-propenal (acrolein) acrolein 119 120 121 122 and 123 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144670 15896810 190127 6554 3309 ELA2 HNE HNE 0 0.0 HNE and acrolein are increased in AD brain 124 and 125 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144671 15896810 190127 6554 3309 ELA2 HNE HNE 13 0.0 acrolein are increased in AD brain 124 and 125 and HNE is covalently bound in excess to the glutamate transporter in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144690 15896810 190149 10463 6018 IL6 HSF HSFs 7 0.6 These denaturated proteins activate heat shock factors (HSFs) HSFs within the cytosol by dissociating other HSPs that are normally 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144692 15896810 190149 10463 6018 IL6 HSF HSF 20 0.6 cytosol by dissociating other HSPs that are normally bound to HSF 132 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144693 15896810 190150 10463 6018 IL6 HSF HSF 1 0.6 Freed HSF is phosphorylated and forms trimers which enter the nucleus and 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144694 15896810 190150 9652 23316 HSD17B6 HSE HSE 17 0.3 enter the nucleus and bind to heat shock elements (HSE) HSE within the promoters of different heat shock genes leading to 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144712 15896810 190167 1495 937 BAG1 BAG1 BAG-1 10 0.0 In addition HSP70 binds to and modulates the function of BAG-1 the bcl-2 binding protein 142 thus modulating some type of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 144720 15896810 190174 10463 6018 IL6 HSF HSFs 16 0.6 chaperoning of proteins degraded in proteasomes which include NFKB cyclins HSFs hypoxia-inducible factor some apoptosis-related proteins tumor necrosis factor and erythropoietin 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144744 15896810 190205 20455 14011 SMC2 CAPE CAPE 15 1.3 astroglial cells the role of caffeic acid phenylethyl ester (CAPE), CAPE an active component of propolis as a novel HO-1 inducer 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144746 15896810 190206 20455 14011 SMC2 CAPE CAPE 3 1.3 The similarity of CAPE to curcumin is striking because CAPE is also a Michael 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 144747 15896810 190206 20455 14011 SMC2 CAPE CAPE 9 1.3 The similarity of CAPE to curcumin is striking because CAPE is also a Michael reaction acceptor endowed with anti-inflammatory antioxidant 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 147176 15964487 194014 20996 11179 SOD1 ALS ALS 12 1.4 AD Parkinson (PD) PD diseases and amyotrophic lateral sclerosis (ALS), ALS are one of the main causes of death in Western 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000456571993222906<>ScoreDetail__5468|IGFALS|0.000248253897132062__11179|SOD1|0.000456571993222906__ 0 0 0 0 0 147178 15964487 194017 17686 9683 PTPRU PTP PTP 6 0.3 Opening of a permeability transition pore (PTP) PTP leads to mitochondrial swelling and the release of intramitochondrial proteins 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147179 15964487 194018 17686 9683 PTPRU PTP PTP 7 0.3 Indeed drugs with the ability to block PTP formation are cytoprotective against a variety of toxic stimuli ( 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147180 15964487 194019 17686 9683 PTPRU PTP PTP 21 0.3 membrane potential (_amp_#x394;_amp_#x3c8;m), _amp_#x394 _amp_#x3c8 m the opening of the PTP and the release of proapoptotic factors ( Kristal and Dubinsky 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147184 15964487 194059 17686 9683 PTPRU PTP PTP 0 0.3 PTP activity 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147185 15964487 194060 17686 9683 PTPRU PTP PTP 0 0.3 PTP opening was assayed spectrophotometrically as previously described ( Kristal et 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147186 15964487 194062 17686 9683 PTPRU PTP PTP 13 0.3 at 540nm (A A 540 indicating mitochondrial swelling due to PTP opening were followed after addition of different compounds using a 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147187 15964487 194090 8255 4236 GFER HPO HPO 17 0.0 were resuspended in media containing 125mM KCl 2mM K 2 HPO 4 1mM MgCl 2 20mM HEPES 5_amp_#x3bc M EGTA 1_amp_#x3bc 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 147188 15964487 194103 17686 9683 PTPRU PTP PTP 13 0.3 in cellular death programs associated to some pathological situations is PTP formation ( Hirsch et al. 1998 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147189 15964487 194104 20247 20116 SLC25A29 CACL CaCl 19 1.3 swelling by following 540nm absorbance (A A 540 decrease using CaCl 2 and KO 2 as inductors 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 147190 15964487 194119 17686 9683 PTPRU PTP PTP 17 0.3 of cytoplasmic free Ca 2 levels ( Skulachev 1999 and PTP is triggered by intramitochondrial Ca 2 accumulation we were interested 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147191 15964487 194120 20247 20116 SLC25A29 CACL CaCl 33 1.3 2 from media following the addition of known pulses of CaCl 2 using Calcium Green-5N fluorescence tracing 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 147192 15964487 194121 20247 20116 SLC25A29 CACL CaCl 4 1.3 A fixed amount of CaCl 2 (4nmol) 4nmol was added repeatedly every 60 s until 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 147193 15964487 194143 17686 9683 PTPRU PTP PTP 7 0.3 Mitochondrial swelling might be a consequence of PTP formation which leads to a massive water influx into mitochondria 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147194 15964487 194145 17686 9683 PTPRU PTP PTP 6 0.3 In fact drugs able to block PTP formation afford complete or partial neuroprotection against a broad type 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147195 15964487 194153 22000 11730 TERT TERT tert 20 0.0 where minocycline has distinct mechanisms of action against oxidative ( tert -butyl hydroperoxide phenylarsine oxide and nonoxidative (Ca/Pi, Ca Pi t-Bid 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 147197 15964487 194174 17686 9683 PTPRU PTP PTP 17 0.3 dissipation and blocking both mitochondrial Ca 2 accumulation and subsequent PTP opening 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147198 15964487 194175 17686 9683 PTPRU PTP PTP 1 0.3 Since PTP might play a key role in the development of a 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9951 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9951|REG1A|0.000357540123947243<>ScoreDetail__9951|REG1A|0.000357540123947243__9683|PTPRU|0.000257334019557386__ 0 0 0 0 0 147199 15964487 194185 20247 20116 SLC25A29 CACL CaCl 16 1.3 A 540 indicating mitochondrial swelling were followed after addition of CaCl 2 (75_amp_#x3bc;M, 75_amp_#x3bc M panel A and KO 2 (5_amp_#x3bc;M, 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 147200 15964487 194186 9701 5244 HSPA9 CSA CsA 19 0.3 Red (RR, RR 5 _amp_#x3bc M and cyclosporin A (CsA, CsA 10 _amp_#x3bc M was measured 14 JUMiner_v2.2 1 2 UserEdit 0 2 5244 TotalCon:3<>3439|ERCC8|1161|Complete__2440|CSH1|1442|Complete__5244|HSPA9|3313|Complete__<>AvaiableGeneRif=3<>BEST:5244|HSPA9|0.000505687193139817<>ScoreDetail__3439|ERCC8|0.000220871142763688__2440|CSH1|0.000339353719693828__5244|HSPA9|0.000505687193139817__ 1 1 0 0 0 147201 15964487 194193 20247 20116 SLC25A29 CACL CaCl 3 1.3 Pulses of 4nmol CaCl 2 (100_amp_#x3bc;M) 100_amp_#x3bc M were added every 60 s 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 136102 16026864 180215 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is a neurodegenerative disease clinically characterized by progressive loss of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136103 16026864 180216 20996 11179 SOD1 ALS ALS 0 2.2 ALS is sporadic in 90% of cases the remaining 10% are 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136105 16026864 180217 20996 11179 SOD1 ALS ALS 14 2.2 apparent differences in onset or progression of sporadic and familial ALS which has led researchers to hypothesize that the two forms 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136106 16026864 180218 20996 11179 SOD1 ALS ALS 9 2.2 Corresponding to the clinical picture the characteristic hallmark of ALS pathology is the progressive and highly selective loss of cortical 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136107 16026864 180220 18723 10261 ROS1 ROS ROS 17 0.0 including glutamate excitotoxicity 2 production of reactive oxygen species (ROS) ROS 3 Ca 2 -dependent formation of protein aggregates 4 axonal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136108 16026864 180222 20996 11179 SOD1 ALS ALS 5 2.2 Increasing evidence also suggests that ALS pathogenesis is not confined to motoneurons but rather develops as 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136109 16026864 180223 20996 11179 SOD1 ALS ALS 9 2.2 According to the selective pattern of motoneuron loss in ALS it is generally believed that unique properties of affected motoneurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136110 16026864 180223 20996 11179 SOD1 ALS ALS-associated 26 2.2 properties of affected motoneurons are responsible for their vulnerability during ALS-associated injury 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136112 16026864 180225 20996 11179 SOD1 ALS ALS 31 2.2 will also address their involvement during pathological states such as ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136113 16026864 180226 18723 10261 ROS1 ROS ROS 15 0.0 integrative hypothesis for the role of Ca 2 mitochondria and ROS in selective motoneuron vulnerability 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136114 16026864 180231 20996 11179 SOD1 ALS ALS 11 2.2 of the cellular and molecular event initiating motoneuron degeneration in ALS disruption of intracellular Ca 2 homeostasis is thought to have 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136115 16026864 180232 20996 11179 SOD1 ALS ALS 30 2.2 and parvalbumin were absent in motoneuron populations lost early in ALS (cortical, cortical spinal and lower cranial nerve motoneurons whereas motoneurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136116 16026864 180235 20996 11179 SOD1 ALS ALS 14 2.2 Ca 2 homeostasis ultimately lead to degeneration of motoneurons in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136117 16026864 180237 20996 11179 SOD1 ALS ALS 23 2.2 strategy that has proven beneficial in slowing disease progression in ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136118 16026864 180238 20996 11179 SOD1 ALS ALS 7 2.2 The presumed mechanisms of glutamate-mediated toxicity in ALS have been reviewed recently and are therefore only briefly outlined 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136120 16026864 180240 20996 11179 SOD1 ALS ALS-resistant 35 2.2 2 concentration ([Ca Ca 2 i in motoneurons than in ALS-resistant neurons 23 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136121 16026864 180242 20996 11179 SOD1 ALS ALS 6 2.2 For the well-studied familial form of ALS induced by mutant SOD1 the involvement of Ca 2 has 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136124 16026864 180243 20996 11179 SOD1 ALS ALS 38 2.2 homeostasis by excitotoxic mechanisms similar to those proposed for sporadic ALS 27 and 28 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136126 16026864 180244 20996 11179 SOD1 ALS ALS 17 2.2 importance of Ca 2 -permeable AMPA receptors in mutant SOD1-related ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136131 16026864 180250 20996 11179 SOD1 ALS ALS 7 2.2 In both sporadic and familial forms of ALS there is increasing evidence for crucial involvement of mitochondria 30 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136132 16026864 180251 20996 11179 SOD1 ALS ALS 22 2.2 swelling as some of the earliest signs of pathology in ALS mouse models and in human ALS 32 33 and 34 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136133 16026864 180251 20996 11179 SOD1 ALS ALS 28 2.2 signs of pathology in ALS mouse models and in human ALS 32 33 and 34 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136134 16026864 180252 20996 11179 SOD1 ALS ALS 20 2.2 but were also detected in muscle and liver biopsies from ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136135 16026864 180253 18723 10261 ROS1 ROS ROS 20 0.0 altered activity of the respiratory chain and increased production of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136136 16026864 180254 20996 11179 SOD1 ALS ALS 2 2.2 In sporadic ALS altered electron transport chain activity most often a decrease in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136137 16026864 180255 20996 11179 SOD1 ALS ALS 23 2.2 in cell function has been addressed by transferring mtDNA from ALS subjects to mtDNA-depleted human neuroblastoma cells 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136138 16026864 180256 20996 11179 SOD1 ALS ALS 33 2.2 a pathological role for mtDNA mutations in some forms of ALS 38 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136139 16026864 180257 18723 10261 ROS1 ROS ROS 8 0.0 Other studies pointed out the increased production of ROS by mitochondria in motoneurons as a result of mitochondrial Ca 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136140 16026864 180258 18723 10261 ROS1 ROS ROS 3 0.0 Evidence suggests that ROS generated in motoneurons can cross the plasma membrane and cause 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136141 16026864 180260 18723 10261 ROS1 ROS ROS 22 0.0 exact mechanisms of how mitochondrial Ca 2 uptake would increase ROS production are still unclear 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136142 16026864 180261 20996 11179 SOD1 ALS ALS 2 2.2 In mutant-SOD1-related ALS the importance of mitochondrial mechanisms was indicated not only by 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136145 16026864 180265 18723 10261 ROS1 ROS ROS 14 0.0 such disturbed mitochondrial respiration seems to be increased production of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136147 16026864 180270 20996 11179 SOD1 ALS ALS-like 5 2.2 In line with these observations ALS-like symptoms and neuropathology can be produced in mice by a 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136153 16026864 180274 20996 11179 SOD1 ALS ALS 23 2.2 of Ca 2 homeostasis and selective vulnerability of motoneurons during ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136154 16026864 180275 20996 11179 SOD1 ALS ALS-related 19 2.2 have proven valuable tools for physiological and biochemical characterization of ALS-related pathology over time and for testing for protective strategies 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136155 16026864 180285 20996 11179 SOD1 ALS ALS 37 2.2 with the selective vulnerability of a given cell type in ALS ( Figure 2 b 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136156 16026864 180287 20996 11179 SOD1 ALS ALS 24 2.2 and hippocampal cells 66 which are also hardly affected in ALS patients and corresponding mouse models 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136157 16026864 180295 20996 11179 SOD1 ALS ALS-related 31 2.2 but also enhance the selective vulnerability of hypoglossal motoneurons during ALS-related motoneuron degeneration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136158 16026864 180298 20996 11179 SOD1 ALS ALS-resistant 12 2.2 mitochondrial Ca 2 uptake is comparably small in highly buffered ALS-resistant cells 39 and 70 suggesting that mitochondria partially compensate for 1 JUMiner_v2.2 1 2 32 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136159 16026864 180300 18723 10261 ROS1 ROS ROS-dependent 19 0.0 homeostasis in motoneurons not only by buffering but also by ROS-dependent regulation of excitability 18 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136160 16026864 180301 18723 10261 ROS1 ROS ROS 7 0.0 When respiration is inhibited by cyanide subsequent ROS formation induces opening of Na conductances increases action potential discharge 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136161 16026864 180302 20996 11179 SOD1 ALS ALS 6 2.2 This mechanism is potentially relevant for ALS because various studies have demonstrated mitochondrial inhibition and increased ROS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136162 16026864 180302 18723 10261 ROS1 ROS ROS 16 0.0 ALS because various studies have demonstrated mitochondrial inhibition and increased ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136163 16026864 180304 20996 11179 SOD1 ALS ALS 5 2.2 In conclusion it seems that ALS is a multifactorial disease where motoneuron degeneration can be initiated 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136165 16026864 180307 18723 10261 ROS1 ROS ROS 16 0.0 to be worked-out these alterations seem to increase formation of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136166 16026864 180308 18723 10261 ROS1 ROS ROS 4 0.0 It is hypothesized that ROS have a central role in propagating damage by targeting surrounding 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136167 16026864 180311 18723 10261 ROS1 ROS ROS 20 0.0 induction of apoptotic pathways could well be consequences of either ROS generation or a rise in Ca 2 i 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136168 16026864 180316 20996 11179 SOD1 ALS ALS 15 2.2 protecting mitochondrial function could be useful in various forms of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136169 16026864 180323 20996 11179 SOD1 ALS ALS 12 2.2 2 -buffering capacities correlate with the vulnerability of neurons in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136170 16026864 180329 20996 11179 SOD1 ALS ALS 16 2.2 between cells and that neurons that are typically damaged in ALS _amp_#x2013 hypoglossal spinal and facial motoneurons (MN) MN _amp_#x2013 display 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136171 16026864 180329 20996 11179 SOD1 ALS ALS 39 2.2 that are several times lower than cells usually resistant in ALS i.e oculomotor neurons and cerebellar (Cb) Cb Purkinje cells 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136172 16026864 180336 20996 11179 SOD1 ALS ALS 9 2.2 Figure 4._amp_#xa0 Ca 2 mitochondria and motoneuron degeneration in ALS _amp_#x2013 an integrative model that combines different aspects of ALS-related 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136173 16026864 180336 20996 11179 SOD1 ALS ALS-related 19 2.2 ALS _amp_#x2013 an integrative model that combines different aspects of ALS-related motoneuron degeneration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136174 16026864 180337 20996 11179 SOD1 ALS ALS-related 0 2.2 ALS-related disturbance of mitochondrial respiration by mutant superoxide dismutase 1 (SOD1) 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000779631943122995<>ScoreDetail__5468|IGFALS|0.000282552389922298__11179|SOD1|0.000779631943122995__ 0 0 0 0 0 136176 16026864 180337 18723 10261 ROS1 ROS ROS 21 0.0 hypoxia results in increased formation of reactive oxygen species (ROS) ROS 48 and 49 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136177 16026864 180338 18723 10261 ROS1 ROS ROS 3 0.0 Evidence suggests that ROS formation enhances motoneuron excitability via induction of a Na current 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136178 16026864 180339 18723 10261 ROS1 ROS ROS 0 0.0 ROS are also suspected to leave the neuron and damage glial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136179 16026864 180346 18723 10261 ROS1 ROS ROS 27 0.0 be integrated into the model as consequences of mitochondrial disturbance ROS formation or increased Ca 2 i 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136748 16043017 181168 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is a fatal motor neuron degenerative disease characterized by the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136749 16043017 181169 20996 11179 SOD1 ALS ALS 1 2.2 Familial ALS cases accounting for 10_amp_#x2013 15% of all ALS disease are 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136750 16043017 181169 20996 11179 SOD1 ALS ALS 8 2.2 Familial ALS cases accounting for 10_amp_#x2013 15% of all ALS disease are caused by a gain-of-function mutation in Cu Zn-superoxide 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136755 16043017 181173 20996 11179 SOD1 ALS ALS-like 21 1.9 spinal cord from 2 to 4 months and eventually develop ALS-like motor neuron disease and die within 5_amp_#x2013 6 months 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136762 16043017 181177 20996 11179 SOD1 ALS ALS 34 2.2 B-crystallin may play an important role in the neurodegeneration of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136763 16043017 181178 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is a fatal motor neuron degenerative disease characterized by the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136764 16043017 181179 20996 11179 SOD1 ALS ALS 0 2.2 ALS typically presents in middle age and progresses rapidly 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136765 16043017 181180 20996 11179 SOD1 ALS ALS 5 2.2 Life expectancy of victims of ALS usually is 3_amp_#x2013 5 years after diagnosis 1 and 2 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136766 16043017 181181 20996 11179 SOD1 ALS ALS 1 2.2 Inherited ALS accounts for 10_amp_#x2013 15% of cases and among all of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136767 16043017 181181 20996 11179 SOD1 ALS ALS 13 2.2 10_amp_#x2013 15% of cases and among all of the familial ALS (FALS) FALS patients 20_amp_#x2013 30% of them are caused by 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136776 16043017 181190 20996 11179 SOD1 ALS ALS 7 2.2 The proteinaceous inclusions found in tissues from ALS patients 23 24 and 25 and mSOD transgenic mice 22 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136779 16043017 181191 20996 11179 SOD1 ALS ALS 27 2.2 27 although the roles of oxidative stress and aggregation in ALS are highly controversial (recently recently reviewed in 18 28 and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136783 16043017 181195 20996 11179 SOD1 ALS ALS 15 2.2 the notion that oxidative stress plays an important role in ALS development 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136785 16043017 181199 20996 11179 SOD1 ALS ALS-like 32 1.9 39 creating oxidative stress that may be responsible for the ALS-like syndrome observed in the G93A-SOD1 mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136788 16043017 181200 20996 11179 SOD1 ALS ALS 29 2.2 is likely important to the development of this model of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136789 16043017 181203 20996 11179 SOD1 ALS ALS 13 2.2 better understand the role of oxidative modification of proteins in ALS we employed quantitative redox proteomic analysis to identify the specific 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136791 16043017 181206 22055 11764 TG TGN TgN 12 0.0 human SOD1 gene with a G93A mutation strain B6SJL/TgN B6SJL TgN (SOD1-G93A)-2Gur) SOD1-G93A -2Gur 37 were purchased from The Jackson Laboratory 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136792 16043017 181239 7509 13506 FEZF2 TOF TOF 22 0.3 Bruker Daltonics Billerica MA USA at the UKMSF or a TOF Spec 2E (Micromass, Micromass UK MALDI-TOF mass spectrometer at the 1 JUMiner_v2.2 1 2 maldi-tof 0 0 0 0 0 0 0 0 136793 16043017 181242 6883 3541 F3 TFA TFA 11 0.0 spot was washed with 1 _amp_#x3bc l of a 1% TFA solution for approximately 60 s 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136794 16043017 181243 6883 3541 F3 TFA TFA 1 0.0 The TFA droplet was gently blown off the sample spot with compressed 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136795 16043017 181244 6883 3541 F3 TFA TFA 16 0.0 1 _amp_#x3bc l of a solution of ethanol acetone 0.1% TFA (6:3:1 6 3 1 ratio 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 136825 16043017 181294 20996 11179 SOD1 ALS ALS 12 2.2 issue of whether oxidative stress plays an early role in ALS remains unclear our current study is consistent with the notion 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136836 16043017 181302 20996 11179 SOD1 ALS ALS 12 2.2 this notion free cytosolic calcium was increased in lymphocytes from ALS patients 70 suggesting that oxidative modification of TCTP may also 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136842 16043017 181309 20996 11179 SOD1 ALS ALS 32 2.2 and the oxidative stress observed in G93A-SOD1 transgenic mice and ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136844 16043017 181310 20996 11179 SOD1 ALS ALS 27 2.2 decreased in G93A-SOD1 mouse spinal cord the inclusions of human ALS and mSOD1 (including including G93A mice are excessively ubiquitinated 79 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136848 16043017 181319 20996 11179 SOD1 ALS ALS 6 2.2 Consistent with this notion inclusions in ALS patients contain B-crystallin metallothionein glutamine synthetase and tubulin immunoreactivities 90 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136850 16043017 181320 20996 11179 SOD1 ALS ALS 26 2.2 that they are involved in the formation of inclusions in ALS patients or ALS models 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136851 16043017 181320 20996 11179 SOD1 ALS ALS 29 2.2 involved in the formation of inclusions in ALS patients or ALS models 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136852 16043017 181321 20996 11179 SOD1 ALS ALS 16 2.2 found in fibrillar neuronal inclusions in the cortex of sporadic ALS patients 79 80 81 and 91 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136860 16043017 181324 20996 11179 SOD1 ALS ALS 48 2.2 between protein oxidation protein aggregation and Ca 2 regulation in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 136864 16043017 181326 20996 11179 SOD1 ALS ALS 17 2.2 modifications could also play a role in the pathogenesis of ALS involving other proteins 92 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158256424889225<>ScoreDetail__5468|IGFALS|0.000797990940455794__11179|SOD1|0.00158256424889225__ 0 0 0 0 0 137129 16046141 181619 20996 11179 SOD1 ALS ALS 23 1.7 neurons that constitute the hallmark of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137131 16046141 181620 20996 11179 SOD1 ALS ALS 21 1.7 mutant Cu Zn superoxide dismutases (SOD1) SOD1 typical of familial ALS is mediated by Apaf1 a scaffold protein involved in neural 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137136 16046141 181625 18723 10261 ROS1 ROS ROS 33 0.6 imbalance between generation and removal of reactive oxygen species (ROS) ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 137137 16046141 181626 20996 11179 SOD1 ALS ALS 17 1.7 as Alzheimer's disease Parkinson's disease and amyotrophic lateral sclerosis (ALS) ALS ( Andersen 2004 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137138 16046141 181627 20996 11179 SOD1 ALS ALS 1 1.7 In ALS that is the most frequent paralytic disease in adults symptoms 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137139 16046141 181628 18723 10261 ROS1 ROS ROS 16 0.6 respiratory complexes cytochrome c release and oxidative stress (increased increased ROS flux oxidatively modified proteins seem likely candidates to explain many 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 137140 16046141 181628 20996 11179 SOD1 ALS ALS 29 1.7 modified proteins seem likely candidates to explain many facets of ALS because of their early occurrence in experimental models and in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137141 16046141 181629 20996 11179 SOD1 ALS ALS 0 1.7 ALS occurs both as a sporadic and as a familial dominantly 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137143 16046141 181630 20996 11179 SOD1 ALS ALS 12 1.7 only mechanical ventilation and treatment with riluzole prolong survival in ALS patients to some extent 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137144 16046141 181631 20996 11179 SOD1 ALS ALS 20 1.7 knowledge of the actual mechanisms by which neurons die in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137147 16046141 181633 20996 11179 SOD1 ALS ALS 18 1.7 evidence indicates that the mutant SOD1-mediated cell death observed in ALS is apoptotic in nature (reviewed reviewed by Gu_amp_#xe9 gan and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137148 16046141 181634 20996 11179 SOD1 ALS ALS 16 1.7 show altered expression in post-mortem samples from sporadic and familial ALS patients and in experimental models as well ( Mu et 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137150 16046141 181634 20996 11179 SOD1 ALS ALS 94 1.7 and caspase-9 is activated in spinal motor neurons of human ALS subjects ( Inoue et al. 2003 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137153 16046141 181637 20996 11179 SOD1 ALS ALS 6 1.7 In spinal cord specimens of both ALS patients and in the mice model for fALS evidence of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137155 16046141 181638 20996 11179 SOD1 ALS ALS 53 1.7 exact role played by these organelles in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137160 16046141 181645 17196 30025 PPRC1 PRC pRc 0 0.0 pRc/CMV pRc CMV plasmids coding for wt or G93A G37R G85R and 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137163 16046141 181649 6895 3530 F12 F12 F12 19 0.0 of Cell Culture and grown in Dulbecco's modified Eagle's/F12 Eagle's F12 medium supplemented with 15% fetal calf serum (FCS) FCS at 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137164 16046141 181650 17196 30025 PPRC1 PRC pRc 11 0.0 expression of wt- or fALS-SOD1s was obtained by transfecting pRc/CMV-wtSOD1 pRc CMV-wtSOD1 or pRc/CMV-fALS-SOD1 pRc CMV-fALS-SOD1 plasmids in SH-SY5Y neuroblastoma cell 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137165 16046141 181650 17196 30025 PPRC1 PRC pRc 13 0.0 fALS-SOD1s was obtained by transfecting pRc/CMV-wtSOD1 pRc CMV-wtSOD1 or pRc/CMV-fALS-SOD1 pRc CMV-fALS-SOD1 plasmids in SH-SY5Y neuroblastoma cell using LipofectAMINE 2000 (Invitrogen), 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137174 16046141 181671 19573 10691 SDS SDS SDS 23 0.0 50 mM Tris_amp_#x2013 HCl 0.5% Triton X-100 0.25% Na-deoxycholate 0.1% SDS 150 mM NaCl 1 mM EDTA 5 mM MgCl 2 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000322607838559905<>ScoreDetail__10691|SDS|0.000143876611418048__19440|SBDS|0.000322607838559905__ 0 0 0 0 0 137178 16046141 181688 19329 10524 SALL1 TBS TBS 5 0.0 After incubation in Tris-buffered saline (TBS) TBS solution containing 0.1% Tween 20 and 5% non-fat milk filters 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137179 16046141 181688 19329 10524 SALL1 TBS TBS 36 0.0 diluted in a 2% non-fat milk 0.1% Tween 20/TBS 20 TBS solution 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137180 16046141 181689 19329 10524 SALL1 TBS TBS 6 0.0 Following extensive washing in 0.1% Tween 20/TBS 20 TBS solution filters were incubated with the appropriated peroxidase-conjugated secondary antibodies 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137181 16046141 181690 19329 10524 SALL1 TBS TBS 6 0.0 Filters were washed in 0.1% Tween 20/TBS 20 TBS solution and developed using the POD chemiluminescence detection system (Roche) 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137184 16046141 181698 19573 10691 SDS SDS SDS-polyacrylamide 5 0.0 Samples were resolved on 12% SDS-polyacrylamide gels and DNP-derivatized proteins were identified by immunoblotting with a 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000322607838559905<>ScoreDetail__10691|SDS|0.000143876611418048__19440|SBDS|0.000322607838559905__ 0 0 0 0 0 137207 16046141 181729 17732 9717 PXMP3 PAF1 paf1 15 1.3 named ETNA ( E mbryonic T elencephalic N aive A paf1 ETNA+/+ ETNA and ETNA_amp_#x2212;/_amp_#x2212; ETNA_amp_#x2212 _amp_#x2212 cell lines have been 14 JUMiner_v2.2 1 2 UserEdit 0 2 9717 TotalCon:2<>25459|PAF1|54623|Complete__9717|PXMP3|5828|Complete__<>AvaiableGeneRif=2<>BEST:9717|PXMP3|0.000903102422439439<>ScoreDetail__9717|PXMP3|0.000903102422439439__25459|PAF1|0.000372564699040419__ 1 1 0 0 0 137218 16046141 181740 6634 3346 ENDOG ENDOG EndoG 37 0.0 such as AIF ( Fig 4 and Fig 5 and EndoG (not not shown are not affected by the expression of 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137219 16046141 181742 18723 10261 ROS1 ROS ROS 17 0.6 on mitochondrial metabolic activity ATP synthesis and the generation of ROS since alteration of these factors is likely to contribute to 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 137220 16046141 181742 20996 11179 SOD1 ALS ALS 35 1.7 to contribute to the apoptotic death of neuronal cells in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137225 16046141 181747 20996 11179 SOD1 SOD1 SOD1-transfected 26 1.7 cells transfected with fALS-SOD1s as compared to untransfected or wild-type SOD1-transfected cells considering that the percentage of transfected cells was estimated 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 137228 16046141 181755 20996 11179 SOD1 ALS ALS 23 1.7 al. 2000 Parkinson's disease ( Yang et al. 2004 and ALS ( Yuan and Yankner 2000 Gu_amp_#xe9 gan and Przedborski 2003 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137229 16046141 181756 20996 11179 SOD1 ALS ALS 1 1.7 In ALS activation of the apoptotic pathway in motor neurons may descend 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137230 16046141 181759 20996 11179 SOD1 ALS ALS 20 1.7 terminals of muscle biopsies from patients with early diagnosed sporadic ALS ( Siklos et al. 1996 and Beal 2000 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137234 16046141 181764 20996 11179 SOD1 ALS ALS 88 1.7 neuron death in SOD1 mutant mice and perhaps also in ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137235 16046141 181765 20996 11179 SOD1 ALS ALS 13 1.7 knowledge of the mechanism of cell death of neurons in ALS may provide precious suggestions on new therapeutic strategies we have 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137244 16046141 181770 18723 10261 ROS1 ROS ROS 44 0.6 for disruption of electron transport leading to increased generation of ROS loss of ATP production and mitochondrial damage ( Ricci et 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 137246 16046141 181771 20996 11179 SOD1 ALS ALS 17 1.7 in this work and in several other experimental paradigms of ALS may descend from mitochondria damage rather than a direct consequence 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137254 16046141 181776 20996 11179 SOD1 ALS ALS 25 1.7 spinal mitochondria as the basis for their selective toxicity in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137261 16046141 181783 20996 11179 SOD1 ALS ALS 4 1.7 In this view sporadic ALS and non-SOD1-linked fALS may descend either from other (unknown) unknown 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137263 16046141 181785 20996 11179 SOD1 ALS ALS 9 1.7 Because mitochondrial dysfunction occurs early in the course of ALS interception of Apaf1-mediated function may represent an important site for 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00124307451123221<>ScoreDetail__5468|IGFALS|0.000378242219879445__11179|SOD1|0.00124307451123221__ 0 0 0 0 0 137279 16046141 181826 5131 2524 CTRL CTRL ctrl 17 0.0 G93A G37R G85R and I113T-SOD1 mutants in the absence (ctrl) ctrl or in the presence (zVAD) zVAD of 100 _amp_#x3bc M 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137783 16050975 182083 20996 11179 SOD1 ALS ALS 15 1.7 is involved in the pathogenesis of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137784 16050975 182085 20996 11179 SOD1 ALS ALS 11 1.7 and biochemical mitochondrial abnormalities have been described in sporadic human ALS cases but the implications of these findings in terminally ill 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137785 16050975 182086 20996 11179 SOD1 ALS ALS 14 1.7 have also been identified in transgenic mouse models of familial ALS expressing mutant Cu Zn superoxide dismutase (SOD1) SOD1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137787 16050975 182087 20996 11179 SOD1 ALS ALS 33 1.7 mitochondrial dysfunction may be causally involved in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137791 16050975 182089 20996 11179 SOD1 ALS ALS 28 1.7 the relative contribution of mitochondrial dysfunction to the pathogenesis of ALS as well as to identify therapeutic approaches that target mitochondrial 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137792 16050975 182095 20996 11179 SOD1 ALS ALS 45 1.7 as a potentially important contributing factor to the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137793 16050975 182096 20996 11179 SOD1 ALS ALS 13 1.7 we will briefly describe the clinical and pathological characteristics of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137794 16050975 182097 20996 11179 SOD1 ALS ALS 13 1.7 examine the current evidence supporting the involvement of mitochondria in ALS and discuss its potential implications for the mechanism of pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137795 16050975 182102 20996 11179 SOD1 ALS ALS 0 1.7 ALS is a fatal neurodegenerative disorder that selectively affects neurons of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137796 16050975 182103 20996 11179 SOD1 ALS ALS 3 1.7 The prevalence of ALS is approximately 1_amp_#x2013 2 in 100 000 individuals ( Roman 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137797 16050975 182104 20996 11179 SOD1 ALS ALS 3 1.7 The onset of ALS is most common in the fourth and fifth decade of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137798 16050975 182108 20996 11179 SOD1 ALS ALS 1 1.7 Pathologically ALS is characterized by extensive loss of lower motor neurons in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137799 16050975 182110 20996 11179 SOD1 ALS ALS 16 1.7 incompletely defined etiology such as Alzheimer's disease and Parkinson's disease ALS appears to be a syndrome originating from diverse pathogenic processes 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137800 16050975 182111 20996 11179 SOD1 ALS ALS 0 1.7 ALS is predominantly a sporadic disorder (SALS), SALS but approximately 10% 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137801 16050975 182115 20996 11179 SOD1 ALS ALS 16 1.7 understanding the development and the role of mitochondrial dysfunction in ALS using these transgenic models 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137802 16050975 182118 20996 11179 SOD1 ALS ALS 1 1.7 Familial ALS due to SOD1 mutations and transgenic mouse models 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137816 16050975 182130 20996 11179 SOD1 ALS ALS 19 1.7 to what happens in humans develop motor neuron degeneration and ALS models that express mutant SOD1 exclusively either in the motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137821 16050975 182134 20996 11179 SOD1 ALS ALS 3 1.7 Mitochondrial involvement in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137822 16050975 182136 20996 11179 SOD1 ALS ALS 4 1.7 Mitochondrial involvement in sporadic ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137823 16050975 182140 20996 11179 SOD1 ALS ALS 16 1.7 levels within the mitochondria were found in muscle biopsies of ALS patients ( Siklos et al. 1996 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137824 16050975 182147 20996 11179 SOD1 ALS ALS 13 1.7 created cytoplasmic hybrid cells (cybrids) cybrids by fusing platelets from ALS patients (as as mitochondrial donor with neuroblastoma cells that have 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137825 16050975 182148 20996 11179 SOD1 ALS ALS 3 1.7 They showed that ALS cybrids have impaired respiratory chain function increased free radical production 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137827 16050975 182153 20996 11179 SOD1 ALS ALS 31 1.7 these studies have increased our understanding of mitochondrial involvement in ALS raised new questions and generated new hypotheses that can be 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137829 16050975 182156 20996 11179 SOD1 ALS ALS 5 1.7 Mitochondrial involvement in models of ALS created by introduction of SOD1 mutants 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137838 16050975 182176 20996 11179 SOD1 ALS ALS 24 1.7 of the potential mechanisms for the motor neuron-selective toxicity in ALS ( Rothstein 1996 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137841 16050975 182183 20996 11179 SOD1 ALS ALS 4 1.7 Mitochondria and apoptosis in ALS models 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137842 16050975 182185 20996 11179 SOD1 ALS ALS 9 1.7 Although the mechanisms leading to motor neuron death in ALS are still unclear several lines of evidence suggest that the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137847 16050975 182191 20996 11179 SOD1 ALS ALS 13 1.7 of caution should be said in regard to apoptosis in ALS motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137849 16050975 182193 20996 11179 SOD1 ALS ALS 15 1.7 of apoptotic cell death are difficult to detect both in ALS patients and in transgenic animals ( Migheli et al. 1999 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137850 16050975 182194 20996 11179 SOD1 ALS ALS 12 1.7 suggest that if the mitochondrially initiated apoptosis is occurring in ALS motor neurons it may follow an atypical course where the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137853 16050975 182198 20996 11179 SOD1 ALS ALS 5 1.7 Consistent with this scenario in ALS axons degenerate from the distal to the proximal direction (dying 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137894 16050975 182236 20996 11179 SOD1 ALS ALS 13 1.7 a necessary step in motor neuron degeneration and development of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137907 16050975 182252 20996 11179 SOD1 ALS ALS 10 1.7 1._amp_#xa0 Diagram of potential pathways of mitochondrial involvement in SOD1-related ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00109460856319025<>ScoreDetail__5468|IGFALS|0.000256580402565804__11179|SOD1|0.00109460856319025__ 0 0 0 0 0 137912 16050975 182256 17370 15860 PRPF6 TOM TOM 27 0.0 affect mitochondrial import by interfering with the translocation machinery (TOM/TIM) TOM TIM ( Liu et al. 2004 generate toxic free radicals 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 137913 16050975 182256 1016 13209 ARHGEF5 TIM TIM 27 0.0 mitochondrial import by interfering with the translocation machinery (TOM/TIM) TOM TIM ( Liu et al. 2004 generate toxic free radicals (ROS) 1 JUMiner_v2.2 1 0 0 2 11813 TotalCon:2<>13209|ARHGEF5|7984|Complete__11813|TIMELESS|8914|Complete__<>AvaiableGeneRif=2<>BEST:11813|TIMELESS|0.000270112166006307<>ScoreDetail__13209|ARHGEF5|9.53538820949248e-05__11813|TIMELESS|0.000270112166006307__ 0 0 0 0 0 137914 16050975 182256 18723 10261 ROS1 ROS ROS 38 0.0 ( Liu et al. 2004 generate toxic free radicals (ROS) ROS via aberrant superoxide chemistry ( Estevez et al. 1999 accumulate 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131705 16188953 173803 18723 10261 ROS1 ROS ROS 5 1.2 Detoxification of reactive oxygen species (ROS) ROS by pramipexole is shown in vitro and in vivo by 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131706 16188953 173803 18723 10261 ROS1 ROS ROS 18 1.2 is shown in vitro and in vivo by evaluating mitochondrial ROS release and aconitase-2 activity respectively 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131707 16188953 173805 18723 10261 ROS1 ROS ROS 21 1.2 the reactivity of the respective radical and the compartmentalization of ROS generation and ROS detoxification 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131708 16188953 173805 18723 10261 ROS1 ROS ROS 24 1.2 the respective radical and the compartmentalization of ROS generation and ROS detoxification 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131709 16188953 173808 18723 10261 ROS1 ROS ROS 30 1.2 to accumulate in brain cells and mitochondria where they detoxify ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131710 16188953 173811 17189 9319 PPP4C PPX PPX 1 0.3 Pramipexole (PPX) PPX - -2-amino-4 5 6 7-tetrahydro-6-D -propylamino-benzathiazole is a nonergot dopamine 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131711 16188953 173812 17189 9319 PPP4C PPX PPX 7 0.3 Preclinical studies show that nanomolar concentrations of PPX protect dopaminergic neurons in vitro (Ling Ling et al. 1999 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131712 16188953 173813 17189 9319 PPP4C PPX PPX 9 0.3 This is possibly mediated by the high selectivity of PPX for D3 receptors (Mierau Mierau et al. 1995 Ramirez et 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131713 16188953 173814 17189 9319 PPP4C PPX PPX 6 0.3 At higher concentrations (above above 10 microM PPX has been shown to be neuroprotective in vitro independent of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131714 16188953 173815 17189 9319 PPP4C PPX PPX 6 0.3 In addition SND the (+)-enantiomer -enantiomer of PPX has been shown to be neuroprotective as well (Abramova Abramova 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131715 16188953 173815 17189 9319 PPP4C PPX PPX 37 0.3 affinity to dopamine receptors is approximately 100-fold less compared with PPX (Mierau, Mierau 1995 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131716 16188953 173819 17189 9319 PPP4C PPX PPX 4 0.3 However the concept that PPX and/or and or SND act intracellularly as mitochondrial-targeted antioxidants has 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131717 16188953 173821 20996 11179 SOD1 ALS ALS 26 2.2 of Alzheimer's diseases Parkinson's disease or amyotrophic lateral sclerosis (ALS) ALS (Andersen, Andersen 2004 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131718 16188953 173822 17189 9319 PPP4C PPX PPX 25 0.3 to enter neural cells and exert the same properties as PPX 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131719 16188953 173823 17189 9319 PPP4C PPX PPX 20 0.3 efficacy toward hydrogen peroxide and nitric oxide when compared with PPX and by equipotent efficacy of SND and PPX to prevent 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131720 16188953 173823 17189 9319 PPP4C PPX PPX 28 0.3 compared with PPX and by equipotent efficacy of SND and PPX to prevent cell death in glutathione-depleted neuroblastoma cells (Maher Maher 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131721 16188953 173824 17189 9319 PPP4C PPX PPX 7 0.3 This study addresses those neuroprotective properties of PPX and SND which are not mediated by stimulation of dopamine 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131722 16188953 173825 17189 9319 PPP4C PPX PPX 15 0.3 action is demonstrated by evaluating the uptake properties of H-labeled PPX 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131723 16188953 173826 17189 9319 PPP4C PPX PPX 7 0.3 We show for the first time that PPX enters neural cells and accumulates in mitochondria driven by mitochondrial 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131724 16188953 173827 17189 9319 PPP4C PPX PPX 2 0.3 In addition PPX detoxifies ROS within the mitochondria as shown by inhibition of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131725 16188953 173827 18723 10261 ROS1 ROS ROS 4 1.2 In addition PPX detoxifies ROS within the mitochondria as shown by inhibition of mitochondrial hydrogen 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131727 16188953 173828 20996 11179 SOD1 ALS ALS 0 2.2 ALS is a devastating disease progressing from mild motor symptoms to 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131728 16188953 173829 20996 11179 SOD1 ALS ALS 4 2.2 Twenty percent of familial ALS cases are caused by mutations in superoxide dismutase 1 (SOD1), 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131731 16188953 173830 20996 11179 SOD1 ALS ALS 9 2.2 Transgenic SOD1 mice represent the predominant model to study ALS pathogenesis and therapy 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131732 16188953 173831 20996 11179 SOD1 ALS ALS 4 2.2 Neuronal cell death in ALS is at least in part associated with an increase in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131733 16188953 173832 20996 11179 SOD1 ALS ALS 11 2.2 dysfunction seems a likely candidate to explain many facets of ALS because it is the earliest reported pathologic event in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131734 16188953 173832 20996 11179 SOD1 ALS ALS 21 2.2 ALS because it is the earliest reported pathologic event in ALS mice (Bendotti Bendotti et al. 2001 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131735 16188953 173833 18723 10261 ROS1 ROS ROS 18 1.2 oxidative stress and indeed markers of oxidative damage (increased increased ROS flux oxidatively modified proteins have been found in cultured neuronal 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131736 16188953 173834 17189 9319 PPP4C PPX PPX 1 0.3 Furthermore PPX reduces oxidative stress in ALS patients (Pattee Pattee et al. 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131737 16188953 173834 20996 11179 SOD1 ALS ALS 6 2.2 Furthermore PPX reduces oxidative stress in ALS patients (Pattee Pattee et al. 2003 pointing to the necessity 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131738 16188953 173834 17189 9319 PPP4C PPX PPX 19 0.3 Pattee et al. 2003 pointing to the necessity to evaluate PPX and SND for their efficacy in an animal model for 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131739 16188953 173834 20996 11179 SOD1 ALS ALS 30 2.2 and SND for their efficacy in an animal model for ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131740 16188953 173835 17189 9319 PPP4C PPX PPX 5 0.3 To test for neuroprotection by PPX/SND PPX SND in vivo transgenic SOD1 mice were treated with both 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131742 16188953 173836 17189 9319 PPP4C PPX PPX 2 0.3 Treatment with PPX resulted in preonset motor hyperactivity SND was able to prolong 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131743 16188953 173837 17189 9319 PPP4C PPX PPX 7 0.3 This is the first report showing that PPX and SND are able to act as brain- and mitochondrial-targeted 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131744 16188953 173860 17189 9319 PPP4C PPX PPX 19 0.3 5 mM glutamate with or without the additional presence of PPX SND (both both 0.008-1 mM or EUK-134 (2-250 2-250 microM 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131745 16188953 173871 17189 9319 PPP4C PPX PPX 6 0.3 For analyzing the uptake of H PPX (69 69 mCi/mmol, mCi mmol GE Healthcare Little Chalfont Buckinghamshire 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131746 16188953 173871 20247 20116 SLC25A29 CACL CaCl 35 1.0 buffer (20 20 mM HEPES 145 mM NaCl 1.8 mM CaCl 2 5.4 mM KCl 1 mM MgCl 2 0.8 mM 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 131747 16188953 173871 8255 4236 GFER HPO HPO 50 0.0 mM KCl 1 mM MgCl 2 0.8 mM Na 2 HPO 4 and 5 mM glucose pH 7.4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131748 16188953 173873 17189 9319 PPP4C PPX PPX 3 0.3 Uptake of H PPX was started by the addition of 200 microl of H 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131749 16188953 173873 17189 9319 PPP4C PPX PPX 14 0.3 was started by the addition of 200 microl of H PPX (6 6 microCi/ml) microCi ml in incubation buffer with or 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131750 16188953 173873 17189 9319 PPP4C PPX PPX 24 0.3 microCi/ml) microCi ml in incubation buffer with or without unlabeled PPX (0-30 0-30 mM 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131751 16188953 173877 20247 20116 SLC25A29 CACL CaCl 25 1.0 buffer (20 20 mM HEPES 5.6 mM NaCl 1.8 mM CaCl 2 145 mM KCl 1 mM MgCl 2 0.8 mM 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 131752 16188953 173877 8255 4236 GFER HPO HPO 40 0.0 mM KCl 1 mM MgCl 2 0.8 mM Na 2 HPO 4 and 5 mM Glc pH 7.4 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131753 16188953 173878 17189 9319 PPP4C PPX PPX 4 0.3 The uptake of H PPX was calculated by subtracting the obtained amount of radioactivity in 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131754 16188953 173879 17189 9319 PPP4C PPX PPX 4 0.3 The concentration of H PPX added to the incubation medium was 43.5 nM calculated by 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131755 16188953 173879 17189 9319 PPP4C PPX PPX 29 0.3 as well as the specific radioactivity of the used H PPX stock into account (1 1 mCi/ml, mCi ml 69 Ci/mmol) 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131756 16188953 173884 17189 9319 PPP4C PPX PPX 6 0.3 For measuring the uptake of H PPX 50 microl of mitochondria (0-1.6 0-1.6 mg/ml) mg ml were 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131757 16188953 173885 17189 9319 PPP4C PPX PPX 3 0.3 Uptake of H PPX was started by the addition of 200 microl of H 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131758 16188953 173885 17189 9319 PPP4C PPX PPX 14 0.3 was started by the addition of 200 microl of H PPX (6 6 microCi/ml) microCi ml in incubation buffer with or 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131759 16188953 173885 17189 9319 PPP4C PPX PPX 24 0.3 microCi/ml) microCi ml in incubation buffer with or without unlabeled PPX (0-30 0-30 mM 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131760 16188953 173889 17189 9319 PPP4C PPX PPX 5 0.3 The specific uptake of H PPX was determined as the amount of radioactivity in the presence 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131761 16188953 173896 17189 9319 PPP4C PPX PPX 3 0.3 In further conditions PPX (300 300 microM malonate (Malo, Malo 10 mM the SOD-catalase 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131763 16188953 173900 17189 9319 PPP4C PPX PPX 36 0.3 (0.1 0.1 mM (Fridovich, Fridovich 1970 in a solution containing PPX SND or EUK-134 at the indicated concentrations 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131764 16188953 173901 18723 10261 ROS1 ROS ROS 3 1.2 After 20 min ROS generation was stopped by the addition of allopurinol (1 1 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131766 16188953 173906 3897 2665 CD55 DAF DAF 35 1.2 to 100 microl of a solution containing 4 5-diaminofluorescein (DAF; DAF 5 microM and PPX or SND 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131767 16188953 173906 17189 9319 PPP4C PPX PPX 39 0.3 a solution containing 4 5-diaminofluorescein (DAF; DAF 5 microM and PPX or SND 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131768 16188953 173907 3897 2665 CD55 DAF DAF-triazole 3 1.2 The generation of DAF-triazole fluorescence was measured at room temperature every 30 s during 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131769 16188953 173908 17189 9319 PPP4C PPX PPX 9 0.3 The obtained slopes were plotted against the concentration of PPX 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131770 16188953 173918 17189 9319 PPP4C PPX PPX 9 0.3 Schedule for Plasma and Brain Levels of SND and PPX 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131771 16188953 173919 17189 9319 PPP4C PPX PPX 16 0.3 daily (7:00 7 00 AM and 7 00 PM with PPX or SND (four four in each group 200 mg/kg) mg 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131772 16188953 173924 17189 9319 PPP4C PPX PPX 16 0.3 injections (9:00 9 00 AM and 5 00 PM of PPX (30 30 mg/kg, mg kg n = 8 or vehicle 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131773 16188953 173927 17189 9319 PPP4C PPX PPX 8 0.3 Animals were treated by supplementing the diet with PPX or SND 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131774 16188953 173930 17189 9319 PPP4C PPX PPX 29 0.3 II (7 7 males 8 females received control diet and PPX in the drinking water (3 3 mg/kg/day), mg kg day 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131775 16188953 173945 23261 10539 TSPAN31 SAS SAS 9 0.0 The statistical evaluation was performed using the software package SAS version 8.2 (SAS SAS Institute Cary NC 1 JUMiner_v2.2 1 0 0 2 19237 TotalCon:2<>10539|TSPAN31|6302|Complete__19237|NANS|54187|Complete__<>AvaiableGeneRif=2<>BEST:19237|NANS|0.000547885163269779<>ScoreDetail__10539|TSPAN31|0__19237|NANS|0.000547885163269779__ 0 0 0 0 0 131776 16188953 173945 23261 10539 TSPAN31 SAS SAS 12 0.0 was performed using the software package SAS version 8.2 (SAS SAS Institute Cary NC 1 JUMiner_v2.2 1 0 0 2 19237 TotalCon:2<>10539|TSPAN31|6302|Complete__19237|NANS|54187|Complete__<>AvaiableGeneRif=2<>BEST:19237|NANS|0.000547885163269779<>ScoreDetail__10539|TSPAN31|0__19237|NANS|0.000547885163269779__ 0 0 0 0 0 131777 16188953 173947 17189 9319 PPP4C PPX PPX 5 0.3 Plasma and Brain Levels of PPX or SND 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131778 16188953 173948 17189 9319 PPP4C PPX PPX 3 0.3 For quantification of PPX or SND in brain the tissue was homogenized with 0.05 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131779 16188953 173949 22000 11730 TERT TERT tert 21 0.0 water and internal standard and then extracted two times with tert -butyl-methylether at pH 10 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131780 16188953 173950 22000 11730 TERT TERT tert 19 0.0 and an internal standard and then extracted two times with tert -butyl-methylether at pH 10 14 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131784 16188953 173967 19573 10691 SDS SDS SDS 17 0.0 5 microg were reduced with dithiothreitol and subjected to SDS/polyacrylamide SDS polyacrylamide gel electrophoresis on a 10% polyacrylamide gel 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000215552942169049<>ScoreDetail__10691|SDS|0.000127839871429615__19440|SBDS|0.000215552942169049__ 0 0 0 0 0 131785 16188953 173976 17189 9319 PPP4C PPX PPX 12 0.3 for an intracellular site of action the uptake of H PPX into neural cells both cerebellar granule cells and astroglial cells 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131786 16188953 173977 17189 9319 PPP4C PPX PPX 3 0.3 The uptake of PPX increases with incubation time and reaches constant levels after incubation 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131787 16188953 173978 17189 9319 PPP4C PPX PPX 7 0.3 After reaching plateau the amount of H PPX obtained in the cell lysates does not differ significantly between 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131788 16188953 173979 17189 9319 PPP4C PPX PPX 15 0.3 cells converts to an intracellular concentration of 160 nM H PPX by taking the specific volume for astroglial cells (4 4 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131789 16188953 173980 17189 9319 PPP4C PPX PPX 0 0.3 PPX has been proposed to accumulate in mitochondria (Abramova Abramova et 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131790 16188953 173981 17189 9319 PPP4C PPX PPX 14 0.3 a prerequisite for penetration into mitochondria we show that H PPX enters astrocytes and neurons beyond nonspecific binding indicated by reduced 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131791 16188953 173982 17189 9319 PPP4C PPX PPX 2 0.3 Furthermore H PPX accumulates in astroglial cells as shown by the 3-fold intracellular 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131792 16188953 173983 17189 9319 PPP4C PPX PPX 17 0.3 and therefore diffusion-limited because of the nonsaturable rate of total PPX uptake (labeled labeled plus unlabeled which is proportional to the 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131793 16188953 173983 17189 9319 PPP4C PPX PPX 28 0.3 (labeled labeled plus unlabeled which is proportional to the total PPX concentration 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131794 16188953 173984 17189 9319 PPP4C PPX PPX 20 0.3 acidification might be explained by the p K values of PPX ( ~5 and 11 for the aminothiazole and propylamino group 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131795 16188953 173985 17189 9319 PPP4C PPX PPX 4 0.3 At pH 7.4 >98% PPX is protonated to the less permeable univalent cation a pH 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131796 16188953 173986 17189 9319 PPP4C PPX PPX 2 0.3 Mitochondrial H PPX uptake is proportional to mitochondrial amount and correlates with the 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131797 16188953 173987 17189 9319 PPP4C PPX PPX 7 0.3 The ability of mitochondria to retain H PPX is greatly affected by rupture of the mitochondrial membranes showing 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131798 16188953 173987 17189 9319 PPP4C PPX PPX 22 0.3 rupture of the mitochondrial membranes showing that nonspecific binding of PPX to mitochondrial proteins is low 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131799 16188953 173988 17189 9319 PPP4C PPX PPX 3 0.3 We conclude that PPX permeates the inner mitochondrial membrane and enters the matrix 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131800 16188953 173990 17189 9319 PPP4C PPX PPX 7 0.3 We show that in energized mitochondria H PPX influx is stimulated by a factor of two to six 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131801 16188953 173991 17189 9319 PPP4C PPX PPX 16 0.3 nM in energized mitochondria accounts for a 3-fold accumulation of PPX within mitochondria compared with incubation buffer 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131802 16188953 173992 17189 9319 PPP4C PPX PPX 15 0.3 pmol/mg) pmol mg most likely reflect the uniform distribution of PPX between incubation buffer and mitochondrial matrix (diffusion diffusion only whereas 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131803 16188953 173994 17189 9319 PPP4C PPX PPX 13 0.3 equal octanol/water octanol water partitioning (log log P = 0 PPX approximately -0.2 data not shown 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131804 16188953 173995 17189 9319 PPP4C PPX PPX 10 0.3 We conclude that apart from its binding to dopamine receptors PPX can accumulate within cells and mitochondria 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131805 16188953 173997 17189 9319 PPP4C PPX PPX 8 0.3 Although several studies addressed the antioxidative properties of PPX (e.g., e.g. Cassarino et al. 1998 Ferger et al. 2000 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131806 16188953 173998 17189 9319 PPP4C PPX PPX 7 0.3 Therefore we reevaluated the antioxidative properties of PPX and SND targeted toward different reactive species and compartments obtained 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131808 16188953 173999 17189 9319 PPP4C PPX PPX 3 0.3 We show that PPX and (the the equipotent SND are weak H 2 O 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131809 16188953 174000 18723 10261 ROS1 ROS ROS 6 1.2 In contrast EUK-134 detoxifies the generated ROS in the 5 microM range indicating a 100-fold higher efficacy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131810 16188953 174000 17189 9319 PPP4C PPX PPX 19 0.3 5 microM range indicating a 100-fold higher efficacy compared with PPX or SND 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131811 16188953 174002 17189 9319 PPP4C PPX PPX 9 0.3 Importantly the loss of efficacy was not observed if PPX or SND was tested in these systems 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131812 16188953 174003 17189 9319 PPP4C PPX PPX 8 0.3 This is consistent with the uptake properties of PPX yielding cellular or mitochondrial accumulation thus bypassing competition with the 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131813 16188953 174004 17189 9319 PPP4C PPX PPX 7 0.3 The uptake properties and the efficacy of PPX to scavenge H 2 O 2 (accumulates accumulates 3-fold IC 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131814 16188953 174006 18723 10261 ROS1 ROS ROS 1 1.2 Mitochondrial ROS attenuation in HT22 cells is sufficient but not a prerequisite 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131815 16188953 174007 17189 9319 PPP4C PPX PPX 3 0.3 Therefore pathways by PPX/SND PPX SND other than antioxidative action located to mitochondria cannot be 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131816 16188953 174009 17189 9319 PPP4C PPX PPX 4 0.3 The low efficacy of PPX and SND toward H 2 O 2 might be the 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131817 16188953 174011 3897 2665 CD55 DAF DAF-triazole 3 1.2 The inhibition of DAF-triazole generation in the presence of a nitric oxide donor and 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131818 16188953 174011 17189 9319 PPP4C PPX PPX 25 0.3 (Nagata Nagata et al. 1999 was used to show that PPX and SND detoxify nitric oxide equipotently at the 15 microM 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131819 16188953 174012 17189 9319 PPP4C PPX PPX 7 0.3 We conclude that the antioxidative efficacy of PPX and SND in addition to the spatial issues discussed above 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131820 16188953 174013 17189 9319 PPP4C PPX PPX 3 0.3 We show that PPX treatment (2 2 x 30 mg/kg) mg kg results in 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131822 16188953 174014 17189 9319 PPP4C PPX PPX 7 0.3 Because treatment of these mice with a PPX dose of 2 x 200 mg/kg mg kg results in 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131824 16188953 174016 17189 9319 PPP4C PPX PPX 18 0.3 dopaminergic and nondopaminergic cells in the presence of 10 microM PPX or SND if added 48 h prior to complex I 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131825 16188953 174017 17189 9319 PPP4C PPX PPX 0 0.3 PPX causes a slight but not significant increase in total aconitase 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131827 16188953 174020 17189 9319 PPP4C PPX PPX 7 0.3 The present results support the concept of PPX and SND as mitochondria-targeted antioxidants evidenced by equal antioxidative efficacy 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131828 16188953 174021 17189 9319 PPP4C PPX PPX 2 0.3 Targeting of PPX to mitochondria is supported by the membrane potential-dependent uptake process 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131829 16188953 174021 17189 9319 PPP4C PPX PPX 35 0.3 compared with direct scavenging and finally by the ability of PPX to lower mitochondrial superoxide levels in vivo 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131830 16188953 174022 17189 9319 PPP4C PPX PPX 9 0.3 We conclude that the in vitro neuroprotective properties of PPX are independent of the chiral 6-propylaminogroup in the molecule 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131831 16188953 174023 17189 9319 PPP4C PPX PPX 6 0.3 Therefore the (+)-enantiomer -enantiomer SND rather than PPX might permit a sufficiently high dosage regimen to exert antioxidative 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131832 16188953 174024 17189 9319 PPP4C PPX PPX 9 0.3 Therefore we tested SND (at at a high dose and PPX (at at a low dose in an animal model for 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131833 16188953 174024 20996 11179 SOD1 ALS ALS 20 2.2 at a low dose in an animal model for familial ALS the SOD1-G93A mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131834 16188953 174025 17189 9319 PPP4C PPX PPX 19 0.3 to achieve antioxidative action based on equipotent efficacy compared with PPX and the micromolar brain levels achieved in C57BL/6 C57BL 6 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131835 16188953 174026 17189 9319 PPP4C PPX PPX 2 0.3 The used PPX dose of 3 mg/kg/day mg kg day was chosen based 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131836 16188953 174027 17189 9319 PPP4C PPX PPX 6 0.3 Indeed we show that treatment with PPX does not increase survival time of the SOD1-G93A mice and 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131837 16188953 174028 17189 9319 PPP4C PPX PPX-treated 0 0.3 PPX-treated animals display an increase in presymptomatic running wheel activity probably 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131838 16188953 174032 20996 11179 SOD1 ALS ALS 16 2.2 mg/kg mg kg riluzole (the the only drug launched for ALS which prolongs survival time by 8 days in our laboratory 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131839 16188953 174035 17189 9319 PPP4C PPX PPX 10 0.3 Based on the high dose the equipotent antioxidative properties of PPX and SND and the lack of evidence for different distribution 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131840 16188953 174036 18723 10261 ROS1 ROS ROS 18 1.2 mouse needs to be confirmed by direct measurement of mitochondrial ROS attenuation in this model using specific endpoints such as modification 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131842 16188953 174039 17189 9319 PPP4C PPX PPX 3 0.3 Uptake of H PPX in neural cells 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131843 16188953 174040 17189 9319 PPP4C PPX PPX 19 0.3 circles/bars) circles bars was started by the addition of H PPX (3 3 microCi/ml) microCi ml in incubation buffer containing 5 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131844 16188953 174041 5131 2524 CTRL CTRL Ctrl 13 0.0 at 37degreeC by using an incubating buffer pH 7.4 (Ctrl) Ctrl containing digitonin (Digi, Digi 100 microg/ml) microg ml or adjusting 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131845 16188953 174042 17189 9319 PPP4C PPX PPX 11 0.3 and D uptake was started by the addition of H PPX (3 3 microCi/ml) microCi ml and a variable concentration of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131846 16188953 174042 17189 9319 PPP4C PPX PPX 20 0.3 3 microCi/ml) microCi ml and a variable concentration of unlabeled PPX (0-30 0-30 mM 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131847 16188953 174043 17189 9319 PPP4C PPX PPX 13 0.3 normalized on time and expressed as the rate of H PPX uptake 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131848 16188953 174044 17189 9319 PPP4C PPX PPX 6 0.3 D the specific rate of total PPX uptake was calculated by taking the excess of unlabeled PPX 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131849 16188953 174044 17189 9319 PPP4C PPX PPX 16 0.3 PPX uptake was calculated by taking the excess of unlabeled PPX into account and is shown as a function of total 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131850 16188953 174044 17189 9319 PPP4C PPX PPX 27 0.3 into account and is shown as a function of total PPX concentration in the incubation buffer * p _lt_ 0.05 ** 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131851 16188953 174044 17189 9319 PPP4C PPX PPX 66 0.3 or with C the incubation in the absence of unlabeled PPX respectively 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131852 16188953 174046 17189 9319 PPP4C PPX PPX 3 0.3 Uptake of H PPX in mitochondria 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131853 16188953 174048 17189 9319 PPP4C PPX PPX 8 0.3 Uptake was started by the addition of H PPX (3 3 microCi/ml) microCi ml and terminated at the indicated 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131854 16188953 174051 15869 8506 OSM OSM mOsm 12 0.0 were preincubated in buffer with increasing osmolarity (160-960 160-960 mOsm/l mOsm l adjusted with sucrose *** p _lt_ 0.001 compared with 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131855 16188953 174051 15869 8506 OSM OSM mOsm 25 0.0 *** p _lt_ 0.001 compared with incubation in 320 mOsm/l mOsm l incubation buffer 10 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131856 16188953 174052 17189 9319 PPP4C PPX PPX 6 0.3 D uptake was started by H PPX (3 3 microCi/ml), microCi ml which was diluted with unlabeled 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131857 16188953 174052 17189 9319 PPP4C PPX PPX 14 0.3 (3 3 microCi/ml), microCi ml which was diluted with unlabeled PPX (0-10 0-10 mM normalized on time and taking the excess 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131858 16188953 174052 17189 9319 PPP4C PPX PPX 26 0.3 mM normalized on time and taking the excess of unlabeled PPX into account 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131859 16188953 174053 17189 9319 PPP4C PPX PPX 5 0.3 The specific rate of total PPX uptake is shown as a function of the total PPX 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131860 16188953 174053 17189 9319 PPP4C PPX PPX 15 0.3 PPX uptake is shown as a function of the total PPX concentration 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131861 16188953 174055 20247 20116 SLC25A29 CACL CaCl 23 1.0 mM 1 microM valinomycin (Val), Val 100 nmol/mg nmol mg CaCl 2 1 mM phosphate 5 microM rotenone (Rot), Rot or 14 JUMiner_v2.2 1 2 cacl 0 0 0 0 0 0 0 0 131862 16188953 174055 24185 29175 WDTC1 ADP ADP 11 0.0 of mitochondrial membrane potential was induced by the addition of ADP plus phosphate (both both 1 mM 1 microM valinomycin (Val), 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131863 16188953 174057 17189 9319 PPP4C PPX PPX 3 0.3 Antioxidative effects of PPX and SND related to hydrogen peroxide 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131864 16188953 174058 18723 10261 ROS1 ROS ROS 1 1.2 A ROS were generated by xanthine oxidase in a solution containing EUK-134 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131865 16188953 174058 17189 9319 PPP4C PPX PPX 14 0.3 xanthine oxidase in a solution containing EUK-134 (black black bars PPX (light light gray bars or SND (dark dark gray bars 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131866 16188953 174059 18723 10261 ROS1 ROS ROS 10 1.2 To avoid competition of the compounds with the detection system ROS generation was stopped after 20 min by the addition of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131867 16188953 174060 17189 9319 PPP4C PPX PPX 43 0.3 with the rate of AR oxidation in the presence of PPX (300 300 microM and EUK-134 (30 30 microM 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131868 16188953 174060 5131 2524 CTRL CTRL Ctrl 30 0.0 0.4 units/ml units ml HRP and 2.5 mM succinate (Ctrl) Ctrl and compared with the rate of AR oxidation in the 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131869 16188953 174064 17189 9319 PPP4C PPX PPX 4 0.3 Cells were treated with PPX (1 1 mM SND (1 1 mM and EUK-134 (250 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131870 16188953 174069 17189 9319 PPP4C PPX PPX 3 0.3 Antioxidative effects of PPX and SND related to nitric oxide generated by DETA 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131871 16188953 174070 3897 2665 CD55 DAF DAF 15 1.2 initiated by the addition of DETA to a solution containing DAF and PPX (filled filled circles or SND (open open circles 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131872 16188953 174070 17189 9319 PPP4C PPX PPX 17 0.3 the addition of DETA to a solution containing DAF and PPX (filled filled circles or SND (open open circles both 0-10 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131873 16188953 174071 3897 2665 CD55 DAF DAF-triazole 3 1.2 The generation of DAF-triazole fluorescence was measured at room temperature every 30 s during 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131874 16188953 174072 17189 9319 PPP4C PPX PPX 9 0.3 The obtained slopes were plotted against the concentration of PPX 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131875 16188953 174075 17189 9319 PPP4C PPX PPX 3 0.3 Antioxidative effect of PPX in vivo 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131877 16188953 174076 17189 9319 PPP4C PPX PPX 14 0.3 mitochondrial aconitase after treatment of C57BL/6 C57BL 6 mice with PPX (2 2 x 30 mg/kg mg kg per day n 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131878 16188953 174076 5131 2524 CTRL CTRL Ctrl 26 0.0 mg kg per day n = 8 or vehicle (Ctrl, Ctrl n = 6 have been determined as described under Materials 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131880 16188953 174079 17189 9319 PPP4C PPX PPX 6 0.3 Treatment of SOD1(G93A) SOD1 G93A transgenic mice with PPX and SND 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131881 16188953 174080 17189 9319 PPP4C PPX PPX 18 0.3 SND (100 100 mg/kg mg kg p.o. black circles or PPX (3 3 mg/kg mg kg p.o. gray circles was measured 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131882 16188953 174080 5131 2524 CTRL CTRL Ctrl 8 0.0 A motor activity of mice treated with vehicle (Ctrl; Ctrl open circles SND (100 100 mg/kg mg kg p.o. black 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131883 16188953 174084 23261 10539 TSPAN31 SAS SAS 14 0.0 by a log rank Mantel-Cox test using the software package SAS version 8.2 1 JUMiner_v2.2 1 0 0 2 19237 TotalCon:2<>10539|TSPAN31|6302|Complete__19237|NANS|54187|Complete__<>AvaiableGeneRif=2<>BEST:19237|NANS|0.000547885163269779<>ScoreDetail__10539|TSPAN31|0__19237|NANS|0.000547885163269779__ 0 0 0 0 0 131884 16188953 174085 17189 9319 PPP4C PPX PPX- 7 0.3 TABLE 1 Plasma and brain levels of PPX- and SND-treated C57BL/6 C57BL 6 mice 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131885 16188953 174096 17189 9319 PPP4C PPX PPX 10 0.3 In contrast to acidification an increase to pH 8 doubles PPX influx in both cell types compared with pH 7.4 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131886 16188953 174097 17189 9319 PPP4C PPX PPX 3 0.3 Dilution of H PPX with unlabeled PPX results in a dose-dependent inhibition of H 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131887 16188953 174097 17189 9319 PPP4C PPX PPX 6 0.3 Dilution of H PPX with unlabeled PPX results in a dose-dependent inhibition of H PPX uptake ( 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131888 16188953 174097 17189 9319 PPP4C PPX PPX 14 0.3 with unlabeled PPX results in a dose-dependent inhibition of H PPX uptake ( Fig 1C which is caused by isotope dilution 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131889 16188953 174098 17189 9319 PPP4C PPX PPX 3 0.3 Multiplication of H PPX uptake ( Fig 1C by the molar excess of unlabeled 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131890 16188953 174098 17189 9319 PPP4C PPX PPX 15 0.3 uptake ( Fig 1C by the molar excess of unlabeled PPX yields the rate of total PPX uptake (labeled labeled plus 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131891 16188953 174098 17189 9319 PPP4C PPX PPX 21 0.3 molar excess of unlabeled PPX yields the rate of total PPX uptake (labeled labeled plus unlabeled Fig 1D which is proportional 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131892 16188953 174098 17189 9319 PPP4C PPX PPX 35 0.3 plus unlabeled Fig 1D which is proportional to the total PPX concentration (labeled labeled plus unlabeled over a range of seven 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131893 16188953 174099 17189 9319 PPP4C PPX PPX 8 0.3 In a second set of experiments entry of PPX into isolated mitochondria was measured and characterized 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131894 16188953 174100 17189 9319 PPP4C PPX PPX 8 0.3 As observed in cells the uptake of H PPX in mitochondria strongly depends on mitochondrial integrity ( Fig 2A 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131895 16188953 174102 17189 9319 PPP4C PPX PPX 6 0.3 By subtraction the amount of H PPX for unspecific binding (sonicated sonicated mitochondria from the amount obtained 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131896 16188953 174102 17189 9319 PPP4C PPX PPX 29 0.3 a specific uptake of 0.15 _amp_#177 0.01 pmol H]PPX/mg H PPX mg protein was obtained which corresponds to an intramitochondrial concentration 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131897 16188953 174103 17189 9319 PPP4C PPX PPX 2 0.3 Furthermore H PPX uptake is proportional to the mitochondria amount ( R = 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131898 16188953 174105 17189 9319 PPP4C PPX PPX 8 0.3 As observed in cells mitochondrial uptake of H PPX is significantly inhibited in the presence of unlabeled PPX (>1 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131899 16188953 174105 17189 9319 PPP4C PPX PPX 17 0.3 H PPX is significantly inhibited in the presence of unlabeled PPX (>1 >1 microM data not shown which after taking the 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131900 16188953 174105 17189 9319 PPP4C PPX PPX 51 0.3 of total uptake (labeled labeled plus unlabeled and the total PPX concentration ( R = 0.999 Fig 2D 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131901 16188953 174106 17189 9319 PPP4C PPX PPX 12 0.3 the membrane potential as a driving force for mitochondrial H PPX uptake we used different energy substrates to polarize the mitochondrial 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131902 16188953 174107 17189 9319 PPP4C PPX PPX 15 0.3 malate pyruvate succinate or ATP results in a comparable H PPX uptake 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131903 16188953 174109 24185 29175 WDTC1 ADP ADP 18 0.0 if mitochondrial membrane potential is reduced by the addition of ADP P i (57%), 57% valinomycin (47%), 47% calcium P i 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131904 16188953 174110 17189 9319 PPP4C PPX PPX 4 0.3 After demonstrating entry of PPX into brain cells and mitochondria we reevaluated the antioxidative properties 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131905 16188953 174110 17189 9319 PPP4C PPX PPX 16 0.3 brain cells and mitochondria we reevaluated the antioxidative properties of PPX and SND and compared the obtained efficacy with EUK-134 a 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131907 16188953 174112 18723 10261 ROS1 ROS ROS 15 1.2 the dose response for the detoxification of in situ generated ROS by an antioxidant independent of its uptake properties 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131908 16188953 174114 18723 10261 ROS1 ROS ROS 20 1.2 a concentration of 300 microM was able to detoxify >95% ROS generated by xanthine oxidase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131909 16188953 174115 17189 9319 PPP4C PPX PPX 1 0.3 Both PPX and SND were less potent at this concentration ( ~75% 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131910 16188953 174116 18723 10261 ROS1 ROS ROS 1 1.2 Comparable ROS detoxification was achieved at 3 microM EUK-134 and 1 mM 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131911 16188953 174116 17189 9319 PPP4C PPX PPX 14 0.3 achieved at 3 microM EUK-134 and 1 mM for either PPX or SND 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131912 16188953 174117 18723 10261 ROS1 ROS ROS 11 1.2 both enantiomers showed equipotent efficacy in detoxification of xanthine oxidase-generated ROS ( Fig 3A 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131913 16188953 174118 17189 9319 PPP4C PPX PPX 3 0.3 To show that PPX and EUK-134 are able to inhibit mitochondrial hydrogen peroxide release 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131914 16188953 174118 17189 9319 PPP4C PPX PPX 28 0.3 of hydrogen peroxide in succinate-energized mitochondria in the presence of PPX (300 300 microM or EUK-134 (30 30 microM 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131915 16188953 174119 5131 2524 CTRL CTRL Ctrl 25 0.0 the values obtained in the absence of an antioxidant (Ctrl, Ctrl Fig 3B 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 131916 16188953 174120 17189 9319 PPP4C PPX PPX 7 0.3 To evaluate whether these antioxidative properties of PPX and SND are sufficient to confer neuroprotection in a cellular 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131917 16188953 174122 18723 10261 ROS1 ROS ROS 11 1.2 has been described to result in an early increase of ROS (5-10-fold) 5-10-fold followed by a later but massive increase in 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131918 16188953 174122 18723 10261 ROS1 ROS ROS 21 1.2 (5-10-fold) 5-10-fold followed by a later but massive increase in ROS (200-400-fold) 200-400-fold derived from mitochondria and paralleled by the time 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 131919 16188953 174125 17189 9319 PPP4C PPX PPX 7 0.3 In the absence of glutamate incubation with PPX or SND (both both at 1 mM does not significantly 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131920 16188953 174126 17189 9319 PPP4C PPX PPX 0 0.3 PPX SND and EUK were able to prevent glutamate-induced cell death 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131921 16188953 174127 17189 9319 PPP4C PPX PPX 11 0.3 up to 82% remaining viability occurred at 1 mM (PPX PPX and SND and 250 microM (EUK-134) EUK-134 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131922 16188953 174128 17189 9319 PPP4C PPX PPX 0 0.3 PPX SND and EUK-134 were able to protect cells in a 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131923 16188953 174130 17189 9319 PPP4C PPX PPX 22 0.3 Bonferroni's post hoc test resulted in no significant difference between PPX and EUK 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131924 16188953 174131 3897 2665 CD55 DAF DAF 32 1.2 the nitric oxide donor DETA which in the presence of DAF yields the fluorescent DAF-triazole 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131925 16188953 174131 3897 2665 CD55 DAF DAF-triazole 36 1.2 DETA which in the presence of DAF yields the fluorescent DAF-triazole 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131926 16188953 174132 17189 9319 PPP4C PPX PPX 1 0.3 Both PPX and SND ( Fig 4 equally inhibit the generation of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131927 16188953 174132 3897 2665 CD55 DAF DAF-triazole 14 1.2 SND ( Fig 4 equally inhibit the generation of the DAF-triazole 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131928 16188953 174134 17189 9319 PPP4C PPX PPX 17 0.3 have relevance in vivo we tested whether micromolar concentrations of PPX and SND can be achieved in vivo 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131929 16188953 174135 17189 9319 PPP4C PPX PPX 8 0.3 We treated C57BL/6 C57BL 6 mice with high doses of PPX and SND (200 200 mg/kg mg kg p.o for 4 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131930 16188953 174138 17189 9319 PPP4C PPX PPX 11 0.3 was followed by an experiment where mitochondria were isolated after PPX treatment of mice to determine mitochondrial aconitase activity an indicator 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131932 16188953 174139 17189 9319 PPP4C PPX PPX 0 0.3 PPX treatment for 4 days (2 2 x 30 mg/kg) mg 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131935 16188953 174140 17189 9319 PPP4C PPX PPX 18 0.3 mitochondrial aconitase because protein levels were not affected by the PPX treatment ( Fig 5B 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131937 16188953 174141 20996 11179 SOD1 ALS ALS 18 2.2 the G93A-mutant SOD1 a common and well described model of ALS where neuronal cell death is associated with an increase in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131938 16188953 174145 17189 9319 PPP4C PPX PPX 7 0.3 Since we found equipotent antioxidative properties of PPX and SND and no evidence for a transporter which is 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131939 16188953 174145 17189 9319 PPP4C PPX PPX 23 0.3 for a transporter which is involved in the uptake of PPX we tested SND at a high dose of 100 mg/kg 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131940 16188953 174146 17189 9319 PPP4C PPX PPX 0 0.3 PPX was given at a lower dose of 3 mg/kg mg 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131941 16188953 174146 20996 11179 SOD1 ALS ALS 36 2.2 et al. 2001 to test for putative neuroprotection in the ALS model which might be mediated via activation of dopamine receptors 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131942 16188953 174148 17189 9319 PPP4C PPX PPX-treated 2 0.3 In contrast PPX-treated animals show a significant increase by 55% to 23 900 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131943 16188953 174150 17189 9319 PPP4C PPX PPX- 29 0.3 significantly delayed at day 106 105-106 or 109 108-110 in PPX- or SND-treated animals respectively 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131945 16188953 174151 17189 9319 PPP4C PPX PPX-treated 47 0.3 _amp_#177 S.E.M. n = 11 and in comparison to the PPX-treated group (122 122 _amp_#177 2 days log rank test p 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131946 16188953 174152 17189 9319 PPP4C PPX PPX-treated 5 0.3 The survival times of the PPX-treated animals and the control group do not differ significantly (log 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131947 16188953 174155 17189 9319 PPP4C PPX PPX 1 0.3 ABBREVIATIONS PPX pramipexole ALS amyotrophic lateral sclerosis DETA ( Z -1- 2- 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131948 16188953 174155 20996 11179 SOD1 ALS ALS 3 2.2 ABBREVIATIONS PPX pramipexole ALS amyotrophic lateral sclerosis DETA ( Z -1- 2- 2-aminoethyl -N 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00113862687172083<>ScoreDetail__5468|IGFALS|0.000432549337658827__11179|SOD1|0.00113862687172083__ 0 0 0 0 0 131949 16188953 174155 3897 2665 CD55 DAF DAF 30 1.2 EUK-134 SND919CL2x 2-amino-4 5 6 7-tetrahydro-6-L -propylamino-benzathiazole dihydrochloride SND SND919CL2x DAF 4 5-diaminofluorescein HBSS Hanks' balanced salt solution AR Amplex Red 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 131950 16188953 174155 18723 10261 ROS1 ROS ROS 46 1.2 solution AR Amplex Red MS mass spectrometry HRP horseradish peroxidase ROS reactive oxygen species ANOVA analysis of variance FCCP carbonyl cyanide 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132291 16194581 174693 18723 10261 ROS1 ROS ROS 25 0.3 defend against the cellular generation of reactive oxygen species (ROS) ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132292 16194581 174694 18723 10261 ROS1 ROS ROS 1 0.3 These ROS cause oxidative damage to nucleic acid carbohydrate protein and lipids 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132293 16194581 174698 9947 5468 IGFALS ALS ALS 11 1.2 are augmented by neurodegenerative diseases including amyotrophic lateral sclerosis (ALS), ALS Alzheimer's disease (AD), AD and Parkinson's disease (PD) PD 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000574291995604416<>ScoreDetail__5468|IGFALS|0.000365916410969869__11179|SOD1|0.000574291995604416__ 0 0 0 0 0 132294 16194581 174705 9947 5468 IGFALS ALS ALS 13 1.2 in age-related neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), ALS Alzheimer's disease (AD), AD and Parkinson's disease (PD) PD 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000574291995604416<>ScoreDetail__5468|IGFALS|0.000365916410969869__11179|SOD1|0.000574291995604416__ 0 0 0 0 0 132295 16194581 174718 18723 10261 ROS1 ROS ROS 3 0.3 Reactive oxygen species (ROS) ROS collectively refer to oxygen radicals and non-radicals that are readily 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132296 16194581 174719 18723 10261 ROS1 ROS ROS 0 0.3 ROS are the by-products of normal aerobic metabolism 3 and 14 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132297 16194581 174721 18723 10261 ROS1 ROS ROS 3 0.3 The production of ROS is normally counterbalanced by cellular defense systems 24 and 32 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132298 16194581 174722 18723 10261 ROS1 ROS ROS 5 0.3 However about 1% of the ROS escape daily elimination to give rise to oxidative cellular damage 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132299 16194581 174723 18723 10261 ROS1 ROS ROS 7 0.3 The process by which the production of ROS is not effectively neutralized leading to cellular damage is known 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132300 16194581 174730 18723 10261 ROS1 ROS ROS 8 0.3 Also many neurotransmitters themselves are autoxidized to generate ROS 26 53 64 and 71 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132301 16194581 174733 9947 5468 IGFALS ALS ALS 22 1.2 the pathogenesis of neurodegenerative diseases such as AD PD and ALS 9 15 and 77 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000574291995604416<>ScoreDetail__5468|IGFALS|0.000365916410969869__11179|SOD1|0.000574291995604416__ 0 0 0 0 0 132302 16194581 174737 18723 10261 ROS1 ROS ROS 6 0.3 Inflammation is intimately linked to enhanced ROS production 17 29 52 and 56 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132303 16194581 174738 18723 10261 ROS1 ROS ROS 4 0.3 Local unbridled over-production of ROS has been reported in several inflammatory diseases 11 31 and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 132306 16194581 174741 18723 10261 ROS1 ROS ROS 17 0.3 to be activated by inflammation to produce high levels of ROS and cytokines 11 12 58 68 and 84 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133168 16227974 175706 18723 10261 ROS1 ROS ROS 11 0.6 growing body of evidence indicates that reactive oxygen species (ROS), ROS which are primarily generated by mitochondrial metabolism can fuel both 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133169 16227974 175709 18723 10261 ROS1 ROS ROS 6 0.6 Here I review the evidence that ROS contribute to neurodegenerative disease atherosclerosis and cancer and then discuss 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133170 16227974 175710 20996 11179 SOD1 ALS ALS 7 1.7 Oxidents and neurodegeneration Amyotrophic lateral sclerosis ( ALS is a devastating disease that is characterized by motor-neuron degeneration 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000589084383163048<>ScoreDetail__5468|IGFALS|0.000345076216439068__11179|SOD1|0.000589084383163048__ 0 0 0 0 0 133172 16227974 175712 18723 10261 ROS1 ROS ROS 19 0.6 the most tangible clues linking the inappropriate metabolism of cellular ROS to the development of a specific neurological disease 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133174 16227974 175713 20996 11179 SOD1 ALS ALS 9 1.7 That said how disease-causing mutations in SOD1 lead to ALS remains controversial 2 3 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000589084383163048<>ScoreDetail__5468|IGFALS|0.000345076216439068__11179|SOD1|0.000589084383163048__ 0 0 0 0 0 133175 16227974 175715 20996 11179 SOD1 ALS ALS 2 1.7 Similar to ALS most cases are sporadic although a number of dominant and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000589084383163048<>ScoreDetail__5468|IGFALS|0.000345076216439068__11179|SOD1|0.000589084383163048__ 0 0 0 0 0 133176 16227974 175716 16063 16369 PARK7 DJ1 DJ1 24 0.6 been identified including those encoding alpha-synuclein parkin ubiquitin C-terminal hydrolase-1 DJ1 and PTEN-induced kinase-1 ( PINK1 (Refs Refs 2 4 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 133179 16227974 175717 18723 10261 ROS1 ROS ROS 21 0.6 unifying hypothesis is that they trigger an increase in neuronal ROS levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133180 16227974 175722 16063 16369 PARK7 DJ1 DJ1 5 0.6 In addition neurons that lack DJ1 were recently shown to have an increased sensitivity to oxidative 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 133187 16227974 175734 18723 10261 ROS1 ROS ROS 17 0.6 inherited forms of these diseases therefore does not directly involve ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133189 16227974 175743 18723 10261 ROS1 ROS ROS 12 0.6 the mitochondrial protein aconitase have demonstrated that low levels of ROS caused mild oxidation and stimulated degradation whereas higher levels of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133190 16227974 175743 18723 10261 ROS1 ROS ROS 23 0.6 caused mild oxidation and stimulated degradation whereas higher levels of ROS caused aconitase to aggregate and become more resistant to proteasomal 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133192 16227974 175744 18723 10261 ROS1 ROS ROS 14 0.6 evidence indicates that certain intracellular protein aggregates can alter mitochondrial ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133193 16227974 175746 18723 10261 ROS1 ROS ROS 1 0.6 Alternatively ROS might contribute to the progression of these and other diseases 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133194 16227974 175747 18723 10261 ROS1 ROS ROS 8 0.6 Finally it is important to stress that cellular ROS can directly target nuclear DNA 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133195 16227974 175754 18723 10261 ROS1 ROS ROS 11 0.6 exist regarding how risk factors trigger an increase in vascular ROS levels and what oxidant source is responsible for the in 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133197 16227974 175761 18723 10261 ROS1 ROS ROS 12 0.6 in mice with hypercholesterolaemia there is evidence of increased mitochondrial ROS production 27 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133198 16227974 175765 13744 7475 MT-TA TRNA tRNA 9 1.3 Further analysis indeed identified a mutation in a mitochondria-encoded tRNA that was the underlying basis for why members of this 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 133199 16227974 175770 18723 10261 ROS1 ROS ROS 14 0.6 is a considerable amount of literature on the role of ROS as DNA-damaging agents and as potential initiators of tumour formation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133201 16227974 175773 18723 10261 ROS1 ROS ROS 22 0.6 range of peptide growth factors trigger the rapid production of ROS in cells and that this ROS burst is required for 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133202 16227974 175773 18723 10261 ROS1 ROS ROS 28 0.6 the rapid production of ROS in cells and that this ROS burst is required for normal growth-factor signalling 35 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133203 16227974 175774 18723 10261 ROS1 ROS ROS 18 0.6 growth-factor and cytokine signalling has expanded the potential role of ROS in tumour formation and suggests that besides random damage to 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133206 16227974 175776 18723 10261 ROS1 ROS ROS 20 0.6 telangiectasia mutated ( ATM and Ras can all alter intracellular ROS levels 31 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133208 16227974 175777 18723 10261 ROS1 ROS ROS 5 0.6 More importantly the alteration in ROS levels has been linked to the ability of gene products 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133209 16227974 175777 13925 7553 MYC MYC Myc 20 0.0 to the ability of gene products such as Ras and Myc to induce cellular transformation or genomic instability 36 37 2 JUMiner_v2.2 1 0 0 2 7553 TotalCon:2<>7553|MYC|4609|Complete__7869|NOL3|8996|Complete__<>AvaiableGeneRif=2<>BEST:7553|MYC|0.000534467067351009<>ScoreDetail__7553|MYC|0.000534467067351009__7869|NOL3|0.000504227436234179__ 0 0 0 0 0 133210 16227974 175779 18723 10261 ROS1 ROS ROS 4 0.6 In both phenotypes Ras-induced ROS production seems to have a crucial role 39 40 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133215 16227974 175786 18723 10261 ROS1 ROS ROS 10 0.6 Again these results indicate an intimate coupling between cellular metabolism ROS levels and tumour-causing genes ( Fig 3 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133216 16227974 175787 18723 10261 ROS1 ROS ROS 6 0.6 There is also considerable evidence that ROS can modulate the tumour phenotype 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133222 16227974 175796 18723 10261 ROS1 ROS ROS 13 0.6 the family of SIR-2-related proteins (known known as sirtuins and ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133236 16227974 175806 18723 10261 ROS1 ROS ROS 15 0.6 to oxidative challenges and their cells contain lower levels of ROS 57 58 59 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133239 16227974 175811 18723 10261 ROS1 ROS ROS 29 0.6 evidence that this life extension might occur through reduced mitochondrial ROS generation 62 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133240 16227974 175817 18723 10261 ROS1 ROS ROS 9 0.6 For example why has the measurable release of mitochondrial ROS persisted throughout evolution when it is clear that simple increased 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133241 16227974 175817 18723 10261 ROS1 ROS ROS 26 0.6 clear that simple increased expression of antioxidant proteins can reduce ROS levels and apparently prolong lifespan 67 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133242 16227974 175818 18723 10261 ROS1 ROS ROS 6 0.6 Is it the sum of all ROS produced or only mitochondrial-derived oxidants that drive disease and ageing 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133243 16227974 175819 18723 10261 ROS1 ROS ROS 6 0.6 What are the relevant targets of ROS and are the targets the same or different for ageing 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133244 16227974 175820 18723 10261 ROS1 ROS ROS 22 0.6 once we have a more detailed understanding of how mitochondrial ROS are produced and what regulates their release 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133245 16227974 175821 18723 10261 ROS1 ROS ROS 6 0.6 My personal bias is that mitochondrial ROS are not incidentally produced or accidentally released but rather have 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133247 16227974 175822 7503 3657 FES FES Fe-S 54 0.0 as aconitase and components of mitochondrial complex I that contain Fe-S clusters 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133250 16227974 175823 18723 10261 ROS1 ROS ROS-mediated 1 0.0 Another ROS-mediated regulatory role might involve a number of cytosolic stress pathways 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133251 16227974 175824 18723 10261 ROS1 ROS ROS 9 0.6 Indeed I would suggest that the release of mitochondrial ROS is used as a common messenger to sustain stress-activated pathways 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133252 16227974 175824 18723 10261 ROS1 ROS ROS 38 0.6 able to actively regulate and titrate the amount of mitochondrial ROS released 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133253 16227974 175825 18723 10261 ROS1 ROS ROS 14 0.6 comfortable with the regulated release of large amounts of mitochondrial ROS during apoptosis I would suggest that in numerous other contexts 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133254 16227974 175827 18723 10261 ROS1 ROS ROS-regulatory 5 0.0 A potential hint to this ROS-regulatory role is already beginning to emerge 68 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 133255 16227974 175828 18723 10261 ROS1 ROS ROS 6 0.6 It is this regulated release of ROS and this overall stress-signalling function of oxidants that I believe 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133256 16227974 175828 18723 10261 ROS1 ROS ROS 37 0.6 hypertension and protein misfolding and the sustained increase in measurable ROS levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133257 16227974 175830 18723 10261 ROS1 ROS ROS 15 0.6 intimate connection between cellular insult/stress, insult stress the production of ROS and the ultimate development of a disease or ageing phenotype 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133260 16227974 175843 20996 11179 SOD1 ALS ALS 0 1.7 ALS Alzheimer's disease Parkinson's disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000589084383163048<>ScoreDetail__5468|IGFALS|0.000345076216439068__11179|SOD1|0.000589084383163048__ 0 0 0 0 0 133269 16227974 175859 18723 10261 ROS1 ROS ROS 16 0.6 proteins seems to be accelerated by reactive oxygen species (ROS) ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133270 16227974 175860 18723 10261 ROS1 ROS ROS 17 0.6 protein aggregates might affect mitochondria leading to higher levels of ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133271 16227974 175861 18723 10261 ROS1 ROS ROS 14 0.6 a positive-feedback loop that is fuelled by the levels of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133272 16227974 175864 18723 10261 ROS1 ROS ROS 17 0.6 suppressors alter the levels of intracellular reactive oxygen species (ROS) ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133273 16227974 175866 18723 10261 ROS1 ROS ROS 2 0.6 Increased intracellular ROS levels can stimulate several cellular reactions/processes reactions processes that can 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133274 16227974 175870 18723 10261 ROS1 ROS ROS 15 0.6 the physiological and pathophysiological roles of reactive oxygen species (ROS) ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133275 16227974 175871 18723 10261 ROS1 ROS ROS 1 0.6 Mitochondrial ROS production and release is shown by the arrows with the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133276 16227974 175871 18723 10261 ROS1 ROS ROS 14 0.6 release is shown by the arrows with the intensity of ROS indicated by the width of the arrow 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133277 16227974 175873 18723 10261 ROS1 ROS ROS 11 0.6 cytosolic metabolic pathways might also be regulated by these mitochondrial-derived ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133278 16227974 175874 18723 10261 ROS1 ROS ROS 23 0.6 are postulated to in turn titrate the release of mitochondrial ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133279 16227974 175875 18723 10261 ROS1 ROS ROS 4 0.6 This regulated release of ROS has been suggested to be necessary to sustain these stress-activated 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133280 16227974 175876 18723 10261 ROS1 ROS ROS 13 0.6 loop provides a potential explanation for the concordance of increased ROS levels with a number of age-associated diseases 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 133281 16227974 175877 18723 10261 ROS1 ROS ROS 7 0.6 Finally continued cellular stress results in sustained ROS production and the resultant increase in cell death DNA mutations 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134145 16242643 176941 18723 10261 ROS1 ROS ROS 32 0.6 cardiolipin we observed that malonate induced reactive oxygen species (ROS) ROS production to an extent that surpasses the antioxidant defense capacity 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134146 16242643 176943 18723 10261 ROS1 ROS ROS 5 0.6 Moreover minocycline failed to block ROS production and to abrogate malonate-induced oxidation of GSH and cardiolipin 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134150 16242643 176952 17686 9683 PTPRU PTP PTP 37 0.3 opening of the mitochondrial high conductance permeability transition pore (PTP) PTP ( Zhu et al. 2002 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 134153 16242643 176963 18723 10261 ROS1 ROS ROS 12 0.6 of this reversible succinate dehydrogenase inhibitor to cell cultures induced ROS production that resulted in the depletion of glutathione and cardiolipin 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134155 16242643 176983 18723 10261 ROS1 ROS ROS 3 0.6 Intracellular generation of ROS 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134156 16242643 176991 18723 10261 ROS1 ROS ROS 4 0.6 The average relative percent ROS production from at least three separate cultures was determined 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134158 16242643 177024 17686 9683 PTPRU PTP PTP 15 0.3 540 nm ( A 540 indicating mitochondrial swelling due to PTP opening were determined after the addition of different compounds using 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 134160 16242643 177038 19573 10691 SDS SDS SDS 23 0.0 computer Primer Express software program specially provided with the 7000 SDS (Applied Applied Biosystems 1 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000257402387039422<>ScoreDetail__10691|SDS|0.000228444618497487__19440|SBDS|0.000257402387039422__ 0 0 0 0 0 134161 16242643 177052 18723 10261 ROS1 ROS ROS 10 0.6 Tetracyclines have been reported to have the ability to inhibit ROS production in various cell types ( Gabler et al. 1992 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134162 16242643 177056 18723 10261 ROS1 ROS ROS 20 0.6 et al. 2005 and Maragos et al. 2004 malonate increased ROS production in cerebellar granular cell cultures ( Fig 2 B 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134163 16242643 177066 18723 10261 ROS1 ROS ROS 12 0.6 proteins and lipids commonly occurs as a consequence of increased ROS production and depletion of the antioxidant capacity 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134164 16242643 177073 17686 9683 PTPRU PTP PTP 11 0.3 some circumstances mitochondria respond to cellular stress by opening the PTP resulting in the swelling of the organelle 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 134174 16242643 177089 18723 10261 ROS1 ROS ROS 17 0.6 abrogate any of the effects caused by malonate including increased ROS production and the subsequent depletion of GSH and cardiolipin 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134177 16242643 177093 18723 10261 ROS1 ROS ROS 6 0.6 For this reason we began measuring ROS levels in cerebellar granular cells treated with malonate minocycline or 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134178 16242643 177094 18723 10261 ROS1 ROS ROS 4 0.6 As expected malonate increased ROS production in a concentration-dependent manner 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134179 16242643 177097 18723 10261 ROS1 ROS ROS 13 0.6 to previous results showing that minocycline decreases the formation of ROS in various cell types ( Gabler et al. 1992 in 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134180 16242643 177097 18723 10261 ROS1 ROS ROS 35 0.6 our experimental model minocycline failed to prevent malonate-induced rise in ROS production 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134181 16242643 177098 18723 10261 ROS1 ROS ROS 21 0.6 capacity revealed that although this antibiotic decreased the abovementioned basal ROS production it did not modify reduced glutathione levels in cerebellar 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134182 16242643 177100 18723 10261 ROS1 ROS ROS 12 0.6 present data point to cardiolipin as a target of malonate-induced ROS 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134183 16242643 177104 17686 9683 PTPRU PTP PTP 0 0.3 PTP can be monitored by following mitochondrial swelling which interestingly has 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 134184 16242643 177104 13412 7214 MPHOSPH6 MPP MPP 24 0.0 be involved in several death pathways including those induced by MPP staurosporine veratridine malonate or NMDA ( Boada et al. 2000 1 JUMiner_v2.2 1 0 0 2 7214 TotalCon:2<>7214|MPHOSPH6|10200|Complete__7225|MPZ|4359|Complete__<>AvaiableGeneRif=2<>BEST:7214|MPHOSPH6|0.000704914822792246<>ScoreDetail__7214|MPHOSPH6|0.000704914822792246__7225|MPZ|0.000384733731121043__ 0 0 0 0 0 134185 16242643 177105 17686 9683 PTPRU PTP PTP 8 0.3 On the other hand drugs able to block PTP formation afford complete or partial neuroprotection against a broad type 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 134186 16242643 177110 17686 9683 PTPRU PTP PTP 5 0.3 Whether the main mechanism mediating PTP formation that is through an oxidative (e.g., e.g. tert -butyl 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 134187 16242643 177110 22000 11730 TERT TERT tert 13 0.6 mediating PTP formation that is through an oxidative (e.g., e.g. tert -butyl hydroperoxide phenylarsine oxide or non-oxidative (Ca/Pi, Ca Pi t-Bid 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 134189 16242643 177110 17686 9683 PTPRU PTP PTP 48 0.3 et al. 2002 influences the ability of minocycline to block PTP formation needs to be studied further 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 134190 16242643 177111 18723 10261 ROS1 ROS ROS-mediated 21 0.3 capable of blocking mitochondrial swelling when this process is mainly ROS-mediated as it is the case for malonate ( Fern_amp_#xe1 ndez-G_amp_#xf3 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 134191 16242643 177113 13412 7214 MPHOSPH6 MPP MPP 20 0.0 to block the effect of the mitochondrial toxin 1-methyl-4-phenylpyridinium (MPP MPP on mitochondrial swelling and also postulated a lack of direct 1 JUMiner_v2.2 1 0 0 2 7214 TotalCon:2<>7214|MPHOSPH6|10200|Complete__7225|MPZ|4359|Complete__<>AvaiableGeneRif=2<>BEST:7214|MPHOSPH6|0.000704914822792246<>ScoreDetail__7214|MPHOSPH6|0.000704914822792246__7225|MPZ|0.000384733731121043__ 0 0 0 0 0 134198 16242643 177146 17686 9683 PTPRU PTP PTP 7 0.3 The effect of 50 _amp_#x3bc M minocycline on PTP was also measured 1 JUMiner_v2.2 1 2 permeability transition pore 0 2 9683 TotalCon:2<>9683|PTPRU|10076|Complete__9951|REG1A|5967|Complete__<>AvaiableGeneRif=2<>BEST:9683|PTPRU|0.000368527731711811<>ScoreDetail__9951|REG1A|0.000265498473383778__9683|PTPRU|0.000368527731711811__ 0 0 0 0 0 129625 16406002 170390 18723 10261 ROS1 ROS ROS 12 0.0 oxidative stress the production of highly reactive oxygen species (ROS) ROS overwhelms antioxidant defenses resulting in the modification of macromolecules and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 129626 16406002 170407 6554 3309 ELA2 HNE HNE 9 0.9 of such toxic compounds are 4-oxonon-2-enal (ONE), ONE 4-hydroxynon-2-enal (HNE), HNE and acrolein which contain an _amp_#x3b2 -unsaturated aldehyde capable of 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129630 16406002 170424 19572 10690 SDPR SDR SDR 42 0.3 aldo-keto reductases (AKR) AKR 12 and the short-chain dehydrogenases (SDR) SDR 13 (to to which Sniffer belongs 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129631 16406002 170428 19572 10690 SDPR SDR SDR 8 0.3 Like CR the Sniffer protein belongs to the SDR superfamily 13 and both enzymes share all the essential motifs 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129632 16406002 170439 6554 3309 ELA2 HNE HNE 16 0.9 to be both more neurotoxic and more protein reactive than HNE 8 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129633 16406002 170440 6554 3309 ELA2 HNE HNE 9 0.9 NADPH-dependent ONE ketone reduction resulted in the production of HNE and ONE aldehyde reduction yielded 1-hydroxynon-2-en-4-one (HNO) HNO 17 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129635 16406002 170444 6554 3309 ELA2 HNE HNE 11 0.9 addition the fact that CR produces another reactive lipid aldehyde HNE from ONE may indicate that AKR1B1 is the more important 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129637 16406002 170446 6554 3309 ELA2 HNE HNE 4 0.9 First ONE but not HNE is the major product of breakdown of lipid hydroperoxides and 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129638 16406002 170446 6554 3309 ELA2 HNE HNE 30 0.9 were detected as a result from ONE rather than from HNE 19 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129639 16406002 170447 6554 3309 ELA2 HNE HNE 12 0.9 ONE is both more neurotoxic and more protein reactive than HNE 8 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129640 16406002 170451 6554 3309 ELA2 HNE HNE 2 0.9 HNO and HNE are much less reactive toward thiols than ONE (i.e., i.e. 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129641 16406002 170451 6554 3309 ELA2 HNE HNE 18 0.9 than ONE (i.e., i.e. 55-fold for HNO and 110-fold for HNE but are still electrophilic Michael acceptors 20 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129642 16406002 170452 6554 3309 ELA2 HNE HNE 0 0.9 HNE in turn is a substrate for AKR1B1 (carbonyl carbonyl reduction 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 129644 16406002 170458 6554 3309 ELA2 HNE HNE 7 0.9 Abbreviations DHN = 4-dihydroxynonene HNA = 4-hydroxynonan-acid HNE = 4-hydroxynon-2-enal HNO = 1-hydroxynon-2-en-4-one ONA = 4-oxononanal ONE = 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 118661 16440303 154887 20996 11179 SOD1 ALS ALS 3 1.4 Amyotrophic lateral sclerosis (ALS) ALS is a progressive neurodegenerative disorder disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00135071453864046<>ScoreDetail__5468|IGFALS|0.000606167756926729__11179|SOD1|0.00135071453864046__ 0 0 0 0 0 118662 16440303 154888 20996 11179 SOD1 ALS ALS 4 1.4 Ten percent of the ALS patients are congenital (familial familial ALS and the other 90% 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00135071453864046<>ScoreDetail__5468|IGFALS|0.000606167756926729__11179|SOD1|0.00135071453864046__ 0 0 0 0 0 118663 16440303 154888 20996 11179 SOD1 ALS ALS 9 1.4 Ten percent of the ALS patients are congenital (familial familial ALS and the other 90% are sporadic ALS (SALS) SALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00135071453864046<>ScoreDetail__5468|IGFALS|0.000606167756926729__11179|SOD1|0.00135071453864046__ 0 0 0 0 0 118664 16440303 154888 20996 11179 SOD1 ALS ALS 16 1.4 congenital (familial familial ALS and the other 90% are sporadic ALS (SALS) SALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00135071453864046<>ScoreDetail__5468|IGFALS|0.000606167756926729__11179|SOD1|0.00135071453864046__ 0 0 0 0 0 118665 16440303 154889 20996 11179 SOD1 ALS ALS 15 1.4 found in the Cu Zn-SOD cause 20% of the familial ALS due to its low enzyme activity 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00135071453864046<>ScoreDetail__5468|IGFALS|0.000606167756926729__11179|SOD1|0.00135071453864046__ 0 0 0 0 0 118666 16440303 154896 18723 10261 ROS1 ROS ROS 17 0.0 and chaperone proteins proteins involved in reactive oxygen species (ROS), ROS enzyme proteins and proteins that mediated cell death and survival 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 109933 16546755 143260 9947 5468 IGFALS ALS ALS 3 0.3 Amyotrophic lateral sclerosis (ALS) ALS is a progressive lethal neurodegenerative disease that selectively affects motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000980643603940679<>ScoreDetail__5468|IGFALS|0.0009758382450525__11179|SOD1|0.000980643603940679__ 0 0 0 0 0 109934 16546755 143261 18723 10261 ROS1 ROS ROS 3 0.3 Reactive oxygen species (ROS) ROS are assumed to be involved in the pathogenesis of ALS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 109935 16546755 143261 9947 5468 IGFALS ALS ALS 13 0.3 ROS are assumed to be involved in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000980643603940679<>ScoreDetail__5468|IGFALS|0.0009758382450525__11179|SOD1|0.000980643603940679__ 0 0 0 0 0 109936 16546755 143262 18723 10261 ROS1 ROS ROS 8 0.3 Metallothioneins (MTs) MTs are self-protective multifunctional proteins that scavenge ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 109937 16546755 143264 9947 5468 IGFALS ALS ALS 12 0.3 been suggested to have important roles in the pathophysiology of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000980643603940679<>ScoreDetail__5468|IGFALS|0.0009758382450525__11179|SOD1|0.000980643603940679__ 0 0 0 0 0 113359 16624679 147570 20996 11179 SOD1 SOD1 SOD1 8 3.7 G93ASOD1 cells died more than untransfected and wild-type SOD1 cells after 6 and 24 h exposure to 12.5 _amp_#x3bc 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 113360 16624679 147575 20996 11179 SOD1 SOD1 SOD1 21 3.7 their basal level was higher than in untransfected and wild-type SOD1 cells 1 JUMiner_v2.2 1 2 32 0 0 0 0 0 0 0 0 113361 16624679 147580 20996 11179 SOD1 ALS ALS 16 2.7 and death of motor neurons in amyotrophic lateral sclerosis (ALS), ALS which occurs in clinically and pathologically similar sporadic (SALS) SALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00142357144152476<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00142357144152476__ 0 0 0 0 0 113362 16624679 147581 20996 11179 SOD1 ALS ALS 16 2.7 suggested by ultrastructural studies showing mitochondrial abnormalities in tissues of ALS patients including in the early stages of the disease the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00142357144152476<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00142357144152476__ 0 0 0 0 0 113364 16624679 147585 18723 10261 ROS1 ROS ROS 12 0.0 also the major intracellular source of reactive oxygen species (ROS), ROS which are by-products of respiration 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113365 16624679 147586 18723 10261 ROS1 ROS ROS 11 0.0 mitochondrial dysfunction can lead to defective ATP production and increased ROS formation 1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113366 16624679 147587 20996 11179 SOD1 ALS ALS 27 2.7 to neuronal cell death including that of motor neurons in ALS 46 and 13 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00142357144152476<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00142357144152476__ 0 0 0 0 0 113367 16624679 147587 18723 10261 ROS1 ROS ROS 12 0.0 the result of an imbalance between production and degradation of ROS has long been linked to neuronal cell death including that 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113368 16624679 147588 20996 11179 SOD1 ALS ALS 26 2.7 37 a function that has been thoroughly investigated to understand ALS pathogenesis 44 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00142357144152476<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00142357144152476__ 0 0 0 0 0 113373 16624679 147592 20996 11179 SOD1 ALS ALS 9 2.7 The identification of SOD1 mutations as a cause of ALS has served for creating experimental models of the disease expressing 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00142357144152476<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00142357144152476__ 0 0 0 0 0 113375 16624679 147593 20996 11179 SOD1 ALS ALS 19 2.7 also replicate alterations in the activities of ETC observed in ALS patients 7 33 32 42 and 9 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00142357144152476<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00142357144152476__ 0 0 0 0 0 113380 16624679 147606 7361 20442 FBRS FBS FBS 19 0.0 high-glucose DMEM Biochrom Berlin Germany supplemented with 5% heat-inactivated defined FBS (defined defined FBS Hyclone Logan UT USA 1 mM glutamine 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 113381 16624679 147606 7361 20442 FBRS FBS FBS 21 0.0 Berlin Germany supplemented with 5% heat-inactivated defined FBS (defined defined FBS Hyclone Logan UT USA 1 mM glutamine 1 mM pyruvate 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 113382 16624679 147615 18723 10261 ROS1 ROS ROS 17 0.0 potential (_amp_#x394; _amp_#x394 _amp_#x3a8 m and reactive oxygen species (ROS) ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113383 16624679 147620 6603 3331 EMD EMD EMD 9 0.0 viability was determined with propidium iodide (PI) PI (Calbiochem, Calbiochem EMD Biosciences Inc. San Diego CA USA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113384 16624679 147627 18723 10261 ROS1 ROS ROS 1 0.0 Intracellular ROS were measured with 2_amp_#x2032 7_amp_#x2032 -dichlorodihydrofluorescein diacetate (Sigma_amp_#x2013;Aldrich Sigma_amp_#x2013 Aldrich 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113389 16624679 147678 18723 10261 ROS1 ROS ROS 4 0.0 Effect of rotenone on ROS generation in untransfected and transfected NSC-34 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113391 16624679 147679 18723 10261 ROS1 ROS ROS 26 0.0 we considered the possibility of a toxicity pathway mediated by ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113392 16624679 147680 18723 10261 ROS1 ROS ROS 0 0.0 ROS formation was studied by biparametric DCF_amp_#x2013 PI flow cytometry 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113393 16624679 147684 18723 10261 ROS1 ROS ROS 12 0.0 h exposure to rotenone there was a significant increase of ROS formation in all three lines ( p _amp_#x3c 0.001 versus 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113394 16624679 147691 18723 10261 ROS1 ROS ROS 19 0.0 and irreversibly inhibits complex I of the ETC the main ROS generating site in mitochondria 27 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113396 16624679 147694 18723 10261 ROS1 ROS ROS 18 0.0 by looking at changes in _amp_#x394 _amp_#x3a8 m ATP and ROS levels _amp_#x394 _amp_#x3a8 m (positive positive on the outside and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113397 16624679 147695 24185 29175 WDTC1 ADP ADP 20 0.3 out of the inner mitochondrial membrane to generate ATP from ADP and phosphate (by by F0F1-ATPase and to regulate mitochondrial protein 3 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 113398 16624679 147712 18723 10261 ROS1 ROS ROS 7 0.0 Mitochondrial membrane hyperpolarization has been linked to ROS formation 23 and 47 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113399 16624679 147713 18723 10261 ROS1 ROS ROS 1 0.0 Cellular ROS production increased after rotenone treatment 5 49 and 34 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113400 16624679 147713 18723 10261 ROS1 ROS ROS 16 0.0 rotenone treatment 5 49 and 34 and in HL-60 mitochondrial ROS were responsible for cell death 29 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113401 16624679 147714 18723 10261 ROS1 ROS ROS 2 0.0 Exposure to ROS favors opening of the mitochondrial permeability transition pore a channel 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113402 16624679 147715 18723 10261 ROS1 ROS ROS 8 0.0 This causes mitochondrial membrane depolarization so we studied ROS production to clarify how oxidative stress affected the selective susceptibility 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113403 16624679 147716 18723 10261 ROS1 ROS ROS 5 0.0 Rotenone caused comparable increases of ROS in untransfected and transfected cells however like before rotenone treatment 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113404 16624679 147716 18723 10261 ROS1 ROS ROS 21 0.0 however like before rotenone treatment G93ASOD1 cells had the highest ROS level indicating a persistent stronger oxidative environment in these motor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113408 16624679 147718 18723 10261 ROS1 ROS ROS-derived 5 0.0 The idea that in FALS ROS-derived toxicity might affect the mitochondria is reinforced by the finding 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113409 16624679 147720 18723 10261 ROS1 ROS ROS 25 0.0 permeability transition pore components adding its effect to that of ROS formed in mitochondria after rotenone 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113410 16624679 147722 24185 29175 WDTC1 ADP ADP 21 0.3 of the mitochondrial permeability transition pore by affecting ATP/ADP ATP ADP binding sites 21 3 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 113416 16624679 147728 20996 11179 SOD1 ALS ALS 17 2.7 in the search for factors contributing to the etiology of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00142357144152476<>ScoreDetail__5468|IGFALS|0.00040551500405515__11179|SOD1|0.00142357144152476__ 0 0 0 0 0 113423 16624679 147735 24185 29175 WDTC1 ADP ADP 5 0.3 Cytosolic ATP is converted to ADP which re-enters the mitochondrial matrix 3 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 113435 16624679 147753 18723 10261 ROS1 ROS ROS 5 0.0 Fig 6._amp_#xa0 Effect of rotenone on ROS production 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 113436 16624679 147754 18723 10261 ROS1 ROS ROS 0 0.0 ROS were measured on the basis of the conversion of 2_amp_#x2032 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103403 16681429 132318 20996 11179 SOD1 ALS ALS 15 1.9 erythrocytes from sporadic amyotrophic lateral sclerosis (SALS) SALS and familial ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00152035411554691<>ScoreDetail__5468|IGFALS|0.00098049896502887__11179|SOD1|0.00152035411554691__ 0 0 0 0 0 103404 16681429 132319 20996 11179 SOD1 ALS ALS 22 1.9 important factor in the pathogenesis of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00152035411554691<>ScoreDetail__5468|IGFALS|0.00098049896502887__11179|SOD1|0.00152035411554691__ 0 0 0 0 0 103407 16681429 132323 20996 11179 SOD1 ALS ALS 26 1.9 GSH-Px and glutathione reductase (GR) GR in erythrocytes from sporadic ALS patients SALS (-/+)], - familial ALS patients with the Leu144Phe 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00152035411554691<>ScoreDetail__5468|IGFALS|0.00098049896502887__11179|SOD1|0.00152035411554691__ 0 0 0 0 0 103408 16681429 132323 20996 11179 SOD1 ALS ALS 31 1.9 in erythrocytes from sporadic ALS patients SALS (-/+)], - familial ALS patients with the Leu144Phe mutation in the SOD1 gene FALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00152035411554691<>ScoreDetail__5468|IGFALS|0.00098049896502887__11179|SOD1|0.00152035411554691__ 0 0 0 0 0 103412 16681429 132324 5532 2719 DDC DDC DDC 9 0.0 We also examined the in vitro effect of diethyldithiocarbamate (DDC) DDC on CuZn SOD activity in erythrocytes from FALS patients SALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 103417 16681429 132329 3544 1516 CAT CAT CAT 0 1.0 CAT activity was decreased in both SALS and FALS patients 1 JUMiner_v2.2 1 2 35 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 103419 16681429 132331 5532 2719 DDC DDC DDC 1 0.0 Finally DDC inhibited CuZn SOD activity in erythrocytes from control subjects FALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 106246 16764863 137537 832 549 AOC2 RAO Rao 2 0.0 Shyam D Rao a Sandra Anne Banack b c Paul Alan Cox c 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 106247 16764863 137545 9947 5468 IGFALS ALS ALS 3 0.3 Amyotrophic lateral sclerosis (ALS) ALS is an adult onset neurodegenerative disease characterized by the selective 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106248 16764863 137548 9947 5468 IGFALS ALS ALS 25 0.3 the disease known as Guam ALS_amp_#x2013 Parkinsonism Dementia Complex (ALS/PDC) ALS PDC 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106249 16764863 137548 16271 8759 PDC PDC PDC 25 0.3 disease known as Guam ALS_amp_#x2013 Parkinsonism Dementia Complex (ALS/PDC) ALS PDC 4 JUMiner_v2.2 1 2 UserEdit 0 2 8759 TotalCon:2<>8759|PDC|5132|Complete__9153|PNKD|25953|Complete__<>AvaiableGeneRif=2<>BEST:8759|PDC|0.00141292829388909<>ScoreDetail__8759|PDC|0.00141292829388909__9153|PNKD|0.000468237864835336__ 1 1 0 0 0 106250 16764863 137549 9947 5468 IGFALS ALS ALS 4 0.3 In the 1950s the ALS incidence and death rate among the indigenous Chamorro people of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106251 16764863 137550 9947 5468 IGFALS ALS ALS 4 0.3 The Guam form of ALS shows the same pattern of selective MN death with the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106252 16764863 137551 9947 5468 IGFALS ALS ALS 19 0.3 but typically onset is 10_amp_#xa0 years later in life than ALS ( Mulder et al. 1954 and Kurland 1988 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106253 16764863 137551 16271 8759 PDC PDC PDC 9 0.0 Variant forms often exhibit Parkinsonism and an Alzheimer's-like dementia (PDC), PDC but typically onset is 10_amp_#xa0 years later in life than 1 JUMiner_v2.2 1 0 0 2 8759 TotalCon:2<>8759|PDC|5132|Complete__9153|PNKD|25953|Complete__<>AvaiableGeneRif=2<>BEST:8759|PDC|0.00141292829388909<>ScoreDetail__8759|PDC|0.00141292829388909__9153|PNKD|0.000468237864835336__ 0 0 0 0 0 106254 16764863 137556 9947 5468 IGFALS ALS ALS-like 26 0.3 doses of BMAA developed clinical electrophysiological and neuropathological evidence of ALS-like motor dysfunction ( Spencer et al. 1987 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106255 16764863 137558 9947 5468 IGFALS ALS ALS 7 0.3 However the relevance of BMAA to Guam ALS was called into question as the concentrations present in washed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106256 16764863 137559 9947 5468 IGFALS ALS ALS 9 0.3 Further study of BMAA as a putative cause of ALS/PDC ALS PDC was largely discontinued 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106257 16764863 137559 16271 8759 PDC PDC PDC 9 0.3 study of BMAA as a putative cause of ALS/PDC ALS PDC was largely discontinued 4 JUMiner_v2.2 1 2 UserEdit 0 2 8759 TotalCon:2<>8759|PDC|5132|Complete__9153|PNKD|25953|Complete__<>AvaiableGeneRif=2<>BEST:8759|PDC|0.00141292829388909<>ScoreDetail__8759|PDC|0.00141292829388909__9153|PNKD|0.000468237864835336__ 1 1 0 0 0 106258 16764863 137562 9947 5468 IGFALS ALS ALS 46 0.3 in brain tissue from Chamorros who died of Guam ALS/PDC ALS PDC ( Cox et al. 2003 Murch et al. 2004a 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106259 16764863 137562 16271 8759 PDC PDC PDC 46 0.3 brain tissue from Chamorros who died of Guam ALS/PDC ALS PDC ( Cox et al. 2003 Murch et al. 2004a and 4 JUMiner_v2.2 1 2 UserEdit 0 2 8759 TotalCon:2<>8759|PDC|5132|Complete__9153|PNKD|25953|Complete__<>AvaiableGeneRif=2<>BEST:8759|PDC|0.00141292829388909<>ScoreDetail__8759|PDC|0.00141292829388909__9153|PNKD|0.000468237864835336__ 1 1 0 0 0 106260 16764863 137565 9947 5468 IGFALS ALS ALS 35 0.3 with which BMAA injures MNs the principal neurons affected in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106261 16764863 137566 9947 5468 IGFALS ALS ALS 10 0.3 than 50_amp_#xa0 years of study the cause of Guam ALS/PDC ALS PDC remains enigmatic 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106262 16764863 137566 16271 8759 PDC PDC PDC 10 0.3 50_amp_#xa0 years of study the cause of Guam ALS/PDC ALS PDC remains enigmatic 4 JUMiner_v2.2 1 2 UserEdit 0 2 8759 TotalCon:2<>8759|PDC|5132|Complete__9153|PNKD|25953|Complete__<>AvaiableGeneRif=2<>BEST:8759|PDC|0.00141292829388909<>ScoreDetail__8759|PDC|0.00141292829388909__9153|PNKD|0.000468237864835336__ 1 1 0 0 0 106263 16764863 137567 9947 5468 IGFALS ALS ALS 12 0.3 to identify mechanisms contributing to the loss of MNs in ALS and gleaning clues to disease processes which may be common 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106264 16764863 137567 9947 5468 IGFALS ALS ALS 24 0.3 gleaning clues to disease processes which may be common to ALS Parkinson's disease and Alzheimer's disease calls for further investigation of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106266 16764863 137591 832 549 AOC2 RAO Rao 16 0.0 primarily as described previously ( Carriedo et al. 1996 and Rao et al. 2003 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 106268 16764863 137618 19254 10472 RUNX2 CCD CCD 39 0.0 emitted fluorescence signals were collected using a 12-bit cooled digital CCD camera (Orca-100; Orca-100 Hamamatsu Bridgewater NJ 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 106269 16764863 137621 8255 4236 GFER HSS HSS 24 0.3 2.5_amp_#xa0 _amp_#x3bc M Fura-2 AM in HEPES buffered solution (HSS) HSS containing 0.2% pluronic acid and 1.5% dimethylsulfoxide (DMSO) DMSO for 1 JUMiner_v2.2 1 2 UserEdit 0 2 4236 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:4236|GFER|0.000388712105333359<>ScoreDetail__4236|GFER|0.000388712105333359__14524|SPAG9|0.000153540071796203__10818|SGSH|0.000190102021418161__15894|PANK2|0.000282834379169662__ 1 1 0 0 0 106270 16764863 137622 8255 4236 GFER HSS HSS 5 0.3 Cultures were then washed in HSS and kept in the dark for an additional 30_amp_#xa0 min 1 JUMiner_v2.2 1 2 UserEdit 0 2 4236 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:4236|GFER|0.000388712105333359<>ScoreDetail__4236|GFER|0.000388712105333359__14524|SPAG9|0.000153540071796203__10818|SGSH|0.000190102021418161__15894|PANK2|0.000282834379169662__ 1 1 0 0 0 106271 16764863 137627 18723 10261 ROS1 ROS ROS 0 0.3 ROS generation was monitored by use of the oxidation-sensitive dye HEt 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106272 16764863 137628 8255 4236 GFER HSS HSS 7 0.3 Cultures were loaded with 5_amp_#xa0 _amp_#x3bc M HEt in HSS for 45_amp_#xa0 min at 25_amp_#xb0 C and then washed into 1 JUMiner_v2.2 1 2 UserEdit 0 2 4236 TotalCon:4<>4236|GFER|2671|Complete__15894|PANK2|80025|Complete__10818|SGSH|6448|Complete__14524|SPAG9|9043|Complete__<>AvaiableGeneRif=4<>BEST:4236|GFER|0.000388712105333359<>ScoreDetail__4236|GFER|0.000388712105333359__14524|SPAG9|0.000153540071796203__10818|SGSH|0.000190102021418161__15894|PANK2|0.000282834379169662__ 1 1 0 0 0 106273 16764863 137632 18723 10261 ROS1 ROS ROS 8 0.3 Because HEt fluorescence is cumulative the rate of ROS generation was assessed as the rate of increase (or or 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106274 16764863 137632 18723 10261 ROS1 ROS ROS 31 0.3 F x / F 0 curves over time and net ROS production was assessed as the increase in F x / 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106275 16764863 137651 18723 10261 ROS1 ROS ROS 9 0.3 BMAA induces high Ca 2 i rises and ROS generation in MNs 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106276 16764863 137653 17319 9413 PRKDC HYRC Hyrc 28 1.3 et al. 1993 Choi 1994 Lu et al. 1996 and Hyrc et al. 1997 2 JUMiner_v2.2 1 2 34 0 0 0 0 0 0 0 0 106277 16764863 137658 18723 10261 ROS1 ROS ROS 13 0.3 demonstrated that glutamate-receptor-mediated Ca 2 entry triggers the generation of ROS ( Lafon-Cazal et al. 1993 Dugan et al. 1995 Reynolds 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106278 16764863 137659 18723 10261 ROS1 ROS ROS 10 0.3 We therefore proceeded to examine the effects of BMAA on ROS production in MNs using the oxidant-sensitive fluorophore hydroethidine (HEt) HEt 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106279 16764863 137662 18723 10261 ROS1 ROS ROS 2 0.3 The BMAA-induced ROS generation was dose-dependent and paralleling the Ca 2 i rises 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106280 16764863 137675 832 549 AOC2 RAO Rao 18 0.0 previously established astrocytic monolayer ( Carriedo et al. 1996 and Rao et al. 2003 _amp_#x2013 is ideally suited for this type 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 106281 16764863 137680 18723 10261 ROS1 ROS ROS 12 0.3 toxic receptor activation caused high Ca 2 i rises and ROS generation in MNs suggesting a largely oxidative mechanism of injury 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106282 16764863 137683 9947 5468 IGFALS ALS ALS 8 0.3 Any plausible hypothesis regarding a proposed cause of ALS should be capable of explaining the selective loss of MNs 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106283 16764863 137686 9947 5468 IGFALS ALS ALS 24 0.3 populations of neurons that are largely resistant to injury in ALS ( Nunn et al. 1987 Ross et al. 1987 Weiss 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106284 16764863 137693 9947 5468 IGFALS ALS ALS 29 0.3 consistent with the pattern of selective neuronal loss seen in ALS and lends further support to its potential role as an 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106285 16764863 137699 9947 5468 IGFALS ALS ALS 9 0.3 Furthermore suggesting the possible relevance of this finding to ALS studies by ourselves and others have found MNs also to 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106286 16764863 137700 18723 10261 ROS1 ROS ROS 26 0.3 part from Ca 2 uptake into mitochondria with resultant mitochondrial ROS generation ( Lafon-Cazal et al. 1993 Dugan et al. 1995 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106287 16764863 137701 18723 10261 ROS1 ROS ROS 60 0.3 Ca 2 entry through this route can also cause mitochondrial ROS generation ( Carriedo et al. 1998 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106288 16764863 137703 18723 10261 ROS1 ROS ROS 44 0.3 with consequent disruption of function of these organelles and strong ROS generation ( Carriedo et al. 2000 and Bergmann and Keller 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106289 16764863 137705 18723 10261 ROS1 ROS ROS 31 0.3 2 entry through Ca-A/K Ca-A K channels and consequent mitochondrial ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106290 16764863 137706 9947 5468 IGFALS ALS ALS 9 0.3 Similar injury mechanisms may apply to sporadic forms of ALS where decreased glutamate uptake capacity in the spinal cord and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106291 16764863 137709 9947 5468 IGFALS ALS ALS 10 0.3 Consistent with its postulated role in the Guam form of ALS a low dilution of cycad extract caused virtually no injury 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106292 16764863 137716 9947 5468 IGFALS ALS ALS 6 0.3 Consistent with a role in Guam ALS BMAA acts through AMPA/kainate AMPA kainate receptors to induce preferential 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106293 16764863 137717 9947 5468 IGFALS ALS ALS 118 0.3 clues that this toxin may provide to the etiologies of ALS as well as of Parkinson's and Alzheimer's diseases 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000473617188114607<>ScoreDetail__5468|IGFALS|0.000309445364690464__11179|SOD1|0.000473617188114607__ 0 0 0 0 0 106294 16764863 137741 18723 10261 ROS1 ROS ROS 5 0.3 Fig 3._amp_#xa0 BMAA exposure causes preferential ROS generation in MNs 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106295 16764863 137749 18723 10261 ROS1 ROS ROS 0 0.3 ROS generation is assessed by normalizing HEt fluorescence to baseline levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 106296 16764863 137752 18723 10261 ROS1 ROS ROS 4 0.3 BMAA induced significantly greater ROS production in MNs than other spinal neurons after 30_amp_#xa0 min 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 100194 16877542 128986 18723 10261 ROS1 ROS ROS 4 0.0 In Situ Visualization of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100195 16877542 128991 6327 15531 EBNA1BP2 P40 P-40 9 0.3 Supernatants of mouse spinal cord tissue homogenized in Nonidet P-40 buffer containing 50 mM DTT were collected and incubated (at 11 JUMiner_v2.2 1 2 nonidet 0 2 6871 TotalCon:9<>682|ARHGEF2|9181|Complete__15531|EBNA1BP2|10969|Complete__9565|PSMD7|5713|Complete__6029|IL9|3578|Complete__6508|LANCL1|10314|No_GeneRif__6502|RPSA|3921|Complete__6871|MAPK1|5594|Complete__16896|RABEPK|10244|Complete__15979|TP63|8626|Complete__<>AvaiableGeneRif=8<>BEST:6871|MAPK1|0.000752624094504684<>ScoreDetail__15979|TP63|0.000496127774993406__16896|RABEPK|0.000101282916948008__6502|RPSA|0.000521222028738287__15531|EBNA1BP2|0.000738701616486897__682|ARHGEF2|0.000595108664553268__9565|PSMD7|0.000248157574288567__6029|IL9|0.000644004922037618__6871|MAPK1|0.000752624094504684__ 0 0 0 0 0 100207 16877542 129018 3884 1659 CD33 p67 p67 4 0.0 The levels of the p67 phox subunit that contains the NADPH-binding site of the NADPH 1 JUMiner_v2.2 1 0 0 2 1659 TotalCon:2<>1659|CD33|945|Complete__16672|METAP2|10988|Complete__<>AvaiableGeneRif=2<>BEST:1659|CD33|0.000776415125613499<>ScoreDetail__1659|CD33|0.000776415125613499__16672|METAP2|0.000718318559914951__ 0 0 0 0 0 100211 16877542 129024 18723 10261 ROS1 ROS ROS 20 0.0 in transgenic SOD1 G93A mice by probing for formation of ROS and evidence of protein oxidation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100212 16877542 129025 18723 10261 ROS1 ROS ROS 7 0.0 In nontransgenic mice spinal cord production of ROS evidenced by the fluorescence emitted by ethidium the oxidation product 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100272 16877542 129061 18723 10261 ROS1 ROS ROS 1 0.0 Microglial-Derived ROS Recapitulate the IGF1/Akt IGF1 Akt Pathway Defect in Vitro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100275 16877542 129062 18723 10261 ROS1 ROS ROS 7 0.0 To test the idea that NADPH oxidase-derived ROS could impair IGF1 pathway function an in vitro cell system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100295 16877542 129074 18723 10261 ROS1 ROS ROS 40 0.0 morphology of resting microglia and did not seem to produce ROS ( Figs 1 and 6 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100306 16877542 129079 18723 10261 ROS1 ROS ROS 24 0.0 in transgenic SOD1 G93A mice eliminates the production of microglial-derived ROS ( Fig 1 M and importantly prolongs survival and retards 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100317 16877542 129085 18723 10261 ROS1 ROS ROS 28 0.0 their plasma membrane proteins and lipids damaged by NADPH oxidase-derived ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100321 16877542 129088 18723 10261 ROS1 ROS ROS 6 0.0 First at that lower level of ROS production oxidative stress may not kill cells but instead may 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100332 16877542 129095 18723 10261 ROS1 ROS ROS 39 0.0 receptor including autophosphorylation and Akt phosphorylation were indeed abated by ROS in a microglial NADPH oxidase-dependent manner 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100357 16877542 129124 18723 10261 ROS1 ROS ROS 8 0.0 Modulation of the IGF1/Akt IGF1 Akt pathway by NADPH oxidase-derived ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100361 16877542 129128 18723 10261 ROS1 ROS ROS 4 0.0 Glucose oxidase- and microglial-derived ROS impair the IGF1 Akt pathway in vitro 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100367 16877542 129130 18723 10261 ROS1 ROS ROS 0 0.0 ROS reactive oxygen species SOD1 superoxide dismutase 1 IGF1 insulin-like growth 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100376 16877542 129138 18723 10261 ROS1 ROS ROS 12 0.0 mediators that could promote neurodegeneration are reactive oxygen species (ROS) ROS produced by the enzyme NADPH oxidase complex ( 7 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100377 16877542 129139 18723 10261 ROS1 ROS ROS-generating 2 0.0 Although this ROS-generating multimeric oxidase is indispensable for protecting the host against invading 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 100380 16877542 129143 18723 10261 ROS1 ROS ROS-generating 29 0.0 provide compelling evidence that supports the concept that this microglial ROS-generating enzymatic complex promotes spinal cord motor neuron degeneration by a 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 101473 16895581 130036 18723 10261 ROS1 ROS ROS 3 0.0 Reactive oxygen species (ROS) ROS play a major role in the pathogenesis of neurodegenerative diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 101474 16895581 130038 18723 10261 ROS1 ROS ROS 5 0.0 A major proportion of cellular ROS is generated at the inner mitochondrial membrane by the respiratory 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 101475 16895581 130039 20996 11179 SOD1 ALS ALS 36 2.7 in the G93A mouse model of amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0015288472966802<>ScoreDetail__5468|IGFALS|0.000391668150258145__11179|SOD1|0.0015288472966802__ 0 0 0 0 0 101477 16895581 130043 20996 11179 SOD1 ALS ALS 19 2.7 oxidative stress is a therapeutic option for the treatment of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.0015288472966802<>ScoreDetail__5468|IGFALS|0.000391668150258145__11179|SOD1|0.0015288472966802__ 0 0 0 0 0 94441 17014688 122442 20996 11179 SOD1 ALS ALS 4 1.7 Reduced oxidative damage in ALS by high-dose enteral melatonin treatment 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00125167522188788<>ScoreDetail__5468|IGFALS|0.000719646345224633__11179|SOD1|0.00125167522188788__ 0 0 0 0 0 94442 17014688 122443 20996 11179 SOD1 ALS ALS 3 1.7 Amyotrophic lateral sclerosis (ALS) ALS is the collective term for a fatal motoneuron disease of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00125167522188788<>ScoreDetail__5468|IGFALS|0.000719646345224633__11179|SOD1|0.00125167522188788__ 0 0 0 0 0 94443 17014688 122445 20996 11179 SOD1 ALS ALS 31 1.7 cells (NSC-34), NSC-34 (2) 2 a genetic mouse model of ALS (SOD1(G93A)-transgenic SOD1 G93A -transgenic mice and (3) 3 a group 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00125167522188788<>ScoreDetail__5468|IGFALS|0.000719646345224633__11179|SOD1|0.00125167522188788__ 0 0 0 0 0 94445 17014688 122445 20996 11179 SOD1 ALS ALS 43 1.7 and (3) 3 a group of 31 patients with sporadic ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00125167522188788<>ScoreDetail__5468|IGFALS|0.000719646345224633__11179|SOD1|0.00125167522188788__ 0 0 0 0 0 94447 17014688 122449 20996 11179 SOD1 ALS ALS 16 1.7 provide a surrogate marker for oxidative stress were elevated in ALS patients but were normalized to control values by melatonin treatment 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00125167522188788<>ScoreDetail__5468|IGFALS|0.000719646345224633__11179|SOD1|0.00125167522188788__ 0 0 0 0 0 94448 17014688 122450 20996 11179 SOD1 ALS ALS 25 1.7 suitable for clinical trials aimed at neuroprotection through antioxidation in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00125167522188788<>ScoreDetail__5468|IGFALS|0.000719646345224633__11179|SOD1|0.00125167522188788__ 0 0 0 0 0 83479 17025271 107541 18723 10261 ROS1 ROS ROS 10 0.0 are a major source of intracellular reactive oxygen species (ROS) ROS and are particularly vulnerable to oxidative stress 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 83480 17025271 107543 18723 10261 ROS1 ROS ROS 6 0.0 Because dysfunctional mitochondria will produce more ROS a feed-forward loop is set up whereby ROS-mediated oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 83481 17025271 107543 18723 10261 ROS1 ROS ROS-mediated 14 0.0 produce more ROS a feed-forward loop is set up whereby ROS-mediated oxidative damage to mitochondria favors more ROS generation resulting in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 83482 17025271 107543 18723 10261 ROS1 ROS ROS 21 0.0 set up whereby ROS-mediated oxidative damage to mitochondria favors more ROS generation resulting in a vicious cycle 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 83483 17025271 107545 18723 10261 ROS1 ROS ROS 9 0.0 However if mitochondria are the major source of intracellular ROS and mitochondria are most vulnerable to oxidative damage then it 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 87988 17099894 113917 20996 11179 SOD1 ALS ALS 14 1.4 for mitochondriopathy and MN degeneration in amyotrophic lateral sclerosis (ALS) ALS mice involving blockade of apoptosis accumulation of MN mitochondria with 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00128416738679533<>ScoreDetail__5468|IGFALS|0.000381494951550141__11179|SOD1|0.00128416738679533__ 0 0 0 0 0 88107 17105868 114227 20996 11179 SOD1 ALS ALS 18 1.9 produce spinal motor neuron degeneration in amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88108 17105868 114228 20996 11179 SOD1 ALS ALS 11 1.9 of reactive oxygen species were increased in motor neurons from ALS mice compared with wild-type mice at age 10 weeks before 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88111 17105868 114233 20996 11179 SOD1 ALS ALS 20 1.9 Fas-mediated apoptosis can prevent neuronal loss and motor dysfunction in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88112 17105868 114234 20996 11179 SOD1 ALS ALS 3 1.9 Amyotrophic lateral sclerosis (ALS) ALS is a neurodegenerative disorder characterized by degeneration of upper and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88113 17105868 114235 20996 11179 SOD1 ALS ALS 15 1.9 role for oxidative stress in the motor neuron loss in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88114 17105868 114236 20996 11179 SOD1 ALS ALS 22 1.9 in the motor cortex and spinal cord in patients with ALS (Bowling Bowling et al. 1993 Beal et al. 1997 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88115 17105868 114237 20996 11179 SOD1 ALS ALS 21 1.9 8-hydroxyl-2-deoxyguanosine in the cortex and spinal cord in patients with ALS (Fitzmaurice Fitzmaurice et al. 1996 Pedersen et al. 1998 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88116 17105868 114238 20996 11179 SOD1 ALS ALS 13 1.9 oxidative stress apoptosis probably contributes to motor neuron degeneration in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88118 17105868 114240 20996 11179 SOD1 ALS ALS 26 1.9 and protein level in spinal motor neurons from patients with ALS and from SOD1-G93A mice (Mu Mu et al. 1996 Vukosavic 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88121 17105868 114242 20996 11179 SOD1 ALS ALS 28 1.9 caspase 3 and cytochrome c in spinal motor neurons of ALS transgenic mice and humans with ALS (Guegan Guegan et al. 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88122 17105868 114242 20996 11179 SOD1 ALS ALS 34 1.9 spinal motor neurons of ALS transgenic mice and humans with ALS (Guegan Guegan et al. 2001 Inoue et al. 2003 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88125 17105868 114243 20996 11179 SOD1 ALS ALS 21 1.9 inhibitory protein XIAP prolongs survival and improves motor performance in ALS mice expressing the SOD1-G93A mutation (Kostic Kostic et al. 1997 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88126 17105868 114244 20996 11179 SOD1 ALS ALS 16 1.9 caspase inhibitors prolongs survival and delays disease progression in transgenic ALS mice (Li Li et al. 2000 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88127 17105868 114247 20996 11179 SOD1 ALS ALS 15 1.9 prevents neuronal cell apoptosis and protects spinal motor neurons in ALS mice (Ryu Ryu et al. 1999 Kaspar et al. 2003 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88128 17105868 114248 20996 11179 SOD1 ALS ALS 29 1.9 and motor function than monotherapy in transgenic mouse models of ALS (Zhang Zhang et al. 2003 Petri et al. 2006 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88129 17105868 114249 20996 11179 SOD1 ALS ALS 24 1.9 and can contribute to neuronal death through distinctive routes in ALS we hypothesize that a therapeutic approach targeting both oxidative stress 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88132 17105868 114275 19976 9662 SIRPA MFR MFR 3 0.0 Mitochondrial free radicals (MFR) MFR generation was determined as described previously (Kim Kim et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88133 17105868 114279 19976 9662 SIRPA MFR MFRs 0 0.0 MFRs were determined by detection of the oxidized fluorescence product (excitation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88134 17105868 114280 19976 9662 SIRPA MFR MFR 0 0.0 MFR intensity was analyzed by Image Gauge 3.12 (Fuji Fuji Photo 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88135 17105868 114281 19976 9662 SIRPA MFR MFRs 2 0.0 To determine MFRs in spinal motor neurons sections were immunolabeled with mouse monoclonal 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88136 17105868 114290 19573 10691 SDS SDS SDS 7 0.3 Protein samples were electrophoresed on a 12% SDS polyacrylamide gel and transferred to a nitrocellulose membrane 1 JUMiner_v2.2 1 2 sds 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000272650903678085<>ScoreDetail__10691|SDS|5.81327752586908e-05__19440|SBDS|0.000272650903678085__ 0 0 0 0 0 88137 17105868 114292 11823 16429 LIAS LAS LAS 20 0.0 Little Chalfont Buckinghamshire UK on X-ray film or with an LAS 1000 image analyzer (Fuji Fuji Photo Film Co. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88140 17105868 114321 19976 9662 SIRPA MFR MFRs 11 0.0 and G93A transgenic mice showed similar levels of nitrotyrosine and MFRs in dorsal horn neurons and white matter (data data not 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88141 17105868 114327 20996 11179 SOD1 ALS ALS 11 1.9 in both human patients and the transgenic mouse model of ALS have delineated multiple pathological mechanisms of neuronal death in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88142 17105868 114327 20996 11179 SOD1 ALS ALS 21 1.9 ALS have delineated multiple pathological mechanisms of neuronal death in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88144 17105868 114329 20996 11179 SOD1 ALS ALS 7 1.9 Riluzole the only therapeutic drug approved for ALS extends survival by approximately 3 months and is thought to 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88145 17105868 114330 20996 11179 SOD1 ALS ALS 23 1.9 and probably constitutes an additional route toward neuronal death in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88146 17105868 114331 20996 11179 SOD1 ALS ALS 30 1.9 and progression of motor function deficit and extend survival in ALS transgenic mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88147 17105868 114332 20996 11179 SOD1 ALS ALS 3 1.9 Oxidative stress in ALS seems to be attributable to multiple factors including mitochondrial dysfunction 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88149 17105868 114332 20996 11179 SOD1 ALS ALS 43 1.9 last of which are present in approximately 20% of familial ALS cases (Rosen Rosen et al. 1993 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88151 17105868 114335 20996 11179 SOD1 ALS ALS 9 1.9 Second in transgenic mice expressing the SOD1-G93A mutation (transgenic transgenic ALS mice administration of antioxidants such as coenzyme Q10 a component 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88153 17105868 114336 20996 11179 SOD1 ALS ALS 23 1.9 that such stress causes degeneration of spinal motor neurons in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88154 17105868 114337 19976 9662 SIRPA MFR MFRs 4 0.0 Levels of nitrotyrosine and MFRs were increased before neuronal death in the lumbar spinal cord 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88158 17105868 114345 20996 11179 SOD1 ALS ALS 21 1.9 to Neu2000 contributing to degeneration of spinal motor neurons in ALS mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88159 17105868 114346 20996 11179 SOD1 ALS ALS 11 1.9 lines of evidence support a potential role of apoptosis in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88162 17105868 114349 20996 11179 SOD1 ALS ALS 4 1.9 In motor neurons of ALS mice the Fas-signaling pathway remained activated after complete blockade of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88166 17105868 114351 20996 11179 SOD1 ALS ALS 36 1.9 caspase 8 and caspase 3 in the spinal cords of ALS mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88174 17105868 114365 20996 11179 SOD1 ALS ALS 26 1.9 Li may additively improve neurological function and neuronal survival in ALS and possibly other neurological diseases including stroke Alzheimer's disease and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88175 17105868 114368 20996 11179 SOD1 ALS ALS 15 1.9 sections from the control (a a and c and G93A ALS transgenic mice (b b and d at 8 weeks of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88192 17105868 114424 20996 11179 SOD1 ALS ALS 10 1.9 We examined whether the Fas pathway would mediate apoptosis in ALS mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88198 17105868 114429 20996 11179 SOD1 ALS ALS 23 1.9 in spinal motor neurons and mediate subsequent neuronal apoptosis in ALS mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88203 17105868 114443 19976 9662 SIRPA MFR MFR 24 0.0 from 8 weeks of age the increase in nitrotyrosine and MFR in lumbar spinal motor neurons at 10 weeks of age 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 88208 17105868 114454 20996 11179 SOD1 ALS ALS 17 1.9 oxidative stress and Fas-mediated apoptosis additively improves motor performance in ALS mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88209 17105868 114469 20996 11179 SOD1 ALS ALS 1 1.9 ABBREVIATIONS ALS amyotrophic lateral sclerosis PaGE paw grip endurance MFR mitochondrial free 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00121630583376416<>ScoreDetail__5468|IGFALS|0.000614029028222309__11179|SOD1|0.00121630583376416__ 0 0 0 0 0 88213 17105868 114469 19976 9662 SIRPA MFR MFR 9 0.0 ABBREVIATIONS ALS amyotrophic lateral sclerosis PaGE paw grip endurance MFR mitochondrial free radicals DIV days in vitro BSO DL -buthionine- 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 79987 17127561 103316 20996 11179 SOD1 ALS ALS 19 0.3 reactive oxygen species and its involvement has been documented in ALS and other neurodegenerative disorders 3 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921332310364603<>ScoreDetail__5468|IGFALS|0.000877165502333887__11179|SOD1|0.000921332310364603__ 0 0 0 0 0 79990 17127561 103319 20996 11179 SOD1 ALS ALS 13 0.3 has also recently been found underexpressed in spinal cord of ALS patients 3 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921332310364603<>ScoreDetail__5468|IGFALS|0.000877165502333887__11179|SOD1|0.000921332310364603__ 0 0 0 0 0 79992 17127561 103320 20996 11179 SOD1 ALS ALS 22 0.3 of two 3'UTR SNPs of the FMO1 gene in sporadic ALS patients compared to a healthy control population 3 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921332310364603<>ScoreDetail__5468|IGFALS|0.000877165502333887__11179|SOD1|0.000921332310364603__ 0 0 0 0 0 79994 17127561 103321 20996 11179 SOD1 ALS ALS 38 0.3 the FMO1 gene might be associated to susceptibility to develop ALS 3 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921332310364603<>ScoreDetail__5468|IGFALS|0.000877165502333887__11179|SOD1|0.000921332310364603__ 0 0 0 0 0 72470 17150307 92624 20996 11179 SOD1 ALS ALS 15 2.2 age-dependent motor neuron degeneration in human amyotrophic lateral sclerosis (ALS) ALS has not been defined and the role of glutathione (GSH) 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72471 17150307 92626 18723 10261 ROS1 ROS ROS 30 0.0 was accompanied by increased production of reactive oxygen species (ROS) ROS measured by the DCF fluorescent oxidation assay 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72476 17150307 92629 20996 11179 SOD1 ALS ALS-like 2 2.2 In an ALS-like transgenic mouse model overexpressing mutant G93A-SOD1 gene we showed that 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72478 17150307 92629 20996 11179 SOD1 ALS ALS-like 38 2.2 AIF translocation caspase 3 activation and motor neuron degeneration during ALS-like disease onset and progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72479 17150307 92630 20996 11179 SOD1 ALS ALS 31 2.2 pathways contributing at least partially to motor neuron degeneration in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72480 17150307 92632 20996 11179 SOD1 ALS ALS 3 2.2 Amyotrophic lateral sclerosis (ALS) ALS is a fatal neurodegenerative disease that primarily affects motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72481 17150307 92633 20996 11179 SOD1 ALS ALS 17 2.2 motor neuron degeneration remain largely unidentified and effective therapy for ALS is not yet available 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72483 17150307 92634 20996 11179 SOD1 ALS ALS 16 2.2 motor neuron degeneration and have linked to 2_amp_#x02013 5% of ALS cases ( Rosen et al. 1994 Rosen et al. 1993 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72484 17150307 92635 20996 11179 SOD1 ALS ALS 8 2.2 Several potential mechanisms of motor neuron degeneration in ALS have been proposed based on clinical studies animal model and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72485 17150307 92637 20996 11179 SOD1 ALS ALS 20 2.2 and sustained event in association with motor neuron death in ALS ( Bogdanov et al. 1998 Liu et al. 1998 although 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72486 17150307 92638 18723 10261 ROS1 ROS ROS 13 0.0 potentially increased by enhanced production of reactive oxygen species (ROS), ROS decreased antioxidants/antioxidant antioxidants antioxidant enzyme systems or a combination of 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72487 17150307 92640 18723 10261 ROS1 ROS ROS 4 0.0 Reduction of GSH enhances ROS production and promotes oxidative damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72488 17150307 92641 20996 11179 SOD1 ALS ALS 15 2.2 GSH binding in the spinal cords of patients with sporadic ALS ( Lanius et al. 1993 suggesting that GSH may play 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72489 17150307 92641 20996 11179 SOD1 ALS ALS 33 2.2 that GSH may play a role in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72492 17150307 92643 18723 10261 ROS1 ROS ROS 9 0.0 GSH is the most abundant and effective scavenger against ROS directly in mammalian cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72493 17150307 92646 8204 4311 GCLC GCS GCS 12 0.0 sequential enzymatic reactions catalyzed by _amp_#x003b3 -glutamylcysteine synthetase (_amp_#x003b3;-GCS) _amp_#x003b3 -GCS and GSH synthetase 11 JUMiner_v2.2 1 0 0 2 12524 TotalCon:2<>4311|GCLC|2729|Complete__12524|UGCG|7357|Complete__<>AvaiableGeneRif=2<>BEST:12524|UGCG|0.000797573098998761<>ScoreDetail__12524|UGCG|0.000797573098998761__4311|GCLC|0.000637308880421754__ 0 0 0 0 0 72494 17150307 92647 8204 4311 GCLC GCS GCS 8 0.0 L-Buthionine Sulfoximine (BSO) BSO is a selective inhibitor of _amp_#x003b3 -GCS 11 JUMiner_v2.2 1 0 0 2 12524 TotalCon:2<>4311|GCLC|2729|Complete__12524|UGCG|7357|Complete__<>AvaiableGeneRif=2<>BEST:12524|UGCG|0.000797573098998761<>ScoreDetail__12524|UGCG|0.000797573098998761__4311|GCLC|0.000637308880421754__ 0 0 0 0 0 72495 17150307 92652 20996 11179 SOD1 ALS ALS 13 2.2 of GSH in the pathogenesis of motor neuron degeneration in ALS remained largely undefined 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72496 17150307 92653 20996 11179 SOD1 ALS ALS-like 13 2.2 we have focused on a cell culture system and an ALS-like transgenic mouse model to study the effect of GSH on 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72497 17150307 92666 7361 20442 FBRS FBS FBS 54 0.0 DMEM supplemented with 10% heat inactivated fetal bovine serum (FBS), FBS 100 units/ml units ml penicillin and 100 _amp_#x003bc;g/ml _amp_#x003bc g 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 72498 17150307 92679 12519 6983 ME1 MES MES 16 0.0 control EA or BSO treated experiments were homogenized completely in MES buffer 200 mM 2-(N-morpholino)ethanesulphonic 2- N-morpholino ethanesulphonic acid 50 mM 1 JUMiner_v2.2 1 0 0 2 7121 TotalCon:2<>6983|ME1|4199|Complete__7121|MKS1|54903|Complete__<>AvaiableGeneRif=2<>BEST:7121|MKS1|0.000227616700271272<>ScoreDetail__7121|MKS1|0.000227616700271272__6983|ME1|0.000213635651517525__ 0 0 0 0 0 72499 17150307 92682 18723 10261 ROS1 ROS ROS 11 0.0 Methods Assay of cellular production of reactive oxygen species (ROS) ROS A dichlorofluorescin (DCF) DCF assay was used to determine cellular 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72500 17150307 92682 18723 10261 ROS1 ROS ROS 24 0.0 assay was used to determine cellular reactive oxygen species (ROS) ROS generation in NSC34 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72501 17150307 92686 18723 10261 ROS1 ROS ROS 9 0.0 The fluorescent intensity measuring the oxidation of DCFH-DA by ROS represents the relative steady state of ROS generation in cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72502 17150307 92686 18723 10261 ROS1 ROS ROS 16 0.0 of DCFH-DA by ROS represents the relative steady state of ROS generation in cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72507 17150307 92720 8255 4236 GFER HPO HPO 21 0.0 l of ice cold lysis buffer (10mM 10mM K 2 HPO 4 pH 7.2/1mM 7.2 1mM EDTA/5mM EDTA 5mM EGTA/10mM EGTA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72508 17150307 92722 19573 10691 SDS SDS SDS 10 0.0 samples (20 20 _amp_#x003bc g were separated in a 12.5% SDS PAGE gel and transferred onto nitrocellulose membrane 1 JUMiner_v2.2 1 0 0 2 10691 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:10691|SDS|0.000401160278960686<>ScoreDetail__10691|SDS|0.000401160278960686__19440|SBDS|0.000357263000331185__ 0 0 0 0 0 72509 17150307 92725 3778 10620 CCL21 ECL ECL 15 0.0 times with TBST for 5 min each and visualized in ECL reagents (Amersham Amersham Bioscience Piscataway NJ 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72510 17150307 92736 20996 11179 SOD1 ALS ALS-like 36 2.2 Cashman et al. 1992 Bishop et al. 1999 and an ALS-like transgenic mouse model ( Gurney et al. 1994 were employed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72511 17150307 92736 20996 11179 SOD1 ALS ALS 60 2.2 the role of GSH in motor neuron death associated with ALS disease onset and progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72512 17150307 92740 18723 10261 ROS1 ROS ROS 5 0.0 Results GSH depletion elevated cellular ROS production in NSC34 cells The DCF assay was applied to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72513 17150307 92740 18723 10261 ROS1 ROS ROS 20 0.0 The DCF assay was applied to measure the kinetics of ROS production in GSH depleted cells ( Wang and Joseph 1999 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72514 17150307 92742 18723 10261 ROS1 ROS ROS 14 0.0 intracellular GSH more effectively ( Figure 1 and promoted more ROS production ( Figure 2A than BSO ( Figure 2B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72521 17150307 92764 20996 11179 SOD1 ALS ALS-like 22 2.2 mouse spinal cords was associated with motor neuron death and ALS-like disease onset and progression The well-established mutant G93A-SOD1 transgenic mouse 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72522 17150307 92764 20996 11179 SOD1 ALS ALS-like 35 2.2 and progression The well-established mutant G93A-SOD1 transgenic mouse model of ALS-like disease was used to analyze the levels of GSH in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72523 17150307 92764 20996 11179 SOD1 ALS ALS 49 2.2 to analyze the levels of GSH in the course of ALS disease onset and progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72524 17150307 92766 20996 11179 SOD1 ALS ALS-like 13 2.2 oxidized GSH (GSSG) GSSG levels were significantly increased during both ALS-like disease onset and progression ( Figure 8B and 8D 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72525 17150307 92768 20996 11179 SOD1 ALS ALS-like 19 2.2 G93A-SOD1 transgenic mouse motor neuron cells were decreased at both ALS-like disease onset and progression ( Figure 8E 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72527 17150307 92769 20996 11179 SOD1 ALS ALS-like 21 2.2 activation and motor neuron cell death ( Figure 9 in ALS-like transgenic mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72528 17150307 92772 20996 11179 SOD1 ALS ALS 19 2.2 plays an important role in motor neuron degeneration leading to ALS disease onset and progression ( Hall et al. 1998 Tu 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72529 17150307 92775 20996 11179 SOD1 ALS ALS 34 2.2 a cell culture model and a mouse model recapitulating human ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72531 17150307 92780 20996 11179 SOD1 ALS ALS 15 2.2 as an important factor associated with motor neuron degeneration in ALS by activation of multiple apoptotic pathways 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72532 17150307 92782 8204 4311 GCLC GCS GCS 7 0.0 BSO is an inhibitor of _amp_#x003b3 -glutamylcysteine synthetase (_amp_#x003b3;-GCS) _amp_#x003b3 -GCS which blocks GSH synthesis 11 JUMiner_v2.2 1 0 0 2 12524 TotalCon:2<>4311|GCLC|2729|Complete__12524|UGCG|7357|Complete__<>AvaiableGeneRif=2<>BEST:12524|UGCG|0.000797573098998761<>ScoreDetail__12524|UGCG|0.000797573098998761__4311|GCLC|0.000637308880421754__ 0 0 0 0 0 72533 17150307 92787 20996 11179 SOD1 ALS ALS-like 4 2.2 The lifespan of the ALS-like mice have been characterized into three stages namely disease free 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72534 17150307 92790 20996 11179 SOD1 ALS ALS 34 2.2 of intracellular GSH to motor neuron death (apoptosis) apoptosis in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72535 17150307 92793 8204 4311 GCLC GCS GCS 7 0.0 GSH is biosynthesized from L-glutamate catalyzed by _amp_#x003b3 -GCS and glutathione synthetase (GS) GS in the cytosol 11 JUMiner_v2.2 1 0 0 2 12524 TotalCon:2<>4311|GCLC|2729|Complete__12524|UGCG|7357|Complete__<>AvaiableGeneRif=2<>BEST:12524|UGCG|0.000797573098998761<>ScoreDetail__12524|UGCG|0.000797573098998761__4311|GCLC|0.000637308880421754__ 0 0 0 0 0 72536 17150307 92797 18723 10261 ROS1 ROS ROS 10 0.0 As shown in Figure 2 GSH reduction dramatically increased ROS generation as measured by the DCF assay 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72547 17150307 92808 20996 11179 SOD1 ALS ALS 24 2.2 nuclear translocation may underlie some of the events linked to ALS disease onset and progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72548 17150307 92810 20996 11179 SOD1 ALS ALS-like 14 2.2 has also been shown to lead motor neuron degeneration in ALS-like mouse and human ALS patients ( Guegan et al. 2001 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72549 17150307 92810 20996 11179 SOD1 ALS ALS 18 2.2 to lead motor neuron degeneration in ALS-like mouse and human ALS patients ( Guegan et al. 2001 Li et al. 2000 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72550 17150307 92811 20996 11179 SOD1 ALS ALS-like 10 2.2 Discussion Decreased GSH is associated with motor neuron degeneration and ALS-like disease onset and progression in the G93A-SOD1 transgenic mouse model 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72551 17150307 92811 20996 11179 SOD1 ALS ALS 33 2.2 alterations of glutathione S-transferase pi activity have been reported in ALS patients ( Kuzma et al. 2006 Usarek et al. 2005 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72552 17150307 92812 20996 11179 SOD1 ALS ALS 10 2.2 Nevertheless the effects of GSH to motor neuron degeneration in ALS remains largely unknown even though abnormalities in GSH are associated 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72553 17150307 92814 20996 11179 SOD1 ALS ALS-like 13 2.2 of GSH and reciprocal increase of GSSG occurred in the ALS-like mice during the stages of disease progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72554 17150307 92817 20996 11179 SOD1 ALS ALS-like 4 2.2 More significantly treatment of ALS-like transgenic mice with antioxidants such as SOD and catalase mimetics 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72556 17150307 92818 20996 11179 SOD1 ALS ALS 33 2.2 damage incurred by motor neurons and may therefore lead to ALS disease onset and progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72557 17150307 92824 20996 11179 SOD1 ALS ALS-like 19 2.2 a frequent phenomenon occurring in the spinal cord of G93A-SOD1 ALS-like mice that is temporally associated with disease onset and progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72558 17150307 92826 20996 11179 SOD1 ALS ALS 21 2.2 therapeutic approaches targeting to mitochondria at early stage for delay ALS disease onset and progression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72559 17150307 92832 16315 30012 PDF PDF PDF 6 0.3 Footnotes Publisher's Disclaimer This is a PDF file of an unedited manuscript that has been accepted for 1 JUMiner_v2.2 1 2 pdf file 0 2 30012 TotalCon:3<>30012|PDF|64146|Complete__30142|GDF15|9518|Complete__8866|PFDN1|5201|Complete__<>AvaiableGeneRif=3<>BEST:30012|PDF|0.00113735551617425<>ScoreDetail__8866|PFDN1|0.000283898043572178__30142|GDF15|0.000578194553623238__30012|PDF|0.00113735551617425__ 0 0 0 0 0 72560 17150307 92837 18723 10261 ROS1 ROS ROS 8 0.0 Figure 2 GSH depletion enhances reactive oxygen species (ROS) ROS production in NSC34 cells 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 72562 17150307 92844 20996 11179 SOD1 ALS ALS-like 14 2.2 AIF and active caspase 3 in motor neuron cells of ALS-like mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72564 17150307 92846 20996 11179 SOD1 ALS ALS 4 2.2 AIF Apoptosis Inducing Factor ALS Amyotrophic Lateral Sclerosis BSO L-Buthionine Sulfoximine DCF Dichlorofluorescin DMEM Dulbecco_amp_#x02019 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00127347925873815<>ScoreDetail__5468|IGFALS|0.000806860188017188__11179|SOD1|0.00127347925873815__ 0 0 0 0 0 72566 17150307 92846 7361 20442 FBRS FBS FBS 21 0.0 DMEM Dulbecco_amp_#x02019 s Modified Eagle_amp_#x02019 s Medium EA Ethacrynic Acid FBS Fetal Bovine Serum _amp_#x003b3 -GCS _amp_#x003b3 -Glutamylcysteine Synthetase GSH Glutathione 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 72567 17150307 92846 8204 4311 GCLC GCS GCS 25 0.0 s Medium EA Ethacrynic Acid FBS Fetal Bovine Serum _amp_#x003b3 -GCS _amp_#x003b3 -Glutamylcysteine Synthetase GSH Glutathione GSSG Oxidized Glutathione MBM Monobromobimane 11 JUMiner_v2.2 1 0 0 2 12524 TotalCon:2<>4311|GCLC|2729|Complete__12524|UGCG|7357|Complete__<>AvaiableGeneRif=2<>BEST:12524|UGCG|0.000797573098998761<>ScoreDetail__12524|UGCG|0.000797573098998761__4311|GCLC|0.000637308880421754__ 0 0 0 0 0 72568 17150307 92846 18723 10261 ROS1 ROS ROS 37 0.0 Synthetase GSH Glutathione GSSG Oxidized Glutathione MBM Monobromobimane PFA Paraformaldehyde ROS Reactive Oxygen Species SOD1 Cu Zn-Superoxide Dismutase TUNEL Terminal Deoxynucleotidyl 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74189 17174478 95142 18723 10261 ROS1 ROS ROS 9 0.0 Proteins that control cellular levels of reactive oxygen species (ROS) ROS or DNA damage responses are essential to the nervous system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74190 17174478 95143 18723 10261 ROS1 ROS ROS 6 0.0 This is because an imbalance of ROS may cause significant damage to the cell which often produces 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74191 17174478 95148 18723 10261 ROS1 ROS ROS 2 0.0 Responses to ROS and DNA damage have many critical links to neuroscience 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74192 17174478 95149 18723 10261 ROS1 ROS ROS 8 0.0 The damage from stroke is likely linked to ROS with resulting damage to membrane components proteins and DNA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74193 17174478 95154 18723 10261 ROS1 ROS ROS 3 0.0 Defects in either ROS controlling enzymes or DNA double-strand break (DSB) DSB repair genes 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74194 17174478 95157 18723 10261 ROS1 ROS ROS 11 0.0 the emerging knowledge of mutations and polymorphisms in key human ROS and DNA repair genes may provide an informed basis for 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74195 17174478 95159 18723 10261 ROS1 ROS ROS 15 0.0 important gains in our knowledge of the cellular mechanisms controlling ROS and DNA repair events through insights provided by structural biochemistry 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74196 17174478 95160 18723 10261 ROS1 ROS ROS 12 0.0 the known roles disease phenotypes and molecular mechanisms of key ROS and DNA repair proteins within the nervous system 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74197 17174478 95162 18723 10261 ROS1 ROS ROS 17 0.0 provide a more unified understanding of molecular survival mechanisms from ROS and DNA damaging insults 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74198 17174478 95166 16315 30012 PDF PDF PDF 6 0.6 Footnotes Publisher's Disclaimer This is a PDF file of an unedited manuscript that has been accepted for 1 JUMiner_v2.2 1 2 pdf file 0 2 30012 TotalCon:3<>30012|PDF|64146|Complete__30142|GDF15|9518|Complete__8866|PFDN1|5201|Complete__<>AvaiableGeneRif=3<>BEST:30012|PDF|0.000818341494571003<>ScoreDetail__8866|PFDN1|0.000403626428216592__30142|GDF15|0.000355705901713305__30012|PDF|0.000818341494571003__ 0 0 0 0 0 74201 17174478 95171 16266 8757 PDB1 PDB PDB 6 0.3 In the wild type MnSOD structure (PDB PDB code 1N0J the His26 His74 His163 and Asp159 side chains 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74207 17174478 95178 7638 3768 FMN1 FMN FMN 1 0.0 The FMN domain is shown as a yellow box 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74216 17174478 95190 6277 3094 DYRK3 RED RED 6 0.0 The conserved helicase motifs I-VI and RED are colored by bars the N-terminal DRD and ThM domains 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>3094|DYRK3|8444|Complete__5958|IK|3550|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 74221 17174478 95193 9122 4852 HDAC1 HD1 HD1 10 0.3 a Schematic model shows how XPB DRD depicted in blue HD1 cyan RED motif red HD2 green and ThM purple may 1 JUMiner_v2.2 1 2 UserEdit 0 2 9069 TotalCon:2<>4852|HDAC1|3065|Complete__9069|PLEC1|5339|Complete__<>AvaiableGeneRif=2<>BEST:9069|PLEC1|0.000743006237796555<>ScoreDetail__9069|PLEC1|0.000743006237796555__4852|HDAC1|0.000271388197420876__ 1 1 0 0 0 74222 17174478 95193 6277 3094 DYRK3 RED RED 12 0.1 model shows how XPB DRD depicted in blue HD1 cyan RED motif red HD2 green and ThM purple may be activated 6 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>3094|DYRK3|8444|Complete__5958|IK|3550|No_GeneRif__<>AvaiableGeneRif=1<> 1 1 0 0 0 74226 17174478 95194 13444 7230 MRE11A ATLD ATLD 8 2.3 Af XPB Archaeoglobus fulgidus XPB AH auto-inhibitory helix ATLD ataxiatelangiectasia-like disorder BER base excision repair CS Cockayne syndrome CD 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74227 17174478 95194 1755 1101 BRCA2 FAD FAD 31 0.8 CT C-terminal tail DRD damage recognition domain DSBs double-strand breaks FAD flavin adenine dinucleotide (F)ALS F ALS (Familial) Familial amyotrophic lateral 1 JUMiner_v2.2 1 2 nadph 0 2 3585 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:3585|FANCD2|0.000968810183662925<>ScoreDetail__1101|BRCA2|0.000307126255127774__9508|PSEN1|0.000428328502098994__3585|FANCD2|0.000968810183662925__ 0 0 0 0 0 74228 17174478 95194 20996 11179 SOD1 ALS ALS 35 2.9 domain DSBs double-strand breaks FAD flavin adenine dinucleotide (F)ALS F ALS (Familial) Familial amyotrophic lateral sclerosis FMN flavin mononucleotide GG-NER global 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921146267190215<>ScoreDetail__5468|IGFALS|0.000205613241492752__11179|SOD1|0.000921146267190215__ 0 0 0 0 0 74229 17174478 95194 9122 4852 HDAC1 HD1 HD1 49 0.3 sclerosis FMN flavin mononucleotide GG-NER global genome nucleotide excision repair HD1 and HD2 helicase domains 1 and 2 HR homologous recombination 1 JUMiner_v2.2 1 2 UserEdit 0 2 9069 TotalCon:2<>4852|HDAC1|3065|Complete__9069|PLEC1|5339|Complete__<>AvaiableGeneRif=2<>BEST:9069|PLEC1|0.000743006237796555<>ScoreDetail__9069|PLEC1|0.000743006237796555__4852|HDAC1|0.000271388197420876__ 1 1 0 0 0 74238 17174478 95194 21298 11316 SSB SSB SSBs 116 0.3 nonhomologous end joining ROS reactive oxygen species SOD superoxide dismutase SSBs single-strand breaks TC-NER transcription-coupled nucleotide excision repair ThM thumb domain 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74239 17174478 95194 8901 21157 GTF2H5 TTD TTD 127 1.2 single-strand breaks TC-NER transcription-coupled nucleotide excision repair ThM thumb domain TTD trichothiodystropy WS Werner syndrome XP xeroderma pigmentosum 1 JUMiner_v2.2 1 2 UserEdit 0 2 21157 TotalCon:2<>21157|GTF2H5|404672|Complete__3434|ERCC2|2068|Complete__<>AvaiableGeneRif=2<>BEST:21157|GTF2H5|0.00104353482027836<>ScoreDetail__21157|GTF2H5|0.00104353482027836__3434|ERCC2|0.000283645881010553__ 1 1 0 0 0 74240 17174478 95194 7638 3768 FMN1 FMN FMN 40 0.0 adenine dinucleotide (F)ALS F ALS (Familial) Familial amyotrophic lateral sclerosis FMN flavin mononucleotide GG-NER global genome nucleotide excision repair HD1 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74241 17174478 95194 18723 10261 ROS1 ROS ROS 109 0.0 oxygenase module NOSred NOS reductase module NHEJ nonhomologous end joining ROS reactive oxygen species SOD superoxide dismutase SSBs single-strand breaks TC-NER 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74243 17174478 95195 18723 10261 ROS1 ROS ROS 0 0.0 ROS Removal by Manganese Superoxide Dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74244 17174478 95196 18723 10261 ROS1 ROS ROS 13 0.0 activity of post-mitotic neuronal cells typically produces significant quantities of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74245 17174478 95197 18723 10261 ROS1 ROS ROS 7 0.0 However neurons are also relatively sensitive to ROS and neurodegenerative disorders including amyotrophic lateral sclerosis Alzheimer disease and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74246 17174478 95197 18723 10261 ROS1 ROS ROS 27 0.0 and Parkinson disease have been linked to damage caused by ROS ( Andersen 2004 90 % of the ROS in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74247 17174478 95197 18723 10261 ROS1 ROS ROS 36 0.0 caused by ROS ( Andersen 2004 90 % of the ROS in the cell are generated by mitochondria as the toxic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74250 17174478 95199 18723 10261 ROS1 ROS ROS 25 0.0 and are the enzymes that provide the master controls for ROS levels in the cell ( Silverman and Nick 2002 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74258 17174478 95206 18723 10261 ROS1 ROS ROS 24 0.0 barrier progressive neuropathology is caused by excessive mitochondrial production of ROS ( Melov et al. 1998 normally removed by MnSOD 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74261 17174478 95207 18723 10261 ROS1 ROS ROS 5 0.1 To define how MnSOD controls ROS levels in the cell the molecular mechanism of MnSOD has 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74263 17174478 95216 18723 10261 ROS1 ROS ROS 0 0.0 ROS Removal by Manganese Superoxide Dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74264 17174478 95220 10965 21302 KCTD11 REN Ren 48 0.3 al. 2003 Hearn et al. 2004 Ayala et al. 2005a Ren et al. 2006 2 JUMiner_v2.2 1 2 34 0 2 9958 TotalCon:2<>9958|REN|5972|Complete__21302|KCTD11|147040|Complete__<>AvaiableGeneRif=2<>BEST:9958|REN|0.000348036476140382<>ScoreDetail__21302|KCTD11|0.000290391864644516__9958|REN|0.000348036476140382__ 0 0 0 0 0 74266 17174478 95226 18723 10261 ROS1 ROS ROS 33 0.0 highly tuned reactivity of the active site functioning to minimize ROS damage to the brain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74267 17174478 95227 18723 10261 ROS1 ROS ROS 0 0.0 ROS and Copper Zinc Superoxide Dismutase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74268 17174478 95228 20996 11179 SOD1 ALS ALS 13 2.9 common neurological disorders in humans is amyotrophic lateral sclerosis (ALS ALS or Lou Gehrig's disease which affects approximately 1 in 200 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921146267190215<>ScoreDetail__5468|IGFALS|0.000205613241492752__11179|SOD1|0.000921146267190215__ 0 0 0 0 0 74269 17174478 95230 20996 11179 SOD1 ALS ALS 19 2.9 5_amp_#x02013 10% of cases which is referred to as familial ALS (FALS)( FALS Cleveland and Rothstein 2001 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921146267190215<>ScoreDetail__5468|IGFALS|0.000205613241492752__11179|SOD1|0.000921146267190215__ 0 0 0 0 0 74281 17174478 95241 20996 11179 SOD1 ALS ALS 12 2.9 been observed in both mouse and cell culture models of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921146267190215<>ScoreDetail__5468|IGFALS|0.000205613241492752__11179|SOD1|0.000921146267190215__ 0 0 0 0 0 74283 17174478 95243 20996 11179 SOD1 ALS ALS 5 2.9 Furthermore in transgenic mice the ALS aggregates can be detected biochemically months before the onset of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000921146267190215<>ScoreDetail__5468|IGFALS|0.000205613241492752__11179|SOD1|0.000921146267190215__ 0 0 0 0 0 74293 17174478 95256 18723 10261 ROS1 ROS ROS 8 0.0 The catalase protein completes the process of eliminating ROS by converting hydrogen peroxide into water and oxygen 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74294 17174478 95271 18723 10261 ROS1 ROS ROS 0 0.0 ROS and Nitric Oxide Synthase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74310 17174478 95286 1755 1101 BRCA2 FAD FAD 21 0.8 domain with the aid of one flavin adenine dinucleotide (FAD) FAD and one flavin mononucleotide (FMN) FMN moiety 1 JUMiner_v2.2 1 2 nadph 0 2 3585 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:3585|FANCD2|0.000968810183662925<>ScoreDetail__1101|BRCA2|0.000307126255127774__9508|PSEN1|0.000428328502098994__3585|FANCD2|0.000968810183662925__ 0 0 0 0 0 74311 17174478 95286 7638 3768 FMN1 FMN FMN 26 0.0 flavin adenine dinucleotide (FAD) FAD and one flavin mononucleotide (FMN) FMN moiety 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74313 17174478 95289 1755 1101 BRCA2 FAD FAD-binding 9 0.8 _amp_#x003b1 -helical connecting domain (CD) CD orients flanking FMN- and FAD-binding domains to align the two flavins ( Wang et al. 1 JUMiner_v2.2 1 2 nadph 0 2 3585 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:3585|FANCD2|0.000968810183662925<>ScoreDetail__1101|BRCA2|0.000307126255127774__9508|PSEN1|0.000428328502098994__3585|FANCD2|0.000968810183662925__ 0 0 0 0 0 74314 17174478 95289 7638 3768 FMN1 FMN FMN- 7 0.1 An _amp_#x003b1 -helical connecting domain (CD) CD orients flanking FMN- and FAD-binding domains to align the two flavins ( Wang 6 JUMiner_v2.2 1 2 flavin mononucleotide 0 0 0 0 0 0 0 0 74315 17174478 95290 1755 1101 BRCA2 FAD FAD 7 0.8 Electron transfer proceeds from NADPH to the FAD to FMN and then to the oxygenase heme ( Adak 1 JUMiner_v2.2 1 2 nadph 0 2 3585 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:3585|FANCD2|0.000968810183662925<>ScoreDetail__1101|BRCA2|0.000307126255127774__9508|PSEN1|0.000428328502098994__3585|FANCD2|0.000968810183662925__ 0 0 0 0 0 74316 17174478 95290 7638 3768 FMN1 FMN FMN 9 0.1 Electron transfer proceeds from NADPH to the FAD to FMN and then to the oxygenase heme ( Adak et al. 6 JUMiner_v2.2 1 2 flavin mononucleotide 0 0 0 0 0 0 0 0 74317 17174478 95293 18723 10261 ROS1 ROS ROS 0 0.0 ROS and Nitric Oxide Synthase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74320 17174478 95296 7638 3768 FMN1 FMN FMN-binding 14 0.0 C-terminal tail (CT) CT represses electron transfer by locking the FMN-binding domain in the electron-accepting position 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74323 17174478 95297 7638 3768 FMN1 FMN FMN-binding 13 0.0 contain the 42_amp_#x02013 45-residue auto-inhibitory helix (AH) AH within the FMN-binding domain which interferes with Ca 2 /CaM CaM binding and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74332 17174478 95306 7638 3768 FMN1 FMN FMN 5 0.0 The shortest distance between the FMN and heme cofactors is 70 _amp_#x0212b in this model which 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74333 17174478 95307 7638 3768 FMN1 FMN FMN 11 0.0 the structural biochemical and modeling results indicate that the entire FMN domain serves as a one-electron shuttle by swinging back and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74336 17174478 95310 7638 3768 FMN1 FMN FMN 3 0.0 Additionally this swinging FMN domain mechanism would account for the slow rate of inter-module 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74338 17174478 95311 7638 3768 FMN1 FMN FMN 20 0.0 electron transfer mechanism where the two redox partners of the FMN shuttles are located on adjacent polypeptides 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74339 17174478 95312 7638 3768 FMN1 FMN FMN-binding 29 0.0 would displace the repressive C-terminal tail and thereby unlock the FMN-binding domain for shuttling 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74340 17174478 95313 18723 10261 ROS1 ROS ROS 0 0.0 ROS and Nitric Oxide Synthase 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74341 17174478 95314 18723 10261 ROS1 ROS ROS 0 0.0 ROS and Pathogens 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74342 17174478 95315 18723 10261 ROS1 ROS ROS 5 0.0 Pathogens are likely to amplify ROS damage in the CNS during pathogenesis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74343 17174478 95320 23898 12669 VDAC1 PORIN porin 19 1.6 substantial sequence conservation with N meningitides acts cooperatively with a porin to induce calcium ion transients in infected epithelial cells ( 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74345 17174478 95321 18723 10261 ROS1 ROS ROS 14 0.0 by pathogen invasion in neuronal cells is expected to increase ROS stress ( Koedel and Pfister 1999 through the calcium-mediated activation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74346 17174478 95322 18723 10261 ROS1 ROS ROS 7 0.0 Therefore a combination of factors may exacerbate ROS production and provide increased risk of damage to the brain 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74348 17174478 95324 18723 10261 ROS1 ROS ROS 3 0.0 Their high metabolic ROS generation is further accentuated by NO used in signaling and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74349 17174478 95325 18723 10261 ROS1 ROS ROS 6 0.0 Besides directly increasing cellular apoptosis these ROS events increase DNA damage with implications for degenerative diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74350 17174478 95327 18723 10261 ROS1 ROS ROS 11 0.0 of mitochondrial and nuclear DNA damage which can occur by ROS and a large variety of other genotoxic agents in post-mitotic 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74354 17174478 95335 21298 11316 SSB SSB SSBs 15 0.3 in the backbone can occur either as single-strand breaks (SSBs) SSBs or as DSBs 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74355 17174478 95336 21298 11316 SSB SSB SSBs 0 0.3 SSBs are efficiently repaired by a mechanism that shares many common 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74356 17174478 95350 18723 10261 ROS1 ROS ROS 12 0.0 mechanisms to avoid mutations in mtDNA are the control of ROS and the repair of DNA damage 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74357 17174478 95351 18723 10261 ROS1 ROS ROS 5 0.0 Reduced DNA repair or increased ROS are correlated with the induction of apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74365 17174478 95373 13444 7230 MRE11A ATLD ATLD 10 2.3 in the Mre11 component give rise to ataxia-telangiectasia-like disorder (ATLD), ATLD with its increased radiosensitivity and an increased level of spontaneously 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74367 17174478 95374 13444 7230 MRE11A ATLD ATLD 12 2.3 Nbs1 cause Nijmegen Breakage syndrome which displays similar symptoms to ATLD and is characterized by microcephaly radiosensitivity immunodeficiency increased cancer risk 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74398 17174478 95416 24185 29175 WDTC1 ADP ADP-ribose 51 0.1 2001b PCNA ( Lebel et al. 1999 and poly(ADP-ribose)polymerase poly ADP-ribose polymerase 1 (PARP-1) PARP-1 ( von Kobbe et al. 2003a 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74413 17174478 95420 24185 29175 WDTC1 ADP ADP-ribose 14 0.1 complex with the Ku70/80 Ku70 80 subunit and poly(ADP-ribose) poly ADP-ribose polymerase-1 (PARP-1) PARP-1 ( Li et al. 2004 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74415 17174478 95421 21298 11316 SSB SSB SSBs 5 0.3 Notably PARP-1 binds sites of SSBs and DSBs and is also implicated in the control of 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74441 17174478 95439 16266 8757 PDB1 PDB PDB 21 0.3 built based on a multimeric A thaliana structural homolog (PDB PDB code 1VK0 ( Perry et al. 2006 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74487 17174478 95478 8901 21157 GTF2H5 TTD TTD 12 1.2 the rare genetic disorders xeroderma pigmentosum (XP), XP trichothiodystrophy (TTD) TTD and Cockayne syndrome (CS) CS 1 JUMiner_v2.2 1 2 UserEdit 0 2 21157 TotalCon:2<>21157|GTF2H5|404672|Complete__3434|ERCC2|2068|Complete__<>AvaiableGeneRif=2<>BEST:21157|GTF2H5|0.00104353482027836<>ScoreDetail__21157|GTF2H5|0.00104353482027836__3434|ERCC2|0.000283645881010553__ 1 1 0 0 0 74488 17174478 95482 8901 21157 GTF2H5 TTD TTD 1 1.2 The TTD individuals have characteristically brittle hair and nails and may also 1 JUMiner_v2.2 1 2 UserEdit 0 2 21157 TotalCon:2<>21157|GTF2H5|404672|Complete__3434|ERCC2|2068|Complete__<>AvaiableGeneRif=2<>BEST:21157|GTF2H5|0.00104353482027836<>ScoreDetail__21157|GTF2H5|0.00104353482027836__3434|ERCC2|0.000283645881010553__ 1 1 0 0 0 74506 17174478 95489 9122 4852 HDAC1 HD1 HD1 14 0.3 the Af XPB structure contains two RecA-like helicase domains (HD1 HD1 and HD2 that belong to helicase superfamily 2 1 JUMiner_v2.2 1 2 UserEdit 0 2 9069 TotalCon:2<>4852|HDAC1|3065|Complete__9069|PLEC1|5339|Complete__<>AvaiableGeneRif=2<>BEST:9069|PLEC1|0.000743006237796555<>ScoreDetail__9069|PLEC1|0.000743006237796555__4852|HDAC1|0.000271388197420876__ 1 1 0 0 0 74508 17174478 95491 9122 4852 HDAC1 HD1 HD1 9 0.3 A small N-terminal domain is attached to helicase domain HD1 ( Fig 7 which shares structural similarity to the mismatch 1 JUMiner_v2.2 1 2 UserEdit 0 2 9069 TotalCon:2<>4852|HDAC1|3065|Complete__9069|PLEC1|5339|Complete__<>AvaiableGeneRif=2<>BEST:9069|PLEC1|0.000743006237796555<>ScoreDetail__9069|PLEC1|0.000743006237796555__4852|HDAC1|0.000271388197420876__ 1 1 0 0 0 74517 17174478 95496 9122 4852 HDAC1 HD1 HD1 15 0.3 conserved XPB-family specific RED amino acid motif located in domain HD1 ( Fig 7c 1 JUMiner_v2.2 1 2 UserEdit 0 2 9069 TotalCon:2<>4852|HDAC1|3065|Complete__9069|PLEC1|5339|Complete__<>AvaiableGeneRif=2<>BEST:9069|PLEC1|0.000743006237796555<>ScoreDetail__9069|PLEC1|0.000743006237796555__4852|HDAC1|0.000271388197420876__ 1 1 0 0 0 74518 17174478 95496 6277 3094 DYRK3 RED RED 8 0.1 Also present is a highly conserved XPB-family specific RED amino acid motif located in domain HD1 ( Fig 7c 6 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>3094|DYRK3|8444|Complete__5958|IK|3550|No_GeneRif__<>AvaiableGeneRif=1<> 1 1 0 0 0 74520 17174478 95497 6277 3094 DYRK3 RED RED 6 0.2 Mutational analysis suggests that this XPB RED motif has a critical role in DNA unwinding function ( 5 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>3094|DYRK3|8444|Complete__5958|IK|3550|No_GeneRif__<>AvaiableGeneRif=1<> 1 1 0 0 0 74527 17174478 95504 9122 4852 HDAC1 HD1 HD1 8 0.3 The relative orientation of the two helicase domains HD1 and HD2 observed in the full-length Af XPB is different 1 JUMiner_v2.2 1 2 UserEdit 0 2 9069 TotalCon:2<>4852|HDAC1|3065|Complete__9069|PLEC1|5339|Complete__<>AvaiableGeneRif=2<>BEST:9069|PLEC1|0.000743006237796555<>ScoreDetail__9069|PLEC1|0.000743006237796555__4852|HDAC1|0.000271388197420876__ 1 1 0 0 0 74534 17174478 95510 6277 3094 DYRK3 RED RED 9 0.0 In both cases in this new _amp_#x0201c closed_amp_#x0201d configuration the RED motif would be ideally placed at the helicase active site 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>3094|DYRK3|8444|Complete__5958|IK|3550|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 74536 17174478 95511 6277 3094 DYRK3 RED RED 29 0.0 lie in the groove on the opposite side of the RED motif 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>3094|DYRK3|8444|Complete__5958|IK|3550|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 74539 17174478 95512 6277 3094 DYRK3 RED RED 4 0.0 In this position the RED motif would function as a _amp_#x0201c wedge_amp_#x0201d to unzip the 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>3094|DYRK3|8444|Complete__5958|IK|3550|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 74568 17174478 95531 18723 10261 ROS1 ROS ROS 46 0.0 through mutations in specific residues such as observed in the ROS controlling superoxide dismutases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74574 17174478 95543 18723 10261 ROS1 ROS ROS 32 0.0 progression that provide genomic stability and protection from insults from ROS and DNA damage agents 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74863 17191135 96081 18723 10261 ROS1 ROS ROS 6 0.6 However while excess reactive oxygen species (ROS) ROS are toxic regulated ROS play an important role in cell 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74864 17191135 96081 18723 10261 ROS1 ROS ROS 10 0.6 while excess reactive oxygen species (ROS) ROS are toxic regulated ROS play an important role in cell signaling 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74865 17191135 96082 6554 3309 ELA2 HNE HNE 20 0.0 of the product of polyunsaturated fatty acid peroxidation (hydroxynonenals, hydroxynonenals HNE or cholesterol oxidation can disrupt redox homeostasis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74866 17191135 96085 18723 10261 ROS1 ROS ROS 18 0.6 is generally associated with metabolic derangements and excessive production of ROS 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74869 17191135 96101 18723 10261 ROS1 ROS ROS 16 0.6 uptake by cells is converted into reactive oxygen species (ROS) ROS 1 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74870 17191135 96103 18723 10261 ROS1 ROS ROS 9 0.6 In contrast to this physiological role pathological actions of ROS occur at an order of magnitude higher concentrations 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74871 17191135 96106 18723 10261 ROS1 ROS ROS 5 0.6 Indeed continuous low concentrations of ROS induce expression of antioxidant enzymes and related defense mechanisms 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74872 17191135 96107 20996 11179 SOD1 ALS ALS 13 1.9 s diseases (HD), HD but also amyotrophic lateral scelrosis (ALS) ALS and Friedreich_amp_#8217 s ataxia (FRDA) FRDA belong to the so-called 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000570340949044605<>ScoreDetail__5468|IGFALS|0.000429859285933318__11179|SOD1|0.000570340949044605__ 0 0 0 0 0 74874 17191135 96111 18723 10261 ROS1 ROS ROS 20 0.6 stress which leads to mitochondrial dysfunction and excessive production of ROS thus inducing oxidative stress 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74875 17191135 96112 18723 10261 ROS1 ROS ROS 9 0.6 The ability of a cell to deal with excessive ROS as well as excessive reactive nitrogen species (RNS) RNS requires 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74876 17191135 96112 6981 22140 FAM20C RNS RNS 17 0.6 excessive ROS as well as excessive reactive nitrogen species (RNS) RNS requires the activation of pro-survival pathways as well as the 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74879 17191135 96115 6981 22140 FAM20C RNS RNS 21 0.6 stress through its properties to bind and inactivate NO and RNS 11 -14 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74898 17191135 96135 18723 10261 ROS1 ROS ROS 6 0.6 As a consequence of this aggregation ROS formation increases and a pro-oxidant environment takes place 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74900 17191135 96140 18723 10261 ROS1 ROS ROS 13 0.6 heme oxygenase could _amp_#8220 sense_amp_#8221 NO and thus protect against ROS and RNS insults is supported by the following findings (a) 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74901 17191135 96140 6981 22140 FAM20C RNS RNS 15 0.6 could _amp_#8220 sense_amp_#8221 NO and thus protect against ROS and RNS insults is supported by the following findings (a) a NO 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74903 17191135 96141 6981 22140 FAM20C RNS RNS 5 0.6 The conception that NO and RNS can be directly involved in the modulation of HO-1 expression 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74907 17191135 96142 10676 6121 IRF6 LPS LPS 7 0.6 In rat glial cells treatment with lipopolysaccaride (LPS) LPS and interferon-G (IFN-G) IFN-G promotes a rapid increase in both 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>12728|VWS||No_GeneRif__6121|IRF6|3664|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 74913 17191135 96142 10676 6121 IRF6 LPS LPS 45 0.6 of HO-1 mRNA expression by iNOS-derived NO following stimulation with LPS has also been reported in different brain regions particularly in 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>12728|VWS||No_GeneRif__6121|IRF6|3664|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 74939 17191135 96162 10463 6018 IL6 HSF HSFs 7 0.3 These denaturated proteins activate heat shock factors (HSFs) HSFs within the cytosol (or or ER by dissociating other Hsps 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74940 17191135 96162 10463 6018 IL6 HSF HSF 20 0.3 (or or ER by dissociating other Hsps normally bound to HSF 34 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74941 17191135 96163 10463 6018 IL6 HSF HSF 1 0.3 Freed HSF is phosphorylated and forms trimers which enter the nucleus and 13 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74942 17191135 96163 9652 23316 HSD17B6 HSE HSE 17 0.0 enter the nucleus and bind to heat shock elements (HSE) HSE within the promoters of different heat shock genes leading to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74959 17191135 96177 11717 6530 LCT LAC LAC 28 0.0 up-regulation of Hsp60 may be a fundamental site targeted by LAC action with consequent restoration of complex IV function under conditions 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 74965 17191135 96184 18723 10261 ROS1 ROS ROS 8 0.6 Heme oxygenase-1 is induced by various stimuli including ROS RNS ischemia heat shock LPS hemin and the neuroprotective agent 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 74966 17191135 96184 6981 22140 FAM20C RNS RNS 9 0.6 Heme oxygenase-1 is induced by various stimuli including ROS RNS ischemia heat shock LPS hemin and the neuroprotective agent Neotrofin 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 74967 17191135 96184 10676 6121 IRF6 LPS LPS 13 0.6 induced by various stimuli including ROS RNS ischemia heat shock LPS hemin and the neuroprotective agent Neotrofin 41 44 -46 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>12728|VWS||No_GeneRif__6121|IRF6|3664|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 74999 17191135 96199 10676 6121 IRF6 LPS LPS 19 0.6 recent data showed that the reductase can be induced by LPS and bromobenzene at a post-transcriptional level whereas heat shock has 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>12728|VWS||No_GeneRif__6121|IRF6|3664|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 75025 17191135 96223 1755 1101 BRCA2 FAD FAD 14 0.3 which each monomer includes two prosthetic flavin adenine dinucleotide (FAD) FAD groups and a NADPH binding site 1 JUMiner_v2.2 1 2 nadph 0 2 3585 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:3585|FANCD2|0.000616414966919063<>ScoreDetail__1101|BRCA2|0.000291740765865872__9508|PSEN1|0.000550124664860037__3585|FANCD2|0.000616414966919063__ 0 0 0 0 0 75026 17191135 96224 1755 1101 BRCA2 FAD FAD 18 0.3 consisting of two cysteines adjacent to the flavin ring of FAD in the N-terminal part of the protein 1 JUMiner_v2.2 1 2 nadph 0 2 3585 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:3585|FANCD2|0.000616414966919063<>ScoreDetail__1101|BRCA2|0.000291740765865872__9508|PSEN1|0.000550124664860037__3585|FANCD2|0.000616414966919063__ 0 0 0 0 0 75066 17191135 96251 18723 10261 ROS1 ROS ROS 16 0.6 of reducing equivalents Trx by itself acts as antioxidant or ROS scavenger 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75084 17191135 96261 22000 11730 TERT TERT tert 29 0.3 embryo kidney cells to cell death induced by etopoxide or tert -butylhydroperoxide 82 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 75088 17191135 96264 18723 10261 ROS1 ROS ROS 16 0.6 to be associated with brain regions producing high levels of ROS 83 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75090 17191135 96269 12369 6893 MAPT tau tau 42 1.8 ubiquitination clearing misfolded proteins to the proteasome and segregation of tau aggregates from the cellular machinery and recruitment of chaperone pairs 1 JUMiner_v2.2 1 2 35 0 0 0 0 0 0 0 0 75095 17191135 96270 7962 4012 FUT1 HSC Hsc 23 0.5 for the E3 ligase carboxyl terminus of heat-shock cognate (Hsc)70-interacting Hsc 70-interacting protein (CHIP) CHIP 86 -88 2 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 75140 17191135 96305 18723 10261 ROS1 ROS ROS 16 0.6 to inhibit lipid peroxidation and to effectively intercept and neutralize ROS and RNS 23 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75141 17191135 96305 6981 22140 FAM20C RNS RNS 18 0.6 lipid peroxidation and to effectively intercept and neutralize ROS and RNS 23 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 75144 17191135 96307 18723 10261 ROS1 ROS ROS 32 0.6 that HO-1-derived BR has the ability to efficiently scavenge both ROS and RNS 8 11 -13 99 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75145 17191135 96307 6981 22140 FAM20C RNS RNS 34 0.6 BR has the ability to efficiently scavenge both ROS and RNS 8 11 -13 99 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 75146 17191135 96309 16343 17468 PDLIM5 LIM Lim 4 0.3 Based on these findings Lim and colleagues have provided convincing evidence that dietary curcumin given 2 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 75147 17191135 96314 11717 6530 LCT LAC LAC 3 0.0 Acetyl-l -carnitine (LAC), LAC is a compound of great interest for its wide clinical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75149 17191135 96322 11717 6530 LCT LAC LAC 29 0.0 often obscured by more abundant ones it has reported that LAC modulates specific genes in the rat CNS such as the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 75154 17191135 96329 20996 11179 SOD1 ALS ALS 7 1.9 Protein conformational diseases such as AD PD ALS HD and MS affect a large portion of our aging 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000570340949044605<>ScoreDetail__5468|IGFALS|0.000429859285933318__11179|SOD1|0.000570340949044605__ 0 0 0 0 0 75155 17191135 96334 18723 10261 ROS1 ROS ROS 24 0.6 (mal)folding mal folding cycles and oxidative damage cycles sustaining excessive ROS production and oxidative stress 125 126 (Figs Figs 3 4 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75156 17191135 96335 18723 10261 ROS1 ROS ROS 1 0.6 These ROS set in motion a lot of redox reactions which can 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75157 17191135 96336 18723 10261 ROS1 ROS ROS 8 0.6 The ability of a cell to deal with ROS and oxidative stress requires functional chaperones antioxidant production protein degradation 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75158 17191135 96337 18723 10261 ROS1 ROS ROS 20 0.6 susceptible to perturbations in the quality control system and that ROS play an important role in the development and/or and or 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75162 17191135 96349 18723 10261 ROS1 ROS ROS 24 0.6 the altered membrane permeability results in Ca 2 leakage and ROS formation 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75163 17191135 96351 18723 10261 ROS1 ROS ROS 0 0.6 ROS generated during and as a consequence of protein misfolding cause 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 75164 17191135 96352 18723 10261 ROS1 ROS ROS-induced 10 0.3 In these conditions chaperone proteins themselves can be target of ROS-induced alterations 1 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 67820 17317654 85968 20996 11179 SOD1 ALS ALS 13 0.0 close resemblance to another neurodegenerative disease amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000787353801774373<>ScoreDetail__5468|IGFALS|0.000392433874892081__11179|SOD1|0.000787353801774373__ 0 0 0 0 0 67821 17317654 85969 20996 11179 SOD1 ALS ALS 6 0.0 One of the believed pathomechanisms of ALS is oxidative stress therefore this article's emphasis on the role 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000787353801774373<>ScoreDetail__5468|IGFALS|0.000392433874892081__11179|SOD1|0.000787353801774373__ 0 0 0 0 0 67822 17317654 85971 18723 10261 ROS1 ROS ROS 12 0.0 may point to a deficit in reactive oxygen species (ROS) ROS scavenging and/or and or ROS overproduction being involved in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 67823 17317654 85971 18723 10261 ROS1 ROS ROS 15 0.0 in reactive oxygen species (ROS) ROS scavenging and/or and or ROS overproduction being involved in the aetiopathology of these neurodegenerative diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70304 17365122 89703 18723 10261 ROS1 ROS ROS 31 0.0 is the oxidative stress induced by reactive oxygen species (ROS) ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70305 17365122 89708 18723 10261 ROS1 ROS ROS 5 0.0 When exposed to naphthazarin-induced cells ROS formation appeared to be reduced by colloidal silver 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70306 17365122 89709 18723 10261 ROS1 ROS ROS 2 0.0 However intracellular ROS formation in hydrogen peroxide-treated cells slightly reduced by colloidal silver 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70472 17368952 89802 20996 11179 SOD1 ALS ALS 16 2.8 the role of reactive species in amyotrophic lateral sclerosis (ALS), ALS the goal of this work is to explore the correlation 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70474 17368952 89802 20996 11179 SOD1 ALS ALS 41 2.8 proteins and mutation of Cu Zn-superoxide dismutase (SOD1) SOD1 in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70476 17368952 89803 20996 11179 SOD1 ALS ALS 14 2.8 Cu Zn-superoxide dismutase (mSOD1) mSOD1 gene from humans with familial ALS wild-type mice overexpressing the normal human SOD1 gene and normal 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70483 17368952 89808 20996 11179 SOD1 ALS ALS 51 2.8 nitration of proteins in neurons of the motor cortex in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70486 17368952 89810 20996 11179 SOD1 ALS ALS 20 2.8 to increased nitric oxide nitration and oxidation of proteins in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70487 17368952 89811 20996 11179 SOD1 ALS ALS 3 2.8 Amyotrophic lateral sclerosis (ALS) ALS is a progressive degenerative disorder of motor neurons in the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70488 17368952 89814 20996 11179 SOD1 ALS ALS 3 2.8 Approximately 10_amp_#x2013 15% of ALS cases are inherited 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70489 17368952 89815 20996 11179 SOD1 ALS ALS 11 2.8 number of mechanisms have been proposed for the pathogenesis of ALS including genetic factors oxidative stress protein aggregation glutamatergic toxicity mitochondrial 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70491 17368952 89816 20996 11179 SOD1 ALS ALS 13 2.8 of the Cu Zn-superoxide dismutase (SOD1) SOD1 gene in familial ALS patients ( Deng et al 1993 and Rosen et al 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70492 17368952 89816 20996 11179 SOD1 ALS ALS 35 2.8 1993 was the first breakthrough in identifying causes of familial ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70494 17368952 89817 20996 11179 SOD1 ALS ALS 9 2.8 To explore how mutant Cu Zn-superoxide dismutase (mSOD1) mSOD1 causes ALS a transgenic mouse model was established by introducing a human 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70496 17368952 89817 20996 11179 SOD1 ALS ALS 46 2.8 1994 these transgenic mice developed symptoms resembling those of human ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70498 17368952 89818 20996 11179 SOD1 ALS ALS 11 2.8 then over 100 different SOD1 mutants have been identified in ALS families and a number of transgenic mouse models with different 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70506 17368952 89824 18723 10261 ROS1 ROS ROS 5 0.3 Elevation of reactive oxygen species (ROS) ROS and oxidative damage has also been reported by others ( 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 70508 17368952 89825 18723 10261 ROS1 ROS ROS 10 0.3 These results directly correlate mutation of SOD1 to generation of ROS and resulting oxidative damage 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 70509 17368952 89826 18723 10261 ROS1 ROS ROS 1 0.3 Increased ROS and oxidation were also found in ALS patients ( Bowling 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 70510 17368952 89826 20996 11179 SOD1 ALS ALS 8 2.8 Increased ROS and oxidation were also found in ALS patients ( Bowling et al 1993 Ferrante et al 1997a 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70511 17368952 89826 18723 10261 ROS1 ROS ROS 32 0.3 Said Ahmed et al 2000 further supporting the involvement of ROS in ALS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 70512 17368952 89826 20996 11179 SOD1 ALS ALS 34 2.8 et al 2000 further supporting the involvement of ROS in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70513 17368952 89827 6981 22140 FAM20C RNS RNS 3 0.3 Reactive nitrogen species (RNS) RNS include nitric oxide ( _amp_#xb7 NO and peroxynitrite (ONOO ONOO 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 70517 17368952 89830 20996 11179 SOD1 ALS ALS 10 2.8 Genetically decreased spinal cord copper concentration prolongs life in familial ALS mice ( Kiaei et al. 2004 supporting copper_amp_#x2019 s involvement 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70518 17368952 89832 20996 11179 SOD1 ALS ALS 32 2.8 et al 1999 and Taskiran et al 2000 of sporadic ALS patients compared with the controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70519 17368952 89832 11629 6493 LAMC2 CSF CSF 16 0.0 nitrate and nitrite are significantly higher in cerebrospinal fluid (CSF) CSF and serum ( Tohgi et al 1999 and Taskiran et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70521 17368952 89833 20996 11179 SOD1 ALS ALS 13 2.8 nitric oxide synthase (NOS) NOS increases during the development of ALS in the G93A transgenic mice compared with normal SOD1 mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70526 17368952 89834 20996 11179 SOD1 ALS ALS 40 2.8 manipulation of neuronal NOS does not alter the course of ALS ( Facchinetti et al 1999 and Upton-Rice et al 1999 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70527 17368952 89834 20996 11179 SOD1 ALS ALS 59 2.8 et al 1999 complicating the role of _amp_#xb7 NO in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70528 17368952 89836 20996 11179 SOD1 ALS ALS 6 2.8 Increased protein nitration also occurs in ALS patients ( Abe et al 1995 and Beal et al 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70533 17368952 89841 20996 11179 SOD1 ALS ALS 19 2.8 spinal cord and in brain regions related to movement in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70534 17368952 89842 20996 11179 SOD1 ALS ALS 39 2.8 oxidation of proteins contribute differently to different brain regions in ALS and controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70537 17368952 89845 6981 22140 FAM20C RNS RNS 18 0.3 measured biochemically to provide further support for the correlation between RNS and mutation of SOD1 in ALS 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 70539 17368952 89845 20996 11179 SOD1 ALS ALS 24 2.8 for the correlation between RNS and mutation of SOD1 in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70541 17368952 89850 20996 11179 SOD1 ALS ALS 25 2.8 overexpressing the mSOD1 gene (G93A) G93A from humans with familial ALS B6SJL-TgN(SOD1-G93A)1Gur, B6SJL-TgN SOD1-G93A 1Gur mice overexpressing normal human SOD1 gene 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70544 17368952 89851 20996 11179 SOD1 ALS ALS 22 2.8 3-NY in nitrated proteins in brain tissues the onset of ALS symptoms of the mSOD1 mice that we used was delayed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70552 17368952 89863 5176 2557 CUX1 CUT CUT 17 0.0 in rostral and caudal directions on a cryostat (IMEB IMEB CUT 4500 Leica Microsystems Bensheim Germany 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70553 17368952 89885 7625 3758 FLOT2 ESA ESA 51 0.0 were analyzed by HPLC with electrochemical detection (Coulochem Coulochem II ESA Laboratory Inc. Chelmsford MA USA as reported by Hensley et 1 JUMiner_v2.2 1 0 0 2 3758 TotalCon:2<>3758|FLOT2|2319|Complete__9204|PON1|5444|Complete__<>AvaiableGeneRif=2<>BEST:3758|FLOT2|0.000351458651576852<>ScoreDetail__9204|PON1|0.000347837246844954__3758|FLOT2|0.000351458651576852__ 0 0 0 0 0 70554 17368952 89888 11629 6493 LAMC2 CSF CSF 20 0.0 the intrathecal space of the mouse spinal cord to sample CSF from there to avoid damage to the spinal cord caused 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70555 17368952 89897 8255 4236 GFER HPO HPO 34 0.0 Ca 2 132 Cl _amp_#x2212 21.0 HCO 3 _amp_#x2212 2.5 HPO 4 2_amp_#x2212 and 3.5 glucose 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70597 17368952 89950 20996 11179 SOD1 ALS ALS 33 2.8 _amp_#xb7 NO suggest that _amp_#xb7 NO may be associated with ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70605 17368952 89957 20996 11179 SOD1 ALS ALS 14 2.8 oxidation and nitration of proteins in motor cortex neurons in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70609 17368952 89961 20996 11179 SOD1 ALS ALS 16 2.8 there are contradictions regarding the role of protein nitration in ALS the recent report that 3-NY-immunoactivity was higher in the spinal 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70611 17368952 89962 20996 11179 SOD1 ALS ALS 18 2.8 support a role of protein nitration in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70614 17368952 89964 20996 11179 SOD1 ALS ALS 8 2.8 This suggests that _amp_#xb7 NO is associated with ALS because overexpression of the normal SOD1 gene in the mouse 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70616 17368952 89964 20996 11179 SOD1 ALS ALS 26 2.8 in the mouse did not increase levels of citrulline in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70617 17368952 89965 20996 11179 SOD1 ALS ALS 4 2.8 Elevation of citrulline in ALS may not demonstrate that _amp_#xb7 NO contributes to the pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70618 17368952 89965 20996 11179 SOD1 ALS ALS 16 2.8 not demonstrate that _amp_#xb7 NO contributes to the pathogenesis of ALS because of the complexity of _amp_#xb7 NO functions as described 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70621 17368952 89967 20996 11179 SOD1 ALS ALS 37 2.8 inducible NOS and _amp_#xb7 NO act as inflammatory markers in ALS ( Barbeito et al 2004 and Xie et al 2004 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70622 17368952 89968 20996 11179 SOD1 ALS ALS 14 2.8 this recent progress support involvement of elevated _amp_#xb7 NO in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70623 17368952 89969 20996 11179 SOD1 ALS ALS 33 2.8 may contribute to the selective damage of motor neurons in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70624 17368952 89970 20996 11179 SOD1 ALS ALS 8 2.8 However the excitatory amino acid levels measured from ALS patients and transgenic animals are another area of controversy the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70625 17368952 89970 20996 11179 SOD1 ALS ALS 37 2.8 aspartate are increased significantly in the CSF of patients with ALS ( Rothstein et al. 1990 and in the extracellular fluid 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70627 17368952 89970 11629 6493 LAMC2 CSF CSF 33 0.0 amino acid glutamate and aspartate are increased significantly in the CSF of patients with ALS ( Rothstein et al. 1990 and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70628 17368952 89970 11629 6493 LAMC2 CSF CSF 65 0.0 Alexander et al. 2000 but the glutamate concentration in the CSF of G93A mice was not different in 14- and 18-week 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 70630 17368952 89975 20996 11179 SOD1 ALS ALS 19 2.8 accurate conclusion regarding the involvement of excitatory amino acids in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70637 17368952 89979 20996 11179 SOD1 ALS ALS 15 2.8 oxidation of proteins to neuronal degeneration in motor cortex in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 70641 17368952 89981 6981 22140 FAM20C RNS RNS 24 0.3 in mSOD1 mice than in control mice further supporting that RNS and resulting protein nitration play a role in ALS 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 70642 17368952 89981 20996 11179 SOD1 ALS ALS 33 2.8 that RNS and resulting protein nitration play a role in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00161777181525835<>ScoreDetail__5468|IGFALS|0.000731819644310418__11179|SOD1|0.00161777181525835__ 0 0 0 0 0 54400 17496232 67646 3471 1473 CANX P90 P90 24 0.0 of postnatal day 2 (P2) P2 and day 90 (P90) P90 rat liver are included p Phosphorylated 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54404 17496232 67655 24185 29175 WDTC1 ADP ADP-to-ATP 26 0.0 O 2 and substrate availabilities as well as by the ADP-to-ATP ratio likely the main mitochondrial modulator in response to cell 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54429 17496232 67666 10676 6121 IRF6 LPS LPS 30 0.3 is modulated by inflammatory mediators like cytokines TNF-alpha IFN-gamma and LPS that activate transcription factors like NF-kappaB or AP-1 ( 59 1 JUMiner_v2.2 1 2 UserEdit 0 1 0 TotalCon:2<>12728|VWS||No_GeneRif__6121|IRF6|3664|Complete__<>AvaiableGeneRif=1<> 1 1 0 0 0 54458 17496232 67742 18723 10261 ROS1 ROS ROS 7 0.3 Although high levels of reactive oxygen species (ROS) ROS are frequently associated with cytotoxicity H 2 O 2 mediates 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 54489 17496232 67773 23055 11812 TRIM24 TF1A TF-1a 7 0.0 Activation of a myeloid leukemia cell line (TF-1a) TF-1a by granulocyte/macrophage granulocyte macrophage colony-stimulating factor induced only a transient 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 54491 17496232 67774 18723 10261 ROS1 ROS ROS 10 0.3 gain significance considering that ERK1/2 ERK1 2 are activated by ROS ( 134 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 54494 17496232 67776 18723 10261 ROS1 ROS ROS 13 0.3 depend on translocation of Bax to mitochondria and generation of ROS and ultimately on the release of cytochrome c but in 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 54507 17496232 67780 16734 9052 PLAU ATF ATF 35 0.6 MKK3 6 and p38 MAPK and activating transcription factors (ATF)-1 ATF -1 (cAMP cAMP response element-binding protein and ATF-2 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 54536 17496232 67801 18723 10261 ROS1 ROS ROS 23 0.3 however other mitochondrial enzymes like monoamino oxidase could contribute to ROS production ( 3 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 54537 17496232 67806 18723 10261 ROS1 ROS ROS 17 0.3 intact mitochondria rotenone inhibition of complex I did not increase ROS production with complex I substrates in myocardial ischemia ( 43 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 54538 17496232 67808 18723 10261 ROS1 ROS ROS 1 0.3 Therefore ROS production may differ substantially in mitochondria and corresponding submitochondrial particles 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 54557 17496232 67833 18723 10261 ROS1 ROS ROS 21 0.3 p38 MAPK activity which in turn may be regulated by ROS ( 81 and NO ( 104 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 54590 17496232 67880 20996 11179 SOD1 ALS ALS 17 2.2 -nitrosylation contributes to the development of amyotrophic lateral sclerosis (ALS); ALS ALS is one of the most common adult-onset neurodegenerative diseases 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00054670412384765<>ScoreDetail__5468|IGFALS|0.000455259857037071__11179|SOD1|0.00054670412384765__ 0 0 0 0 0 54591 17496232 67880 20996 11179 SOD1 ALS ALS 18 2.2 contributes to the development of amyotrophic lateral sclerosis (ALS); ALS ALS is one of the most common adult-onset neurodegenerative diseases and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00054670412384765<>ScoreDetail__5468|IGFALS|0.000455259857037071__11179|SOD1|0.00054670412384765__ 0 0 0 0 0 54603 17496232 67894 20996 11179 SOD1 ALS ALS 39 2.2 to the onset of diseases with high mortality rate like ALS or cancer 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00054670412384765<>ScoreDetail__5468|IGFALS|0.000455259857037071__11179|SOD1|0.00054670412384765__ 0 0 0 0 0 58549 17571960 73867 20996 11179 SOD1 ALS ALS 38 0.0 (PD), PD Huntington's (HD) HD diseases amyotrophic lateral sclerosis (ALS), ALS spinal muscular atrophy (SMA), SMA and diabetic encephalopathy 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000541264326850375<>ScoreDetail__5468|IGFALS|9.47957152336714e-05__11179|SOD1|0.000541264326850375__ 0 0 0 0 0 58550 17571960 73867 20478 11117 SMN1 SMA SMA 42 0.0 diseases amyotrophic lateral sclerosis (ALS), ALS spinal muscular atrophy (SMA), SMA and diabetic encephalopathy 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59582 17584954 75211 18723 10261 ROS1 ROS ROS 3 0.6 Reactive oxygen species (ROS), ROS especially mitochondrial ROS are postulated to play a significant role 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59583 17584954 75211 18723 10261 ROS1 ROS ROS 6 0.6 Reactive oxygen species (ROS), ROS especially mitochondrial ROS are postulated to play a significant role in muscle atrophy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59584 17584954 75212 18723 10261 ROS1 ROS ROS 7 0.6 We report a dramatic increase in mitochondrial ROS generation in three conditions associated with muscle atrophy in aging 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59586 17584954 75212 20996 11179 SOD1 ALS ALS 33 3.0 Sod1 and in the neurodegenerative disease amyotrophic lateral sclerosis (ALS) ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59587 17584954 75213 18723 10261 ROS1 ROS ROS 0 0.6 ROS generation in muscle mitochondria is nearly threefold higher in 28- 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59589 17584954 75214 18723 10261 ROS1 ROS ROS 5 0.6 In Sod1 mice muscle mitochondrial ROS production is increased >100% in 20-mo compared with 5-mo-old mice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59590 17584954 75215 20996 11179 SOD1 ALS ALS 0 3.0 ALS G93A mutant mice show a 75% loss of muscle mass 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59591 17584954 75215 18723 10261 ROS1 ROS ROS 21 0.6 during disease progression and up to 12-fold higher muscle mitochondrial ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59592 17584954 75216 20996 11179 SOD1 ALS ALS 3 3.0 In a second ALS mutant model H46RH48Q mice ROS production is approximately fourfold higher 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59593 17584954 75216 18723 10261 ROS1 ROS ROS 8 0.6 In a second ALS mutant model H46RH48Q mice ROS production is approximately fourfold higher than in control mice and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59594 17584954 75217 18723 10261 ROS1 ROS ROS 1 0.6 Thus ROS production is strongly correlated with the extent of muscle atrophy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59595 17584954 75218 18723 10261 ROS1 ROS ROS 30 0.6 were interested in determining whether denervation plays a role in ROS generation in muscle mitochondria isolated from hindlimb muscle following surgical 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59596 17584954 75219 18723 10261 ROS1 ROS ROS 5 0.6 Seven days postdenervation muscle mitochondrial ROS production increased nearly 30-fold 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59597 17584954 75220 18723 10261 ROS1 ROS ROS 7 0.6 We conclude that enhanced generation of mitochondrial ROS may be a common factor in the mechanism underlying denervation-induced 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59598 17584954 75226 20996 11179 SOD1 ALS ALS 34 3.0 and in atrophic mouse muscle from amyotrophic lateral sclerosis (ALS) ALS transgenic mice ( 54 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59599 17584954 75227 18723 10261 ROS1 ROS ROS 10 0.6 mitochondria are an important source of reactive oxygen species (ROS) ROS in cells we were interested in delineating the role of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59600 17584954 75227 18723 10261 ROS1 ROS ROS 23 0.6 we were interested in delineating the role of muscle mitochondrial ROS generation in muscle atrophy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59601 17584954 75228 18723 10261 ROS1 ROS ROS 6 0.6 In this study we measured mitochondrial ROS production during aging in wild-type mice and in mutant mouse 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59602 17584954 75228 18723 10261 ROS1 ROS ROS 30 0.6 significant loss of muscle mass to assess the importance of ROS generation in the basic mechanism(s) mechanism s underlying muscle atrophy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59607 17584954 75235 20996 11179 SOD1 ALS ALS 29 3.0 CuZn-SOD that are found in humans with the neurodegenerative disease ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59608 17584954 75236 20996 11179 SOD1 ALS ALS 0 3.0 ALS is characterized by selective loss of upper and lower motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59609 17584954 75237 20996 11179 SOD1 ALS ALS 15 3.0 of the CuZn-SOD protein develop a disease strikingly similar to ALS ( 31 including paralysis and significant loss of muscle mass 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59610 17584954 75238 18723 10261 ROS1 ROS ROS 2 0.6 We measured ROS production in skeletal muscle mitochondria from two different CuZn-SOD mutant 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59611 17584954 75243 18723 10261 ROS1 ROS ROS 7 0.6 In this study we propose that mitochondrial ROS is a critical factor in the mechanism underlying muscle atrophy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59612 17584954 75244 18723 10261 ROS1 ROS ROS 15 0.6 in all three models we observed a significant increase in ROS generation that correlated to the extent of muscle atrophy i.e. 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59613 17584954 75244 18723 10261 ROS1 ROS ROS 27 0.6 that correlated to the extent of muscle atrophy i.e. greater ROS generation in models exhibiting greater atrophy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59615 17584954 75245 20996 11179 SOD1 ALS ALS 15 3.0 the three conditions we studied (aging, aging Sod1 mice and ALS is largely the result of loss of innervation we asked 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59616 17584954 75245 18723 10261 ROS1 ROS ROS 30 0.6 of loss of innervation we asked whether mitochondrial generation of ROS would be induced by surgical denervation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59617 17584954 75246 18723 10261 ROS1 ROS ROS 18 0.6 rapid muscle mass loss and a dramatic increase in mitochondria ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59618 17584954 75247 18723 10261 ROS1 ROS ROS 18 0.6 loss of innervation in the induction of skeletal muscle mitochondrial ROS generation oxidative stress and loss of muscle mass 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59621 17584954 75251 20996 11179 SOD1 ALS ALS 2 3.0 Two different ALS mouse models were employed 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59622 17584954 75263 18723 10261 ROS1 ROS ROS 1 0.6 Mitochondrial ROS production was measured with the Amplex red-horseradish peroxidase (HRP) HRP 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59623 17584954 75266 18723 10261 ROS1 ROS ROS 20 0.6 H 2 O 2 production and are referred to as ROS rather than H 2 O 2 production ( 55 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59624 17584954 75272 8255 4236 GFER HPO HPO 21 0.3 HEPES 5 mM MgCl 2 and 2 mM K 2 HPO 4 pH 7.44 1 JUMiner_v2.2 1 2 k 2 hpo 0 0 0 0 0 0 0 0 59625 17584954 75275 8255 4236 GFER HPO HPO 21 0.3 HEPES 5 mM MgCl 2 and 2 mM K 2 HPO 4 pH 7.44 with 0.3% BSA 1 JUMiner_v2.2 1 2 k 2 hpo 0 0 0 0 0 0 0 0 59626 17584954 75276 24185 29175 WDTC1 ADP ADP 11 0.0 3 respiration was induced with the addition of 0.3 mM ADP 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 59627 17584954 75287 18723 10261 ROS1 ROS ROS 0 0.6 ROS production is increased in muscle mitochondria during aging and is 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59628 17584954 75288 18723 10261 ROS1 ROS ROS 23 0.6 of muscle mass is associated with alterations in muscle mitochondrial ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59629 17584954 75291 18723 10261 ROS1 ROS ROS 8 0.6 The major finding of this study is that ROS production was elevated in skeletal muscle mitochondria isolated from mice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59631 17584954 75291 20996 11179 SOD1 ALS ALS 43 3.0 mice (a a mouse model of accelerated sarcopenia and two ALS mutant mouse models differing in the time course and extent 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59632 17584954 75292 18723 10261 ROS1 ROS ROS 5 0.6 Thus as Fig 6 illustrates ROS production was lowest during normal aging (when when the extent 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59634 17584954 75292 20996 11179 SOD1 ALS ALS 33 3.0 from the Sod1 mice and increased nearly 10-fold in G93A ALS mutant mice which showed the most dramatic muscle atrophy 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59635 17584954 75293 18723 10261 ROS1 ROS ROS 12 0.6 also holds within each of the models studied i.e. both ROS production and loss of muscle mass were higher in 32-mo-old 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59636 17584954 75293 18723 10261 ROS1 ROS ROS 28 0.6 mass were higher in 32-mo-old than in 27-mo-old normal mice ROS production and atrophy were higher in 20-mo-old than in 5-mo-old 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59638 17584954 75293 18723 10261 ROS1 ROS ROS 42 0.6 were higher in 20-mo-old than in 5-mo-old Sod1 mice and ROS generation was higher in the G93A compared with the H46RH48Q 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59639 17584954 75293 20996 11179 SOD1 ALS ALS 54 3.0 was higher in the G93A compared with the H46RH48Q mutant ALS models and in agreement with more atrophy in G93A 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59640 17584954 75296 20996 11179 SOD1 ALS ALS 5 3.0 Denervation is extensively documented in ALS caused by the degeneration of lower motor neurons ( 75 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59643 17584954 75299 20996 11179 SOD1 ALS ALS 12 3.0 characteristic of the three models (aging, aging Sod1 mice and ALS mutant mice is alterations in innervation of muscle fibers ( 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59644 17584954 75300 18723 10261 ROS1 ROS ROS 10 0.6 To test whether denervation contributes to an increase in mitochondrial ROS we measured ROS generation in mouse muscle following sciatic nerve 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59645 17584954 75300 18723 10261 ROS1 ROS ROS 13 0.6 denervation contributes to an increase in mitochondrial ROS we measured ROS generation in mouse muscle following sciatic nerve transection 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59646 17584954 75301 18723 10261 ROS1 ROS ROS 0 0.6 ROS generation was dramatically increased in surgically denervated muscle demonstrating a 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59647 17584954 75301 18723 10261 ROS1 ROS ROS 19 0.6 demonstrating a direct role for denervation in increased muscle mitochondrial ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59648 17584954 75302 18723 10261 ROS1 ROS ROS 4 0.6 Thus an elevation in ROS generation is a common event in skeletal muscle mitochondria under 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59649 17584954 75303 18723 10261 ROS1 ROS ROS 9 0.6 What is the connection between denervation and altered mitochondrial ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59650 17584954 75306 20996 11179 SOD1 ALS ALS 19 3.0 inhibition of neural signaling occurs in many neuromuscular diseases including ALS or spinal cord injury ( 75 spinal muscular atrophy ( 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59651 17584954 75311 18723 10261 ROS1 ROS ROS 23 0.6 loss of innervation that leads to muscle mitochondrial dysfunction increased ROS generation and an increase in oxidative stress the consequences of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59652 17584954 75311 18723 10261 ROS1 ROS ROS 58 0.6 additional neurons or neuromuscular junctions exacerbating the increase in muscle ROS generation even further and continuing the cycle of damage 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59653 17584954 75315 18723 10261 ROS1 ROS ROS 15 0.6 subjected to nerve transaction also reported an increase in mitochondrial ROS generation that was associated with an increase in the mitochondrial 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59654 17584954 75317 18723 10261 ROS1 ROS ROS 6 0.6 How might the increase in mitochondrial ROS production contribute to the loss of muscle mass 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59655 17584954 75319 18723 10261 ROS1 ROS ROS 7 0.6 We can propose several ways that mitochondrial ROS generation might contribute to muscle atrophy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59656 17584954 75320 18723 10261 ROS1 ROS ROS 7 0.6 It is possible that the increased in ROS directly or indirectly damages proteins increasing their turnover which could 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59657 17584954 75321 18723 10261 ROS1 ROS ROS 2 0.6 Alternatively increased ROS may damage critical enzymes such as those involved in energy 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59658 17584954 75322 18723 10261 ROS1 ROS ROS 3 0.6 In fact increased ROS production following denervation is mirrored by decreases in surface hydrophobicity 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59659 17584954 75323 18723 10261 ROS1 ROS ROS 2 0.6 Increased mitochondrial ROS may also play a signaling role 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59660 17584954 75324 18723 10261 ROS1 ROS ROS 7 0.6 Another good candidate for an effect of ROS on signaling is NF-kappaB. 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59662 17584954 75326 18723 10261 ROS1 ROS ROS 15 0.6 a central role in intrinsic pathway of apoptosis and mitochondrial ROS generation and atrophy could also be linked through apoptosis ( 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59663 17584954 75327 18723 10261 ROS1 ROS ROS 1 0.6 Mitochondrial ROS has also been shown to lead to upregulation of the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59666 17584954 75328 18723 10261 ROS1 ROS ROS 15 0.6 whether the loss of innervation precedes the increase in mitochondrial ROS generation or vice versa 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59668 17584954 75329 20996 11179 SOD1 ALS ALS 15 3.0 young and old wild-type mice the Sod1 model and the ALS mouse models we cannot be certain whether the increase in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59669 17584954 75329 18723 10261 ROS1 ROS ROS 26 0.6 mouse models we cannot be certain whether the increase in ROS generation precedes or follows changes in innervation especially in the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59671 17584954 75330 18723 10261 ROS1 ROS ROS 13 0.6 however is that in each situation both muscle atrophy and ROS production increase over time 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59672 17584954 75331 20996 11179 SOD1 ALS ALS 1 3.0 In ALS mice muscle atrophy occurs over weeks rather than months and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59673 17584954 75331 18723 10261 ROS1 ROS ROS 31 0.6 roughly correlate the timing of loss of muscle mass and ROS increase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59674 17584954 75332 20996 11179 SOD1 ALS ALS 19 3.0 begins as early as 30-40 days of age in G93A ALS mice ( 24 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59675 17584954 75333 18723 10261 ROS1 ROS ROS 17 0.6 we had already detected a small but significant increase in ROS production supporting the fact that denervation and muscle ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59676 17584954 75333 18723 10261 ROS1 ROS ROS 26 0.6 in ROS production supporting the fact that denervation and muscle ROS generation are closely related and suggesting denervation precedes the increase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59677 17584954 75333 18723 10261 ROS1 ROS ROS 38 0.6 are closely related and suggesting denervation precedes the increase in ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59678 17584954 75335 18723 10261 ROS1 ROS ROS 0 0.6 ROS generation was significantly increased 2 days after nerve transaction but 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59679 17584954 75336 18723 10261 ROS1 ROS ROS 15 0.6 the loss of innervation precedes the increase in muscle mitochondrial ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59680 17584954 75337 18723 10261 ROS1 ROS ROS 10 0.6 Furthermore the sciatic nerve transection demonstrated that an elevation in ROS generation precedes a significant loss in muscle mass (by by 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59681 17584954 75338 18723 10261 ROS1 ROS ROS 1 0.6 Although ROS production was increased as early as 5 days after sciatic 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59682 17584954 75339 18723 10261 ROS1 ROS ROS 6 0.6 The fact that dramatic changes in ROS were present before the loss of muscle mass supports the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59683 17584954 75339 18723 10261 ROS1 ROS ROS 19 0.6 before the loss of muscle mass supports the hypothesis that ROS may in fact contribute to muscle mass loss 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59684 17584954 75340 20996 11179 SOD1 ALS ALS 18 3.0 of muscle mass loss were quite different in these two ALS animal models and that these changes correlated with muscle mitochondrial 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59685 17584954 75340 18723 10261 ROS1 ROS ROS 29 0.6 animal models and that these changes correlated with muscle mitochondrial ROS generation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59686 17584954 75342 20996 11179 SOD1 ALS ALS 6 3.0 In effect the H46RH48Q mice developed ALS despite remarkably little muscle mass loss 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59687 17584954 75343 20996 11179 SOD1 ALS ALS 1 3.0 Incidentally ALS patients with the H46R mutation have a very long survival 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59688 17584954 75344 20996 11179 SOD1 ALS ALS 23 3.0 insight into the role of denervation in the etiology of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59689 17584954 75345 20996 11179 SOD1 ALS ALS 0 3.0 ALS has been proposed to be more than a strict neuropathy 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59690 17584954 75346 20996 11179 SOD1 ALS ALS 7 3.0 A converging line of argument suggests that ALS is a distal axonopathy ( 24 that is the disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59691 17584954 75349 20996 11179 SOD1 ALS ALS 6 3.0 The fact that H46RH48Q mice develop ALS with only mild muscle mass loss (and and that occurs 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59692 17584954 75350 18723 10261 ROS1 ROS ROS 40 0.6 which is reflected in the extent of the elevation of ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59693 17584954 75351 18723 10261 ROS1 ROS ROS 20 0.6 whereas muscle atrophy was associated with significant increases in mitochondrial ROS production in state 1 and with the substrates glutamate and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59694 17584954 75351 18723 10261 ROS1 ROS ROS 41 0.6 malate the exact opposite occurred with the substrate succinate succinate-supported ROS release was significantly decreased in conditions in which the loss 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59695 17584954 75352 18723 10261 ROS1 ROS ROS 11 0.6 example although there was no statistically significant difference in succinate-supported ROS release with age succinate-supported H 2 O 2 release was 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59697 17584954 75352 20996 11179 SOD1 ALS ALS 31 3.0 was in fact lower in old Sod1 and late-stage G93A ALS skeletal muscle mitochondria conditions that are associated with losses in 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59698 17584954 75353 18723 10261 ROS1 ROS ROS 6 0.6 The mechanism(s) mechanism s driving this decrease in ROS production and the potential physiological relevance of this phenomenon are 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59699 17584954 75356 18723 10261 ROS1 ROS ROS 7 0.6 We therefore conclude that the increases in ROS observed in state 1 that occurred in the presence of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59700 17584954 75357 18723 10261 ROS1 ROS ROS 28 0.6 innervation are associated with dramatic increases in mitochondrial production of ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59701 17584954 75358 18723 10261 ROS1 ROS ROS 29 0.6 the downstream targets and effects of the increase in mitochondrial ROS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59702 17584954 75361 18723 10261 ROS1 ROS ROS 1 0.6 Increased ROS generation in skeletal muscle mitochondria from young and old mice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59703 17584954 75362 18723 10261 ROS1 ROS ROS 7 0.6 Skeletal muscle mitochondria were isolated and mitochondrial ROS generation was measured as described in EXPERIMENTAL PROCEDURES 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59704 17584954 75365 18723 10261 ROS1 ROS ROS 13 0.6 are mean (_amp_#177;SE) _amp_#177 SE expressed as rates of mitochondrial ROS release measured in male mice killed at 10 mo (open 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59705 17584954 75367 18723 10261 ROS1 ROS ROS 0 0.6 ROS production in D was measured in the presence of 5 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59706 17584954 75369 18723 10261 ROS1 ROS ROS 1 0.6 Increased ROS generation in skeletal muscle mitochondria from Sod1 mice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59712 17584954 75373 18723 10261 ROS1 ROS ROS 4 0.6 C and D ROS generation from skeletal muscle mitochondria isolated from the hindlimb of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59713 17584954 75374 18723 10261 ROS1 ROS ROS 13 0.6 _amp_#177 SE for state 1 and glutamate (Glut)/malate-supported Glut malate-supported ROS generation in mitochondria from 5-mo-old WT ( n = 21 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59716 17584954 75374 18723 10261 ROS1 ROS ROS 54 0.6 = 16 values in D are means _amp_#177 SE for ROS generation in the presence of succinate alone antimycin A succinate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59718 17584954 75376 20996 11179 SOD1 ALS ALS 7 3.0 Muscle mass loss during amyotrophic lateral sclerosis (ALS) ALS in the G93A and H46RH48Q mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59719 17584954 75380 18723 10261 ROS1 ROS ROS 1 0.6 Increased ROS generation in skeletal muscle mitochondria isolated from ALS transgenic mice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59720 17584954 75380 20996 11179 SOD1 ALS ALS 9 3.0 Increased ROS generation in skeletal muscle mitochondria isolated from ALS transgenic mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59721 17584954 75381 18723 10261 ROS1 ROS ROS 0 0.6 ROS production was measured in skeletal muscle mitochondria of female ALS 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59722 17584954 75381 20996 11179 SOD1 ALS ALS 10 3.0 ROS production was measured in skeletal muscle mitochondria of female ALS transgenic mouse models G93A ( A and B and H46R/H48Q 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59723 17584954 75385 18723 10261 ROS1 ROS ROS 0 0.6 ROS production was measured in mitochondria isolated from hindlimb muscle of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59724 17584954 75389 18723 10261 ROS1 ROS ROS 0 0.6 ROS production is dramatically increased following surgical denervation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59725 17584954 75392 18723 10261 ROS1 ROS ROS 7 0.6 Mice were killed tissues were harvested and ROS production was measured in isolated muscle mitochondria at 2 ( 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59726 17584954 75393 18723 10261 ROS1 ROS ROS 8 0.6 A time course of the rate of ROS production in state 1 following denervation (filled filled squares denervated 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59727 17584954 75395 18723 10261 ROS1 ROS ROS 2 0.6 C ROS generation in mitochondria from the control (open open bars and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59728 17584954 75396 18723 10261 ROS1 ROS ROS 19 0.6 = 5 mice * P _lt_ 0.05 significant difference in ROS generation in muscle mitochondria following denervation compared with mitochondria from 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59729 17584954 75399 18723 10261 ROS1 ROS ROS 5 0.6 Correlation between muscle atrophy and ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59730 17584954 75400 18723 10261 ROS1 ROS ROS 0 0.6 ROS production data in state 1 are plotted vs gastrocnemius muscle 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59731 17584954 75401 18723 10261 ROS1 ROS ROS 3 0.6 Muscle mass and ROS production are expressed as the increase relative to young wild-type 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59732 17584954 75405 18723 10261 ROS1 ROS ROS 0 0.6 ROS production and mitochondrial respiration were measured in muscle mitochondria isolated 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59733 17584954 75408 18723 10261 ROS1 ROS ROS 3 0.6 Measurement of mitochondrial ROS production in isolated mitochondria is most traditionally done in the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59734 17584954 75408 18723 10261 ROS1 ROS ROS 23 0.6 the presence of added substrates largely because the levels of ROS with endogenous (state state 1 substrates are too low to 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59735 17584954 75409 18723 10261 ROS1 ROS ROS 17 0.6 the fluorogenic probe Amplex red is sensitive enough to detect ROS produced in mitochondria even during state 1 in the absence 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59736 17584954 75410 18723 10261 ROS1 ROS ROS 12 0.6 we previously found that the age-related increase in state 1 ROS generation is greater than in mitochondria exposed to glutamate/malate glutamate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59737 17584954 75411 18723 10261 ROS1 ROS ROS 9 0.6 As shown in Fig 1 C state 1 ROS production was increased nearly twofold in mitochondria isolated from hindlimb 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59738 17584954 75412 18723 10261 ROS1 ROS ROS 7 0.6 In 32-mo-old animals the increase in ROS generation was even greater reaching levels approximately threefold higher than 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59739 17584954 75414 18723 10261 ROS1 ROS ROS 8 0.6 In mitochondria isolated from muscle of 10-mo-old mice ROS generation was about five times higher with glutamate/malate glutamate malate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59740 17584954 75415 18723 10261 ROS1 ROS ROS 0 0.6 ROS generation in mitochondria respiring on glutamate/malate glutamate malate occurs primarily 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59741 17584954 75416 18723 10261 ROS1 ROS ROS 0 0.6 ROS production using glutamate/malate glutamate malate was increased with age and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59742 17584954 75417 18723 10261 ROS1 ROS ROS 3 0.6 The difference in ROS production with 5 mM glutamate/malate glutamate malate as a substrate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59743 17584954 75418 18723 10261 ROS1 ROS ROS 1 0.6 When ROS generation with glutamate/malate glutamate malate was stimulated by the addition 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59744 17584954 75418 18723 10261 ROS1 ROS ROS 19 0.6 addition of the complex I inhibitor rotenone the rate of ROS generation was increased ~10-fold but any effect of age disappeared 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59745 17584954 75419 18723 10261 ROS1 ROS ROS 0 0.6 ROS release with the substrate succinate exhibited quite different trends from 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59746 17584954 75422 18723 10261 ROS1 ROS ROS 28 0.6 interest in succinate-driven reverse electron transfer because this source of ROS is so much greater than any others at least under 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59747 17584954 75423 18723 10261 ROS1 ROS ROS 5 0.6 We compared the rates of ROS generation in young and old skeletal muscle mitochondria with succinate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59748 17584954 75424 18723 10261 ROS1 ROS ROS 17 0.6 III inhibitor resulted in a seven- to eightfold increase in ROS generation that similar to the production of ROS in response 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59749 17584954 75424 18723 10261 ROS1 ROS ROS 25 0.6 increase in ROS generation that similar to the production of ROS in response to the complex I inhibitor rotenone was not 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59750 17584954 75425 18723 10261 ROS1 ROS ROS 3 0.6 Skeletal muscle mitochondrial ROS production is increased in Sod1 null mice and is associated 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59755 17584954 75431 18723 10261 ROS1 ROS ROS 2 0.6 State 1 ROS production was increased over 30% in mitochondria from Sod1 mice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59757 17584954 75432 18723 10261 ROS1 ROS ROS 5 0.6 By 20 mo of age ROS production in mitochondria from Sod1 mice was threefold higher than 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59759 17584954 75433 18723 10261 ROS1 ROS ROS 9 0.6 In mitochondria incubated with glutamate malate as respiratory substrates ROS release was increased ~35% (30.89 30.89 _amp_#177 4.77 pmol H 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59762 17584954 75434 18723 10261 ROS1 ROS ROS 7 0.6 In 20-mo-old Sod1 mice the increase in ROS generation with the substrates glutamate and malate was >100% ( 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59763 17584954 75435 18723 10261 ROS1 ROS ROS 6 0.6 There was no significant difference in ROS production in state 1 or in response to glutamate/malate glutamate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59764 17584954 75436 18723 10261 ROS1 ROS ROS 5 0.6 This is consistent with increased ROS being specifically associated with age-associated muscle loss since wild-type mice 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59767 17584954 75439 18723 10261 ROS1 ROS ROS 0 0.6 ROS production is increased in muscle mitochondria in mouse models of 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59768 17584954 75439 20996 11179 SOD1 ALS ALS 11 3.0 production is increased in muscle mitochondria in mouse models of ALS and is correlated with the extent of muscle atrophy 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59769 17584954 75440 18723 10261 ROS1 ROS ROS 5 0.6 We next measured state 1 ROS production in mitochondria in another mouse model associated with significant 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59770 17584954 75441 20996 11179 SOD1 ALS ALS 4 3.0 We studied two different ALS mutant models the well-characterized G93A mutant ( 31 and mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59772 17584954 75447 18723 10261 ROS1 ROS ROS 11 0.6 pattern of muscle atrophy correlated closely with increases in mitochondrial ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59773 17584954 75448 18723 10261 ROS1 ROS ROS 2 0.6 State 1 ROS release during the disease course in G93A mice was increased 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59775 17584954 75449 18723 10261 ROS1 ROS ROS 13 0.6 mutant mice there was an up to fourfold increase in ROS release at late stage but virtually no change at early 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59776 17584954 75450 18723 10261 ROS1 ROS ROS 10 0.6 stage G93A mice with glutamate/malate glutamate malate as respiratory substrate ROS release was increased over sixfold ( Fig 4 A and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59777 17584954 75450 18723 10261 ROS1 ROS ROS 31 0.6 A and E but in contrast in the H46RH48Q mice ROS release was only ~75% higher compared with the age-matched wild-type 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59779 17584954 75451 18723 10261 ROS1 ROS ROS 10 0.6 As we had observed in mitochondria from the Sod1 mice ROS production with succinate as a substrate was lower in G93A 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59781 17584954 75452 18723 10261 ROS1 ROS ROS 13 0.6 in Fig 4 C in addition to the increase in ROS the RCR was decreased 46% in mitochondria isolated from muscle 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59782 17584954 75453 18723 10261 ROS1 ROS ROS 0 0.6 ROS production is increased in muscle mitochondria following surgical denervation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59783 17584954 75454 18723 10261 ROS1 ROS ROS 13 0.6 denervation might be a factor in the increase in mitochondrial ROS in the three models of muscle atrophy studied here we 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59784 17584954 75454 18723 10261 ROS1 ROS ROS 28 0.6 of muscle atrophy studied here we measured mitochondrial state 1 ROS generation in the gastrocnemius and tibialis anterior muscles following denervation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59785 17584954 75455 18723 10261 ROS1 ROS ROS 0 0.6 ROS release was increased dramatically 5 days after sciatic nerve transection 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59786 17584954 75456 18723 10261 ROS1 ROS ROS 21 0.6 the loss of muscle mass was minimal yet state 1 ROS production was nearly 30-fold higher in mitochondria isolated from the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59787 17584954 75457 18723 10261 ROS1 ROS ROS 0 0.6 ROS release with glutamate/malate glutamate malate was 11-fold higher in the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59788 17584954 75458 18723 10261 ROS1 ROS ROS 9 0.6 There was no significant difference in the rates of ROS production in response to denervation with the use of succinate 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59789 17584954 75460 18723 10261 ROS1 ROS ROS 8 0.6 The relationship between muscle atrophy and induction of ROS generation by skeletal muscle mitochondria isolated from young and old 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 59791 17584954 75460 20996 11179 SOD1 ALS ALS 27 3.0 and old wild-type mice 20-mo-old Sod1 mice and the two ALS mouse models is illustrated in Fig 6 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00158202037855057<>ScoreDetail__5468|IGFALS|0.000571371434285143__11179|SOD1|0.00158202037855057__ 0 0 0 0 0 59792 17584954 75461 18723 10261 ROS1 ROS ROS 18 0.6 greater loss of muscle mass show relatively higher levels of ROS production 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 49061 17634371 61548 20996 11179 SOD1 ALS ALS 8 1.7 In motor neurons overexpressing the amyotrophic lateral sclerosis (ALS)-linked ALS -linked superoxide dismutase 1 (SOD1 SOD1 mutation NGF induced apoptosis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49072 17634371 61553 20996 11179 SOD1 ALS ALS-linked 9 1.7 This apoptotic pathway is facilitated by the expression of ALS-linked SOD1 mutations and critically modulated by Nrf2 activity 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49088 17634371 61559 20996 11179 SOD1 ALS ALS 30 1.7 Ferri et al. 1998 and in amyotrophic lateral sclerosis (ALS) ALS (Seeburger Seeburger et al. 1993 Lowry et al. 2001b 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49102 17634371 61568 18723 10261 ROS1 ROS ROS 30 0.0 promote cytochrome c release and induce reactive oxygen species (ROS) ROS production (Garcia-Ruiz Garcia-Ruiz et al. 1997 Gudz et al. 1997 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49103 17634371 61568 12393 6899 MAS1 MAS Mas 48 0.0 1997 Gudz et al. 1997 Quillet-Mary et al. 1997 Mansat-de Mas et al. 1999 Birbes et al. 2002 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49105 17634371 61569 6981 22140 FAM20C RNS RNS 19 0.6 involves increased production of ROS and reactive nitrogen species (RNS) RNS (Pehar Pehar et al. 2004 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 49106 17634371 61569 18723 10261 ROS1 ROS ROS 14 0.0 that p75 -induced motor neuron death involves increased production of ROS and reactive nitrogen species (RNS) RNS (Pehar Pehar et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49108 17634371 61570 18723 10261 ROS1 ROS ROS 6 0.0 However the source of the increased ROS production induced by p75 activation in motor neurons is currently 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49110 17634371 61571 20996 11179 SOD1 ALS ALS-linked 19 1.7 mediated by p75 in motor neurons and the impact of ALS-linked SOD1 expression 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49113 17634371 61573 20996 11179 SOD1 ALS ALS-linked 3 1.7 Motor neurons overexpressing ALS-linked SOD1 mutation showed greater susceptibility to the p75 -activated apoptotic 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49119 17634371 61576 22000 11730 TERT TERT tert 15 0.3 Harlan (Madison, Madison WI recombinant human soluble Fas ligand and tert -butylhydroquinone (tBHQ) tBHQ from Alexis (San San Diego CA and 14 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 49125 17634371 61586 13439 1304 MRAP B27 B-27 27 0.0 micro M 2-mercaptoethanol 0.5 m M L -glutamine and 2% B-27 supplement (Invitrogen) Invitrogen 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49129 17634371 61591 19573 10691 SDS SDS SDS-polyacrylamide 19 0.0 microg of spinal cord extract were resolved on a 12% SDS-polyacrylamide gel and transferred to nitrocellulose membrane 11 JUMiner_v2.2 1 0 0 2 19440 TotalCon:2<>10691|SDS|10993|Complete__19440|SBDS|51119|Complete__<>AvaiableGeneRif=2<>BEST:19440|SBDS|0.000280628304019052<>ScoreDetail__10691|SDS|0.000107700592353258__19440|SBDS|0.000280628304019052__ 0 0 0 0 0 49161 17634371 61647 20996 11179 SOD1 ALS ALS-linked 1 1.7 Moreover ALS-linked SOD1 overexpression increases motor neuron vulnerability to NGF-mediated apoptosis by 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49181 17634371 61656 20996 11179 SOD1 ALS ALS 5 1.7 Interestingly the spinal cord of ALS patients and SOD1 mice exhibit a remarkable increase in ceramides 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49192 17634371 61666 20996 11179 SOD1 ALS ALS-linked 8 1.7 It was previously shown that motor neurons overexpressing ALS-linked SOD1 mutations (G37R, G37R G85R or G93A display increased susceptibility 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49215 17634371 61679 8190 15990 GCA GCL GCL 10 0.0 GSH is synthesized by the consecutive action of the enzymes GCL and glutathione synthetase 1 JUMiner_v2.2 1 0 0 2 23843 TotalCon:3<>15990|GCA|25801|Complete__19717|GMCL1L|64396|No_GeneRif__23843|GMCL1|64395|Complete__<>AvaiableGeneRif=2<>BEST:23843|GMCL1|0.000291833863150763<>ScoreDetail__23843|GMCL1|0.000291833863150763__15990|GCA|0.000132177999706271__ 0 0 0 0 0 49219 17634371 61680 8190 15990 GCA GCL GCL 0 0.0 GCL catalyzes the rate-limiting step in GSH biosynthesis and both subunits 1 JUMiner_v2.2 1 0 0 2 23843 TotalCon:3<>15990|GCA|25801|Complete__19717|GMCL1L|64396|No_GeneRif__23843|GMCL1|64395|Complete__<>AvaiableGeneRif=2<>BEST:23843|GMCL1|0.000291833863150763<>ScoreDetail__23843|GMCL1|0.000291833863150763__15990|GCA|0.000132177999706271__ 0 0 0 0 0 49227 17634371 61682 20996 11179 SOD1 ALS ALS 30 1.7 SOD1 expression vector and in motor neurons from SOD1-associated familial ALS cases (Kirby Kirby et al. 2005 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49231 17634371 61683 6981 22140 FAM20C RNS RNS 28 0.6 but also to Fas-mediated apoptosis which also involves ROS and RNS production (Raoul Raoul et al. 2002 tBHQ has been established 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 49235 17634371 61683 18723 10261 ROS1 ROS ROS 26 0.1 to NGF but also to Fas-mediated apoptosis which also involves ROS and RNS production (Raoul Raoul et al. 2002 tBHQ has 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 49236 17634371 61683 8190 15990 GCA GCL GCL 56 0.0 Nrf2 and to subsequently increase GSH content by induction of GCL tBHQ causes increased GCL expression only when Nrf2 is present 1 JUMiner_v2.2 1 0 0 2 23843 TotalCon:3<>15990|GCA|25801|Complete__19717|GMCL1L|64396|No_GeneRif__23843|GMCL1|64395|Complete__<>AvaiableGeneRif=2<>BEST:23843|GMCL1|0.000291833863150763<>ScoreDetail__23843|GMCL1|0.000291833863150763__15990|GCA|0.000132177999706271__ 0 0 0 0 0 49237 17634371 61683 8190 15990 GCA GCL GCL 60 0.0 increase GSH content by induction of GCL tBHQ causes increased GCL expression only when Nrf2 is present but it does not 1 JUMiner_v2.2 1 0 0 2 23843 TotalCon:3<>15990|GCA|25801|Complete__19717|GMCL1L|64396|No_GeneRif__23843|GMCL1|64395|Complete__<>AvaiableGeneRif=2<>BEST:23843|GMCL1|0.000291833863150763<>ScoreDetail__23843|GMCL1|0.000291833863150763__15990|GCA|0.000132177999706271__ 0 0 0 0 0 49260 17634371 61696 5131 2524 CTRL CTRL Ctrl 11 0.2 (1 1 ng/ml) ng ml were exposed to vehicle (Ctrl), Ctrl NGF (100 100 ng/ml), ng ml DETA-NONOate (10 10 micro 5 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 49297 17634371 61722 22825 30698 TRAT1 TRIM TRIM 31 1.3 (1 1 n M NAME (1 1 m M or TRIM (10 10 micro M 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 49303 17634371 61726 20996 11179 SOD1 ALS ALS 22 1.7 in the spinal cord and isolated motor neurons from transgenic ALS mice embryos 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00263912306447868<>ScoreDetail__5468|IGFALS|0.000345527577419773__11179|SOD1|0.00263912306447868__ 0 0 0 0 0 49340 17634371 61756 18723 10261 ROS1 ROS ROS 9 0.0 It has been previously shown that ceramide may induce ROS production by mitochondria (Garcia-Ruiz Garcia-Ruiz et al. 1997 Quillet-Mary et 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49341 17634371 61756 12393 6899 MAS1 MAS Mas 24 0.0 (Garcia-Ruiz Garcia-Ruiz et al. 1997 Quillet-Mary et al. 1997 Mansat-de Mas et al. 1999 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49343 17634371 61757 18723 10261 ROS1 ROS ROS 9 0.0 We therefore tested for the potential involvement of mitochondrial ROS production in NGF-mediated motor neuron death 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49351 17634371 61764 18723 10261 ROS1 ROS ROS 38 0.0 neuron death ( Fig 2 B strengthening the role of ROS production by mitochondria in p75 -mediated motor neuron apoptosis 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 49372 17634371 61772 22825 30698 TRAT1 TRIM TRIM 38 1.3 synthase (NOS) NOS inhibitor and 1-(2-trifluoromethylphenyl)imidazole 1- 2-trifluoromethylphenyl imidazole (TRIM) TRIM (10 10 micro M a specific inhibitor of the neuronal 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 51654 17678953 64372 18723 10261 ROS1 ROS ROS 14 0.0 as nitric oxide (NO) NO and reactive oxygen species (ROS), ROS can contribute to neurodegenerative diseases in part by triggering protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 51655 17678953 64374 20996 11179 SOD1 ALS ALS 39 0.0 ranging from Parkinson's disease (PD), PD amyotrophic lateral sclerosis (ALS), ALS multiple sclerosis and Alzheimer's disease (AD) AD to stroke and 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000568982184781108<>ScoreDetail__5468|IGFALS|0.000370578326782706__11179|SOD1|0.000568982184781108__ 0 0 0 0 0 51656 17678953 64375 18723 10261 ROS1 ROS ROS 36 0.0 ion channel and subsequent free radical production including NO and ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 51659 17678953 64388 1442 905 AXL UFO UFO 9 0.0 these Uncompetitive/Fast Uncompetitive Fast Off-rate therapeutics we use the term UFO drugs because like Unidentified Flying Objects they leave very quickly 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 51661 17678953 64396 1442 905 AXL UFO UFO 16 0.0 can be achieved by coupling NO to memantine yielding second-generation UFO drugs known as NitroMemantines 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40656 17719032 50698 20996 11179 SOD1 ALS ALS 21 1.4 may contribute to excitotoxic motor neuron (MN) MN damage in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40657 17719032 50699 18723 10261 ROS1 ROS ROS 33 0.0 mitochondrial Ca 2 overload and strong reactive oxygen species (ROS) ROS generation 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40658 17719032 50701 20996 11179 SOD1 ALS ALS 36 1.4 1-naphthyl acetylspermine (NAS), NAS in G93A transgenic rat models of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40662 17719032 50708 20996 11179 SOD1 ALS ALS 3 1.4 Amyotrophic lateral sclerosis (ALS) ALS is an adult onset neurodegenerative disease characterized by the selective 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40664 17719032 50713 20996 11179 SOD1 ALS ALS 6 1.4 Currently the best animal models of ALS are provided by rodents harboring mutant forms of the enzyme 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40666 17719032 50713 20996 11179 SOD1 ALS ALS 27 1.4 Zn superoxide dismutase (SOD1), SOD1 which are associated with familial ALS in humans 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40667 17719032 50714 20996 11179 SOD1 ALS ALS 11 1.4 the role of Ca-AMPA channels in in vivo models of ALS recent studies indicate that the rate of progression of MN 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40669 17719032 50715 20996 11179 SOD1 ALS ALS 16 1.4 contribute to MN loss in a distinct form of familial ALS not linked to SOD1 ( Lai et al. 2006 and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40671 17719032 50717 18723 10261 ROS1 ROS ROS 39 0.0 2 is readily taken up into mitochondria resulting in strong ROS generation ( Carriedo et al. 2000 and Rao et al. 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40672 17719032 50717 832 549 AOC2 RAO Rao 47 0.0 in strong ROS generation ( Carriedo et al. 2000 and Rao et al. 2003 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40673 17719032 50719 18723 10261 ROS1 ROS ROS 11 0.0 a possible clue recent in vitro studies indicated that the ROS produced in MNs in response to Ca-AMPA channel activation was 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40674 17719032 50719 832 549 AOC2 RAO Rao 34 0.0 inducing oxidative disruption of glutamate transporters in surrounding astrocytes ( Rao et al. 2003 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40675 17719032 50720 20996 11179 SOD1 ALS ALS 10 1.4 If such a mechanism contributed to glutamate transport disruption in ALS it could provide the basis for a feed forward cycle 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40676 17719032 50720 832 549 AOC2 RAO Rao 29 0.0 forward cycle that could be integral to disease progression ( Rao and Weiss 2004 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40677 17719032 50721 20996 11179 SOD1 ALS ALS 33 1.4 to MN degeneration in an in vivo animal model of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40678 17719032 50722 18723 10261 ROS1 ROS ROS 8 0.0 Specifically in light of culture studies suggesting that ROS produced in MNs in response to excitotoxic activation might contribute 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40683 17719032 50743 7361 20442 FBRS FBS FBS 10 0.0 stains were carried out on floating sections blocked (10% 10% FBS 1_amp_#xa0 h and exposed to primary antibody in 10% FBS 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 40684 17719032 50743 7361 20442 FBRS FBS FBS 19 0.0 FBS 1_amp_#xa0 h and exposed to primary antibody in 10% FBS 0.3% Triton-X 100 (SMI-32, SMI-32 1 8000 ip 1 2000 1 JUMiner_v2.2 1 0 0 1 0 TotalCon:2<>20442|FBRS|64319|Complete__13587|FBXO8|26269|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 40691 17719032 50768 11858 30830 LIN9 TGS Tg-S 21 0.0 with saline (WT), WT transgenic animals infused with saline (Tg-S), Tg-S and sibling transgenic animals infused with NAS (Tg-NAS) Tg-NAS 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40692 17719032 50773 11858 30830 LIN9 TGS Tg-S 19 0.0 (comprising comprising 2 ventral horns with 40% loss in the Tg-S condition and substantially greater MN loss in the end-stage (Tg-ES) 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40695 17719032 50777 20996 11179 SOD1 ALS ALS 21 1.4 of astrocytic glutamate transport in SOD1 mutant rodent models of ALS ( Alexander et al. 2000 Ferrante et al. 1997 and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40699 17719032 50779 11858 30830 LIN9 TGS Tg-S 19 0.0 numbers and intensity of labeling of large GFAP-positive astrocytes in Tg-S mild attenuation of this astrocytosis in the Tg-NAS condition and 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40700 17719032 50782 18723 10261 ROS1 ROS ROS 32 0.0 sharply with distance possibly consistent with a role of MN ROS in the astrocyte damage ( Fig 2 B 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40701 17719032 50784 11858 30830 LIN9 TGS Tg-S 10 0.0 There was a modest increase in NT labeling in the Tg-S conditions which however was not decreased by NAS 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40706 17719032 50790 11858 30830 LIN9 TGS Tg-S 22 0.0 in GLT-1 labeling surrounding MNs in sham-treated transgenic animals (Tg-S) Tg-S 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40711 17719032 50797 18723 10261 ROS1 ROS ROS 19 0.0 has direct effects on astrocytes observations that MNs are strong ROS generators in response to Ca-AMPA channel activation taken together with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40712 17719032 50798 20996 11179 SOD1 ALS ALS 8 1.4 Clues to MN loss in G93A model of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40713 17719032 50799 20996 11179 SOD1 ALS ALS 13 1.4 in the Introduction observations of impaired astrocytic glutamate transport in ALS support an excitotoxic contribution to MN damage in the disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40715 17719032 50802 20996 11179 SOD1 ALS ALS 46 1.4 similar MN ROS generation might contribute to astrocyte dysfunction in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40716 17719032 50802 18723 10261 ROS1 ROS ROS 9 0.0 In our prior culture studies we found that the ROS generated in MNs in response to excitotoxic activation appeared able 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40717 17719032 50802 18723 10261 ROS1 ROS ROS 38 0.0 in adjacent astrocytes leading us to suggest that similar MN ROS generation might contribute to astrocyte dysfunction in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40718 17719032 50803 20996 11179 SOD1 ALS ALS 10 1.4 Consistent with this possibility oxidative tissue damage is prominent in ALS and progressive nitrotyrosine labeling of astrocytes as well as MNs 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40720 17719032 50804 18723 10261 ROS1 ROS ROS 34 0.0 in transgenic animals reflect tissue damage resulting in part from ROS production in MNs 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40721 17719032 50808 832 549 AOC2 RAO Rao 29 0.0 forward vicious cycle which once established could be self-propagating ( Rao and Weiss 2004 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40722 17719032 50809 20996 11179 SOD1 ALS ALS 9 1.4 Such a mechanism could help to explain features of ALS including the rapid progression of the disease after onset as 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40724 17719032 50810 20996 11179 SOD1 ALS ALS 13 1.4 SOD1 mutations only account for a small percentage of human ALS cases these mutations cause a disease which is virtually indistinguishable 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40725 17719032 50810 20996 11179 SOD1 ALS ALS 26 1.4 mutations cause a disease which is virtually indistinguishable from sporadic ALS (which which itself likely has multiple causes with both manifesting 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40727 17719032 50812 20996 11179 SOD1 ALS ALS 6 1.4 Thus it seems likely that in ALS a spectrum of inciting insults can converge into a final 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40729 17719032 50814 20996 11179 SOD1 ALS ALS 13 1.4 increasingly clear that MN degeneration in SOD1 linked models of ALS is non-cell-autonomous with the genotype of glia importantly impacting the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40730 17719032 50816 18723 10261 ROS1 ROS ROS 12 0.0 observations lend preliminary in vivo support to the idea that ROS produced in MNs in response to excitotoxic activation and mitochondrial 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40731 17719032 50819 20996 11179 SOD1 ALS ALS 29 1.4 disease our best chance for effective treatment of most sporadic ALS may be to target the mechanisms underlying disease propagation and 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40732 17719032 50821 20996 11179 SOD1 ALS ALS 10 1.4 However if we can further characterize late stage events in ALS particularly those that are components of positive feedback cycles between 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00106544267306096<>ScoreDetail__5468|IGFALS|0.000318658447934197__11179|SOD1|0.00106544267306096__ 0 0 0 0 0 40733 17719032 50824 11858 30830 LIN9 TGS Tg-S 19 0.0 WT condition in transgenic animals treated with saline infusion (Tg-S), Tg-S there is moderate MN injury characterized variably by cell shrinkage 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40734 17719032 50828 11858 30830 LIN9 TGS Tg-S 36 0.0 each condition # Indicates difference from WT indicates difference from Tg-S by two-tailed t test ( p _amp_#x3c 0.01 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40738 17719032 50832 18723 10261 ROS1 ROS ROS 20 0.0 with the possibility that the labeling is the result of ROS produced within MNs (the the image is shown in pseudocolor 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40742 17719032 50836 11858 30830 LIN9 TGS Tg-S 13 0.0 in numbers of GFAP-positive reactive astrocytes in transgenic animals (Tg-S), Tg-S the modest attenuation of this astrogliosis in the presence of 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40743 17719032 50838 11858 30830 LIN9 TGS Tg-S 11 0.0 marked increase in NT labeling in the transgenic animals (Tg-S), Tg-S initially most prominent within and surrounding ventral horn MNs with 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40748 17719032 50842 11858 30830 LIN9 TGS Tg-S 44 0.0 based upon 6 independent experiments _amp_#x3e 20 fields for WT Tg-S and Tg-NAS conditions 3 experiments 12 fields for Tg-ES NT 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40749 17719032 50842 11858 30830 LIN9 TGS Tg-S 71 0.0 3 independent experiments _amp_#x3e 70 surround regions for WT and Tg-S conditions 3 animals _amp_#x3e 70 regions for Tg-ES condition # 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40750 17719032 50842 11858 30830 LIN9 TGS Tg-S 89 0.0 Tg-ES condition # indicates difference from WT indicates difference from Tg-S by two-tailed t test ( p _amp_#x3c 0.01 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40755 17719032 50845 11858 30830 LIN9 TGS Tg-S 36 0.0 with preservation of dorsal horn labeling in transgenic animals (Tg-S) Tg-S 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40759 17719032 50849 11858 30830 LIN9 TGS Tg-S 27 0.0 from 4 independent experiments _amp_#x3e 100 surround regions for WT Tg-S and Tg-NAS conditions 3 animals _amp_#x3e 60 regions for Tg-ES 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 40760 17719032 50849 11858 30830 LIN9 TGS Tg-S 47 0.0 Tg-ES condition # Indicates difference from WT indicates difference from Tg-S by two-tailed t test ( p _amp_#x3c 0.01 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37289 17956327 46598 12120 6720 LTF LTF LTF 8 0.0 For example AIH (acute acute intermittent hypoxia induces respiratory LTF (long-term long-term facilitation a form of respiratory plasticity arising largely 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37290 17956327 46599 12120 6720 LTF LTF LTF 0 0.0 LTF is a progressive augmentation of ventilation and/or and or respiratory 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37291 17956327 46600 12120 6720 LTF LTF LTF 0 0.0 LTF is observed in multiple respiratory motor outputs including phrenic inspiratory 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37292 17956327 46601 12120 6720 LTF LTF LTF 3 0.0 The magnitude of LTF depends on age gender and genetics 7-9 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37293 17956327 46602 12120 6720 LTF LTF LTF 5 0.0 A fundamental property of respiratory LTF is that it is pattern-sensitive and is elicited by intermittent 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37294 17956327 46603 12120 6720 LTF LTF LTF 19 0.0 long-term potentiation and 5-HT (5-hydroxytryptamine)-dependent 5-hydroxytryptamine -dependent intermediate-term facilitation or LTF in Aplysia 12 13 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37295 17956327 46604 12120 6720 LTF LTF LTF 5 0.0 Although the functional significance of LTF remains uncertain postulated roles include the stabilization of breathing during 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37296 17956327 46605 12120 6720 LTF LTF LTF 9 0.0 Regardless of its physiological relevance the capacity to express LTF may be harnessed as a therapeutic approach to multiple clinical 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37297 17956327 46606 12120 6720 LTF LTF LTF 10 0.0 A detailed understanding of the cellular and synaptic mechanisms of LTF may provide the rationale for new pharmacological approaches in the 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37298 17956327 46607 12120 6720 LTF LTF LTF 21 0.0 the cellular/synaptic cellular synaptic mechanisms that underlie pattern-sensitivity of respiratory LTF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37299 17956327 46608 12120 6720 LTF LTF LTF 23 0.0 yield valuable insights concerning the mechanisms giving rise to respiratory LTF and these concepts may pertain to other forms of pattern-sensitive 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37300 17956327 46609 12120 6720 LTF LTF LTF 5 0.0 Cellular/synaptic Cellular synaptic mechanisms of pLTF (phrenic phrenic LTF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37301 17956327 46610 12120 6720 LTF LTF LTF 7 0.0 Our understanding of the cellular/synaptic cellular synaptic mechanisms of LTF has increased dramatically in recent years particularly for LTF in 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37302 17956327 46610 12120 6720 LTF LTF LTF 16 0.0 of LTF has increased dramatically in recent years particularly for LTF in phrenic motor output (pLTF) pLTF pLTF requires 5-HT 6 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37303 17956327 46612 12120 6720 LTF LTF LTF 15 0.0 5-HT receptor antagonists attenuate pLTF without any effect on hypoglossal LTF suggesting that the relevant 5-HT receptors for pLTF are located 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37304 17956327 46614 12120 6720 LTF LTF LTF 8 0.0 Similar localized mechanisms may give rise to hypoglossal LTF since 5-HT 2A receptors are localized to hypoglossal motor neurons 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37305 17956327 46614 12120 6720 LTF LTF LTF 30 0.0 neurons 20 5-HT 2A receptor activation is necessary for hypoglossal LTF 15 and episodic 5-HT 2 receptor activation elicits hypoglossal LTF 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37306 17956327 46614 12120 6720 LTF LTF LTF 42 0.0 LTF 15 and episodic 5-HT 2 receptor activation elicits hypoglossal LTF in in vitro brainstem slice preparations via post-synaptic mechanisms 11 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37321 17956327 46625 18723 10261 ROS1 ROS ROS 0 0.9 ROS (reactive reactive oxygen species are also necessary for pLTF following 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37322 17956327 46626 18723 10261 ROS1 ROS ROS 1 0.9 Since ROS inhibit many protein phosphatases we hypothesize that ROS generated during 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37323 17956327 46626 18723 10261 ROS1 ROS ROS 9 0.9 Since ROS inhibit many protein phosphatases we hypothesize that ROS generated during AIH inhibit okadaic acid-sensitive protein phosphatases thereby relieving 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37324 17956327 46627 18723 10261 ROS1 ROS ROS 15 0.9 single sustained hypoxic exposure does not generate similar amounts of ROS and that the subsequent lack of phosphatase inhibition disenables pLTF 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37325 17956327 46628 18723 10261 ROS1 ROS ROS-phosphatase 1 0.0 Thus ROS-phosphatase interactions may be a major determinant of pattern-sensitivity in respiratory 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37326 17956327 46628 12120 6720 LTF LTF LTF 12 0.0 interactions may be a major determinant of pattern-sensitivity in respiratory LTF and quite possibly other important models of synaptic plasticity 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37327 17956327 46634 12120 6720 LTF LTF LTF 6 0.0 For example 5-HT-induced intermediate-term facilitation and LTF in Aplysia which are normally elicited only by three to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37332 17956327 46648 18723 10261 ROS1 ROS ROS 14 0.9 the pattern-sensitivity of pLTF to hypoxia is differential formation of ROS which may lead to differential inhibition of okadaic acid-sensitive protein 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37333 17956327 46649 18723 10261 ROS1 ROS ROS 2 0.9 Role of ROS in pLTF 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37334 17956327 46650 18723 10261 ROS1 ROS ROS 0 0.9 ROS such as superoxide anion H 2 O 2 and hydroxyl 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37335 17956327 46651 18723 10261 ROS1 ROS ROS 0 0.9 ROS are continuously generated in cells through enzymatic (e.g e.g NADPH 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37336 17956327 46652 18723 10261 ROS1 ROS ROS 16 0.9 utilize a variety of mechanisms to regulate intracellular and extracellular ROS levels 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37338 17956327 46654 18723 10261 ROS1 ROS ROS 5 0.9 SOD (superoxide superoxide dismutase prevent excessive ROS accumulation 46 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37339 17956327 46655 18723 10261 ROS1 ROS ROS 6 0.9 Oxidation of protein amino acids by ROS (e.g e.g cysteine and tyrosine alters their function in a 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37340 17956327 46656 18723 10261 ROS1 ROS ROS 1 0.9 Although ROS are often thought of as detrimental to cellular processes recent 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37341 17956327 46656 18723 10261 ROS1 ROS ROS 17 0.9 detrimental to cellular processes recent developments have made clear that ROS play critical roles in important cell signalling events and are 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37342 17956327 46657 18723 10261 ROS1 ROS ROS 2 0.9 For example ROS are necessary for hippocampal long-term potentiation 48 and sensory facilitation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37343 17956327 46658 18723 10261 ROS1 ROS ROS 4 0.9 AIH-induced pLTF also requires ROS since pre-treatment with a SOD mimetic abolishes pLTF 23 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37346 17956327 46659 18723 10261 ROS1 ROS ROS 23 0.9 levels (e.g e.g SOD mimetic can disrupt levels of other ROS species such as H 2 O 2 and hydroxyl radical 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37347 17956327 46659 12120 6720 LTF LTF LTF 6 0.0 Thus superoxide anions are necessary for LTF following AIH although changes in superoxide anion levels (e.g e.g 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37348 17956327 46660 18723 10261 ROS1 ROS ROS 5 0.9 NADPH oxidase may generate the ROS necessary for pLTF since apocynin an NADPH oxidase (and and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37349 17956327 46661 18723 10261 ROS1 ROS ROS 4 0.9 Given their short half-life ROS are most likely to be generated locally within close proximity 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37350 17956327 46663 18723 10261 ROS1 ROS ROS 0 0.9 ROS may regulate neural plasticity by altering protein kinase and phosphatase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37351 17956327 46664 18723 10261 ROS1 ROS ROS 13 0.9 including PKC which is necessary for pLTF are activated by ROS 42 46 49 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37352 17956327 46665 18723 10261 ROS1 ROS ROS 7 0.9 Protein kinase activation is enhanced indirectly by ROS inhibition of protein phosphatase activity including those sensitive to okadaic 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37353 17956327 46667 18723 10261 ROS1 ROS ROS 9 0.9 Growth factor receptors which are receptor tyrosine kinases generate ROS when activated by their endogenous ligand 46 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37354 17956327 46668 18723 10261 ROS1 ROS ROS 2 0.9 The resulting ROS inhibit protein tyrosine phosphatases enabling their receptor tyrosine kinase activity 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37355 17956327 46670 18723 10261 ROS1 ROS ROS 17 0.9 hypothesis that the pattern of hypoxia has differential effects on ROS formation 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37356 17956327 46674 18723 10261 ROS1 ROS ROS 7 0.9 One observation supporting the hypothesis that increased ROS production is critical for pLTF is that spinal phosphatase inhibition 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37358 17956327 46675 18723 10261 ROS1 ROS ROS 5 0.9 Collectively our observations suggest that ROS generation during or following AIH is necessary for pLTF via 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37359 17956327 46677 12120 6720 LTF LTF LTF 12 0.0 being made towards understanding cellular/synaptic cellular synaptic mechanisms of respiratory LTF considerable work remains before we will have a full comprehension 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37360 17956327 46680 18723 10261 ROS1 ROS ROS 9 0.9 The work described in the present review implicates differential ROS formation between intermittent and sustained hypoxia as a major factor 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37361 17956327 46681 18723 10261 ROS1 ROS ROS 3 0.9 The most likely ROS targets are okadaic acid-sensitive protein phosphatases in or near phrenic 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37366 17956327 46686 18723 10261 ROS1 ROS ROS 33 0.9 kinase A PKB protein kinase B PKC protein kinase C ROS reactive oxygen species SOD superoxide dismutase TrkB tropomyosin receptor kinase 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 37369 17956327 46686 12120 6720 LTF LTF LTF 15 0.0 hypoxia BDNF brain-derived neurotrophic factor ERK extracellular-signal-regulated kinase 5-HT 5-hydroxytryptamine LTF long-term facilitation pLTF phrenic LTF PKA protein kinase A PKB 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 37370 17956327 46686 12120 6720 LTF LTF LTF 20 0.0 ERK extracellular-signal-regulated kinase 5-HT 5-hydroxytryptamine LTF long-term facilitation pLTF phrenic LTF PKA protein kinase A PKB protein kinase B PKC protein 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 39547 17987632 49321 20996 11179 SOD1 ALS ALS 34 1.4 AD and PD we have investigated amyotrophic lateral sclerosis (ALS) ALS using human neuroblastoma SH-SY5Y cells with mutated SOD1 gene H46R 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00240429827503436<>ScoreDetail__5468|IGFALS|0.000411753696425229__11179|SOD1|0.00240429827503436__ 0 0 0 0 0 39551 17987632 49323 20996 11179 SOD1 ALS ALS 18 1.4 of SOD1 (iso) iso forms in a cellular model of ALS has been evidenced 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00240429827503436<>ScoreDetail__5468|IGFALS|0.000411753696425229__11179|SOD1|0.00240429827503436__ 0 0 0 0 0 22657 18210200 26962 18723 10261 ROS1 ROS ROS 47 0.0 nanomaterials having antioxidant properties to eliminate reactive oxygen species (ROS) ROS in the brain (Blass Blass 2003 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22658 18210200 26963 18723 10261 ROS1 ROS ROS 25 0.0 O 3 can act as direct antioxidants and inhibit the ROS production pathway 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22659 18210200 26980 6256 21317 DYM SMC SMC 19 0.0 decrease their toxicity with respect to smooth muscle cells (SMC), SMC as measured by SMC growth inhibition (Raja Raja et al 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22660 18210200 26980 6256 21317 DYM SMC SMC 23 0.0 respect to smooth muscle cells (SMC), SMC as measured by SMC growth inhibition (Raja Raja et al 2007 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22661 18210200 27007 21257 9361 SRGN PPG PPG 11 0.0 of hydrophobic polymer blocks e.g. poly(propylene poly propylene glycol (PPG), PPG poly( poly d l -lactide poly(caprolactone), poly caprolactone etc. and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22662 18210200 27014 21257 9361 SRGN PPG PPG 10 0.0 Pluronic block copolymers contain two hydrophilic PEG and one hydrophobic PPG blocks (PEG-PPG-PEG) PEG-PPG-PEG 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22663 18210200 27015 16478 8909 PGP Pgp Pgp 22 0.0 and to inhibit a drug efflux transport protein P-glycoprotein (Pgp) Pgp that severely restricts transport of many drugs to the brain 1 JUMiner_v2.2 1 0 0 2 8909 TotalCon:2<>8909|PGP|5240|Complete__13568|PGPEP1|54858|Complete__<>AvaiableGeneRif=2<>BEST:8909|PGP|0.000363669424493136<>ScoreDetail__13568|PGPEP1|0.000158522569650854__8909|PGP|0.000363669424493136__ 0 0 0 0 0 22664 18210200 27015 16478 8909 PGP Pgp Pgp-dependent 45 0.0 Batrakova et al 1998 2001 As a result of formulating Pgp-dependent drugs with Pluronic the bioavailability of such drugs to the 1 JUMiner_v2.2 1 0 0 2 8909 TotalCon:2<>8909|PGP|5240|Complete__13568|PGPEP1|54858|Complete__<>AvaiableGeneRif=2<>BEST:8909|PGP|0.000363669424493136<>ScoreDetail__13568|PGPEP1|0.000158522569650854__8909|PGP|0.000363669424493136__ 0 0 0 0 0 22665 18210200 27051 122 80 ABP1 KAO Kao 39 0.0 Wang et al 2005 Tsai et al 2006 Yang and Kao 2006 2 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22667 18210200 27081 18723 10261 ROS1 ROS ROS 19 0.0 of catalase nanozyme to the brain to mitigate production of ROS and induce neuroprotection (Batrakova Batrakova et al 2007 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 22668 18210200 27095 24109 19667 WDR20 DMR DMR 27 0.0 NS051335 RO1 CA89225 and RO1 CA116591 the National Science Foundation DMR 0513699 and the US Department of Defense USAMRMC 06108004 (all 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23639 18219386 28331 20996 11179 SOD1 ALS ALS 16 1.7 the inherited degenerative neurological disease familial amyotrophic lateral sclerosis (ALS), ALS a non_amp_#x02013 cell-autonomous disease mutant SOD1 synthesis in motor neurons 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23643 18219386 28332 18723 10261 ROS1 ROS ROS 33 0.0 Nox by binding to Rac1 resulting in overproduction of damaging ROS (see see the related article beginning on page 659 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23644 18219386 28333 20996 11179 SOD1 ALS ALS 18 1.7 inhibitor apocynin or by elimination of Nox extends survival in ALS mice reviving the proposal that ROS mediate ALS pathogenesis but 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23645 18219386 28333 20996 11179 SOD1 ALS ALS 26 1.7 survival in ALS mice reviving the proposal that ROS mediate ALS pathogenesis but with a new twist it_amp_#x02019 s ROS produced 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23646 18219386 28333 18723 10261 ROS1 ROS ROS 1 0.0 Diminishing ROS by treatment with the microglial Nox inhibitor apocynin or by 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23647 18219386 28333 18723 10261 ROS1 ROS ROS 24 0.1 Nox extends survival in ALS mice reviving the proposal that ROS mediate ALS pathogenesis but with a new twist it_amp_#x02019 s 6 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 23648 18219386 28333 18723 10261 ROS1 ROS ROS 34 0.0 mediate ALS pathogenesis but with a new twist it_amp_#x02019 s ROS produced by microglia 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23649 18219386 28334 20996 11179 SOD1 ALS ALS 4 1.7 Footnotes Nonstandard abbreviations used ALS amyotrophic lateral sclerosis Nox NADPH oxidase O 2 _amp_#x02022 _amp_#x02013 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23654 18219386 28339 20996 11179 SOD1 ALS ALS 19 1.7 inflammation is amplified by mutant SOD1 binding to Rac1 in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23655 18219386 28339 18723 10261 ROS1 ROS ROS 4 0.0 Figure 1 Production of ROS by microglial Nox2 during inflammation is amplified by mutant SOD1 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23656 18219386 28340 20996 11179 SOD1 ALS ALS 3 1.7 Amyotrophic lateral sclerosis (ALS) ALS is the most common adult-onset motor neuron disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23657 18219386 28342 20996 11179 SOD1 ALS ALS 3 1.7 The majority of ALS cases are sporadic but among the familial cases of disease 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23661 18219386 28344 20996 11179 SOD1 ALS ALS 16 1.7 to slow disease progression when administered at disease onset in ALS mice ( 1 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23662 18219386 28346 20996 11179 SOD1 ALS ALS-like 24 1.7 in which expression of a mutant SOD1_amp_#x02013 encoding transgene recapitulates ALS-like disease including muscle denervation and atrophy glial activation and motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23663 18219386 28348 20996 11179 SOD1 ALS ALS 17 1.7 environment astrocytes have been linked to motor neuron degeneration in ALS because of their reduced capacity for reuptake at synapses of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23664 18219386 28351 20996 11179 SOD1 ALS ALS 13 1.7 antibiotic also capable of downregulating microglial activation increased survival in ALS mice ( 8 9 while the proinflammatory molecule LPS exacerbated 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23675 18219386 28357 20996 11179 SOD1 ALS ALS 22 1.7 upregulated in SOD1 G93A mice ( 13 14 and sporadic ALS patients ( 13 with the former leading to increased O 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23682 18219386 28362 17461 9508 PSEN1 FAD FAD-binding 6 0.3 Nox2 contains an NADPH-binding site a FAD-binding site and 4 heme-binding histidines 11 JUMiner_v2.2 1 2 nadph 0 2 9508 TotalCon:3<>1101|BRCA2|675|Complete__3585|FANCD2|2177|Complete__9508|PSEN1|5663|Complete__<>AvaiableGeneRif=3<>BEST:9508|PSEN1|0.000778601243717523<>ScoreDetail__1101|BRCA2|0.000377789506977283__9508|PSEN1|0.000778601243717523__3585|FANCD2|0.000470549640936794__ 0 0 0 0 0 23700 18219386 28367 13812 32159 MTG1 GTP GTP 22 0.3 p40 phox complex and is active only when bound to GTP not when bound to GDP 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 23702 18219386 28368 13812 32159 MTG1 GTP GTP 10 0.3 The release of GDP to enable a new round of GTP loading is catalyzed by guanine nucleotide exchange factors 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 23703 18219386 28369 13812 32159 MTG1 GTP GTP 17 0.3 proteins which stimulate the intrinsic ability of Rac to hydrolyze GTP to GDP 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 23711 18219386 28373 20996 11179 SOD1 ALS ALS 8 1.7 How does Nox participate in the pathogenesis of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23712 18219386 28374 20996 11179 SOD1 ALS ALS 24 1.7 the simplest view of a potential role for Nox in ALS would be that activation of Nox consequent to microglial cell 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23716 18219386 28377 18723 10261 ROS1 ROS ROS 36 0.0 (derived derived from neurons activate microglial cells to produce more ROS ( 19 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23717 18219386 28378 20996 11179 SOD1 ALS ALS 5 1.7 However in the case of ALS associated with SOD1 mutations the new data reported by Harraz 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23722 18219386 28378 18723 10261 ROS1 ROS ROS 39 0.0 a direct link between the disease-causing mutant SOD1 and Nox-mediated ROS production by microglial cells through SOD1 binding to the Nox 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23724 18219386 28379 18723 10261 ROS1 ROS ROS 10 0.0 Mutant SOD1 stimulates Rac1-GTP activation of Nox and production of ROS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23746 18219386 28386 17966 9871 RASA1 GAP GAP-facilitated 10 0.0 of SOD1 to Rac1-GTP inhibited the intrinsic and/or and or GAP-facilitated GTPase activity of Rac1 (Figure Figure 1 11 JUMiner_v2.2 1 0 0 2 9871 TotalCon:2<>9871|RASA1|5921|Complete__10002|RGS6|9628|Complete__<>AvaiableGeneRif=2<>BEST:9871|RASA1|0.000694789081885856<>ScoreDetail__9871|RASA1|0.000694789081885856__10002|RGS6|0.00031374707582221__ 0 0 0 0 0 23747 18219386 28387 20996 11179 SOD1 ALS ALS-linked 6 1.7 It is now widely accepted that ALS-linked mutations in SOD1 provoke disease due to the acquisition of 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23750 18219386 28388 20996 11179 SOD1 ALS ALS-linked 24 1.7 was enhanced in tissues from mice expressing the catalytically active ALS-linked mutant SOD1 G93A but not in tissues from mice expressing 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23757 18219386 28390 20996 11179 SOD1 ALS ALS 18 1.7 _amp_#x02014 in which no altered pathology is normally observed in ALS _amp_#x02014 also displayed increased production of O 2 _amp_#x02022 _amp_#x02013 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23761 18219386 28391 18723 10261 ROS1 ROS ROS 6 0.0 Such a direct effect of increased ROS as a result of mutant SOD1 within microglial cells obviously 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23764 18219386 28392 20996 11179 SOD1 ALS ALS-linked 29 1.7 not just for SOD1 G93A but also for 2 additional ALS-linked SOD1 mutants SOD1 L8Q and SOD1 G10V ( 20 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23769 18219386 28393 20996 11179 SOD1 ALS ALS 63 1.7 115 different mutations in the SOD1 gene known to cause ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23779 18219386 28397 20996 11179 SOD1 ALS ALS-linked 33 1.7 production be a feature common to the broader set of ALS-linked SOD1 mutants 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23781 18219386 28399 20996 11179 SOD1 ALS ALS 7 1.7 The Nox inhibitor apocynin increases survival in ALS mice 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23783 18219386 28400 20996 11179 SOD1 ALS ALS 11 1.7 ROS production by deleting Nox2 has already proven efficacious in ALS mice ( 13 14 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23784 18219386 28400 18723 10261 ROS1 ROS ROS 1 0.0 Decreasing ROS production by deleting Nox2 has already proven efficacious in ALS 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23786 18219386 28402 20996 11179 SOD1 ALS ALS 11 1.7 addition of apocynin to the drinking water of SOD1 G93A ALS mice beginning at 2 weeks of age increased the animals_amp_#x02019 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23797 18219386 28406 20996 11179 SOD1 ALS ALS 20 1.7 cells has been reported ( 15 staining for Nox2 in ALS mice only revealed accumulation in microglial cells ( 13 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23805 18219386 28409 20996 11179 SOD1 ALS ALS 14 1.7 Nox2 upregulation has been reported in spinal cords of sporadic ALS cases ( 13 but it is still unknown whether patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23808 18219386 28411 20996 11179 SOD1 ALS ALS 4 1.7 Two reported studies of ALS mice with a Nox2 deletion reached divergent conclusions one group 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23814 18219386 28416 9905 5438 IFNG IFN IFN-G 8 0.0 CGD patients are usually chronically administered antibiotics and IFN-_amp_#x003b3 11 JUMiner_v2.2 1 0 0 2 5417 TotalCon:2<>5438|IFNG|3458|Complete__5417|IFNA1|3439|Complete__<>AvaiableGeneRif=2<>BEST:5417|IFNA1|0.000644085702671974<>ScoreDetail__5438|IFNG|0.000531194392064397__5417|IFNA1|0.000644085702671974__ 0 0 0 0 0 23815 18219386 28417 20996 11179 SOD1 ALS ALS 13 1.7 both studies from the Engelhardt group ( 14 20 their ALS animals with lowered Nox activity developed eye infections that if 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23817 18219386 28420 20996 11179 SOD1 ALS ALS 10 1.7 In the current study ( 20 apocynin treatment of ALS mice at 80 days of age (45 45 days before 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23818 18219386 28423 20996 11179 SOD1 ALS ALS 25 1.7 when administered early also implies that inflammation at least in ALS mice must happen earlier than commonly thought (before before obvious 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 23825 18219386 28424 18723 10261 ROS1 ROS ROS 24 0.0 Nox2 and that mutant forms of SOD1 amplify production of ROS by locking Nox2 in its activated state Harraz and colleagues 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 23828 18219386 28426 20996 11179 SOD1 ALS ALS 21 1.7 mutations in SOD1 as one of the toxic contributors in ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00179324454093775<>ScoreDetail__5468|IGFALS|0.00052622644712273__11179|SOD1|0.00179324454093775__ 0 0 0 0 0 26429 18270519 31299 18723 10261 ROS1 ROS ROS 3 0.0 Reactive oxygen species (ROS) ROS and compromised antioxidant defense may contribute to brain disorders such 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26430 18270519 31301 3892 6953 CD46 MCP MC-P 9 0.0 barrier (BBB)-permeable BBB -permeable nitroxide methoxycarbonyl-2 2 5 5-tetramethylpyrrolidine-1-oxyl (MC-P), MC-P as a magnetic resonance-imaging (MRI) MRI contrast agent for brain 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26431 18270519 31302 3892 6953 CD46 MCP MC-P 0 0.0 MC-P relaxation in rodent brain was quantified by MRI using a 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26432 18270519 31303 3892 6953 CD46 MCP MC-P 15 0.0 thalamus the MRI signal intensity increased up to 50% after MC-P injection but increased only by 2.7% when a BBB-impermeable nitroxide 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26433 18270519 31304 3892 6953 CD46 MCP MC-P 10 0.0 The maximum concentrations in the thalamus and cerebral cortex after MC-P injection were calculated to be 1.9 0.35 and 3.0 0.50 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26434 18270519 31306 3892 6953 CD46 MCP MC-P 4 0.0 Also reduction rates of MC-P were significantly decreased after reperfusion following transient MCAO (middle middle 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26435 18270519 31307 18723 10261 ROS1 ROS ROS 19 0.0 MRI contrast agents and antioxidants to evaluate the role of ROS in neurologic diseases 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26436 18270519 31310 18723 10261 ROS1 ROS ROS 4 0.0 Increased reactive oxygen species (ROS) ROS and decreased antioxidant defense may contribute to numerous brain disorders 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26437 18270519 31311 18723 10261 ROS1 ROS ROS 13 0.0 oxidative stress is therefore useful to monitor the role of ROS in brain disorders 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26438 18270519 31312 18723 10261 ROS1 ROS ROS 4 0.0 For image studies of ROS in vivo nitroxide compounds have been used as redox-sensitive contrast 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26439 18270519 31323 3892 6953 CD46 MCP MC-P 5 0.0 One of the nitroxides methoxycarbonyl-2 2 5 5-tetramethylpyrrolidine-1-oxyl (MC-P; MC-P Figure 1 has been used as a contrast agent for 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26440 18270519 31324 3892 6953 CD46 MCP MC-P 8 0.0 Anzai et al (2003) 2003 confirmed that the nitroxide MC-P after intravenous injection accumulated in the brain tissue as evidenced 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26441 18270519 31325 3892 6953 CD46 MCP MC-P 4 0.0 These findings suggest that MC-P can pass through the blood-brain barrier (BBB) BBB and give 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26442 18270519 31327 3892 6953 CD46 MCP MC-P 1 0.0 Therefore MC-P can be used as a BBB-permeable MRI contrast agent that 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26443 18270519 31329 18723 10261 ROS1 ROS ROS 13 0.0 ischemia on reperfusion with oxygenated buffer solutions a burst of ROS has been shown to be generated with a propensity to 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26444 18270519 31330 3892 6953 CD46 MCP MC-P 6 0.0 To show the possibility of using MC-P in brain redox imaging in neurologic disease model rat transient 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26445 18270519 31334 3892 6953 CD46 MCP MC-P 12 0.0 LL sequence we used MRI to study the pharmacokinetics of MC-P concentration in the brain by monitoring T 1 changes before 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26446 18270519 31334 3892 6953 CD46 MCP MC-P 25 0.0 the brain by monitoring T 1 changes before and after MC-P injection 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26447 18270519 31335 3892 6953 CD46 MCP MC-P 14 0.0 readily detected throughout the brain at a well-tolerated dose of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26448 18270519 31338 3892 6953 CD46 MCP MC-P 5 0.0 Estimation of the concentration of MC-P using in vitro relaxivities agreed with EPR results from extracted 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26449 18270519 31339 3892 6953 CD46 MCP MC-P 4 0.0 The results indicate that MC-P goes into the brain and causes reduction of T 1 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26450 18270519 31340 3892 6953 CD46 MCP MC-P 6 0.0 In addition the reduction rate of MC-P was significantly decreased in the infarct region of brain after 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26451 18270519 31343 3892 6953 CD46 MCP MC-P 1 0.0 Chemicals MC-P was purchased from Columbia Advanced Science LC (Baltimore, Baltimore MD 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26452 18270519 31355 8363 23217 GKN1 FOV FOV 21 0.0 256 256 (0.125 0.125 mm resolution field of view (FOV)=3.2 FOV =3.2 3.2 cm slice thickness=2.0 mm and 0.2 mm gap 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26453 18270519 31358 22050 11760 TFPI EPI EPI 21 0.3 0 compensation multislice LL data were acquired by segmented gradient-echo EPI (echo echo planar imaging with TR=10 secs TE 6.7 ms 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 26454 18270519 31361 3892 6953 CD46 MCP MC-P 19 0.0 mm inner diameter containing 0 to 50 mmol/L mmol L MC-P in phosphate-buffered saline (PBS) PBS as shown in Figure 2A 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26455 18270519 31367 3892 6953 CD46 MCP MC-P 9 0.0 The tail vein was cannulated for the injection of MC-P or 3CxP 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26456 18270519 31372 3892 6953 CD46 MCP MC-P 5 0.0 Before making the measurements with MC-P or 3CxP images of the rat were taken with the 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26457 18270519 31374 3892 6953 CD46 MCP MC-P 3 0.0 A solution of MC-P or CxP (1.5 1.5 mol/g mol g body weight was 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26458 18270519 31375 3892 6953 CD46 MCP MC-P 21 0.0 mequiv mL was injected 40 secs after the administration of MC-P and then continuously measured by SPGR till 13 mins 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26459 18270519 31381 7357 3604 FBN2 CCA CCA 2 0.0 The right CCA (common common carotid artery ECA (extra extra carotid artery and 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26460 18270519 31382 7357 3604 FBN2 CCA CCA 1 0.0 The CCA and ECA were ligated and a suture was placed at 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26461 18270519 31384 7357 3604 FBN2 CCA CCA 2 0.0 The left CCA was ligated with a suture to complete the MCAO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26462 18270519 31385 7357 3604 FBN2 CCA CCA 26 0.0 withdrawing the suture tip and the suture of the left CCA region 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26463 18270519 31394 3892 6953 CD46 MCP MC-P 3 0.0 The concentration of MC-P was estimated by the LL T 1 maps using the 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26464 18270519 31395 3892 6953 CD46 MCP MC-P 0 0.0 [MC-P]=( MC-P = R 1 -R 10 )/Relaxivity Relaxivity 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26465 18270519 31396 21414 11362 STAT1 STAT Stat 8 0.3 Statistical analysis was performed using the StatView software Stat View 5.0 (SAS SAS Institute Inc. Cary NC USA 2 JUMiner_v2.2 1 2 stat view 0 0 0 0 0 0 0 0 26466 18270519 31396 23261 10539 TSPAN31 SAS SAS 11 0.0 was performed using the StatView software Stat View 5.0 (SAS SAS Institute Inc. Cary NC USA 1 JUMiner_v2.2 1 0 0 2 19237 TotalCon:2<>10539|TSPAN31|6302|Complete__19237|NANS|54187|Complete__<>AvaiableGeneRif=2<>BEST:19237|NANS|0.000624417520969245<>ScoreDetail__10539|TSPAN31|0__19237|NANS|0.000624417520969245__ 0 0 0 0 0 26467 18270519 31398 3892 6953 CD46 MCP MC-P 2 0.0 Quantification of MC-P in Brain and Blood by EPR Spectroscopy MC-P dissolved in 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26468 18270519 31398 3892 6953 CD46 MCP MC-P 10 0.0 Quantification of MC-P in Brain and Blood by EPR Spectroscopy MC-P dissolved in saline was injected in the tail vein of 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26469 18270519 31401 3892 6953 CD46 MCP MC-P 12 0.0 was extracted 2 5 and 8 mins after injection of MC-P and wet weight was determined 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26470 18270519 31407 3892 6953 CD46 MCP MC-P 15 0.0 mmol/L mmol L between concentration and EPR signal height of MC-P (data data not shown EPR signal heights of homogenate mixtures 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26471 18270519 31408 3892 6953 CD46 MCP MC-P 1 0.0 Finally MC-P concentrations in the brain tissue and blood were calculated based 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26472 18270519 31410 3892 6953 CD46 MCP MC-P 15 0.0 T 1 -weighted images of phantom with various concentrations of MC-P acquired using the SPGR sequence 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26473 18270519 31411 3892 6953 CD46 MCP MC-P 8 0.0 The MR signal intensity increased with concentration of MC-P up to 50 mmol/L mmol L ( Figure 2B with 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26474 18270519 31412 3892 6953 CD46 MCP MC-P 8 0.0 intensity change (%) % in the 5 mmol/L mmol L MC-P tube was about 100% compared with PBS (center center tube 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26475 18270519 31414 3892 6953 CD46 MCP MC-P 8 0.0 The T 1 values decreased depending on the MC-P concentration from 2 246 ms (0.5 0.5 mmol/L) mmol L 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26476 18270519 31415 3892 6953 CD46 MCP MC-P 3 0.0 The relaxivity of MC-P in PBS solution was measured to be 0.16 sec -1 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26477 18270519 31418 3892 6953 CD46 MCP MC-P 4 0.0 After the injection of MC-P solution the intensity in the rat head region immediately increased 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26478 18270519 31420 3892 6953 CD46 MCP MC-P 14 0.0 the signal intensity in the brain tissue after injection of MC-P was about 50% compared with the pre-injection image ( Figure 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26479 18270519 31421 3892 6953 CD46 MCP MC-P 5 0.0 The signal intensity derived from MC-P (oxidized oxidized form MRI visible reached a maximum at 30 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26480 18270519 31422 3892 6953 CD46 MCP MC-P 30 0.0 relaxivity (0.17 0.17 sec -1 mmol/L mmol L -1 as MC-P ( Figure 3B 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26481 18270519 31424 3892 6953 CD46 MCP MC-P 6 0.0 To check if blood flow affected MC-P reduction blood flow was stopped by KCl injection 40 secs 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26482 18270519 31424 3892 6953 CD46 MCP MC-P 20 0.0 was stopped by KCl injection 40 secs after administration of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26483 18270519 31426 3892 6953 CD46 MCP MC-P 10 0.0 The MR signal intensity in brain decreased after enhancement by MC-P in a manner similar to that found for brain but 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26484 18270519 31427 3892 6953 CD46 MCP MC-P 1 0.0 The MC-P reduction rate ( k =0.30 0.066 min -1 in brain 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26485 18270519 31432 3892 6953 CD46 MCP MC-P 4 0.0 The reduction rate of MC-P in the right hemisphere was significantly decreased compared with the 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26486 18270519 31433 3892 6953 CD46 MCP MC-P 16 0.0 of quantitative T 1 maps before and after injection of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26487 18270519 31437 3892 6953 CD46 MCP MC-P 11 0.0 T 1 of these regions rapidly decreased after injection of MC-P and the minimum T 1 (secs) secs of the cerebral 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26488 18270519 31439 3892 6953 CD46 MCP MC-P 8 0.0 From T 1 and in vitro relaxivity of MC-P (0.16 0.16 mmol/L mmol L -1 s -1 the concentration 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26489 18270519 31439 3892 6953 CD46 MCP MC-P 18 0.0 0.16 mmol/L mmol L -1 s -1 the concentration of MC-P at all time points in the ROI was calculated ( 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26490 18270519 31443 3892 6953 CD46 MCP MC-P 6 0.0 To confirm whether the concentration of MC-P determined by the MRI technique is reliable an ex vivo 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26491 18270519 31443 3892 6953 CD46 MCP MC-P 29 0.0 X-band EPR was carried out on the brain tissue for MC-P levels ( Figure 6 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26492 18270519 31444 3892 6953 CD46 MCP MC-P 4 0.0 The oxidized and total MC-P (oxidized+reduced oxidized reduced form levels were determined with and without 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26493 18270519 31445 3892 6953 CD46 MCP MC-P 3 0.0 The brain tissue MC-P level was 0.84 0.035 mmol/L mmol L at 2 mins 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26494 18270519 31445 3892 6953 CD46 MCP MC-P 13 0.0 was 0.84 0.035 mmol/L mmol L at 2 mins after MC-P injection ( Figure 6A 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26495 18270519 31447 3892 6953 CD46 MCP MC-P 5 0.0 On the other hand total MC-P level (oxidized+reduced oxidized reduced form was 1.57 0.199 mmol/L, mmol 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26496 18270519 31447 3892 6953 CD46 MCP MC-P 18 0.0 1.57 0.199 mmol/L, mmol L suggesting that approximately half of MC-P was in the reduced form in the brain at this 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26497 18270519 31448 3892 6953 CD46 MCP MC-P 5 0.0 At 8 mins most of MC-P was reduced (0.24 0.24 0.107 mmol/L); mmol L however total 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26498 18270519 31448 3892 6953 CD46 MCP MC-P 13 0.0 was reduced (0.24 0.24 0.107 mmol/L); mmol L however total MC-P (reduced+oxidized) reduced oxidized still remained (0.92 0.92 0.092 mmol/L) mmol 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26499 18270519 31449 3892 6953 CD46 MCP MC-P 4 0.0 The blood concentrations of MC-P at different time points in six rats are shown in 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26500 18270519 31450 3892 6953 CD46 MCP MC-P 4 0.0 The oxidized form of MC-P followed similar kinetics as the brain peaking at similar concentration 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26501 18270519 31451 3892 6953 CD46 MCP MC-P 1 0.0 Total MC-P levels slowly decreased but MC-P was still present at 30 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26502 18270519 31451 3892 6953 CD46 MCP MC-P 6 0.0 Total MC-P levels slowly decreased but MC-P was still present at 30 mins (level level of oxidized 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26503 18270519 31451 3892 6953 CD46 MCP MC-P 16 0.0 was still present at 30 mins (level level of oxidized MC-P 0.33 0.084 mmol/L, mmol L level of total MC-P 1.04 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26504 18270519 31451 3892 6953 CD46 MCP MC-P 23 0.0 oxidized MC-P 0.33 0.084 mmol/L, mmol L level of total MC-P 1.04 0.07 mmol/L), mmol L suggesting that the clearance of 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26505 18270519 31451 3892 6953 CD46 MCP MC-P 32 0.0 1.04 0.07 mmol/L), mmol L suggesting that the clearance of MC-P from the blood was much slower than the reduction detected 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26506 18270519 31453 3892 6953 CD46 MCP MC-P 15 0.0 show that the cell-permeable and low-molecular-weight BBB-permeable MRI contrast agent MC-P is useful for enhancing MRI intensity in the brain 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26507 18270519 31454 3892 6953 CD46 MCP MC-P 22 0.0 T 1 maps from the brain region before and after MC-P injection 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26508 18270519 31455 3892 6953 CD46 MCP MC-P 5 0.0 This enabled determination of the MC-P concentration in brain regions assuming the in vivo relaxivity of 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26509 18270519 31455 3892 6953 CD46 MCP MC-P 16 0.0 concentration in brain regions assuming the in vivo relaxivity of MC-P as the same in vivo 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26510 18270519 31457 3892 6953 CD46 MCP MC-P 9 0.0 In this study the cell-permeable and highly lipophilic nitroxide MC-P was tested in the brain as an imaging probe 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26511 18270519 31458 3892 6953 CD46 MCP MC-P 8 0.0 The T 1 -weighted MR signal intensity of MC-P showed linearity up to 5 mmol/L mmol L ( Figure 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26512 18270519 31460 3892 6953 CD46 MCP MC-P 2 0.0 Because the MC-P concentration in the thalamus region went up to approximately 3 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26513 18270519 31462 3892 6953 CD46 MCP MC-P 18 0.0 brain regions clearly increased up to 50% after injection of MC-P although there was no enhancement ( 3% in the case 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26514 18270519 31463 3892 6953 CD46 MCP MC-P 24 0.0 similar (0.16 0.16 mmol/L mmol L -1 sec -1 for MC-P 0.17 mmol/L mmol L -1 sec -1 for 3CxP 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26515 18270519 31464 3892 6953 CD46 MCP MC-P 12 0.0 difference detected is most likely because of the distribution of MC-P in the brain 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26516 18270519 31465 3892 6953 CD46 MCP MC-P 0 0.0 MC-P is a highly lipophilic substance with an octanol-water partition coefficient 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26517 18270519 31467 3892 6953 CD46 MCP MC-P 10 0.0 Therefore SPGR signal intensity in the brain region increased after MC-P injection ( Figure 3A 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26518 18270519 31470 3892 6953 CD46 MCP MC-P 7 0.0 The ratio of maximum intensity change between MC-P and 3CxP was 18.5 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26519 18270519 31473 3892 6953 CD46 MCP MC-P 4 0.0 These data suggest that MC-P got distributed in the whole-brain tissue region after passing through 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26520 18270519 31477 3892 6953 CD46 MCP MC-P 1 0.0 Therefore MC-P reduction rate without blood flow was tested ( Figure 3E 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26521 18270519 31478 3892 6953 CD46 MCP MC-P 10 0.0 Even though blood flow was stopped after injecting KCl solution MC-P reduced in the brain 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26522 18270519 31479 3892 6953 CD46 MCP MC-P 4 0.0 The reduction rate of MC-P without blood flow was 60% compared with blood flow suggesting 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26523 18270519 31479 3892 6953 CD46 MCP MC-P 16 0.0 blood flow was 60% compared with blood flow suggesting that MC-P reduction represents reaction with intracellular reductants such as GSH (glutathione), 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26524 18270519 31480 3892 6953 CD46 MCP MC-P 24 0.0 brain changed in a manner that showed the reduction of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26525 18270519 31481 3892 6953 CD46 MCP MC-P 10 0.0 of T 1 (secs) secs before and after injection of MC-P using LL sequence allowed the calculation of MC-P concentration in 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26526 18270519 31481 3892 6953 CD46 MCP MC-P 18 0.0 injection of MC-P using LL sequence allowed the calculation of MC-P concentration in the brain ( Figure 5 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26527 18270519 31483 3892 6953 CD46 MCP MC-P 10 0.0 The T 1 values in the ROI were converted to MC-P concentration ( Figure 5C 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26528 18270519 31484 3892 6953 CD46 MCP MC-P 24 0.0 tissues and the blood concentration of the oxidized form of MC-P as determined ex vivo from EPR ( Figure 6 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26529 18270519 31485 3892 6953 CD46 MCP MC-P 11 0.0 about 0.5 mmol/L mmol L of the oxidized form of MC-P at 10 mins after injection the total MC-P levels (nitroxide+hydroxylamine) 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26530 18270519 31485 3892 6953 CD46 MCP MC-P 19 0.0 form of MC-P at 10 mins after injection the total MC-P levels (nitroxide+hydroxylamine) nitroxide hydroxylamine were still around 1.2 mmol/L, mmol 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26531 18270519 31485 3892 6953 CD46 MCP MC-P 32 0.0 around 1.2 mmol/L, mmol L suggesting that the reduction from MC-P (oxidized, oxidized paramagnetic to hydroxylamine (reduced, reduced diamagnetic was predominant 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26532 18270519 31489 18723 10261 ROS1 ROS ROS 8 0.0 Under normal physiologic conditions neurologic damages mediated by ROS can be prevented by the cellular antioxidant network 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 26533 18270519 31495 3892 6953 CD46 MCP MC-P 7 0.0 These data suggest that the effect of MC-P on MRI signal intensity might enable monitoring of brain damage 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26534 18270519 31496 3892 6953 CD46 MCP MC-P 6 0.0 As a consequence the BBB-permeable nitroxide MC-P may be useful as an MRI contrast agent to indicate 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26535 18270519 31497 3892 6953 CD46 MCP MC-P 1 0.0 Furthermore MC-P might provide protection of brain because of tissue antioxidant properties 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26536 18270519 31499 3892 6953 CD46 MCP MC-P 2 0.0 The BBB-permeable MC-P is a potent redox-sensitive MRI contrast agent in brain 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26537 18270519 31500 3892 6953 CD46 MCP MC-P 11 0.0 MRI intensity in brain was clearly enhanced after injection of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26538 18270519 31501 3892 6953 CD46 MCP MC-P 14 0.0 1 mapping by LL sequence allowed accurate monitoring of pharmacokinetic MC-P concentration changes with whole-brain coverage 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26539 18270519 31504 3892 6953 CD46 MCP MC-P 11 0.0 reduction oxidation showing the interconversion and the molecular structure of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26540 18270519 31505 3892 6953 CD46 MCP MC-P 10 0.0 The structure on the left is the radical form of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26541 18270519 31506 3892 6953 CD46 MCP MC-P 11 0.0 on the right is the reduced form (hydroxylamine) hydroxylamine of MC-P 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26542 18270519 31509 3892 6953 CD46 MCP MC-P 3 0.0 MR images of MC-P phantom by SPGR and LL sequences 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26543 18270519 31510 3892 6953 CD46 MCP MC-P 6 0.0 ( A Schematics of the MC-P phantom (left left column T 1 -weighted SPGR images (middle 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26544 18270519 31512 3892 6953 CD46 MCP MC-P 0 0.0 MC-P was dissolved in saline 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26545 18270519 31513 3892 6953 CD46 MCP MC-P 10 0.0 ( B Change in the MR signal intensity of MC-P phantom as a function of concentration from 0.2 mmol/L mmol 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26546 18270519 31515 3892 6953 CD46 MCP MC-P 10 0.0 ( C Relaxation rate (1/ 1 T 1 of MC-P as a function of concentration 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26547 18270519 31519 3892 6953 CD46 MCP MC-P 14 0.0 images of rat head region after injection of ( A MC-P (cell-permeable) cell-permeable and ( B 3CxP (cell-impermeable) cell-impermeable 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26548 18270519 31526 3892 6953 CD46 MCP MC-P 10 0.0 The time courses of intensity change of ( C MC-P and ( D 3CxP in the ROI of cerebral cortex 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26549 18270519 31527 3892 6953 CD46 MCP MC-P 6 0.0 ( E Intensity change of MC-P without blood flow is shown 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26550 18270519 31528 3892 6953 CD46 MCP MC-P 8 0.0 KCl (2 2 mL was injected 40 secs after MC-P injection and rats died within 20 secs 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26551 18270519 31532 3892 6953 CD46 MCP MC-P 21 0.0 -weighted MR image of sham and IR treated rats after MC-P injection 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26552 18270519 31533 3892 6953 CD46 MCP MC-P 16 0.0 right hemisphere in the T 1 -weighted MR images after MC-P injection 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26553 18270519 31539 3892 6953 CD46 MCP MC-P 9 0.0 Dynamic T 1 maps of rat head region after MC-P injection acquired by LL sequence 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26554 18270519 31540 3892 6953 CD46 MCP MC-P 12 0.0 A Time-course T 1 maps of rat head region after MC-P injection 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26555 18270519 31541 22050 11760 TFPI EPI EPI 10 0.3 Multislice LL data were acquired every 20 secs by segmented EPI with TR=10 secs TE 6.7 ms FA=20degree acquisition interval=400 ms 1 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 26556 18270519 31543 3892 6953 CD46 MCP MC-P 12 0.0 The changes in ( B T 1 and ( C MC-P concentration in the cerebral cortex and thalamus regions were shown 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26557 18270519 31544 3892 6953 CD46 MCP MC-P 1 0.0 The MC-P concentration was calculated from T 1 using the equation described 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26558 18270519 31546 3892 6953 CD46 MCP MC-P 16 0.0 * P _lt_0.01 the significant difference of maximum concentration of MC-P between cerebral cortex and thalamus by t -test 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26559 18270519 31549 3892 6953 CD46 MCP MC-P 7 0.0 The quantification of oxidized and total (oxidized+reduced) oxidized reduced MC-P in brain tissue and blood using X-band EPR 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26560 18270519 31550 3892 6953 CD46 MCP MC-P 14 0.0 in oxidized (white white bar and total (black black bar MC-P in brain tissue ( N =4 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 26561 18270519 31551 3892 6953 CD46 MCP MC-P 16 0.0 concentration of oxidized Hillered et al (1988) 1988 and total MC-P (brown) brown in the blood 11 JUMiner_v2.2 1 0 0 2 1474 TotalCon:3<>6953|CD46|4179|Complete__1474|CAPG|822|Complete__32018|C1orf132|388732|No_GeneRif__<>AvaiableGeneRif=2<>BEST:1474|CAPG|0.000424732250622584<>ScoreDetail__6953|CD46|0.000329903940451608__1474|CAPG|0.000424732250622584__ 0 0 0 0 0 15719 18308427 18544 20996 11179 SOD1 ALS ALS 24 1.7 in the erythrocytes of 20 sporadic amyotrophic lateral sclerosis (ALS) ALS patients and 20 controls 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15720 18308427 18544 11960 6678 LPO LPO LPO 9 0.0 In the present study the extent of lipid peroxidation (LPO) LPO and antioxidant defenses were evaluated in the erythrocytes of 20 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15721 18308427 18547 20996 11179 SOD1 ALS ALS 18 1.7 glutathione levels were also found to be significantly reduced in ALS patients compared to healthy subjects (P P _amp_#x3c 0.001 P 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15722 18308427 18552 20996 11179 SOD1 ALS ALS 3 1.7 Amyotrophic lateral sclerosis (ALS), ALS a progressive disorder that usually runs a fatal course within 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15723 18308427 18555 20996 11179 SOD1 ALS ALS 9 1.7 Plaitakis (1990) 1990 proposed the hypothesis of glutamatergic dysfunction in ALS i.e imbalance between brain and blood glutamate levels 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15724 18308427 18557 20996 11179 SOD1 ALS ALS 11 1.7 also observed that blood glutamate levels were significantly higher in ALS patients ( Babu et al. 1998 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15725 18308427 18558 20996 11179 SOD1 ALS ALS 14 1.7 hallmark of neurodegenerative disorders such as motor neuron degeneration/ALS, degeneration ALS progressive bulbar palsy (PBP) PBP 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15726 18308427 18558 12527 9234 MED1 PBP PBP 18 0.3 as motor neuron degeneration/ALS, degeneration ALS progressive bulbar palsy (PBP) PBP 1 JUMiner_v2.2 1 2 UserEdit 0 2 8630 TotalCon:5<>8630|PEBP1|5037|Complete__2989|DOCK3|1795|Complete__9234|MED1|5469|Complete__9008|PKD1|5310|Complete__9240|PPBP|5473|Complete__<>AvaiableGeneRif=5<>BEST:8630|PEBP1|0.000447008008444681<>ScoreDetail__9234|MED1|0.000431204810269883__9008|PKD1|0.000294857549651991__8630|PEBP1|0.000447008008444681__2989|DOCK3|0.000131274942239025__9240|PPBP|0.000379687525245181__ 1 1 0 0 0 15730 18308427 18570 20996 11179 SOD1 ALS ALS 16 1.7 determine the oxidant/antioxidant oxidant antioxidant status in the erythrocytes of ALS patients and to evaluate the correlation if any between the 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15733 18308427 18570 11960 6678 LPO LPO LPO 29 0.3 evaluate the correlation if any between the lipid peroxidation (LPO), LPO SOD CAT GSH GSHPx GR and G-6-PDH levels and the 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 15734 18308427 18571 20996 11179 SOD1 ALS ALS 22 1.7 oxidative stress and antioxidant defense parameters in the patients of ALS and may help in evaluating their role in the pathogenesis 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15735 18308427 18575 20996 11179 SOD1 ALS ALS 0 1.7 ALS patients and control subjects 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15736 18308427 18576 20996 11179 SOD1 ALS ALS 0 1.7 ALS patients were selected using the World Federation Of Neurology (WFN) 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15737 18308427 18578 20996 11179 SOD1 ALS ALS 3 1.7 The diagnosis of ALS required the presence of both upper and lower motor neurones 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15738 18308427 18579 20996 11179 SOD1 ALS ALS 3 1.7 Patients diagnosed with ALS also met an extensive list of exclusionary criteria including sensory 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15739 18308427 18579 20996 11179 SOD1 ALS ALS 28 1.7 bladder changes and metabolic or toxic disorder that could mimic ALS e.g myelopathy lead intoxication endocrine abnormalities or peripheral neuropathy 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15740 18308427 18580 20996 11179 SOD1 ALS ALS 7 1.7 Twenty patients were diagnosed as having sporadic ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15741 18308427 18583 12527 9234 MED1 PBP PBP 8 0.3 Six of these patients were diagnosed as having PBP which results from exclusive lower motor neuron involvement in bulbar 1 JUMiner_v2.2 1 2 UserEdit 0 2 8630 TotalCon:5<>8630|PEBP1|5037|Complete__2989|DOCK3|1795|Complete__9234|MED1|5469|Complete__9008|PKD1|5310|Complete__9240|PPBP|5473|Complete__<>AvaiableGeneRif=5<>BEST:8630|PEBP1|0.000447008008444681<>ScoreDetail__9234|MED1|0.000431204810269883__9008|PKD1|0.000294857549651991__8630|PEBP1|0.000447008008444681__2989|DOCK3|0.000131274942239025__9240|PPBP|0.000379687525245181__ 1 1 0 0 0 15742 18308427 18584 12527 9234 MED1 PBP PBP 1 0.3 These PBP patients were having tongue fasciculations and swallowing difficulty but their 1 JUMiner_v2.2 1 2 UserEdit 0 2 8630 TotalCon:5<>8630|PEBP1|5037|Complete__2989|DOCK3|1795|Complete__9234|MED1|5469|Complete__9008|PKD1|5310|Complete__9240|PPBP|5473|Complete__<>AvaiableGeneRif=5<>BEST:8630|PEBP1|0.000447008008444681<>ScoreDetail__9234|MED1|0.000431204810269883__9008|PKD1|0.000294857549651991__8630|PEBP1|0.000447008008444681__2989|DOCK3|0.000131274942239025__9240|PPBP|0.000379687525245181__ 1 1 0 0 0 15744 18308427 18612 17238 9337 PRB1 PMS PMS 16 0.0 10 mM NBT 45 _amp_#x3bc M NADH 23.5 _amp_#x3bc M PMS 12.4 nM 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15746 18308427 18634 6181 3058 DTNB DTNB DTNB-containing 23 0.0 modifications 200 _amp_#x3bc l of 0.01N HCl was mixed with DTNB-containing buffer (110 110 mM Na 2 HPO 4 40 mM 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15747 18308427 18634 8255 4236 GFER HPO HPO 29 0.0 was mixed with DTNB-containing buffer (110 110 mM Na 2 HPO 4 40 mM NaH 2 PO 4 15 mM EDTA 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15748 18308427 18634 6181 3058 DTNB DTNB DTNB 51 0.0 w v bovine serum albumin (BSA)) BSA and 0.3 mM DTNB 11 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15749 18308427 18654 20996 11179 SOD1 ALS ALS 35 1.7 (ADEs) ADEs in erythrocytes between control subjects and patients with ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15750 18308427 18659 20996 11179 SOD1 ALS ALS 8 1.7 The rate of LPO in the erythrocytes of ALS patients was significantly increased with respect to control subjects ( 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15751 18308427 18659 20996 11179 SOD1 ALS ALS 33 1.7 ( Fig 1 whereas catalase activity in the RBC of ALS patients was significantly lower than the controls ( P _amp_#x3c 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15752 18308427 18659 11960 6678 LPO LPO LPO 3 0.0 The rate of LPO in the erythrocytes of ALS patients was significantly increased with 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15754 18308427 18662 20996 11179 SOD1 ALS ALS 1 1.7 In ALS patients it was found that LPO ( Fig 6 started 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15756 18308427 18662 11960 6678 LPO LPO LPO 7 0.0 In ALS patients it was found that LPO ( Fig 6 started to increase and CAT GSH GR 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15757 18308427 18664 20996 11179 SOD1 ALS ALS 16 1.7 above parameters showed significant correlation with the time course of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15758 18308427 18671 20996 11179 SOD1 ALS ALS 6 1.7 The greater enhancement of LPO in ALS patients may be due to the fact that erythrocytes are 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15759 18308427 18671 11960 6678 LPO LPO LPO 4 0.1 The greater enhancement of LPO in ALS patients may be due to the fact that 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 15760 18308427 18672 11960 6678 LPO LPO LPO 27 0.0 leading to release of iron to promote Fenton chemistry and LPO 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15762 18308427 18674 3544 1516 CAT CAT CAT 3 1.0 A decrease in CAT activity is indicative of a situation in which there remains 1 JUMiner_v2.2 1 2 35 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15763 18308427 18674 18723 10261 ROS1 ROS ROS 55 0.0 to hydroxyl radical ( OH the most dreaded of the ROS ( Chattopadhyay et al. 2000 1 JUMiner_v2.2 1 0 0 0 0 0 0 0 0 0 15764 18308427 18678 20996 11179 SOD1 ALS ALS 13 1.7 stress and antioxidant parameters in erythrocytes plasma and CSF of ALS patients 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15765 18308427 18678 11629 6493 LAMC2 CSF CSF 11 0.1 measured oxidative stress and antioxidant parameters in erythrocytes plasma and CSF of ALS patients 6 JUMiner_v2.2 1 2 UserEdit 0 0 0 1 1 0 0 0 15766 18308427 18681 20996 11179 SOD1 ALS ALS 14 1.7 of glutathione in in vivo and in vitro models of ALS promotes multiple apoptotic pathways contributing at least partially to motor 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15768 18308427 18683 3544 1516 CAT CAT CAT 8 1.0 On the other hand GSH levels GR and CAT activities were found to be significantly lower in ALS patients 1 JUMiner_v2.2 1 2 35 0 1 0 TotalCon:2<>1516|CAT|847|Complete__13734|GLYAT|10249|No_GeneRif__<>AvaiableGeneRif=1<> 0 0 0 0 0 15769 18308427 18683 20996 11179 SOD1 ALS ALS 17 1.7 and CAT activities were found to be significantly lower in ALS patients which represents imbalance in the oxidant_amp_#x2013 antioxidant system 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15770 18308427 18684 20996 11179 SOD1 ALS ALS 19 1.7 metabolic events nevertheless it is significant that all the five ALS patients in whom erythrocyte GSH levels were extremely low at 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15771 18308427 18686 20996 11179 SOD1 ALS ALS 15 1.7 need to develop surrogate markers to monitor the progress of ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15772 18308427 18687 20996 11179 SOD1 ALS ALS 17 1.7 imbalance could be a contributing factor in the progression of ALS in an ideal situation these systemic effects should have taken 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15773 18308427 18688 20996 11179 SOD1 ALS ALS 28 1.7 the patients due to significant morbidity and mortality associated with ALS 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15774 18308427 18689 20996 11179 SOD1 ALS ALS 10 1.7 Lipid peroxidation (mean mean _amp_#xb1 S.E.M. in the erythrocytes of ALS patients *** p _amp_#x3c 0.001 vs control 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15775 18308427 18691 20996 11179 SOD1 ALS ALS 10 1.7 Catalase activity (mean mean _amp_#xb1 S.E.M. in the erythrocytes of ALS patients ** p _amp_#x3c 0.01 vs control 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15776 18308427 18693 20996 11179 SOD1 ALS ALS 9 1.7 3._amp_#xa0 Glutathione (mean mean _amp_#xb1 S.E.M. in the erythrocytes of ALS patients ** p _amp_#x3c 0.01 vs control 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15777 18308427 18695 20996 11179 SOD1 ALS ALS 11 1.7 reductase activity (mean mean _amp_#xb1 S.E.M. in the erythrocytes of ALS patients ** p _amp_#x3c 0.01 vs control 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15778 18308427 18697 20996 11179 SOD1 ALS ALS 11 1.7 dehydrogenase activity (mean mean _amp_#xb1 S.E.M. in the erythrocytes of ALS patients *** p _amp_#x3c 0.001 vs control 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15779 18308427 18699 20996 11179 SOD1 ALS ALS 12 1.7 polynomial regression plot showing lipid peroxidation in the erythrocytes of ALS patients vs duration of illness ( N = 10 at 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15780 18308427 18701 20996 11179 SOD1 ALS ALS 14 1.7 plot showing the activity of catalase in the erythrocytes of ALS vs duration of illness ( N = 10 at 6 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15781 18308427 18703 20996 11179 SOD1 ALS ALS 16 1.7 glutathione levels vs duration of illness in the erythrocytes of ALS patients ( N = 10 at 6 months 5 at 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15782 18308427 18705 20996 11179 SOD1 ALS ALS 21 1.7 vs duration of illness in the erythrocytes of patients with ALS ( N = 10 at 6 months 5 at 12 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 15783 18308427 18707 20996 11179 SOD1 ALS ALS 19 1.7 glucose-6-phosphate dehydrogenase vs duration of illness in the erythrocytes of ALS patients ( N = 10 at 6 months 5 at 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 5468 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:5468|IGFALS|0.000884320703977269<>ScoreDetail__5468|IGFALS|0.000884320703977269__11179|SOD1|0.000578917569320476__ 0 0 0 0 0 18493 18349520 21375 20996 11179 SOD1 ALS ALS 13 0.0 that an early therapeutic intervention in amyotrophic lateral sclerosis (ALS) ALS would lead to better results in terms of disease progression 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00115848913889263<>ScoreDetail__5468|IGFALS|0.000866015093405914__11179|SOD1|0.00115848913889263__ 0 0 0 0 0 18494 18349520 21376 20996 11179 SOD1 ALS ALS 26 0.0 biological parameters reflecting for example oxidative stress alterations associated with ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00115848913889263<>ScoreDetail__5468|IGFALS|0.000866015093405914__11179|SOD1|0.00115848913889263__ 0 0 0 0 0 18495 18349520 21379 20996 11179 SOD1 ALS ALS 10 0.0 Objective In this study primary fibroblasts obtained from 10 sporadic ALS (SALS) SALS patients and 10 healthy matched controls were used 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.00115848913889263<>ScoreDetail__5468|IGFALS|0.000866015093405914__11179|SOD1|0.00115848913889263__ 0 0 0 0 0 6787 18574762 7989 20996 11179 SOD1 ALS ALS 5 0.0 Oxidative stress biomarkers in sporadic ALS 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000547064613005482<>ScoreDetail__5468|IGFALS|0.000467440940635001__11179|SOD1|0.000547064613005482__ 0 0 0 0 0 6788 18574762 7990 20996 11179 SOD1 ALS ALS 17 0.0 in a cross-sectional pilot study of 50 participants with sporadic ALS (SALS) SALS compared to 46 control subjects 1 JUMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000547064613005482<>ScoreDetail__5468|IGFALS|0.000467440940635001__11179|SOD1|0.000547064613005482__ 0 0 0 0 0 7730 18588875 8927 20996 11179 SOD1 ALS ALS 18 0.3 disorders including Alzheimer's disease Parkinson's disease amyotrophic lateral sclerosis (ALS), ALS Huntington's disease and the aging process itself 1 JUMiner_v2.2 1 2 amyotrophic lateral sclerosis 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000661633789414603<>ScoreDetail__5468|IGFALS|0.000211573045593991__11179|SOD1|0.000661633789414603__ 0 0 0 0 0 7731 18588875 8930 18723 10261 ROS1 ROS ROS 13 0.3 reactions that form potentially more dangerous reactive oxygen species (ROS) ROS species such as the hydroxyl radical (OH), OH hydrogen peroxide 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 7732 18588875 8931 18723 10261 ROS1 ROS ROS 4 0.3 The major source of ROS in the mitochondria and in the cell overall is leakage 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 7733 18588875 8932 18723 10261 ROS1 ROS ROS 14 0.3 0.2-2% of oxygen taken up by cells is converted to ROS through mitochondrial superoxide generation by the mitochondria 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 7734 18588875 8934 18723 10261 ROS1 ROS ROS 4 0.3 While exogenous sources of ROS such as UV light visible light ionizing radiation chemotherapeutics and 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 7735 18588875 8934 18723 10261 ROS1 ROS ROS 31 0.3 oxidative milieu mitochondria are perhaps the most significant contribution to ROS production affecting the aging process 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 7736 18588875 8935 18723 10261 ROS1 ROS ROS 4 0.3 In addition to producing ROS mitochondria are also a target for ROS which in turn 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 7737 18588875 8935 18723 10261 ROS1 ROS ROS 11 0.3 addition to producing ROS mitochondria are also a target for ROS which in turn reduces mitochondrial efficiency and leads to the 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 7738 18588875 8935 18723 10261 ROS1 ROS ROS 25 0.3 reduces mitochondrial efficiency and leads to the generation of more ROS in a vicious self-destructive cycle 3 JUMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 1888 18715147 2783 18723 10261 ROS1 ROS ROS 6 0.3 The generation of reactive oxygen species (ROS) ROS and reactive nitrogen species (RNS) RNS leads to oxidative and/or 3 SciMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 1889 18715147 2783 6981 22140 FAM20C RNS RNS 11 0.0 reactive oxygen species (ROS) ROS and reactive nitrogen species (RNS) RNS leads to oxidative and/or and or nitrosative damage to cellular 1 SciMiner_v2.2 1 0 0 0 0 0 0 0 0 0 1890 18715147 2784 18723 10261 ROS1 ROS ROS 11 0.3 oxidative stress increases due to an aberrant generation of ROS/RNS ROS RNS and a gradual decline in cellular antioxidant defense mechanisms 3 SciMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 1891 18715147 2784 6981 22140 FAM20C RNS RNS 11 0.3 stress increases due to an aberrant generation of ROS/RNS ROS RNS and a gradual decline in cellular antioxidant defense mechanisms 4 SciMiner_v2.2 1 2 reactive nitrogen species 0 0 0 0 0 0 0 0 1892 18715147 2788 18723 10261 ROS1 ROS ROS 5 0.3 However additional intracellular sources of ROS and RNS exist as well as extracellular sources such as 3 SciMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 1893 18715147 2788 6981 22140 FAM20C RNS RNS 7 0.1 However additional intracellular sources of ROS and RNS exist as well as extracellular sources such as those resulting 6 SciMiner_v2.2 1 2 reactive nitrogen species 0 0 0 0 0 0 0 0 1894 18715147 2789 18723 10261 ROS1 ROS ROS 7 0.3 A significant body of literature indicates that ROS and/or and or RNS resulting from mitochondrial dysfunction neuroinflammation or 3 SciMiner_v2.2 1 2 ros 0 0 0 0 0 0 0 0 1895 18715147 2789 6981 22140 FAM20C RNS RNS 9 0.1 significant body of literature indicates that ROS and/or and or RNS resulting from mitochondrial dysfunction neuroinflammation or toxicants are major factors 6 SciMiner_v2.2 1 2 reactive nitrogen species 0 0 0 0 0 0 0 0 1896 18715147 2789 20996 11179 SOD1 ALS ALS 44 0.0 (AD), AD Huntingtons disease (HD), HD amyotrophic lateral sclerosis (ALS), ALS and many others (1, 1 8 9 16 18 1 SciMiner_v2.2 1 0 0 2 11179 TotalCon:2<>11179|SOD1|6647|Complete__5468|IGFALS|3483|Complete__<>AvaiableGeneRif=2<>BEST:11179|SOD1|0.000707286291639221<>ScoreDetail__5468|IGFALS|6.43107495417859e-05__11179|SOD1|0.000707286291639221__ 0 0 0 0 0 #sen2geneID pmid senID geneID hgncID approvedSymbol matchString actualString startPos score flankingText matchCodeID tag SciMinerVersion SciMinerMethod inExClude inExCludeCond phenotypeOnly conflictCode hgncIDbyNR NRText editTag editUser oldGeneID oldHgncID oldApprovedSymbol oldInExClude oldInExCludeCond 297138 8841988 424205 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 decreased cytochrome c oxidase activity but unchanged superoxide dismutase and glutathione peroxidase activities in the spinal cords of patients with amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297141 8841988 424208 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 we measured the antioxidant actions of superoxide dismutase sod glutathione peroxidase gsh px and cytochrome c oxidase co of the human spinal cord in patients with als in comparison with those in control patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297269 8899665 424391 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 evidence against increased oxidative stress in fibroblasts from patients with non superoxide dismutase 1 mutant familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 297271 8899665 424393 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in parallel fibroblasts were examined for signs of abnormal oxidative stress by study of reactive oxygen species metabolism and concurrently leukocyte dna from the same patients was examined for superoxide dismutase 1 sod1 mutations. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 295173 8922414 420725 20478 11117 SMN1 spinal muscular atrophy spinal muscular atrophy 0 1.0 in humans elevated ros levels also have been linked to neuropathies such as parkinson's disease huntington's chorea alzheimer's disease infantile spinal muscular atrophy and amyotrophic lateral sclerosis als; olanow and arendash 1994 ; beal 1995 ; eisen 1995 ; mattson and goodman 1995 . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 295531 8997453 421543 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 the major neurodegenerative disorders include alzheimer's disease amyotrophic lateral sclerosis parkinson's disease and multiple sclerosis. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 294712 9172131 419815 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 d familial 5 10_amp_#37; cases forms which are clinically and pathologically indistinguishable. 2 the discovery of a missense mutation in the gene encoding the major cellular antioxidant enzyme cu/zn superoxide dismutase sod1 in familial als subjects 3 has initiated an intense investigation into the role of oxidative stress in the pathogenesis of als. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293755 9350962 417497 551 399 ALB albumin albumin 0 0.0 ribes an immunocytochemical method for localization of central nervous system cns lipid peroxidation lp that employs a rabbit derived antibody raised against malondialdehyde mda modified rabbit serum albumin rsa . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293757 9350962 417521 551 399 ALB albumin albumin 0 0.0 five milliliters of the solution was mixed with 5 ml of rabbit serum albumin rsa; 10 mg/ml . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293759 9350962 417531 551 399 ALB albumin albumin 0 0.0 malondialdehyde rabbit serum albumin elisa 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293761 9350962 417533 551 399 ALB albumin albumin 0 0.0 the mda rsa solution was poured out and the plates blocked with 200 _amp_#x3bc; l of a solution of 1% bovine serum albumin bsa in phosphate buffered saline pbs for 30 min. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293763 9350962 417541 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 transgenic familial als mice g1h/+ strain which highly express a mutant human cu/zn superoxide dismutase gene 93 gly_amp_#x2192;ala and develop motor neuron disease gurney et al. 1996 were bred and raised at pharmacia and upjohn. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 293764 9350962 417588 551 399 ALB albumin albumin 0 0.0 specificity of anti malondialdehyde rabbit serum albumin antibody 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 291078 9462746 412763 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 a novel neurological phenotype in mice lacking mitochondrial manganese superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280473 10077670 394958 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 abstract it has been reported that expression of familial amyotrophic lateral sclerosis fals associated mutant cu/zn superoxide dismutase 1 sod induces apoptosis of neuronal cells in culture associated with an increase in reactive oxygen species. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280480 10077670 394991 17303 9391 PRKAR2A protein kinase a protein kinase a 0 0.0 in brief r ii peptide dldvpipgrfdrrvsvaae; 0.25 _amp_#x003bc;m containing the phosphorylation site of type ii camp dependent protein kinase lc services woburn ma was phosphorylated by bovine brain protein kinase a catalytic subunit 30 _amp_#x003bc;g/ml plus _amp_#x0005b;_amp_#x003b3; 32 p_amp_#x0005d;atp 0.5 mm . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280520 10077670 395143 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 als amyotrophic lateral sclerosis sod cu/zn superoxide dismutase 1 fals familial als cyp cyclophilin wt wild type ngf nerve growth factor adv adenovirus csa cyclosporin a nmda n methyl d aspartate mptp mitochondrial permeability transition pore 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 280522 10077670 395146 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in 1993 mutations in cu/zn superoxide dismutase 1 sod were found to be associated with 20_amp_#x00025; of cases of familial als fals 1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 277453 10385054 390311 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 one of the strongest suggestions for this link has come from the association between the familial autosomal dominant form of amyotrophic lateral sclerosis fals and defects in the cu/zn superoxide dismutase sod 1 gene [ 2 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267933 10643818 372664 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 known genetic risk factors for familial alzheimer's disease have been localized to the amyloid precursor protein apolipoprotein e presenilin 1 and presenilin 2 genes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267939 10643818 372671 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e apoe protects neurons from hydrogen peroxide toxicity and binds specific metal ions including iron which could otherwise catalyze the generation of hydroxyl radicals. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267941 10643818 372672 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 the gene product of apolipoprotein e allele epsilon 4 has decreased anti oxidant activity compared to alleles epsilon 2 and 3 [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 267943 10643818 372673 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e may also protect from _amp_#x3b2; amyloid peptide toxicity by binding to amyloid _amp_#x3b2; and under certain circumstances acting as kinetic inhibitor of amyloid formation [ 18 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268284 10671549 373497 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 furthermore g93a cells showed a significant decrease of bcl 2 expression and as target of no derived radicals showed lower cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268311 10671549 373603 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 cytochrome c oxidase activity cells attached and detached were washed and collected by centrifugation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268313 10671549 373605 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 lysates were used for cytochrome c oxidase activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268325 10671549 373664 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 a specific marker of no toxicity was the decrease of cytochrome c oxidase activity which paralleled the extent of apoptosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268340 10671549 373733 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 b activity of cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268342 10671549 373734 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 spectrophotometric determination of cytochrome c oxidase activity was performed as described under "experimental procedures." 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 268357 10671549 373777 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 among the above mentioned molecular target of no toxicity the hemoprotein cytochrome c oxidase appears to be the only one strongly affected by gsno insult and protected by native cu zn sod fig 7 b . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264088 10742195 364641 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 it is especially intriguing how the powerful catalytic redox activity of antioxidant cu/zn superoxide dismutase can convert into a pro oxidant activity a theme echoed in the recent proposal that a_amp_#x3b2; and prp the proteins respectively involved in alzheimer_amp_#x2019;s disease and prion diseases possess 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264096 10742195 364701 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 although cu 2+ is essential for life and the function of numerous enzymes of interest to neurobiology such as tyrosinase ceruloplasmin cytochrome c oxidase and dopamine _amp_#x3b2; hydroxylase free or incorrectly bound cu 2+ can also catalyze the generation of the most damaging radicals such as the hydroxyl radical oh _amp_#x2022; [ 10 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 264100 10742195 364742 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 we have also reported [ 25 ] that apolipoprotein e apoe modulates the precipitation of a_amp_#x3b2; by cu 2+ and zn 2+ which is important because apoe isoforms segregate with the genetic risk for ad; inheritance of the apoe4 isoform carries the gre 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257646 11050436 352951 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 the q cycle mechanism proposed for the operation of the ubiquinol cytochrome c reductase operates as follows. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 257662 11050436 353063 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 complex i nadh ubiquinone oxidoreductase complex iii ubiquinol cytochrome c oxidoreductase complex iv cytochrome c oxidase and complex v h + translocating atp synthetase are shown. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253644 11223912 347837 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 rial uptake of ca 2+ has recently been found to play an important role in glutamate induced neurotoxicity gnt as well as in the activation of ca 2+ dependent molecules such as calmodulin and neuronal nitric oxide synthase nnos in the cytoplasm. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 253691 11228742 347976 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 otrophin mediated activation glutamatergic signal transduction and various diseases with crucial roi involvement e.g. alzheimer's disease parkinson's disease experimental autoimmune encephalomyelitis multiple sclerosis amyotrophic lateral sclerosis and injury . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 249611 11328670 340451 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 invited review: manganese superoxide dismutase in disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 249613 11328670 340452 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 manganese superoxide dismutase mnsod is essential for life as dramatically illustrated by the neonatal lethality of mice that are deficient in mnsod. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245378 11562447 333617 551 399 ALB albumin albumin 0 0.0 peroxynitrite dependent nitrations were impaired when synaptosomes were pretreated with thioreductants glutathione n acetyl cysteine dithiothreitol or antioxidants uric acid melatonin bovine serum albumin desferrioxamine . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245386 11562447 333690 551 399 ALB albumin albumin 0 0.0 the reaction was started by the addition of the substrates [1 c]acetyl coa 14 microm and choline 2.5 mm in the presence of 250 microm eserine 10 microm bovine serum albumin bsa and 75 mm nacl and stopped after 1 h by dilution with cold sodium phosphate buffer. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 245401 11562447 333874 551 399 ALB albumin albumin 0 0.0 ach acetylcholine; sin 1 3 morpholinosydnonimine; coa coenzyme a; chat choline acetyltransferase; vamp/synaptobrevin vesicular associated membrane protein; tca trichloroacetic acid; bsa bovine serum albumin; page polyacrylamide gel electrophoresis; ecl enhanced chemiluminescence; gsh glutathione; nac n acetylcysteine; dtt dithiothreitol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 238978 11679167 325647 17649 9655 PTPN3 tyrosine phosphatase tyrosine phosphatase 0 0.0 it was recently shown that the inhibition of yeast growth by linoleic acid hydroperoxide requires a putative protein tyrosine phosphatase oca1p of unknown function. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239000 11679167 325752 23454 12435 TXN thioredoxin thioredoxin 0 0.0 it was recently shown that the thioredoxin system consisting of thioredoxin thioredoxin reductase and thioredoxin peroxidase plays a key role in regulating the yap1p dependent stress response. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239004 11679167 325754 23454 12435 TXN thioredoxin thioredoxin 0 0.0 in addition the thioredoxin peroxidase tpx1p is essential for the transcriptional activation of trx2 and trr1 genes ross et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239012 11679167 325772 23454 12435 TXN thioredoxin thioredoxin 0 0.0 indeed the induction of tpx1 thioredoxin peroxidase gene is skn7p and yap1p dependent and is lower in respiration deficient mutants and ccp 1_amp_#x394; cells charizanis et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239016 11679167 325799 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 life span of cells adapted to respiratory growth conditions which display high levels of antioxidant defences maclean et al. 2001 and by the decreased life span observed in mutants deficient in cuzn superoxide dismutase or mn superoxide dismutase longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239017 11679167 325799 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 or mn superoxide dismutase longo et al. 1999 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 239019 11679167 325800 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the deficiency in mn superoxide dismutase leads to the accumulation of superoxide radicals which destroy the 4fe_amp_#x2013;4s clusters of mitochondrial enzymes e.g. aconitase leading to an impaired respiratory activity. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232225 11978481 313820 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 the generation of no _amp_#x2022; is catalyzed by three isoforms of nitric oxide synthase neuronal nitric oxide synthase nnos endothelial nitric oxide synthase enos and inducible nitric oxide synthase inos . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232230 11978481 313855 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 one protein was manganese superoxide dismutase which was previously shown to be selectively nitrated at tyr 34 and inactivated [ 22 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232235 11978481 313875 24393 12854 YWHAQ protein tau protein tau 0 1.0 neurofibrillary tangles are protein aggregates which are largely made up of the microtubule associated protein tau. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 232239 11978481 313887 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 a 6 fold increase in 3 nitrotyrosine concentrations was detected in ad cerebrospinal fluid as compared to age matched controls [ 41 ] and an increase in nitrated manganese superoxide dismutase was also reported [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232241 11978481 313900 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 we and others showed that inhibitors of neuronal nitric oxide synthase blocked mptp induced dopaminergic toxicity in mice and that mptp neurotoxicity was attenuated in mice deficient in neuronal nitric oxide synthase [ 45 and 46 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232243 11978481 313901 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 we subsequently showed that neuronal nitric oxide synthase inhibitors blocked mptp neurotoxicity in baboons and this was accompanied by an inhibition of 3 nitrotyrosine staining [ 47 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232245 11978481 313905 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 an increase in nitrated manganese superoxide dismutase was found in cerebrospinal fluid [ 42 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232248 11978481 313925 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 other groups reported marked increases of both free 3 nitrotyrosine and nitrated manganese superoxide dismutase in the cerebrospinal fluid of sporadic als patients [ 42 and 62 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232249 11978481 313926 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in transgenic mouse models of als protein carbonyls are significantly increased in the spinal cord and one of the most heavily oxidized proteins in cu/zn superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 232252 11978481 313929 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 an increase in neuronal nitric oxide synthase nnos was found in motor neurons in one study [ 65 66 and 67 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 218390 12392777 292016 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the antioxidant enzymes in the brain include cu/zn superoxide dismutase sod 1 and mn superoxide dismutase sod 2 which catalyze the conversion of o 2 _amp_#x221a; _amp_#x2212; to h 2 o 2 [ 73 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208065 12618129 278659 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mitochondrial respiratory chain dysfunction was also found in transgenic mice expressing a mutant form of superoxide dismutase 1 associated with familial als [ 15 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208068 12618129 278684 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 the activities of complex i+iii nadh_amp_#x2013;cytochrome c reductase ii+iii succinate_amp_#x2013;cytochrome c reductase iv cytochrome c oxidase cox and the mitochondrial matrix enzyme citrate synthase cs were measured as described elsewhere [ 21 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 208072 12618129 278794 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 i+iii nadh cytochrome c reductase; ii+iii succinate cytochrome c reductase; cox cytochrome c oxidase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 209895 12654515 280327 12355 6872 MAPK10 map kinase map kinase 0 1.0 map kinase activation assay 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 209896 12654515 280328 12355 6872 MAPK10 map kinase map kinase 0 1.0 map kinase activation was measured by the phosphorylation of erk1/2 using anti phospho erk1/2 antibody cell signaling . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 211479 12663085 281801 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 since mutations of the superoxide dismutase 1 sod 1 gene were first identified in 1993 it has been considered a possible cause of familial als fals [ 76 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 211481 12663085 281812 11778 6561 LGALS1 galectin galectin 0 0.0 e as yet unknown with regard to receptor function three proteins have been reported as age binding proteins: age r1 oligosaccharyl transferase complex protein 48 ost48 age r2 80k h protein and age r3 galectin 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 212295 12684448 283326 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 although a small percentage 1 2% of cases have been linked to mutations in the enzyme superoxide dismutase 1 sod1 rosen et al. 1993 the vast majority 90 95% are sporadic. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 205118 12753090 274891 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 nitrosative stress was not involved in the oxidative unbalance as a decrease in neuronal nitric oxide production and down regulation of neuronal nitric oxide synthase nnos level were detected. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201231 12893007 269200 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in some familiar cases of als mutation in the gene for cu/zn superoxide dismutase sod1 can be identified. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201235 12893007 269263 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 hne immunopositivity seems to be associated with the inheritance of apolipoprotein e 4 apoe alleles. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 201721 12901835 269787 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 decreased activity of cytochrome c oxidase was demonstrated in spinal cord motor neurons [ borthwick et al 1999 ] and lymphocytes [ curti et al 1996 ] from sals patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202341 12909279 270800 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 as a chain of consequent events modulating extracellular transport uptake intracellular delivery from chaperones e.g copper chaperone for sod1 ccs cox17 and atx1 to specific targets such as sod1 and cytochrome c oxidase and/or storage in copper scavenging systems such as gsh and metallothioneins [ 72 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 202346 12909279 270835 22023 11740 TF transferrin transferrin 0 0.0 if the ire is located on the 3_amp_#x2032; untranslated region of the mrna the binding of irp usually causes an up regulation of the coded protein as for example for the transferrin receptor [ 28 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187461 14648077 250304 23454 12435 TXN thioredoxin thioredoxin 0 0.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then converted into harmless water h 2 o and oxygen o 2 by prx2 and gpx1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187464 14648077 250304 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 to protect themselves from these ross the cells have developed both an antioxidant system containing superoxide dismutase 1 sod1 and a redox system including peroxiredoxin2 prx2 thioredoxin peroxidase and glutathione peroxidase1 gpx1 : sod1 converts superoxide radicals into hydrogen peroxide h 2 o 2 and h 2 o 2 is then 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187468 14648077 250309 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 keywords peroxiredoxin 2 glutathione peroxidase 1 redox system superoxide dismutase 1 familial amyotrophic lateral sclerosis 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187475 14648077 250322 23454 12435 TXN thioredoxin thioredoxin 0 0.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187478 14648077 250322 17267 17169 PRDX4 thioredoxin peroxidase thioredoxin peroxidase 0 0.0 in this milieu prx2 is also called thioredoxin peroxidase 1 thioredoxin dependent peroxide reductase 1 or thiol specific antioxidant [ 4 5 6 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187482 14648077 250336 551 399 ALB albumin albumin 0 0.0 olyclonal antibody against prx2 a synthetic peptide corresponding to the c terminal region of prx2 amino acids 184_amp_#x2013;198: nh 2 kpnvddskeyfskhn cooh with or without conjugation to human serum albumin hsa at the carboxyl end was supplied by peptide institute osaka japan . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187487 14648077 250372 551 399 ALB albumin albumin 0 0.0 the following primary antibodies were utilized: an affinity purified rabbit antibody against prx2 concentration: 1 _amp_micro;g/ml a polyclonal antibody to gpx1 [diluted 1:2 000 in 1% bovine serum albumin containing phosphate buffered saline bsa pbs ph 7.4] [ 2 ] and a polyclonal antibody to human sod1 diluted 1:10 000 in 1% bsa pbs ph 7.4 [ 1 ]. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187495 14648077 250438 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 similar stainability and immunolocalization of sod1 gpx1 and prx2 in the lbhi are observed lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 187499 14648077 250447 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the precise intra inclusional immunolocalizations of these three proteins differ from each other in this lbhi lbhi lewy body like hyaline inclusion fals familial amyotrophic lateral sclerosis sod1 superoxide dismutase 1 gpx1 glutathione peroxidase1 prx2 peroxiredoxin2 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188362 14660707 251221 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 p experiments were performed on vulnerable hypoglossal motoneurones mns and mitochondrial function was disturbed by bath application of 1_amp_#x02013;2 m m sodium cyanide cn which inhibits complex iv cytochrome c oxidase of the electron transport chain. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 188364 14660707 251324 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 we investigated the impact of a disturbed respiratory chain on membrane currents and [ca 2+ ] i using cyanide cn a known inhibitor of cytochrome c oxidase complex iv . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189434 14690536 252560 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 it is possible that mutations of cu/zn superoxide dismutase sod1 responsible for about 20% of familial als down regulates glutamate transporters via oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189443 14690536 252569 20339 13448 SLC38A2 amino acid transporter 2 amino acid transporter 2 0 0.0 excitatory amino acid transporter 2|sod1 g93a protein|superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 189759 14698606 252862 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 most cases are sporadic although a subset 10% is familial with 20% of these being linked to mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190874 14739060 254321 12355 6872 MAPK10 map kinase map kinase 0 1.0 it is now recognized that redox regulation involving ros is key to the modulation of critical cellular functions notably for neurons astrocytes and microglia such as mitogene activated protein map kinase cascade activation ion transport calcium mobilization and apoptosis program activation. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 190898 14739060 254413 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 parkin is one member of the family of ubiquitin ligase responsible for ubiquination a process tagging proteins for degradation through proteosomal pathway. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 190902 14739060 254448 12580 7008 MELAS mitochondrial encephalomyopathy mitochondrial encephalomyopathy 0 0.0 the classic phenotypes of mitochondrial encephalomyopathy has been described as mitochondrial encephalomyopathy lactic acidosis and stroke like episodes syndrome melas . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190903 14739060 254448 12580 7008 MELAS mitochondrial encephalomyopathy, lactic acidosis, mitochondrial encephalomyopathy lactic acidosis an 0 1.0 the classic phenotypes of mitochondrial encephalomyopathy has been described as mitochondrial encephalomyopathy lactic acidosis and stroke like episodes syndrome melas . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 190904 14739060 254456 12580 7008 MELAS mitochondrial encephalomyopathy mitochondrial encephalomyopathy 0 1.0 primary coenzyme q deficiency cause a mitochondrial encephalomyopathy that is responsive to coenzyme q administration [ 44 ]. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 184281 15038597 246226 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 in particular we recently demonstrated that in copper deficiency mitochondrial function is impaired due to decreased activity of cytochrome c oxidase leading to production of reactive oxygen species which in turn triggers mitochondria mediated apoptotic neurodegeneration. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 177204 15105254 236597 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 increased maos occurs in amyotrophic lateral sclerosis als as the result of genetic abnormalities e.g. cu/zn superoxide dismutase mutations or exposure to environmental toxins. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 173000 15289674 231348 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 detection method of the adjacent motor neuronal death in an in vitro co culture model of familial als associated cu/zn superoxide dismutase. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 173001 15289674 231349 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mutations in cu/zn superoxide dismutase sod1 gene have been identified in familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 151517 15812313 199948 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 copper is an essential trace metal and is required for the proper functioning of several enzymes including cytochrome c oxidase ceruloplasmin and sod1 _amp_#91; 13 _amp_#93;. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 153998 15850589 203859 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mutations of cu/zn superoxide dismutase sod1 are found in patients with familial amyotrophic lateral sclerosis fals . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 153999 15850589 203876 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 about one fifth of fals patients have mutations in the gene encoding for cu/zn superoxide dismutase sod1 and over 100 missense mutations have been described. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142774 15863242 187979 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 cu/zn superoxide dismutase 1 sod1 encoded on chromosome 21 is a key enzyme in metabolism of oxygen free radicals and oxidative stress. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142776 15863242 187987 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the human cu/zn superoxide dismutase 1 gene hsod1 was the first chromosome 21 gene to be characterised groner et al. 1985 and it was even shown earlier to be overexpressed at the protein level in down syndrome ds; trisomy 21 patients si 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142789 15863242 188108 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 finally the manifold decrease of ubiquitin conjugating enzyme e2 level in tg hsod1 mice catalyzing covalent attachment of ubiquitin to other proteins may reflect sod1 mediated impaired protein handling in terms of ubiquitination. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142791 15863242 188110 1345 853 ATP6V1B1 beta polypeptide beta polypeptide 0 0.0 we have included fragments of two proteins table 1 similar to tubulin beta polypeptide and sex determining protein that were differentially expressed between groups but these were not included in the discussion as no definitive assignment can be made based upon an incomplete sequence. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 142792 15863242 188110 23406 20778 TUBB tubulin, beta tubulin beta 0 0.0 we have included fragments of two proteins table 1 similar to tubulin beta polypeptide and sex determining protein that were differentially expressed between groups but these were not included in the discussion as no definitive assignment can be made based upon an incomplet 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144768 15896810 189879 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 there is significant evidence that the pathogenesis of several neurodegenerative diseases including parkinson's disease alzheimer's disease friedreich's ataxia frda multiple sclerosis and amyotrophic lateral sclerosis may involve the generation of reactive oxygen species ros and/or reactive nitrogen species rns associated with mitochondrial dysfunction. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144770 15896810 189890 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 the major neurodegenerative diseases alzheimer's disease ad parkinson's disease pd amyotrophic lateral sclerosis als multiple sclerosis ms huntington's disease hd and frda are all associated with the presence of abnormal proteins. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144784 15896810 189938 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 there is significant evidence that the pathogenesis of several neurodegenerative diseases including parkinson's disease alzheimer's disease friedreich ataxia multiple sclerosis and amyotrophic lateral sclerosis may involve the generation of reactive oxygen species ros reactive nitrogen species rns and mitochondrial dysfunction. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144790 15896810 189946 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 up regulation of protein manganese superoxide dismutase mnsod fails to occur in frda fibroblasts exposed to iron [25] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144799 15896810 190030 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 other data are also consistent with these findings as it has been shown both in a patient with cytochrome c oxidase deficiency and in an animal model of copper deficiency that more than a 50% deficit in complex iv activity did not affect the respiratory flux [56] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144801 15896810 190043 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 cytokines inf _amp_#x3b3; which are present in normal brain are elevated in numerous pathological states including parkinson's disease [83] alzheimer's disease [84] multiple sclerosis ischemia encephalitis and central viral infections [85] . 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 144810 15896810 190071 551 399 ALB albumin albumin 0 0.0 nitrosothiols with biological relevance have been isolated and characterized including s nitrosoglutathione and the nitrosothiols of serum albumin [101] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 144817 15896810 190097 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the factors responsible for this include the inner mitochondrial membrane lipid composition and/or the oxidant/antioxidant balance particularly manganese superoxide dismutase and/or heat shock protein activity and expressions as well as the glutathione status. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147205 15964487 194024 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 treatment of patients with minocycline has therefore been proposed as a possible therapy for some neurodegenerative diseases including multiple sclerosis popovic et al. 2002 ischemia arvin et al. 2002 pd and huntington_amp_#x2019;s disease thomas et al 2003 and thomas et al 2004 because minocycline crosses the blood brain barrier regardless of the dos 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 147208 15964487 194064 551 399 ALB albumin albumin 0 0.0 mitochondrial protein concentrations were quantified spectrophotometrically micro bca protein reagent kit pierce rockford il usa with bovine serum albumin used as standard. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147211 15964487 194087 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 complex iv cytochrome c oxidase; e.c.1.9.3.1 activity was determined as described by wharton and tzagoloff 1967 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 147213 15964487 194091 20411 11086 SLIT2 slit 2 slit 2 0 1.0 fluorescence was continuously monitored using a perkin elmer ls 50b fluorescence spectrometer with the excitation at 506nm and the emission at 531nm slit 2.5nm . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 136180 16026864 180216 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 als is sporadic in 90% of cases; the remaining 10% are of genetic origin with a subset being induced by mutations in the enzyme superoxide dismutase 1 sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136187 16026864 180337 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 als related disturbance of mitochondrial respiration by mutant superoxide dismutase 1 sod1 or hypoxia results in increased formation of reactive oxygen species ros 48 and 49 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 136878 16043017 181252 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 the activities of uch l1 in the spinal cord were measured by determining the rate of conversion of ubiquitin c terminal 7 amido 4 methylcoumarin ub amc calbiochem to ubiquitin and free amc [48] . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137917 16050975 182119 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 approximately 20% of fals cases are due to mutations in the gene encoding superoxide dismutase 1 sod1; cu zn dismutase; mim147450 rosen et al. 1993 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 137930 16050975 182258 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 1|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131952 16188953 173806 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 finally both compounds were tested in superoxide dismutase 1 g93a mice a model of familial amyotrophic lateral sclerosis. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131954 16188953 173829 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 twenty percent of familial als cases are caused by mutations in superoxide dismutase 1 sod1 which expressed in mice result in a phenotype resembling the pathology in patients. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 131959 16188953 173965 166 118 ACO2 aconitase 2 aconitase 2 0 0.0 additionally a monoclonal antibody raised against the 23 c terminal amino acids of aconitase 2 mitochondrial aconitase from rat nanotools; antik_amp_ouml;rpertechnik teningen germany was used to study the expression of the protein in mitochondria. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132337 16194581 174781 10601 6081 INS insulin insulin 0 0.0 the localized expression of erk and insulin like growth factor 1 igf 1 and its receptor igf 1r was also assayed by immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132338 16194581 174781 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 the localized expression of erk and insulin like growth factor 1 igf 1 and its receptor igf 1r was also assayed by immunohistochemistry. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 132341 16194581 174786 12355 6872 MAPK10 map kinase map kinase 0 1.0 the data indicated that bb supplementation increased hippocampal plasticity and cognitive performance via concerted mechanisms involving neurogenesis neurotrophic factor igf 1 and its receptor and map kinase signal transduction cascades. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 133283 16227974 175716 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 at least five separate genes that are associated with parkinson's disease have been identified including those encoding alpha synuclein parkin ubiquitin c terminal hydrolase 1 dj1 and pten induced kinase 1 pink1 refs 2 4 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 133293 16227974 175760 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 superoxide dismutase 2 +/ sod2 +/ mice which lack one copy of this mitochondrial antioxidant protein show an increased rate of atherosclerotic plaque formation 26 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134206 16242643 176951 10436 5991 IL1A interleukin 1 interleukin 1 0 0.0 in this sense tetracyclines can inhibit the matrix metalloproteases activity and superoxide production and can also down regulate the levels of expression of interleukin 1 beta inducible nitric oxide synthase inos caspase 3 and 1 chen et al. 2000 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 134213 16242643 176972 551 399 ALB albumin albumin 0 0.0 tissues were incubated with trypsin for 20 min at 37_amp_#xb0;c and dissociated by trituration in a medium containing dnase bovine serum albumin and trypsin inhibitor. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113437 16624679 147569 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 g93a cu/zn superoxide dismutase sod1 a human mutant sod1 associated with familial amyotrophic lateral sclerosis increased the toxicity of the mitochondrial toxin rotenone in the nsc 34 motoneuronal cell line. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 113438 16624679 147574 11868 30922 LINS1 lines homolog 1 lines 1 0 1.0 in all the cell lines 1 h after rotenone exposure mitochondrial hyperpolarization was accompanied by the formation of a comparable amount of reactive oxygen species. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 113440 16624679 147589 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 some fals patients 20% have mutant forms of cu/zn superoxide dismutase sod1 a free radical scavenging enzyme that converts the superoxide anion radical generated during normal cell metabolism to o 2 and hydrogen peroxide. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100383 16877542 128960 10601 6081 INS insulin insulin 0 0.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100384 16877542 128960 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 we also show that nadph oxidase derived oxidant products damage proteins such as insulin like growth factor 1 igf1 receptors which are located on motor neurons. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100421 16877542 129047 10601 6081 INS insulin insulin 0 0.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100422 16877542 129047 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 nadph oxidase impairs the insulin like growth factor 1 igf1 /akt pathway in transgenic sod1 g93a mice. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100461 16877542 129130 10601 6081 INS insulin insulin 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100462 16877542 129130 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100464 16877542 129130 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ros reactive oxygen species sod1 superoxide dismutase 1 igf1 insulin like growth factor 1 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100466 16877542 129133 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 insights into its neurodegenerative mechanisms followed the discovery that dominant mutations in the gene for superoxide dismutase 1 sod1 cause familial als 2 3 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 100469 16877542 129140 4848 30998 CPAT1 cerebral palsy cerebral palsy 0 1.0 such bystander cytotoxicity is thought to lead to the death of developing oligodendrocytes in periventricular leukomalacia 9 one of the most important causes of cerebral palsy. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 101478 16895581 130040 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ss 31 protected against cell death induced by hydrogen peroxide in vitro in neuronal cells stably transfected with either wild type or mutant cu/zn superoxide dismutase sod1 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87991 17099894 113908 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 motor neuron degeneration in amyotrophic lateral sclerosis mutant superoxide dismutase 1 transgenic mice: mechanisms of mitochondriopathy and cell death. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87993 17099894 113909 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 the mechanisms of human mutant superoxide dismutase 1 msod1 toxicity to motor neurons mns are unresolved. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87997 17099894 113914 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 87998 17099894 113914 4830 31395 COX8B cytochrome c oxidase cytochrome c oxidase 0 0.0 nitrated and aggregated cytochrome c oxidase subunit i and alpha synuclein as well as nitrated sod2 accumulate in msod1 mouse spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88223 17105868 114247 10601 6081 INS insulin insulin 0 0.0 surprisingly insulin like growth factor 1 prevents neuronal cell apoptosis and protects spinal motor neurons in als mice ryu et al. 1999 ; kaspar et al. 2003 but markedly potentiates neuronal cell necrosis induced by hyd 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88224 17105868 114247 9939 5464 IGF1 insulin like growth factor insulin like growth factor 0 0.0 surprisingly insulin like growth factor 1 prevents neuronal cell apoptosis and protects spinal motor neurons in als mice ryu et al. 1999 ; kaspar et al. 2003 but markedly potentiates neuronal cell necrosis induced by hydroxyl radical or gl 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 88241 17105868 114357 1624 1033 BDNF neurotrophin neurotrophin 0 0.0 the neurotrophins nerve growth factor brain derived neurotrophic factor neurotrophin 3 nt 3 and nt 4/5 promote neuronal survival by preventing programmed cell death or apoptosis but they markedly enhance necrotic degeneration of neurons exposed to oxidative stress koh et al. 1995 ; w 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74587 17174478 95194 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 ir hrdc helicase rnase d conserved domain mmr mismatch repair mrn mre11/rad50/nbs1 mtdna mitochondrial dna ner nucleotide excision repair no nitric oxide e i or nnos endothelial inducible or neuronal nitric oxide synthase nosox nos catalytic oxygenase module nosred nos reductase module nhej nonhomologous end joining ros reactive oxygen species sod superoxide dismutase ssbs single strand breaks tc ner transcription cou 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74590 17174478 95195 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74593 17174478 95216 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 ros removal by manganese superoxide dismutase 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74610 17174478 95288 21876 11609 TBXAS1 cytochrome p450 cytochrome p450 0 0.0 nosred belongs to a large protein family including nadph dependent cytochrome p450 reductase and sulfite reductase flavoprotein. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 74633 17174478 95478 8901 21157 GTF2H5 trichothiodystrophy trichothiodystrophy 0 1.0 this includes patients with the rare genetic disorders xeroderma pigmentosum xp trichothiodystrophy ttd and cockayne syndrome cs . 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 75285 17192933 96373 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 correction of humoral derangements from mutant superoxide dismutase 1 spinal cord. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54604 17496232 67630 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 on the contrary lack of no disrupts pathways like s nitrosylation or h 2 o 2 production and likewise is a gateway to disease in amyotrophic lateral sclerosis with superoxide dismutase 1 mutations or to cancer proliferation. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54608 17496232 67638 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 transcriptional increase of neuronal nitric oxide synthase nnos determines extensive binding to complex i and iv and contributes to hypothyroid phenotype. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54610 17496232 67641 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 mw molecular weight; mnsod manganese superoxide dismutase; 2d two dimensional. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54611 17496232 67648 864 576 APAF1 apoptotic protease activating factor apoptotic protease activating factor 0 0.0 no and h 2 o 2 release and activation of intrinsic programmed cell death via apoptotic protease activating factor 1 and activation of p53. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54622 17496232 67705 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in the presence of mitochondrial manganese superoxide dismutase mnsod most of o 2 is dismutated to h 2 o 2 which is freely diffusible to cytosol. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54626 17496232 67729 23454 12435 TXN thioredoxin thioredoxin 0 0.0 otherwise enzymes that catabolize h 2 o 2 catalase gluthatione peroxidase gpx; reactions 6 and 7 and thioredoxin peroxidase trx; reaction 8 are preferentially distributed in cytosol and peroxisomes. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 54642 17496232 67853 864 576 APAF1 apoptotic protease activating factor apoptotic protease activating factor 0 0.0 in the intrinsic program mitochondrial damage results in the release of cytochrome c triggering the assembly of the apoptosome complex with apoptotic protease activating factor 1 as central scaffold protein that directly recruits caspase 9 which in turn elicits caspase 3 effects 31 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 58551 17571960 73867 20478 11117 SMN1 spinal muscular atrophy spinal muscular atrophy 0 1.0 pathogenesis of neurodegeneration a multifaceted process that leads to various chronic disease states such as alzheimer's ad parkinson's pd huntington's hd diseases amyotrophic lateral sclerosis als spinal muscular atrophy sma and diabetic encephalopathy. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 59794 17584954 75259 551 399 ALB albumin albumin 0 0.0 the resulting pellet was washed once in modified chappell perry buffer with 0.5% bovine serum albumin and once in modified chappell perry buffer without bovine serum albumin. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59796 17584954 75306 20478 11117 SMN1 spinal muscular atrophy spinal muscular atrophy 0 1.0 loss of motor neurons breakdown of neuromuscular junctions or inhibition of neural signaling occurs in many neuromuscular diseases including als or spinal cord injury 75 spinal muscular atrophy 56 diabetic neuropathy 72 and aging 6 41 48 and each of these situations is associated with muscle atrophy. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 59798 17584954 75313 5284 19986 CYCS cytochrome c cytochrome c 0 0.0 for example genes encoding the mitochondrial respiratory chain and the tca cycle are significantly downregulated following denervation 48 60 66 and the levels of cytochrome c oxidase succinate dehydrogenase citrate synthase and cardiolipin are significantly lowered 8 14 days after denervation 18 82 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 59802 17584954 75327 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 mitochondrial ros has also been shown to lead to upregulation of the expression of ubiquitin ligase atrogin 1/mafbx 53 and could therefore contribute to atrophy through increased degradation of proteins by the 26s proteasome system. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49408 17634371 61548 20996 11179 SOD1 superoxide dismutase superoxide dismutase 0 0.0 in motor neurons overexpressing the amyotrophic lateral sclerosis als linked superoxide dismutase 1 sod1 mutation ngf induced apoptosis even in the absence of an external source of no. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49415 17634371 61557 22551 11892 TNF tumor necrosis factor tumor necrosis factor 0 0.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49416 17634371 61557 3889 11919 CD40 tumor necrosis factor receptor tumor necrosis factor receptor 0 0.0 ngf exerts its actions through two nonhomologous transmembrane receptors the tyrosine kinase receptor trka and the p75 neurotrophin receptor p75 . p75 is a member of the tumor necrosis factor receptor superfamily and can act as a death receptor signaling apoptosis in several neuronal populations barrett 2000 ; nykjaer et al. 2005 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49425 17634371 61587 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 motor neuron survival was maintained by the addition of glial cell line derived neurotrophic factor gdnf 1 ng/ml; sigma to the culture media. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 49429 17634371 61609 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 atcttgcctcctgctgtgtgatg 3' and 5' ggcttcaatgtcagggatgctttc 3' 153 bp ; glutamate cysteine ligase catalytic subunit gclc 5' atgaaagtggcacaggagcgag 3' and 5' aaacacgccttccttcccattg 3' 186 bp ; neuronal nitric oxide synthase nnos 5' ccacaccaacgggaatcaggag 3' and 5' tcctccagcacctccaccattg 3' 405 bp ; actin 5' catgaagatcctgaccgagcgtg 3' and 5' tctgctggaaggtggacagtgagg 3' 497 bp . p75 primers were from promega madison wi . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51662 17678953 64374 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 d in a final common pathway contributing to neuronal injury and death in a wide range of acute and chronic neurological disorders ranging from parkinson's disease pd amyotrophic lateral sclerosis als multiple sclerosis and alzheimer's disease ad to stroke and trauma. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 51664 17678953 64378 23469 20652 TXNDC15 disulfide isomerase disulfide isomerase 0 0.0 one such molecule affected is protein disulfide isomerase pdi an enzyme responsible for normal protein folding in the endoplasmic greticulum er . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51665 17678953 64382 19134 10417 RPS27A ubiquitin ubiquitin 0 0.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 51666 17678953 64382 18456 21148 RNF123 ubiquitin ligase ubiquitin ligase 0 0.0 another molecule whose s nitrosylation can lead to abnormal protein accumulation is the e3 ubiquitin ligase parkin which contributes to the pathogenesis of pd. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 40793 17719032 50852 20339 13448 SLC38A2 amino acid transporter 2 amino acid transporter 2 0 0.0 excitatory amino acid antagonists|excitatory amino acid transporter 2|glial fibrillary acidic protein|1 naphthylacetylspermine|spermine|sod1 g93a protein|superoxide dismutase| 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 37371 17956327 46603 9749 5294 HTR2B 5 ht 5 ht 0 1.0 other notable models of synaptic plasticity exhibit similar pattern sensitivity including hippocampal long term potentiation and 5 ht 5 hydroxytryptamine dependent intermediate term facilitation or ltf in aplysia [ 12 13 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37372 17956327 46610 9749 5294 HTR2B 5 ht 5 ht 0 1.0 our understanding of the cellular/synaptic mechanisms of ltf has increased dramatically in recent years particularly for ltf in phrenic motor output pltf . pltf requires 5 ht [ 6 15 ] as well as adrenergic receptor activation [ 16 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37373 17956327 46611 9749 5294 HTR2B 5 ht 5 ht 0 1.0 specifically 5 ht 2a receptor activation is necessary during but not following aih suggesting that 5 ht receptor activation is necessary for its induction but not maintenance [ 15 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37374 17956327 46612 9749 5294 HTR2B 5 ht 5 ht 0 1.0 localized cervical c4 injections of 5 ht receptor antagonists attenuate pltf without any effect on hypoglossal ltf suggesting that the relevant 5 ht receptors for pltf are located in or near the phrenic motor nucleus [ 17 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37375 17956327 46613 9749 5294 HTR2B 5 ht 5 ht 0 1.0 since 5 ht 2a receptors in this region are predominantly expressed on phrenic motor neurons [ 18 19 ] these results suggest that the relevant 5 ht receptors are located post synaptically on phrenic motor neurons. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37376 17956327 46614 9749 5294 HTR2B 5 ht 5 ht 0 1.0 similar localized mechanisms may give rise to hypoglossal ltf since 5 ht 2a receptors are localized to hypoglossal motor neurons [ 20 ] 5 ht 2a receptor activation is necessary for hypoglossal ltf [ 15 ] and episodic 5 ht 2 receptor activation elicits hypoglossal ltf in in vitro brainstem slice preparations via post synaptic mechanisms [ 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37377 17956327 46614 9749 5294 HTR2B 5 ht 5 ht 0 1.0 2a receptor activation is necessary for hypoglossal ltf [ 15 ] and episodic 5 ht 2 receptor activation elicits hypoglossal ltf in in vitro brainstem slice preparations via post synaptic mechanisms [ 11 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37380 17956327 46617 9749 5294 HTR2B 5 ht 5 ht 0 1.0 the 5 ht dependent increase in bdnf synthesis following aih is necessary for pltf expression since translational inhibition of bdnf mrna with sirnas small interfering rnas blocks both increased bdnf protein l 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37381 17956327 46619 9749 5294 HTR2B 5 ht 5 ht 0 1.0 in our current working cellular/synaptic model of pltf aih triggers episodic 5 ht release near phrenic motor neurons initiating pltf by activating dendritic 5 ht 2a receptors. 5 ht receptor activation initiates signalling cascades [e.g. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37386 17956327 46634 9749 5294 HTR2B 5 ht 5 ht 0 1.0 for example 5 ht induced intermediate term facilitation and ltf in aplysia which are normally elicited only by three to five episodic 5 ht exposures are elicited by a single 5 ht exposure with protein phosphatase 2b inhibition [ 30 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37388 17956327 46645 9749 5294 HTR2B 5 ht 5 ht 0 1.0 bition of okadaic acid sensitive protein phosphatases is not sufficient to facilitate phrenic motor output [ 22 ]. pltf following sustained hypoxia with spinal protein phosphatase inhibition requires 5 ht receptor activation suggesting that aih and sustained hypoxia with phosphatase inhibition represent the same mechanism [ 44 ]. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37396 17956327 46685 9749 5294 HTR2B 5 ht 5 ht 0 1.0 key words: brain derived neurotrophic factor bdnf 5 hydroxytryptamine 5 ht long term facilitation pattern sensitivity phosphorylation plasticity. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 37403 17956327 46686 9749 5294 HTR2B 5 ht 5 ht 0 1.0 abbreviations used: aih acute intermittent hypoxia; bdnf brain derived neurotrophic factor; erk extracellular signal regulated kinase; 5 ht 5 hydroxytryptamine; ltf long term facilitation; pltf phrenic ltf; pka protein kinase a; pkb protein kinase b; pkc protein kinase c; ros reactive oxygen species; sod superoxide dismutase; trkb tropom 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 22669 18210200 26873 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 in neurodegenerative diseases such as alzheimer_amp_#8217;s diseases ad parkinson_amp_#8217;s diseases pd and multiple sclerosis patients experience symptoms related to movement memory and dementia due to the gradual loss of neurons. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 22684 18210200 27089 1133 727 ARTN neurotrophic factor neurotrophic factor 0 0.0 these diseases would collectively benefit from immunomodulation neurotrophic factors such as glial derived neurotrophic factor or brain derived neurotrophic factor and in the case of hiv 1 disease anti retroviral therapy kabanov and gendelman 2007 . 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 23837 18219386 28381 19504 10604 SCO2 yeast homolog 2 yeast 2 0 1.0 it is puzzling why multiple earlier screens for sod1 interacting proteins including yeast 2 hybrid approaches did not identify rac1. 7 JUMiner_v2.2 2 2 UserEdit 0 0 0 1 1 0 0 0 15800 18308427 18634 551 399 ALB albumin albumin 0 0.0 g the method of brehe and burch 1976 with minor modifications. 200 _amp_#x3bc;l of 0.01n hcl was mixed with dtnb containing buffer 110 mm na 2 hpo 4 40 mm nah 2 po 4 15 mm edta 0.04% w/v bovine serum albumin bsa and 0.3 mm dtnb. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9666 18414597 11018 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9669 18414597 11021 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is an autoimmune inflammatory demyelinating condition of the cns. 7 JUMiner_v2.2 2 0 1 0 0 0 0 0 0 0 9763 18422522 11246 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 endothelial nitric oxide synthase overexpression by neuronal cells in neurodegeneration: a link between inflammation and neuroprotection. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 9765 18422522 11247 14535 7873 NOS2A nitric oxide synthase nitric oxide synthase 0 0.0 the roles of neuronal and inducible nitric oxide synthases in neurones have been extensively investigated; by contrast the biological significance of endothelial nitric oxide synthase enos overexpression that occurs in several pathological conditions has not yet been studied. 7 JUMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2050 18751914 3068 11942 21210 LPAL2 apolipoprotein apolipoprotein 0 0.0 apolipoprotein e is the principal cholesterol carrier protein in the brain and the gene encoding the variant apolipoprotein e4 is a significant risk factor for alzheimer's disease. 7 SciMiner_v2.2 2 0 0 0 0 0 0 0 0 0 2053 18751914 3064 13667 7314 MS multiple sclerosis multiple sclerosis 0 1.0 multiple sclerosis is an autoimmune inflammatory demyelinating condition of the cns. 7 SciMiner_v2.2 2 0 1 0 0 0 0 0 0 0