Document Information

PMID 19019231  (  )
Title Exercise training enhanced myocardial endothelial nitric oxide synthase (eNOS) function in diabetic Goto-Kakizaki (GK) rats.
Abstract BACKGROUND: Different mechanisms of diabetic-induced NO dysfunction have been proposed and central to most of them are significant changes in eNOS function as the rate-limiting step in NO bioavailability. eNOS exists in both monomeric and dimeric conformations, with the dimeric form catalyzing the synthesis of nitric oxide, while the monomeric form catalyzes the synthesis of superoxide (O2-). Diabetic-induced shifts to decrease the dimer:monomer ratio is thought to contribute to the degradation of nitric oxide (NO) bioavailability. Exercise has long been useful in the management of diabetes. Although exercise-induced increases expression of eNOS has been reported, it is unclear if exercise may alter the functional coupling of eNOS. METHODS: To investigate this question, Goto-Kakizaki rats (a model of type II diabetes) were randomly assigned to a 9-week running program (train) or sedentary (sed) groups. RESULTS: Exercise training significantly (p < .05) increased plantaris muscle cytochrome oxidase, significantly improved glycosylated hemoglobin (sed: 7.33 +/- 0.56%; train: 6.1 +/- 0.18%), ad improved insulin sensitivity. Exercise increased both total eNOS expression and the dimer:monomer ratio in the left ventricle LV (sed: 11.7 +/- 3.2%; train: 41.4 +/- 4.7%). Functional analysis of eNOS indicated that exercise induced significant increases in nitric oxide (+28%) production and concomitant decreases in eNOS-dependent superoxide (-12%) production. This effect was observed in the absence of tetrahydrobiopterin (BH4), but not in the presence of exogenous BH4. Exercise training also significantly decreased NADPH-dependent O2- activity. CONCLUSION: Exercise-induced increased eNOS dimerization resulted in an increased coupling of the enzyme to facilitate production of NO at the expense of ROS generation. This shift that could serve to decrease diabetic-related oxidative stress, which should serve to lessen diabetic-related complications.

NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.


Targets by SciMiner Summary

HUGO ID Symbol Target Name #Occur ActualStr
7876NOS3nitric oxide synthase 3 (endothelial cell)94eNOS | eNOS-driven | eNOS-dependent |
7872NOS1nitric oxide synthase 1 (neuronal)11NOS | nNOS |
6081INSinsulin9insulin |
132ACTBactin, beta8beta actin | beta-actin |
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)7alpha-MHC | alpha mhc | alphaMHC |
14874NOX5NADPH oxidase, EF-hand calcium binding domain 56nadph oxidase |
7889NOX1NADPH oxidase 15NOX1 | nadph oxidase 1 | NOX-dependent |
333AGTangiotensinogen (serpin peptidase inhibitor, clade A, member 8)4angiotensin ii | ang ii |
7873NOS2Anitric oxide synthase 2A (inducible, hepatocytes)3iNOS | nitric oxide synthase |
7660NCF1neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)3p47 |
4827HBBhemoglobin, beta2hemoglobin |
5157HPRT1hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)1HPRT |
2578CYBBcytochrome b-245, beta polypeptide (chronic granulomatous disease)1NOX2 |
391AKT1v-akt murine thymoma viral oncogene homolog 11Akt |
19986CYCScytochrome c, somatic1cytochrome c |
2707ACEangiotensin I converting enzyme (peptidyl-dipeptidase A) 11ACE |

 

Targets by SciMiner Full list

HUGO ID Symbol Name ActualStr Score FlankingText
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8and central to most of them are significant changes in eNOS function as the rate-limiting step in NO bioavailability eNOS exists
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8in eNOS function as the rate-limiting step in NO bioavailability eNOS exists in both monomeric and dimeric conformations with the dimeric
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Although exercise-induced increases expression of eNOS has been reported it is unclear if exercise may alter
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8is unclear if exercise may alter the functional coupling of eNOS
4827HBBhemoglobin, betahemoglobin0.3_amp_#x0003c .05 increased plantaris muscle cytochrome oxidase significantly improved glycosylated hemoglobin (sed: sed 7.33 _amp_#x000b1 0.56% train 6.1 _amp_#x000b1 0.18% ad
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Exercise increased both total eNOS expression and the dimer monomer ratio in the left ventricle
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Functional analysis of eNOS indicated that exercise induced significant increases in nitric oxide (+28%)
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS-dependent1.2in nitric oxide (+28%) 28% production and concomitant decreases in eNOS-dependent superoxide (-12%) -12% production
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Conclusion Exercise-induced increased eNOS dimerization resulted in an increased coupling of the enzyme to
4827HBBhemoglobin, betahemoglobin0.3without dietary changes resulted in a significant reduction in glycosylated hemoglobin (HbA HbA 1c increased insulin sensitivity improved blood lipid levels
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8These changes are thought to be the result of increased eNOS protein 5 6
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Several groups have reported that shear stress induces increases in eNOS expression 8 9
7872NOS1nitric oxide synthase 1 (neuronal)NOS2.0NO synthesis is governed by nitric oxide synthase (NOS) NOS
7872NOS1nitric oxide synthase 1 (neuronal)NOS2.0Three isoforms of NOS have been identified which are the products of three separate
7872NOS1nitric oxide synthase 1 (neuronal)NOS2.0identified which are the products of three separate genes endothelial NOS (eNOS), eNOS inducible NOS (iNOS), iNOS and neuronal NOS (nNOS)
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8are the products of three separate genes endothelial NOS (eNOS), eNOS inducible NOS (iNOS), iNOS and neuronal NOS (nNOS) nNOS
7872NOS1nitric oxide synthase 1 (neuronal)NOS2.0products of three separate genes endothelial NOS (eNOS), eNOS inducible NOS (iNOS), iNOS and neuronal NOS (nNOS) nNOS
7873NOS2Anitric oxide synthase 2A (inducible, hepatocytes)iNOS1.7three separate genes endothelial NOS (eNOS), eNOS inducible NOS (iNOS), iNOS and neuronal NOS (nNOS) nNOS
7872NOS1nitric oxide synthase 1 (neuronal)NOS2.0endothelial NOS (eNOS), eNOS inducible NOS (iNOS), iNOS and neuronal NOS (nNOS) nNOS
7872NOS1nitric oxide synthase 1 (neuronal)nNOS1.7(eNOS), eNOS inducible NOS (iNOS), iNOS and neuronal NOS (nNOS) nNOS
7872NOS1nitric oxide synthase 1 (neuronal)NOS2.0Structural domain studies of the NOS molecule have identified separate oxygenase and reductase domains 14
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Dimerization is a requirement for catalytic activity of eNOS although the truly active form is a complex that includes
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8The products catalyzed by eNOS are subject to complex regulation that we are just now
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8et.al demonstrated that exercise training was associated with increased myocardial eNOS levels and enhanced myocardial contractility 17
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8and central to most of them are significant changes in eNOS function as the rate-limiting step in NO bioavailability
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Several studies have reported decreased eNOS activity/protein activity protein levels in diabetic patients or animal models
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8The composition of the eNOS complex is critical for the relative formation of NO or
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8The mechanisms responsible for eNOS dysfunction remain unclear however a decrease in the dimer to
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8remain unclear however a decrease in the dimer to monomer eNOS ratio within the myocardium of diabetic animals has been reported
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Although exercise-induced increases in eNOS expression have been documented it is unclear if exercise may
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8unclear if exercise may also alter the functional coupling of eNOS
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8were exercise trained to test if chronic exercise could improve eNOS function and enhance NO bioavailability
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8to determine the ratio of dimerized and monomerized forms of eNOS with an increase in this ratio reflective increased coupling of
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8an increase in this ratio reflective increased coupling of the eNOS enzyme
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8For total eNOS determinations samples were mixed with Lamelli buffer heated to 95oC
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Antibodies used included eNOS (BD BD Transduction San Jose CA and alpha-MHC derived from
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)alpha-MHC0.5used included eNOS (BD BD Transduction San Jose CA and alpha-MHC derived from the BA-G5 cell line (ATCC, ATCC Manassas VA
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8The dimer monomer ratio calculated from band densities % Dimerized eNOS = dimer density/(dimer density dimer density monomer density *100
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Methods eNOS Activity eNOS enzyme activity was determined by fluorescence spectroscopy method
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Methods eNOS Activity eNOS enzyme activity was determined by fluorescence spectroscopy method using 2
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8SFM 25 spectrofluorometer (excitation excitation 365 nm emission 450 nm eNOS specific activity was the difference in fluorescence between CaCl 2
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.82 or 0.5 mM EGTA and the difference taken as eNOS specific activity
7872NOS1nitric oxide synthase 1 (neuronal)nNOS1.7Using 750 nM 7-nitroindazole (a a nNOS specific inhibitor preliminary experiments indicated that nNOS did not contribute
7872NOS1nitric oxide synthase 1 (neuronal)nNOS1.77-nitroindazole (a a nNOS specific inhibitor preliminary experiments indicated that nNOS did not contribute to left ventricular calcium-dependent NOS activity (data
7872NOS1nitric oxide synthase 1 (neuronal)NOS2.0indicated that nNOS did not contribute to left ventricular calcium-dependent NOS activity (data data not shown
7889NOX1NADPH oxidase 1NOX-dependent2.4uM lucigenin was determined as we have previously described 23 NOX-dependent activity was determined by the addition of 300 uM apocynin
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8activity was determined by the addition of 300 uM apocynin eNOS dependent superoxide activity was determined using dihydroethidium (DHE), DHE as
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS-driven1.2(DHE), DHE as described by Zhao et.al 24 To measure eNOS-driven superoxide activity separate solutions containing either 10 uM BH 4
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)alphaMHC0.3The following genes were studied alphaMHC (f;5'-CTACAAGCGCCAGGCTGAGG-3' f 5'-CTACAAGCGCCAGGCTGAGG-3' r 5'-GTGGGATAGCAACAGCGAGGC-3' NADPH Oxidase 1 (f; f
7660NCF1neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)p470.3r 5'-TTGAGTACCGCCGACAGCAT-3' NADPH Oxidase 2 (f; f 5'-TTGAGTGGTTCGCAGACCT-3' r 5'-GTTGGGCCGTCCATACAG-3' p47 (f; f 5'-ATCCCAACTACGCAGGTGAA-3' r 5'-TATCTCCTCCCCAGCCTTCT -3' GTP cyclohydrolase (f; f
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8r 5'-TATCTCCTCCCCAGCCTTCT -3' GTP cyclohydrolase (f; f 5'-AAGGGTCCATATTGGTTATCTTCCT-3' r 5'-ACACCTCGCATGACCATACA-3' eNOS (f; f 5'-GGCATACAGAACCCAGGATGG-3' r 5'-GCAGGCTGCAGTCCTTTGAT-3' beta-actin (f; f 5'-GCGGTGACCATAGCCCTCTTT-3' r
132ACTBactin, betabeta-actin1.3f 5'-AAGGGTCCATATTGGTTATCTTCCT-3' r 5'-ACACCTCGCATGACCATACA-3' eNOS (f; f 5'-GGCATACAGAACCCAGGATGG-3' r 5'-GCAGGCTGCAGTCCTTTGAT-3' beta-actin (f; f 5'-GCGGTGACCATAGCCCTCTTT-3' r 5'-TGCCACTCCCAAAGTAAAGGGTCA-3'
132ACTBactin, betabeta-actin1.3The data was normalized by _amp_#x00394 2Ct method using beta-actin and the fidelity of the reactions was verified by melting
132ACTBactin, betabeta-actin1.3the mean _amp_#x000b1 SEM with respect to sedentary control values beta-actin expression was compared to hypoxanthine phosphoribosyltransferase (HPRT) HPRT another housekeeping
5157HPRT1hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)HPRT0.9control values beta-actin expression was compared to hypoxanthine phosphoribosyltransferase (HPRT) HPRT another housekeeping gene and no differences were observed
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)alpha-MHC0.5previously reported that high intensity exercise will increase left ventricular alpha-MHC 21
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)alpha-MHC0.5training we did not observe a change in left ventricular alpha-MHC protein (sedentary; sedentary 100 _amp_#x000b1 6.2% Train 100 _amp_#x000b1 5.4%
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Results Exercise training has been reported to increase eNOS protein in different tissues 5 6
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8findings we observed a significant increase in left ventricular total eNOS (Figure Figure 2
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Dimerization of eNOS is required for the synthesis of NO and nitric oxide
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8and nitric oxide and a decrease in the dimer monomer eNOS ratio has been reported in diabetic myocardium 15
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8nonreducing conditions we found that the ratio of dimer monomer eNOS was also significantly increased by exercise training (Figure Figure 2
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8low temperature electrophoresis was performed the ratio of dimer monomer eNOS was compressed but still significantly increased (sed: sed 17.8 _amp_#x000b1
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8In most studies changes in eNOS have only been observed in those tissues undergoing exercise-induced increases
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8In the present study total kidney eNOS levels tended to be increased but a high level of
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8increase in the dimer monomer ratio was observed in the eNOS protein from kidney (sed: sed 12.0 _amp_#x000b1 1.7% train 20.7
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Thus exercise training increased dimerization of eNOS in both tissues
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Results Increased dimerization of the eNOS protein should shift its enzymatic activity towards improved NO generation
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8To examine this concept two in vitro determinations of eNOS function were made
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8the absence of exogenous BH 4 exercise training significantly increased eNOS activity compared to sedentary controls (Figure Figure 3A
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8of exogenous BH 4 to the reaction buffer significantly increased eNOS activity in both groups but canceled the differences between the
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS-driven1.2Determination of eNOS-driven superoxide generation found that in the absence of added BH
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS-driven1.2The addition of BH 4 to the reaction media decreased eNOS-driven superoxide generation in both groups and no difference between sedentary
7889NOX1NADPH oxidase 1NOX12.4However when expression of three subunits (NOX1, NOX1 NOX2 and p47 was examined no significant changes in the
2578CYBBcytochrome b-245, beta polypeptide (chronic granulomatous disease)NOX20.3However when expression of three subunits (NOX1, NOX1 NOX2 and p47 was examined no significant changes in the relative
7660NCF1neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)p470.3However when expression of three subunits (NOX1, NOX1 NOX2 and p47 was examined no significant changes in the relative mRNA levels
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8In contrast to increased levels of eNOS protein exercise training did cause a significant decrease in eNOS-mRNA
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Exercise-induced increases in tissue eNOS expression have been reported and our results in the heart
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8major finding of this study was that exercise training increased eNOS function in part by an increase in dimerization as one
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Exercise-induced increases in vascular eNOS protein have been known for sometime 5 6 33
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8it has been shown that exercise will also alter myocardial eNOS protein and phosphorylation status 17
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8They demonstrated that exercise increased myocardial NOx production eNOS protein levels and increased the sensitivity to insulin-stimulated phosphorylation of
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8protein levels and increased the sensitivity to insulin-stimulated phosphorylation of eNOS
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8The shift in eNOS phosphorylation (ser1179) ser1179 status was mediated through the Akt signaling
391AKT1v-akt murine thymoma viral oncogene homolog 1Akt0.0in eNOS phosphorylation (ser1179) ser1179 status was mediated through the Akt signaling pathway and resulted in enhanced myocardial contractility 17
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8phosphorylation status do not fully explain our findings of increased eNOS dimerization eNOS has 5 phosphorylation sites serines 116 617 635
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8do not fully explain our findings of increased eNOS dimerization eNOS has 5 phosphorylation sites serines 116 617 635 1179 and
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8phosphorylation of the serines 617 635 and 1179 will activate eNOS the Thr 497 phosphorylation appears to serve as an intrinsic
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8to serve as an intrinsic switch to enhance coupling of eNOS in favor of NO production at the expense of superoxide
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8of ser1179 was not required for correct intracellular localization 35 eNOS differs from iNOS and nNOS in that the former contains
7873NOS2Anitric oxide synthase 2A (inducible, hepatocytes)iNOS1.7not required for correct intracellular localization 35 eNOS differs from iNOS and nNOS in that the former contains the consensus sequences
7872NOS1nitric oxide synthase 1 (neuronal)nNOS1.7for correct intracellular localization 35 eNOS differs from iNOS and nNOS in that the former contains the consensus sequences for both
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Myristoylation is required for initial targeting of eNOS to the cell membrane while palmitoylation may stabilize the eNOS
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8eNOS to the cell membrane while palmitoylation may stabilize the eNOS membrane association 36 37
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Exercise improved the eNOS coupling state a shift that could serve to decrease diabetic-related
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Two in vitro determinations of eNOS function were made
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8by the addition of exogenous BH 4 to the reaction eNOS coupling was greater in the left ventricle from the exercise
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8that BH 4 may have been more tightly bound to eNOS in the trained group or eNOS had an increased sensitivity
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8more tightly bound to eNOS in the trained group or eNOS had an increased sensitivity to residual BH 4 producing a
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8increased sensitivity to residual BH 4 producing a shift in eNOS functional state
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.84 is both an anti-oxidant and an essential cofactor of eNOS and other members of the monooxygenase family 39
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8We have demonstrated that exercise training improved eNOS function when BH 4 may have been limiting
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8This suggests that chronic exercise enhanced eNOS function in part through altered BH 4 bioavailability
7660NCF1neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)p470.3Apocynin is thought to interfere with p47 activation of NAD(P)H NAD P H oxidase but more recently
2707ACEangiotensin I converting enzyme (peptidyl-dipeptidase A) 1ACE0.3II levels can be achieved with improved glucose handling or ACE inhibition 52 56
7889NOX1NADPH oxidase 1NOX2.4We did not observe changes in NOX 1 NOX 2 or p47-mRNA levels suggesting that altered expression
7889NOX1NADPH oxidase 1NOX2.4We did not observe changes in NOX 1 NOX 2 or p47-mRNA levels suggesting that altered expression was not
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Control of eNOS protein levels is a complex operation that is mediated on
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8a complex operation that is mediated on several levels including eNOS transcription mRNA stability and post-translational modifications
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8exercise training of diabetic animals lead to an increase in eNOS protein but also a decrease in eNOS-mRNA
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8others who found that in comparison to controls diabetes decreased eNOS protein but increased eNOS-mRNA 18 58
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8paradox may be explained in part by diabetic-induced decreases in eNOS function which activates compensatory mechanisms
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Drummond et.al demonstrated that exogenous H 2 O 2 increased eNOS transcription and eNOS-mRNA stability 60
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS-driven1.2Our observation that exercise training decreased both eNOS-driven and NADPH oxidase derived ROS should serve to lessen this
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8derived ROS should serve to lessen this driving force for eNOS transcription
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8known to serve as a negative feedback mechanism to decrease eNOS transcription via a cGMP-mediated pathway 62 63
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8have been the result of the decreased driving forces for eNOS transcription
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Figure 2 Exercise training increased eNOS protein levels and eNOS dimerization
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Figure 2 Exercise training increased eNOS protein levels and eNOS dimerization
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Figure 3 Exercise training enhances eNOS function in the absence of BH 4
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8A eNOS activity was measured using in the absence or present of
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS-dependent1.2B eNOS-dependent superoxide formation was measured as described in Methods
132ACTBactin, betabeta-actin1.3Data was normalized by the _amp_#x00394 2Ct method using beta-actin and the fidelity of the reactions (more more ...
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8induced alterations in the diabetic myocardium leading to improvements in eNOS function decrease in level or inhibition of function increase in
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Summary Regulation of eNOS function is showing itself to be an increasingly complex event
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8Exercise-induced increases in eNOS expression have been demonstrated in several reports as well as
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8demonstrated in several reports as well as exercise-induced shifts of eNOS phosphorylation status
7876NOS3nitric oxide synthase 3 (endothelial cell)eNOS7.8this study are that exercise at least partially reversed diabetic-induced eNOS dysfunction through increased dimerization leading to increased NO generation at
6081INSinsulininsulin1.0ignificantly p _amp_#x0003c; .05 increased plantaris muscle cytochrome oxidase significantly improved glycosylated hemoglobin sed: 7.33 _amp_#x000b1; 0.56%; train: 6.1 _amp_#x000b1; 0.18% ad improved insulin sensitivity.
6081INSinsulininsulin1.0exercise with and without dietary changes resulted in a significant reduction in glycosylated hemoglobin hba 1c increased insulin sensitivity improved blood lipid levels and lowered blood pressure [ 1 2 ].
7873NOS2Anitric oxide synthase 2A (inducible, hepatocytes)nitric oxide synthase1.0no synthesis is governed by nitric oxide synthase nos .
6081INSinsulininsulin1.0insulin was determined from plasma samples by elisa crystal chem downers grove il .
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)alpha mhc1.0antibodies used included enos bd transduction san jose ca and alpha mhc derived from the ba g5 cell line atcc manassas va .
14874NOX5NADPH oxidase, EF-hand calcium binding domain 5nadph oxidase1.0in brief lv was homogenized in ice cold buffer 20 mm hepes ph 7.4 0.1 mm edta 1 mm glutathione 10 um bh 4 1x proteinase inhibitor protein concentration was determined by the bradford method nadph oxidase activity using 5 um lucigenin was determined as we have previously described [ 23 ] nox dependent activity was determined by the addition of 300 um apocynin enos dependent superoxide activity was det
19986CYCScytochrome c, somaticcytochrome c1.0the rate of cytochrome c oxidation was followed at 550 nm _amp_#x003b5; = 21.0 mm 1 cm 1 using an ultrospec 3100 spectrophometer amersham biosciences piscataway nj .
132ACTBactin, betabeta actin1.0ctacgcaggtgaa 3'; r;5' tatctcctccccagccttct 3' gtp cyclohydrolase f; 5' aagggtccatattggttatcttcct 3' ; r; 5' acacctcgcatgaccataca 3' enos f; 5' ggcatacagaacccaggatgg 3'; r; 5' gcaggctgcagtcctttgat 3' beta actin f; 5' gcggtgaccatagccctcttt 3'; r; 5' tgccactcccaaagtaaagggtca 3' .
7889NOX1NADPH oxidase 1nadph oxidase 11.0the following genes were studied: alphamhc f;5' ctacaagcgccaggctgagg 3' ; r; 5' gtgggatagcaacagcgaggc 3' nadph oxidase 1 f; 5' tcctcactggctgggatagc 3' ; r; 5' ttgagtaccgccgacagcat 3' nadph oxidase 2 f; 5' ttgagtggttcgcagacct 3' ; r; 5' gttgggccgtccatacag 3' p47 f; 5' atcccaactacgcaggtgaa 3'; r;5' tatctcctccccagccttct 3
132ACTBactin, betabeta actin1.0the data was normalized by _amp_#x00394;2ct method using beta actin and the fidelity of the reactions was verified by melting point analysis.
132ACTBactin, betabeta actin1.0data presented are the mean _amp_#x000b1; sem with respect to sedentary control values. beta actin expression was compared to hypoxanthine phosphoribosyltransferase hprt another "housekeeping" gene and no differences were observed.
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)alpha mhc1.0we have previously reported that high intensity exercise will increase left ventricular alpha mhc [ 21 ].
7576MYH6myosin, heavy chain 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)alpha mhc1.0in the present study using a lower intensity of exercise training we did not observe a change in left ventricular alpha mhc protein sedentary; 100 _amp_#x000b1; 6.2% train; 100 _amp_#x000b1; 5.4% or alpha mhc mrna levels.
6081INSinsulininsulin1.0plasma insulin levels were determined prior to the start of the glucose tolerance test and after 120 minutes.
6081INSinsulininsulin1.0calculation of an insulin sensitivity index as described by matsuda and defronzo determined that exercise training significantly increased insulin sensitivity table 1 [ 25 ].
14874NOX5NADPH oxidase, EF-hand calcium binding domain 5nadph oxidase1.0exercise training also significantly decreased ventricular nadph oxidase activity figure 4 .
14874NOX5NADPH oxidase, EF-hand calcium binding domain 5nadph oxidase1.0in the presence of the nadph oxidase inhibitor apocynin nadph oxidase activity was significantly decreased only in the sedentary group and the differences between sedentary and trained groups were eliminated.
14874NOX5NADPH oxidase, EF-hand calcium binding domain 5nadph oxidase1.0results the apparent shift in nadph oxidase activity suggests that this enzyme complex is either less active or that exercise decreased expression of the constitutive subunits.
6081INSinsulininsulin1.0exercise lowers hba 1c increases insulin sensitivity improves blood lipid levels and lowers blood pressure in diabetic individuals [ 1 2 ].
6081INSinsulininsulin1.0the etiology of the gk rats is unknown but it has been suggested that impaired pancreatic mitochondrial function may partially explain the depressed insulin release [ 27 ].
6081INSinsulininsulin1.0they demonstrated that exercise increased myocardial nox production enos protein levels and increased the sensitivity to insulin stimulated phosphorylation of enos.
333AGTangiotensinogen (serpin peptidase inhibitor, clade A, member 8)ang ii1.0plasma levels of angiotensin ii ang ii are elevated in diabetics with poor glucose control and in untreated diabetic animal models [ 52 55 ].
333AGTangiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensin ii1.0plasma levels of angiotensin ii ang ii are elevated in diabetics with poor glucose control and in untreated diabetic animal models [ 52 55 ].
333AGTangiotensinogen (serpin peptidase inhibitor, clade A, member 8)ang ii1.0conversely normalization of ang ii levels can be achieved with improved glucose handling or ace inhibition [ 52 56 ].
333AGTangiotensinogen (serpin peptidase inhibitor, clade A, member 8)ang ii1.0chronically elevated ang ii levels are associated with increased expression of nad p h oxidase components and oxidative stress [ 56 ].
14874NOX5NADPH oxidase, EF-hand calcium binding domain 5nadph oxidase1.0we did not observe changes in nox 1 nox 2 or p47 mrna levels suggesting that altered expression was not influenced by training and that a shift in the activation of nadph oxidase may have had a greater role in the observed improvements.
14874NOX5NADPH oxidase, EF-hand calcium binding domain 5nadph oxidase1.0our observation that exercise training decreased both enos driven and nadph oxidase derived ros should serve to lessen this driving force for enos transcription.
132ACTBactin, betabeta actin1.0data was normalized by the _amp_#x00394;2ct method using beta actin and the fidelity of the reactions more ...
6081INSinsulininsulin1.0improvements derived from increased insulin sensitivity are more ...