SciMiner Result Report Page

Document Information

PMID	17977949 ( )
Title	Attenuation of interstitial fibrosis and tubular apoptosis in db/db transgenic mice overexpressing catalase in renal proximal tubular cells.
Abstract	OBJECTIVE: The present study investigated the relationships between reactive oxygen species (ROS), interstitial fibrosis, and renal proximal tubular cell (RPTC) apoptosis in type 2 diabetic db/db mice and in db/db transgenic (Tg) mice overexpressing rat catalase (rCAT) in their RPTCs (db/db rCAT-Tg). RESEARCH DESIGN AND METHODS: Blood pressure, blood glucose, and albuminuria were monitored for up to 5 months. Kidneys were processed for histology and apoptosis studies (terminal transferase-mediated dUTP nick-end labeling or immunostaining for active caspase-3 and Bax). Real-time quantitative PCR assays were used to quantify angiotensinogen (ANG), p53, and Bax mRNA levels. RESULTS: db/db mice developed obesity, hyperglycemia, hypertension, and albuminuria. In contrast, db/db rCAT-Tg mice became obese and hyperglycemic but had normal blood pressure and attenuated albuminuria compared with db/db mice. Kidneys from db/db mice displayed progressive glomerular hypertrophy, glomerulosclerosis, interstitial fibrosis, and tubular apoptosis and increased expression of collagen type IV, Bax, and active caspase-3, as well as increased ROS production. These changes, except glomerular hypertrophy, were markedly attenuated in kidneys of db/db rCAT-Tg mice. Furthermore, ANG, p53, and Bax mRNA expression was increased in renal proximal tubules of db/db mice but not of db/db rCAT-Tg mice. CONCLUSIONS: Our results indicate a crucial role for intra-renal ROS in the progression of hypertension, albuminuria, interstitial fibrosis, and tubular apoptosis in type 2 diabetes and demonstrate the beneficial effects of suppressing ROS formation. (CHUM) Hotel-Dieu, Research Centre, Pavillon Masson, 3850 Saint Urbain St., Montreal, Quebec, Canada.

NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.

Targets by SciMiner Summary

HUGO ID	Symbol	Target Name	#Occur	ActualStr
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	27	angiotensinogen \| ang ii \| Ang \| ANG \|
1516	CAT	catalase	17	CAT \| catalase \|
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	15	caspase 3 \|
11998	TP53	tumor protein p53	12	p53 \|
2197	COL1A1	collagen, type I, alpha 1	9	collagen \|
6554	LEPR	leptin receptor	8	leptin receptor \|
399	ALB	albumin	6	albumin \|
11766	TGFB1	transforming growth factor, beta 1	4	TGF-B \| TGF-B1 \|
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	3	nadph oxidase \|
11076	SLC9A3R2	solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2	2	sodium/hydrogen exchanger \|
2983	DNTT	deoxynucleotidyltransferase, terminal	2	terminal transferase \|
6081	INS	insulin	2	insulin \|
2202	COL4A1	collagen, type IV, alpha 1	2	collagen iv \|
7660	NCF1	neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)	2	p47 \|
2578	CYBB	cytochrome b-245, beta polypeptide (chronic granulomatous disease)	1	Nox2 \|
9958	REN	renin	1	renin \|
11765	TGFA	transforming growth factor, alpha	1	transforming growth factor \|
7891	NOX4	NADPH oxidase 4	1	Nox4 \|

Targets by SciMiner Full list

HUGO ID	Symbol	Name	ActualStr	Score	FlankingText
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	Real-time quantitative PCR assays were used to quantify angiotensinogen (ANG), ANG p53 and Bax mRNA levels
11998	TP53	tumor protein p53	p53	3.6	quantitative PCR assays were used to quantify angiotensinogen (ANG), ANG p53 and Bax mRNA levels
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	glomerulosclerosis interstitial fibrosis and tubular apoptosis and increased expression of collagen type IV Bax and active caspase-3 as well as increased
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	Furthermore ANG p53 and Bax mRNA expression was increased in renal proximal
11998	TP53	tumor protein p53	p53	3.6	Furthermore ANG p53 and Bax mRNA expression was increased in renal proximal tubules
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	Ang	2.8	Ang II stimulates ROS generation via heightened NADPH oxidase activity in
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	that high glucose evokes ROS generation and enhances angiotensinogen (ANG) ANG (the the sole substrate of RAS gene expression in rat
1516	CAT	catalase	CAT	2.3	The present study investigated whether catalase (CAT) CAT overexpression in RPTCs attenuates the high-glucose action on interstitial fibrosis
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	attenuates the high-glucose action on interstitial fibrosis and tubular apoptosis ANG and proapoptotic gene (p53, p53 Bax and caspase-3 expression in
11998	TP53	tumor protein p53	p53	3.6	interstitial fibrosis and tubular apoptosis ANG and proapoptotic gene (p53, p53 Bax and caspase-3 expression in type 2 diabetic db/db db
1516	CAT	catalase	CAT	2.3	Rabbit polyclonal antibodies against bovine CAT and monoclonal antibodies against B-actin were purchased from Sigma-Aldrich Canada
1516	CAT	catalase	CAT	2.3	The relative densities of CAT and B-actin bands were quantified by computerized laser densitometry (ImageQuant
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	Ang	2.8	used in real-time quantitative PCR to quantify the amount of Ang p53 and Bax mRNA expressed in mRPTs as described previously
11998	TP53	tumor protein p53	p53	3.6	in real-time quantitative PCR to quantify the amount of Ang p53 and Bax mRNA expressed in mRPTs as described previously (
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	The forward and reverse primers corresponding to ANG (NM_007428 NM_007428 forward 5'-ACAGACACCGAGATGCTGTT-3' and reverse 5'-CCACGCTCTCTGGATTTATC-3' p53 (AB020317 AB020317
11998	TP53	tumor protein p53	p53	3.6	corresponding to ANG (NM_007428 NM_007428 forward 5'-ACAGACACCGAGATGCTGTT-3' and reverse 5'-CCACGCTCTCTGGATTTATC-3' p53 (AB020317 AB020317 forward 5' TGATGGAGA GTATTTCACCC-3' and reverse 5'-GGGCATCCTTTAACTCTAAG-3' Bax
1516	CAT	catalase	CAT	2.3	To investigate whether CAT can attenuate kidney injury in type 2 diabetic db/db db
1516	CAT	catalase	CAT	2.3	The CAT transgene and the mutated insulin-2 gene were expressed in kidneys
1516	CAT	catalase	CAT	2.3	CAT protein expression (assessed assessed by Western blotting was at least
1516	CAT	catalase	CAT	2.3	Likewise immunostaining for CAT and ROS generation were higher in RPTCs of db/db db
1516	CAT	catalase	CAT	2.3	db db mice indicating that attenuation of ROS generation by CAT can prevent development of hypertension in db/db db db mice
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	Indeed we have previously reported that Tg mice overexpressing ANG in their RPTCs do develop hypertension ( 32
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	Furthermore our present data show that ANG mRNA expression is threefold higher in RPTs from db/db db
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	Furthermore ECM protein and collagen expression were attenuated in the kidneys of db/db db db
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	By using immunostaining we also detected enhanced collagen type IV expression in glomeruli and tubulointerstitial spaces in db/db
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	Surprisingly collagen type IV expression was completely normalized in db/db db db
1516	CAT	catalase	CAT	2.3	db/db db db mice actually induces tubular apoptosis and that CAT overexpression can at least partially prevent it
11998	TP53	tumor protein p53	p53	3.6	db mice exhibited markedly elevated expression of the proapoptotic genes p53 and Bax
11998	TP53	tumor protein p53	p53	3.6	Our observations that Bax and p53 mRNA expression was considerably lower in db/db db db rCAT-Tg
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	One possibility is that ROS stimulate ANG production and activate the intrarenal RAS as RPTCs express all
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	Ang	2.8	Ang II promotes sodium reabsorption via stimulation of sodium/hydrogen sodium hydrogen
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	Ang	2.8	Furthermore Ang II is capable of stimulating transforming growth factor-B 1 (TGF-B1)
11766	TGFB1	transforming growth factor, beta 1	TGF-B1	1.7	II is capable of stimulating transforming growth factor-B 1 (TGF-B1) TGF-B1 and subsequently enhancing ECM protein collagen type IV and proapoptotic
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	growth factor-B 1 (TGF-B1) TGF-B1 and subsequently enhancing ECM protein collagen type IV and proapoptotic genes in RPTCs leading to tubular
11766	TGFB1	transforming growth factor, beta 1	TGF-B	1.2	Indeed neutralization of TGF-B alleviated fibrosis in diabetic animal models including db/db db db
11766	TGFB1	transforming growth factor, beta 1	TGF-B1	1.7	Moreover TGF-B1 was reported to promote apoptosis after renal injury in both
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	We have previously found that intrarenal ANG gene expression is essential for TGF-B1 gene expression in rat
11766	TGFB1	transforming growth factor, beta 1	TGF-B1	1.7	previously found that intrarenal ANG gene expression is essential for TGF-B1 gene expression in rat RPTCs exposed to high glucose in
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	glucose in vitro ( 47 and that Tg mice overexpressing ANG in RPTCs exhibit hypertension and albuminuria ( 32
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	Our present data showed at least threefold higher ANG mRNA expression in RPTs of db/db db db mice and
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	in RPTs of db/db db db mice and normalization of ANG mRNA expression in db/db db db rCAT-Tg mice
2578	CYBB	cytochrome b-245, beta polypeptide (chronic granulomatous disease)	Nox2	1.0	diabetes is associated with enhanced expression of NADPH oxidase subunits Nox2 Nox4 and p47 mRNA and p47 in mouse glomeruli (
7891	NOX4	NADPH oxidase 4	Nox4	0.9	is associated with enhanced expression of NADPH oxidase subunits Nox2 Nox4 and p47 mRNA and p47 in mouse glomeruli ( 49
7660	NCF1	neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)	p47	0.8	with enhanced expression of NADPH oxidase subunits Nox2 Nox4 and p47 mRNA and p47 in mouse glomeruli ( 49 indicating that
7660	NCF1	neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)	p47	0.8	of NADPH oxidase subunits Nox2 Nox4 and p47 mRNA and p47 in mouse glomeruli ( 49 indicating that these NADPH oxidase
1516	CAT	catalase	CAT	2.3	In summary the present study suggest a critical role for CAT in attenuating hypertension albuminuria interstitial fibrosis and RPTC apoptosis in
1516	CAT	catalase	CAT	2.3	C Immunohistochemical staining of CAT in male non-Tg and Tg mouse kidneys using rabbit anti-CAT
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	Masson's trichrome staining ( A -D and immunostaining for collagen IV ( E -H in male non-Tg and Tg mouse
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	ECM components accumulation (Masson's Masson's trichrome staining ( a and collagen IV deposition ( b
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	Ang	2.8	Expression of Ang Bax and p53 mRNA in RPTs of non-Tg and Tg
11998	TP53	tumor protein p53	p53	3.6	Expression of Ang Bax and p53 mRNA in RPTs of non-Tg and Tg mice quantified by
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	from non-Tg and Tg mice were isolated and assayed for ANG ( A Bax ( B and p53 ( C mRNA
11998	TP53	tumor protein p53	p53	3.6	and assayed for ANG ( A Bax ( B and p53 ( C mRNA
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	The relative densities of ANG Bax and p53 mRNA were normalized with B-actin mRNA control
11998	TP53	tumor protein p53	p53	3.6	The relative densities of ANG Bax and p53 mRNA were normalized with B-actin mRNA control
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	ANG Bax and p53 mRNA levels in db/m db m mice
11998	TP53	tumor protein p53	p53	3.6	ANG Bax and p53 mRNA levels in db/m db m mice were considered as
1516	CAT	catalase	CAT	2.3	CAT protein expression in the RPTs of db/db db db rCAT-Tg
1516	CAT	catalase	CAT	2.3	and db/db db db rCAT-Tg was documented by immunostaining of CAT in mouse kidneys ( Fig 1 C
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	expression of collagenous components ( Fig 5 A and immunoreactive collagen type IV ( Fig 5 B in db/db db db
2197	COL1A1	collagen, type I, alpha 1	collagen	1.2	Once again staining for collagenous components and immunostaining for collagen type IV were normalized in db/db db db rCAT-Tg mouse
1516	CAT	catalase	CAT	2.3	Next we investigated whether CAT overexpression could prevent apoptosis induced by hyperglycemia in mouse RPTCs
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	ANG and proapoptotic gene mRNA expression in mouse RPTs
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ANG	2.8	Expression of ANG mRNA ( Fig 8 A Bax mRNA ( Fig 8
11998	TP53	tumor protein p53	p53	3.6	Fig 8 A Bax mRNA ( Fig 8 B and p53 mRNA ( Fig 8 C was significantly elevated in RPTs
1516	CAT	catalase	catalase	1.0	relationships between reactive oxygen species ros interstitial fibrosis and renal proximal tubular cell rptc apoptosis in type 2 diabetic db/db mice and in db/db transgenic tg mice overexpressing rat catalase rcat in their rptcs db/db rcat tg .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	kidneys were processed for histology and apoptosis studies terminal transferase mediated dutp nick end labeling or immunostaining for active caspase 3 and bax .
2983	DNTT	deoxynucleotidyltransferase, terminal	terminal transferase	1.0	kidneys were processed for histology and apoptosis studies terminal transferase mediated dutp nick end labeling or immunostaining for active caspase 3 and bax .
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	angiotensinogen	1.0	real time quantitative pcr assays were used to quantify angiotensinogen ang p53 and bax mrna levels.
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	kidneys from db/db mice displayed progressive glomerular hypertrophy glomerulosclerosis interstitial fibrosis and tubular apoptosis and increased expression of collagen type iv bax and active caspase 3 as well as increased ros production.
6081	INS	insulin	insulin	1.0	multiple factors have been implicated in the pathogenesis of diabetic nephropathy including hyperglycemia hypertension insulin resistance and oxidative stress 4 .
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ang ii	1.0	ang ii stimulates ros generation via heightened nadph oxidase activity in various renal cell types whereas antioxidants provide renal protection in part by ameliorating oxidative stress 8 11 .
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	nadph oxidase	1.0	ang ii stimulates ros generation via heightened nadph oxidase activity in various renal cell types whereas antioxidants provide renal protection in part by ameliorating oxidative stress 8 11 .
9958	REN	renin	renin	1.0	such data strongly indicate a link between ros renin angiotensin system ras activation and renal cell apoptosis in diabetes.
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	angiotensinogen	1.0	we have reported previously that high glucose evokes ros generation and enhances angiotensinogen ang the sole substrate of ras gene expression in rat rptcs 29 .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	the present study investigated whether catalase cat overexpression in rptcs attenuates the high glucose action on interstitial fibrosis and tubular apoptosis ang and proapoptotic gene p53 bax and caspase 3 expression in type 2 diabetic db/db mice in vivo.
1516	CAT	catalase	catalase	1.0	the present study investigated whether catalase cat overexpression in rptcs attenuates the high glucose action on interstitial fibrosis and tubular apoptosis ang and proapoptotic gene p53 bax and caspase 3 expression in type 2 diabetic db/db mice
1516	CAT	catalase	catalase	1.0	for this purpose we created db/db transgenic tg mice overexpressing rat catalase rcat in rptcs db/db rcat tg by cross breeding heterozygous db/m mice with our established homozygous tg mice overexpressing rcat in rptcs 24 .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	anti cleaved caspase 3 polyclonal antibody anti bax polyclonal antibody and monoclonal anti collagen type iv antibody were obtained from new england biolabs pickering on canada santa cruz biotechnologies santa cruz ca and
6554	LEPR	leptin receptor	leptin receptor	1.0	homozygous db/db rcat tg mice were identified by the pcr of genomic dna for the rcat transgene 24 and the mutated leptin receptor gene 31 .
6554	LEPR	leptin receptor	leptin receptor	1.0	gccgcatggcggacagccgggaccc 3' and the ha a tag sequence encoding amino acid residues 98 106 [ypydvpdya] of human influenza virus hemagglutinin anti sense primer 5' ggcgtagtcaggcacgtcgt 3' 32 the mouse leptin receptor gene forward primer 5' agaacggacactctttgaagtctc 3' and the reverse primer 5' cattcaaaccatagtttaggtttgtgt 3' of the mouse leptin receptor gene 31 respectively were used for pcr.
6554	LEPR	leptin receptor	leptin receptor	1.0	gene forward primer 5' agaacggacactctttgaagtctc 3' and the reverse primer 5' cattcaaaccatagtttaggtttgtgt 3' of the mouse leptin receptor gene 31 respectively were used for pcr.
6554	LEPR	leptin receptor	leptin receptor	1.0	the dna fragment 135 bp of mouse leptin receptor gene was then digested with the restriction enzyme rsa i for 1 h at 37degreec.
2983	DNTT	deoxynucleotidyltransferase, terminal	terminal transferase	1.0	terminal transferase mediated dutp nick end labeling assay and immunohistochemical staining.
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	tion was performed by the standard avidin biotin peroxidase complex method abc staining system; santa cruz biotechnologies 24 32 using primary anti cat polyclonal antibody 1:500 dilution anti cleaved caspase 3 polyclonal antibody 1:50 dilution anti collagen type iv monoclonal antibody 1:50 dilution or anti bax polyclonal antibody 1:50 dilution .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	the percentage of rptcs that stained positive on tunel assay and active caspase 3 and bax immunostaining was estimated quantitatively as previously described 24 .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	the number of rptcs containing tunel positive active caspase 3 or bax staining was divided by the total number of rptcs counted and multiplied by 100 to calculate the percentage of positively stained rptcs.
6554	LEPR	leptin receptor	leptin receptor	1.0	figure 1 a presents data from the specific pcr analysis of the rcat ha transgene and mutated leptin receptor gene in offspring of the rcat tg line 688 crossbred with heterozygous db/m mice.
6554	LEPR	leptin receptor	leptin receptor	1.0	animals displaying rcat ha transgene and the mutated leptin receptor gene were used in subsequent experiments.
6081	INS	insulin	insulin	1.0	the cat transgene and the mutated insulin 2 gene were expressed in kidneys of homozygous db/db cat tg mice.
399	ALB	albumin	albumin	1.0	since microalbuminuria is an important clinical marker for the early detection of hypertension or diabetes induced nephropathy we monitored urinary albuminuria using the albumin to creatinine ratio.
399	ALB	albumin	albumin	1.0	overexpression of rcat in female db/db mice was however more effective in lowering the albumin to creatinine ratio than in male db/db mice.
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	indeed active caspase 3 and bax expression was normalized in db/db rcat tg mice.
11076	SLC9A3R2	solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2	sodium/hydrogen exchanger	1.0	ang ii promotes sodium reabsorption via stimulation of sodium/hydrogen exchanger activity in rptcs 42 ultimately leading to development of hypertension.
11076	SLC9A3R2	solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2	sodium/hydrogen exchanger	1.0	ang ii promotes sodium reabsorption via stimulation of sodium/hydrogen exchanger activity in rptcs 42 ultimately leading to development of hypertension.
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ang ii	1.0	ang ii promotes sodium reabsorption via stimulation of sodium/hydrogen exchanger activity in rptcs 42 ultimately leading to development of hypertension.
333	AGT	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	ang ii	1.0	furthermore ang ii is capable of stimulating transforming growth factor b 1 tgf b1 and subsequently enhancing ecm protein collagen type iv and proapoptotic genes in rptcs leading to tubular injury interstitial fibrosis
11765	TGFA	transforming growth factor, alpha	transforming growth factor	1.0	furthermore ang ii is capable of stimulating transforming growth factor b 1 tgf b1 and subsequently enhancing ecm protein collagen type iv and proapoptotic genes in rptcs leading to tubular injury interstitial fibrosis and cellular apoptosis 43 .
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	nadph oxidase	1.0	among these sources mitochondrial 29 and membrane bound nadph oxidase derived 48 ros production have already been reported.
14874	NOX5	NADPH oxidase, EF-hand calcium binding domain 5	nadph oxidase	1.0	interestingly diabetes is associated with enhanced expression of nadph oxidase subunits nox2 nox4 and p47 mrna and p47 in mouse glomeruli 49 indicating that these nadph oxidase subunits might be involved in ros production in rpts.
6554	LEPR	leptin receptor	leptin receptor	1.0	specific pcr analysis of rcat ha transgene and mutated leptin receptor gene in offspring of rcat tg line 688 cross bred with heterozygous db/m mice.
6554	LEPR	leptin receptor	leptin receptor	1.0	animals displaying rcat ha transgene and mutated leptin receptor gene were used in subsequent experiments.
399	ALB	albumin	albumin	1.0	changes in mean blood pressure a and mean albumin microg to creatinine mg ratios b in male and female non tg and tg mice from 8 to 20 weeks. db/m mice; db/m rcat tg mice; _amp_#149; db/db mice; db/db rcat tg mice.
2202	COL4A1	collagen, type IV, alpha 1	collagen iv	1.0	masson's trichrome staining a d and immunostaining for collagen iv e h in male non tg and tg mouse kidneys at week 20.
2202	COL4A1	collagen, type IV, alpha 1	collagen iv	1.0	i : quantification of ecm components accumulation masson's trichrome staining a and collagen iv deposition b .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	immunohistochemical staining of alpha active caspase 3 and bax in male non tg and tg mouse kidneys at week 20 using rabbit anti alpha active caspase 3 and anti bax polyclonal antibodies respectively.
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	a : alpha active caspase 3 immunostaining a d .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	c : quantitative analysis of active caspase 3 and bax positive rptcs from male non tg and tg mouse kidneys at week 20.
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	immunostained active caspase 3 a and bax b .
399	ALB	albumin	albumin	1.0	slight increases in the 24 h urinary albumin to creatinine ratio were detectable in both male and female db/db and db/db rcat tg mice after week 16 compared with db/m and db/m rcat tg mice respectively fig 3 b .
399	ALB	albumin	albumin	1.0	however the albumin to creatinine ratio at week 16 did not differ significantly in both male and female db/db and db/db rcat tg.
399	ALB	albumin	albumin	1.0	in sharp contrast the 24 h urinary albumin to creatinine ratio was significantly decreased p 0.05 at 18 weeks in both male and female db/db rcat tg mice compared with db/db mice.
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	markedly elevated active caspase 3 expression was detected in rptcs from db/db mice fig 7 a c but not in db/m db/m rcat tg or db/db rcat tg mice fig 7 a a b and d .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	these observations were confirmed by quantitation of the immunostaining of active caspase 3 and bax fig 7 c .
1504	CASP3	caspase 3, apoptosis-related cysteine peptidase	caspase 3	1.0	importantly active caspase 3 and bax immunostaining were significantly attenuated in db/db rcat tg mice.