)| PMID |
17023526 ( ) |
|---|---|
| Title | Vascular lipotoxicity: endothelial dysfunction via fatty-acid-induced reactive oxygen species overproduction in obese Zucker diabetic fatty rats. |
| Abstract | Vascular endothelial dysfunction has been demonstrated in obesity, but the molecular basis for this link has not been clarified. We examined the role of free fatty acids (FFA) on vascular reactivity in the obese fa/fa Zucker diabetic fatty (ZDF) rat. Addition of acetylcholine produced a dose-dependent relaxation in aortic rings of ZDF and lean +/+ rats, but the ED(50) value was higher in ZDF (-6.80 +/- 0.05 vs. -7.11 +/- 0.05 log(10) mol/liter, P = 0.033). A 2-wk treatment with a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, pitavastatin (3 mg/kg/d) or a reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitor, apocynin (5 mmol/liter in drinking water), improved the response in ZDF (ED(50), -7.16 +/- 0.03 and -7.14 +/- 0.05 log(10) mol/liter, P = 0.008 and P = 0.015 vs. vehicle, respectively). Vasodilator response to sodium nitroprusside was identical between ZDF and +/+ rats. Vascular reactive oxygen species (ROS) levels and NADPH oxidase activity in aorta were increased in ZDF rats but were decreased by pitavastatin. In in vitro cell culture, intracellular ROS signal and NADPH oxidase subunit mRNA were increased by palmitate, but this palmitate-induced ROS production was inhibited by NADPH oxidase inhibitor or pitavastatin. In conclusion, FFA-induced NADPH oxidase subunit overexpression and ROS production could be involved in the endothelial dysfunction seen in obese ZDF rats, and this could be protected by pitavastatin or NADPH oxidase inhibitors. the Ryukyus, Nishihara, Okinawa 903-0215, Japan. |
NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.
Targets by SciMiner Summary
| HUGO ID | Symbol | Target Name | #Occur | ActualStr |
|---|---|---|---|---|
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | 33 | nadph oxidase | |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | 16 | p47phox | |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | 13 | endothelial nitric oxide synthase | eNOS | |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | 8 | p67phox | |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | 8 | Nox2 | gp91phox | |
| 6081 | INS | insulin | 8 | insulin | |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | 8 | p22phox | |
| 391 | AKT1 | v-akt murine thymoma viral oncogene homolog 1 | 6 | Rac | |
| 7662 | NCF4 | neutrophil cytosolic factor 4, 40kDa | 6 | p40phox | |
| 11416 | STN | statin | 6 | statin | |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | 6 | GAPDH | glyceraldehyde 3 phosphate dehydrogenase | |
| 13633 | ADIPOQ | adiponectin, C1Q and collagen domain containing | 4 | adiponectin | |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | 4 | TNF-alpha | tnf alpha | |
| 5006 | HMGCR | 3-hydroxy-3-methylglutaryl-Coenzyme A reductase | 3 | 3 hydroxy 3 methylglutaryl coenzyme a reductase | |
| 12517 | UCP1 | uncoupling protein 1 (mitochondrial, proton carrier) | 2 | uncoupling protein 1 | UCP-1 | |
| 9393 | PRKCA | protein kinase C, alpha | 2 | protein kinase c | |
| 2328 | CPT1A | carnitine palmitoyltransferase 1A (liver) | 1 | carnitine palmitoyltransferase i | |
| 6554 | LEPR | leptin receptor | 1 | leptin receptor | |
| 30000 | BBS9 | Bardet-Biedl syndrome 9 | 1 | C-18 | |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | 1 | angiotensin ii | |
| 336 | AGTR1 | angiotensin II receptor, type 1 | 1 | AT1R | |
Targets by SciMiner Full list
| HUGO ID | Symbol | Name | ActualStr | Score | FlankingText |
|---|---|---|---|---|---|
| 30000 | BBS9 | Bardet-Biedl syndrome 9 | C-18 | 0.3 | 8-epi-prostaglandin-F 2 alpha (8-epi-PGF 8-epi-PGF 2 alpha was extracted on C-18 SPE cartridges (Waters Waters Corp. Milford MA and assayed by |
| 13633 | ADIPOQ | adiponectin, C1Q and collagen domain containing | adiponectin | 2.5 | Plasma levels of adiponectin (Otsuka Otsuka Pharmaceutical Co. Ltd Tokyo Japan and TNF-alpha (JIMRO |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 0.5 | of adiponectin (Otsuka Otsuka Pharmaceutical Co. Ltd Tokyo Japan and TNF-alpha (JIMRO JIMRO Co. Ltd. Takasaki Gunma Japan were measured by |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | For immunoprecipitation the primary antibodies endothelial nitric oxide synthase (eNOS) eNOS or p47phox were used at a 1 1000 dilution in |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | the primary antibodies endothelial nitric oxide synthase (eNOS) eNOS or p47phox were used at a 1 1000 dilution in 5% nonfat |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | 2 h followed by a 20-min incubation in anti-phosphotyrosine (eNOS) eNOS or anti-phosphoserine (p47phox) p47phox antibody diluted in blocking buffer |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | a 20-min incubation in anti-phosphotyrosine (eNOS) eNOS or anti-phosphoserine (p47phox) p47phox antibody diluted in blocking buffer |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | ratio of anti-phosphotyrosine or anti-phosphoserine blot intensity to those of eNOS or p47phox blot intensity was used to represent the enzyme |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | anti-phosphotyrosine or anti-phosphoserine blot intensity to those of eNOS or p47phox blot intensity was used to represent the enzyme catalytic activities |
| 7662 | NCF4 | neutrophil cytosolic factor 4, 40kDa | p40phox | 1.3 | follows p22phox (GenBank GenBank NM_000101 forward ATTACTATGTTCGGGCCGTCCT and reverse GGTAGATGCCGCTCGCAAT p40phox (NM_000631 NM_000631 forward ATGCGGATACCTGCCCTCAA and reverse CTCTGAGTCATAGGGCGACTGGTAA p47phox (NM_000265 NM_000265 |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | reverse GGTAGATGCCGCTCGCAAT p40phox (NM_000631 NM_000631 forward ATGCGGATACCTGCCCTCAA and reverse CTCTGAGTCATAGGGCGACTGGTAA p47phox (NM_000265 NM_000265 forward GATGCCCAAAGATGGCAAGAGTA and reverse GCTTTCATCTGACAGAACCACCAA p67phox (NM_000433 NM_000433 |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | reverse CTCTGAGTCATAGGGCGACTGGTAA p47phox (NM_000265 NM_000265 forward GATGCCCAAAGATGGCAAGAGTA and reverse GCTTTCATCTGACAGAACCACCAA p67phox (NM_000433 NM_000433 forward AGCTCCGGCTGGAACACACTA and reverse GGCACCAGCTCATTGCTGTC gp91phox (NM_000397 NM_000397 |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.0 | reverse GCTTTCATCTGACAGAACCACCAA p67phox (NM_000433 NM_000433 forward AGCTCCGGCTGGAACACACTA and reverse GGCACCAGCTCATTGCTGTC gp91phox (NM_000397 NM_000397 forward AAATGGATCGCATCTGTGTGAC and reverse TGGCCACACTAACAGTGATTTAGAG and glyceraldehyde-3-phosphate dehydrogenase |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | NM_000397 forward AAATGGATCGCATCTGTGTGAC and reverse TGGCCACACTAACAGTGATTTAGAG and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) GAPDH (NM_002046 NM_002046 forward GGCCTCCAAGGAGTAAGACC and reverse AGGGGTCTACATGGCAACTG |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.0 | Primers used were as follows p22phox (GenBank GenBank NM_000101 forward ATTACTATGTTCGGGCCGTCCT and reverse GGTAGATGCCGCTCGCAAT p40phox (NM_000631 |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | number of the gene of interest corrected for expression of GAPDH in the samples |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | Serine phosphorylation of p47phox which is a critical step for cytoplasmic complex formation of |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | Under normal conditions NO released by eNOS stimulates soluble guanylyl cyclase increasing cGMP activating cGMP-dependent protein kinase |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | Peroxynitrite uncouples eNOS switching the NO-producing process to a ROS reproduction process ( |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | from increased activity of NADPH oxidase and normal activity of eNOS |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | was decreased by pitavastatin simultaneously with a decrease of vascular p47phox serine phosphorylation indicating that pitavastatin somehow inhibited the activation process |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | TNF-alpha | 0.5 | not change the plasma levels of adipocyte-derived cytokines such as TNF-alpha (vehicle vehicle 4.00 _amp_#177 0.75 vs pitavastatin 4.77 _amp_#177 1.69 |
| 13633 | ADIPOQ | adiponectin, C1Q and collagen domain containing | adiponectin | 2.5 | 0.75 vs pitavastatin 4.77 _amp_#177 1.69 pg/ml) pg ml and adiponectin (8.75 8.75 _amp_#177 0.95 vs 7.27 _amp_#177 0.48 microg/ml) microg |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.0 | enzyme complex that includes the membrane-bound flavocytochrome b558 formed by gp91phox and p22phox and the cytosolic proteins p47phox p67phox and Rac |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | b558 formed by gp91phox and p22phox and the cytosolic proteins p47phox p67phox and Rac |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | formed by gp91phox and p22phox and the cytosolic proteins p47phox p67phox and Rac |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.1 | that includes the membrane-bound flavocytochrome b558 formed by gp91phox and p22phox and the cytosolic proteins p47phox p67phox and Rac |
| 391 | AKT1 | v-akt murine thymoma viral oncogene homolog 1 | Rac | 0.1 | gp91phox and p22phox and the cytosolic proteins p47phox p67phox and Rac |
| 7662 | NCF4 | neutrophil cytosolic factor 4, 40kDa | p40phox | 1.3 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.0 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.3 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox |
| 7662 | NCF4 | neutrophil cytosolic factor 4, 40kDa | p40phox | 1.3 | prior treatment with pitavastatin inhibited the palmitate-induced increases in p22phox p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | with pitavastatin inhibited the palmitate-induced increases in p22phox p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | in p22phox p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.0 | p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.2 | A prior treatment with pitavastatin inhibited the palmitate-induced increases in p22phox p40phox and p47phox mRNA but did not change p67phox and |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | complex formation secondary to posttranslational modification of regulatory subunits (p47phox p47phox and Rac or a chronic increase in the expression and |
| 391 | AKT1 | v-akt murine thymoma viral oncogene homolog 1 | Rac | 0.1 | secondary to posttranslational modification of regulatory subunits (p47phox p47phox and Rac or a chronic increase in the expression and abundance of |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | palmitate can be that protein kinase C-dependent phosphorylation of the p47phox regulatory subunit and its translocation to the Nox2/p22phox Nox2 p22phox |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | Nox2 | 2.0 | the p47phox regulatory subunit and its translocation to the Nox2/p22phox Nox2 p22phox heterodimer to form fully assembled complexes |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.3 | p47phox regulatory subunit and its translocation to the Nox2/p22phox Nox2 p22phox heterodimer to form fully assembled complexes |
| 12517 | UCP1 | uncoupling protein 1 (mitochondrial, proton carrier) | UCP-1 | 1.4 | Adenoviral overexpression of uncoupling protein 1 (UCP-1) UCP-1 or inhibition of mitochondrial FFA oxidation by carnitine palmitoyltransferase I |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | Activated Rac in its GTP-bound state binds to the cytosolic p67phox subunit and activates the oxidase |
| 391 | AKT1 | v-akt murine thymoma viral oncogene homolog 1 | Rac | 0.0 | Activated Rac in its GTP-bound state binds to the cytosolic p67phox subunit |
| 391 | AKT1 | v-akt murine thymoma viral oncogene homolog 1 | Rac | 0.0 | Pitavastatin may inhibit palmitate-induced activation of NADPH oxidase through Rac inactivation because Rac activation requires its posttranslational modification by isoprenylation |
| 391 | AKT1 | v-akt murine thymoma viral oncogene homolog 1 | Rac | 0.0 | inhibit palmitate-induced activation of NADPH oxidase through Rac inactivation because Rac activation requires its posttranslational modification by isoprenylation a process that |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | Activities of eNOS and p47phox and ROS signal in aorta isolated from +/+ |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | Activities of eNOS and p47phox and ROS signal in aorta isolated from +/+ and fa |
| 7662 | NCF4 | neutrophil cytosolic factor 4, 40kDa | p40phox | 1.3 | Expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene were quantified by real-time |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | Expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene were quantified by real-time PCR |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | Expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene were quantified by real-time PCR and |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.0 | Expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene were quantified by real-time PCR and corrected by |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | subunit gene were quantified by real-time PCR and corrected by GAPDH level |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.3 | Expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene were quantified by |
| 391 | AKT1 | v-akt murine thymoma viral oncogene homolog 1 | Rac | 0.0 | FFA-induced ROS production via inhibition of NADPH oxidase expression and Rac inactivation |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | There is controversy about effects of FFA on insulin-mediated eNOS activation and angiotensin type 1 receptor (AT1R) AT1R signaling |
| 336 | AGTR1 | angiotensin II receptor, type 1 | AT1R | 1.6 | on insulin-mediated eNOS activation and angiotensin type 1 receptor (AT1R) AT1R signaling |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | Circulating ROS and vascular activities of NADPH oxidase and eNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | (Table Table 1 alpha in ZDF rats The level of eNOS phosphorylation was not different between +/+ and ZDF rats (Fig |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | ZDF rats (Fig Fig 2 left but the level of p47phox serine phosphorylation a marker of NADPH oxidase activity was increased |
| 7662 | NCF4 | neutrophil cytosolic factor 4, 40kDa | p40phox | 1.3 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene (Fig Fig 3 |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene (Fig Fig 3 |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene (Fig Fig 3 |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.0 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene (Fig Fig 3 |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.3 | Palmitate increased expression levels of p22phox p40phox p47phox p67phox and gp91phox subunit gene (Fig Fig 3 |
| 7662 | NCF4 | neutrophil cytosolic factor 4, 40kDa | p40phox | 1.3 | A prior treatment with pitavastatin inhibited palmitate-induced up-regulation in p22phox p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 3.1 | treatment with pitavastatin inhibited palmitate-induced up-regulation in p22phox p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.6 | in p22phox p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.0 | p40phox and p47phox mRNA but did not change p67phox and gp91phox |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 0.2 | A prior treatment with pitavastatin inhibited palmitate-induced up-regulation in p22phox p40phox and p47phox mRNA but did not change p67phox and |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 2.2 | Abbreviations DPI Diphenyleneiodonium eNOS endothelial nitric oxide synthase 8-epi-PGF 2 alpha 8-epi-prostaglandin-F 2 alpha |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | 8-epi-PGF 2 alpha 8-epi-prostaglandin-F 2 alpha FFA free fatty acids GAPDH glyceraldehyde-3-phosphate dehydrogenase HDL high-density lipoprotein HUVEC human umbilical vein endothelial |
| 5006 | HMGCR | 3-hydroxy-3-methylglutaryl-Coenzyme A reductase | 3 hydroxy 3 methylglutaryl coenzyme a reductase | 1.0 | a 2 wk treatment with a 3 hydroxy 3 methylglutaryl coenzyme a reductase inhibitor pitavastatin 3 mg/kg/d or a reduced nicotinamide adenine dinucleotide phosphate nadph oxidase inhibitor apocynin 5 mmol/liter in drinking water improved the response in zdf ed 50 7.16 _amp_ |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | a 2 wk treatment with a 3 hydroxy 3 methylglutaryl coenzyme a reductase inhibitor pitavastatin 3 mg/kg/d or a reduced nicotinamide adenine dinucleotide phosphate nadph oxidase inhibitor apocynin 5 mmol/liter in drinking water improved the response in zdf ed 50 7.16 _amp_#177; 0.03 and 7.14 _amp_#177; 0.05 log 10 mol/liter p = 0.008 and p = 0.015 vs vehicle respectively . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | vascular reactive oxygen species ros levels and nadph oxidase activity in aorta were increased in zdf rats but were decreased by pitavastatin. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | in in vitro cell culture intracellular ros signal and nadph oxidase subunit mrna were increased by palmitate but this palmitate induced ros production was inhibited by nadph oxidase inhibitor or pitavastatin. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | in conclusion ffa induced nadph oxidase subunit overexpression and ros production could be involved in the endothelial dysfunction seen in obese zdf rats and this could be protected by pitavastatin or nadph oxidase inhibitors. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | subunit overexpression and ros production could be involved in the endothelial dysfunction seen in obese zdf rats and this could be protected by pitavastatin or nadph oxidase inhibitors. |
| 6081 | INS | insulin | insulin | 1.0 | the presence of vascular endothelial dysfunction has been demonstrated in subjects with insulin resistance/visceral fat obesity 1 2 3 . |
| 6081 | INS | insulin | insulin | 1.0 | namely blood flow response to an endothelium dependent vasodilator such as methacholine chloride but not to an endothelium independent vasodilator such as sodium nitroprusside was impaired in obese insulin resistant subjects 1 . |
| 6081 | INS | insulin | insulin | 1.0 | one common metabolic feature of insulin resistance/obesity is a deficit in insulin mediated glucose disposal. |
| 6081 | INS | insulin | insulin | 1.0 | recent evidence raised the possibility that tissue accumulation of free fatty acids ffa mainly causes abnormalities of insulin secretion and actions and consecutive metabolic derangements named lipotoxicity 4 5 6 . |
| 6081 | INS | insulin | insulin | 1.0 | the bloodstream from visceral fat tissues we and others assumed that an elevation of circulating ffa might be causally related to the onset and progression of endothelial dysfunction in patients with insulin resistance/visceral fat obesity 2 3 . |
| 11416 | STN | statin | statin | 1.0 | it has been reported that 3 hydroxy 3 methylglutaryl coenzyme a reductase inhibitors statin improve endothelial function and also reduce vascular superoxide production via inhibition of vascular nadph oxidase activation 10 11 . |
| 5006 | HMGCR | 3-hydroxy-3-methylglutaryl-Coenzyme A reductase | 3 hydroxy 3 methylglutaryl coenzyme a reductase | 1.0 | it has been reported that 3 hydroxy 3 methylglutaryl coenzyme a reductase inhibitors statin improve endothelial function and also reduce vascular superoxide production via inhibition of vascular nadph oxidase activation 10 11 . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | it has been reported that 3 hydroxy 3 methylglutaryl coenzyme a reductase inhibitors statin improve endothelial function and also reduce vascular superoxide production via inhibition of vascular nadph oxidase activation 10 11 . |
| 11416 | STN | statin | statin | 1.0 | thus statin might attenuate ffa induced endothelial dysfunction via inhibition of vascular superoxide production. |
| 11416 | STN | statin | statin | 1.0 | in the present study we examined 1 the role of ffa and the oxidases responsible for ros production in vascular reactivity and 2 effects of statin on vascular ros production in a rodent model of visceral fat obesity zucker diabetic fatty zdf rat which shows hyperphagia and obesity related diabetes dyslipidemia and hypertension resulting from a |
| 6554 | LEPR | leptin receptor | leptin receptor | 1.0 | rodent model of visceral fat obesity zucker diabetic fatty zdf rat which shows hyperphagia and obesity related diabetes dyslipidemia and hypertension resulting from a loss of function mutation in the leptin receptor 12 . |
| 6081 | INS | insulin | insulin | 1.0 | plasma insulin levels were assessed using an insulin elisa kit. |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | plasma levels of adiponectin otsuka pharmaceutical co. ltd tokyo japan and tnf alpha jimro co. ltd. takasaki gunma japan were measured by sandwich elisa as previously described 3 . |
| 13633 | ADIPOQ | adiponectin, C1Q and collagen domain containing | adiponectin | 1.0 | plasma levels of adiponectin otsuka pharmaceutical co. ltd tokyo japan and tnf alpha jimro co. ltd. takasaki gunma japan were measured by sandwich elisa as previously described 3 . |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | endothelial nitric oxide synthase | 1.0 | for immunoprecipitation the primary antibodies [endothelial nitric oxide synthase enos or p47phox] were used at a 1:1000 dilution in 5% nonfat milk solution for 12 h at 4 c 16 17 . |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | glyceraldehyde 3 phosphate dehydrogenase | 1.0 | ctttcatctgacagaaccaccaa; p67phox nm_000433 forward agctccggctggaacacacta and reverse ggcaccagctcattgctgtc; gp91phox nm_000397 forward aaatggatcgcatctgtgtgac and reverse tggccacactaacagtgatttagag; and glyceraldehyde 3 phosphate dehydrogenase gapdh nm_002046 forward ggcctccaaggagtaagacc and reverse aggggtctacatggcaactg. |
| 6081 | INS | insulin | insulin | 1.0 | the mean body weight plasma glucose insulin ffa and triglyceride of obese male zdf fa / fa rats at 9 wk of age were all higher than age matched +/+ controls table 1 . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | nt study were that 1 the vasodilator response to acetylcholine but not to sodium nitroprusside was impaired in prediabetic obese zdf rats 2 elevations in circulating ffa and ros and an enhancement of nadph oxidase activation and vascular ros production were also observed in zdf rats 3 pitavastatin recovered vasodilator responses in zdf rats with a reduction of vascular nadph oxidase activity and ros production |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | activation and vascular ros production were also observed in zdf rats 3 pitavastatin recovered vasodilator responses in zdf rats with a reduction of vascular nadph oxidase activity and ros production and 4 ffa enhanced production of ros and expression of nadph oxidase subunit mrna and those were inhibited by pitavastatin. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | activity and ros production and 4 ffa enhanced production of ros and expression of nadph oxidase subunit mrna and those were inhibited by pitavastatin. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | serine phosphorylation of p47phox which is a critical step for cytoplasmic complex formation of nadph oxidase and serves as nadph oxidase activation 17 was enhanced in zdf aorta indicating that ros production was also locally amplified. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | in zdf rats excess vascular ros can come from increased activity of nadph oxidase and normal activity of enos. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | a 2 wk treatment with a nadph oxidase inhibitor apocynin 13 almost completely recovered the vascular response to acetylcholine in zdf rats supporting the notion that vascular ros is the major cause of endothelial dysfunction. |
| 11416 | STN | statin | statin | 1.0 | it had been shown that 3 hydroxy 3 methylglutaryl coenzyme a reductase inhibitors statin reduce ros production 10 11 . |
| 5006 | HMGCR | 3-hydroxy-3-methylglutaryl-Coenzyme A reductase | 3 hydroxy 3 methylglutaryl coenzyme a reductase | 1.0 | it had been shown that 3 hydroxy 3 methylglutaryl coenzyme a reductase inhibitors statin reduce ros production 10 11 . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | level of vascular ros was decreased by pitavastatin simultaneously with a decrease of vascular p47phox serine phosphorylation indicating that pitavastatin somehow inhibited the activation process of nadph oxidase 10 11 . |
| 11892 | TNF | tumor necrosis factor (TNF superfamily, member 2) | tnf alpha | 1.0 | pitavastatin did not change the plasma levels of adipocyte derived cytokines such as tnf alpha vehicle 4.00 _amp_#177; 0.75 vs pitavastatin 4.77 _amp_#177; 1.69 pg/ml and adiponectin 8.75 _amp_#177; 0.95 vs 7.27 _amp_#177; 0.48 microg/ml in zdf rats 19 20 see also idf worldwide definition of t |
| 13633 | ADIPOQ | adiponectin, C1Q and collagen domain containing | adiponectin | 1.0 | pitavastatin did not change the plasma levels of adipocyte derived cytokines such as tnf alpha vehicle 4.00 _amp_#177; 0.75 vs pitavastatin 4.77 _amp_#177; 1.69 pg/ml and adiponectin 8.75 _amp_#177; 0.95 vs 7.27 _amp_#177; 0.48 microg/ml in zdf rats 19 20 see also idf worldwide definition of the metabolic syndrome at url . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | ffa and vascular nadph oxidase activity |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | we thus tested whether ffa do directly activate vascular ros production and if so whether it can be through nadph oxidase activation. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | the palmitate induced increases in vascular ros signals were inhibited completely by pitavastatin and a general antioxidant nac and partially by dpi a nadph oxidase inhibitor. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | the major source of superoxide anion in the vasculature is the nadph oxidase family of enzymes 21 22 . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | vascular nadph oxidase is a multisubunit enzyme complex that includes the membrane bound flavocytochrome b558 formed by gp91phox and p22phox and the cytosolic proteins p47phox p67phox and rac. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | we thus determined the effects of palmitate on the expression levels of the vascular nadph oxidase subunit gene. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | two general mechanisms underlying activation of nadph oxidase are either an acute increase in oxidase complex formation secondary to posttranslational modification of regulatory subunits p47phox and rac or a chronic increase in the expression and abundance of c |
| 9393 | PRKCA | protein kinase C, alpha | protein kinase c | 1.0 | as we and others reported previously 5 8 palmitate directly increases diacylglycerol levels and protein kinase c activation which is the well known signal for activation of nadph oxidase. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | as we and others reported previously 5 8 palmitate directly increases diacylglycerol levels and protein kinase c activation which is the well known signal for activation of nadph oxidase. |
| 9393 | PRKCA | protein kinase C, alpha | protein kinase c | 1.0 | a key mechanism of acute activation by palmitate can be that protein kinase c dependent phosphorylation of the p47phox regulatory subunit and its translocation to the nox2/p22phox heterodimer to form fully assembled complexes. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | increased expression of nadph oxidase subunits might be the mechanism of chronic nadph activation by palmitate. |
| 2328 | CPT1A | carnitine palmitoyltransferase 1A (liver) | carnitine palmitoyltransferase i | 1.0 | adenoviral overexpression of uncoupling protein 1 ucp 1 or inhibition of mitochondrial ffa oxidation by carnitine palmitoyltransferase i cpt i inhibitor etomoxir could inhibit such ffa induced ros production. |
| 12517 | UCP1 | uncoupling protein 1 (mitochondrial, proton carrier) | uncoupling protein 1 | 1.0 | adenoviral overexpression of uncoupling protein 1 ucp 1 or inhibition of mitochondrial ffa oxidation by carnitine palmitoyltransferase i cpt i inhibitor etomoxir could inhibit such ffa induced ros production. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | nadph oxidase and mitochondrial uncoupling could independently contribute to ffa induced ros production in vascular system. |
| 11416 | STN | statin | statin | 1.0 | may inhibit palmitate induced activation of nadph oxidase through rac inactivation because rac activation requires its posttranslational modification by isoprenylation a process that is inhibited by statin 10 11 . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | pitavastatin may inhibit palmitate induced activation of nadph oxidase through rac inactivation because rac activation requires its posttranslational modification by isoprenylation a process that is inhibited by statin 10 11 . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | inhibition of palmitate induced up regulation of nadph oxidase subunits may be another mechanism of nadph inactivation by pitavastatin. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | endothelial dysfunction and nadph oxidase activation were concomitantly observed in obese zdf rats but those were improved by pitavastatin and apocynin treatment. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | it is suggested that pitavastatin might inhibit ffa induced nadph oxidase subunit gene expression and ros production in endothelial cells and then protect the endothelial dysfunction seen in obese zdf rats. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | effects of palmitate on ros production and levels of vascular nadph oxidase subunit gene in huvec. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | circulating ffa induces vascular ros production via up regulation of vascular nadph oxidase. |
| 11416 | STN | statin | statin | 1.0 | statin may block ffa induced ros production via inhibition of nadph oxidase expression and rac inactivation. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | statin may block ffa induced ros production via inhibition of nadph oxidase expression and rac inactivation. |
| 6081 | INS | insulin | insulin | 1.0 | there is controversy about effects of ffa on insulin mediated enos activation and angiotensin type 1 receptor at1r signaling. |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | angiotensin ii | 1.0 | aii angiotensin ii; dag diacylglycerol. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | circulating ros and vascular activities of nadph oxidase and enos |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | ere increased in zdf rats table 1 alpha in zdf rats the level of enos phosphorylation was not different between +/+ and zdf rats fig 2 left but the level of p47phox serine phosphorylation a marker of nadph oxidase activity was increased in aorta homogenates of zdf rats and it was decreased by pitavastatin treatment fig 2 center . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | the palmitate induced ros formation was inhibited completely by pitavastatin and a general antioxidant nac and partially by dpi a nadph oxidase inhibitor fig 3 . |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | glyceraldehyde 3 phosphate dehydrogenase | 1.0 | abbreviations: dpi diphenyleneiodonium; enos endothelial nitric oxide synthase; 8 epi pgf 2 alpha 8 epi prostaglandin f 2 alpha; ffa free fatty acids; gapdh glyceraldehyde 3 phosphate dehydrogenase; hdl high density lipoprotein; huvec human umbilical vein endothelial cells; nac n acetyl l cysteine; ros reactive oxygen species; tbars thiobarbituric acid reactive substance; zdf zucker diabetic fa |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | endothelial nitric oxide synthase | 1.0 | abbreviations: dpi diphenyleneiodonium; enos endothelial nitric oxide synthase; 8 epi pgf 2 alpha 8 epi prostaglandin f 2 alpha; ffa free fatty acids; gapdh glyceraldehyde 3 phosphate dehydrogenase; hdl high density lipoprotein; huvec human umbilical vein endothelial cells; nac |