)| PMID |
16139267 ( ) |
|---|---|
| Title | Protection against oxidative stress in diabetic rats: role of angiotensin AT(1) receptor and beta 1-adrenoceptor antagonism. |
| Abstract | Oxidative stress and low-grade inflammation are hallmarks of diabetes mellitus. We explored protective, blood pressure-independent effects of the angiotensin II type 1 (AT(1)) receptor antagonist candesartan and the selective beta(1)-adrenoceptor antagonist metoprolol. Diabetes mellitus was induced in 8-week-old Sprague-Dawley rats after injection of streptozotocin. Diabetic rats were randomized to treatment with candesartan or metoprolol in sub-antihypertensive doses or to placebo treatment. In the quadriceps, musculature markers of oxidative stress and inflammation were determined. Function of the inherent vascular bed was measured in vivo in the autoperfused hindlimb. Increases in NAD(P)H activity, expression of its cytosolic subunit p22(phox) and of endothelial NO synthase e(NOS) displayed enhanced oxidative stress. Upregulated intercellular (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 and of inducible NOS (iNOS) revealed inflammatory processes. Diabetes was associated with severe impairment of endothelium-dependent and -independent vasodilatation. Candesartan, but not metoprolol, reduced NAD(P)H activity, attenuated diabetes-induced over-expression of p22(phox) and eNOS mRNA as well as ICAM-1, VCAM-1, iNOS and eNOS immunoreactivity and led to a substantial improvement of endothelium-dependent vasodilatation (+46.3% vs. placebo treatment; P<0.05). Angiotensin AT(1) receptor antagonism, but not beta(1)-adrenoceptor antagonism, ameliorates diabetes-generated oxidative stress, indicating a pivotal role of the renin-angiotensin system in the development of diabetic complications. Berlin, Campus Benjamin Franklin, Hindenburgdamm 30, 12200 Berlin, Germany. |
NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.
Targets by SciMiner Summary
| HUGO ID | Symbol | Target Name | #Occur | ActualStr |
|---|---|---|---|---|
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | 24 | p22 phox | |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | 22 | endothelial nitric oxide synthase | eNOS | eNOS-expression | |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | 16 | VCAM-1 | |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | 14 | NOS | iNOS-expression | |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | 13 | ICAM-1 | |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | 7 | gp91 phox | |
| 19986 | CYCS | cytochrome c, somatic | 5 | cytochrome c | |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | 5 | angiotensin ii | |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | 5 | superoxide dismutase | |
| 2707 | ACE | angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 | 2 | ACE | angiotensin converting enzyme | |
Targets by SciMiner Full list
| HUGO ID | Symbol | Name | ActualStr | Score | FlankingText |
|---|---|---|---|---|---|
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | NAD(P)H NAD P H activity expression of its cytosolic subunit p22 phox and of endothelial NO synthase e(NOS) e NOS displayed |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | NOS | 2.7 | subunit p22 phox and of endothelial NO synthase e(NOS) e NOS displayed enhanced oxidative stress |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | NOS | 2.7 | vascular cell adhesion molecule (VCAM)-1 VCAM -1 and of inducible NOS (iNOS) iNOS revealed inflammatory processes |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | adhesion molecule (VCAM)-1 VCAM -1 and of inducible NOS (iNOS) iNOS revealed inflammatory processes |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | reduced NAD(P)H NAD P H activity attenuated diabetes-induced over-expression of p22 phox and eNOS mRNA as well as ICAM-1 VCAM-1 iNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | P H activity attenuated diabetes-induced over-expression of p22 phox and eNOS mRNA as well as ICAM-1 VCAM-1 iNOS and eNOS immunoreactivity |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | over-expression of p22 phox and eNOS mRNA as well as ICAM-1 VCAM-1 iNOS and eNOS immunoreactivity and led to a substantial |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | of p22 phox and eNOS mRNA as well as ICAM-1 VCAM-1 iNOS and eNOS immunoreactivity and led to a substantial improvement |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | p22 phox and eNOS mRNA as well as ICAM-1 VCAM-1 iNOS and eNOS immunoreactivity and led to a substantial improvement of |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | and eNOS mRNA as well as ICAM-1 VCAM-1 iNOS and eNOS immunoreactivity and led to a substantial improvement of endothelium-dependent vasodilatation |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | The following primers were used for the PCR analysis eNOS 5_amp_#x2032 -GTGTTTGGCCGAGTCCTCACC-3_amp_#x2032 and 5_amp_#x2032 -CTCCTGCAAGGAAAAGCTCTG-3_amp_#x2032 NAD(P)H NAD P H oxidase |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | 5_amp_#x2032 -GTGTTTGGCCGAGTCCTCACC-3_amp_#x2032 and 5_amp_#x2032 -CTCCTGCAAGGAAAAGCTCTG-3_amp_#x2032 NAD(P)H NAD P H oxidase p22 phox subunit 5_amp_#x2032 -ATGGGCAACTTGAAGAGCGTGGC-3_amp_#x2032 and 5_amp_#x2032 -TCCATGTG GAGCCCTTCTT -3_amp_#x2032 NAD(P)H |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | at the given dilutions (45 45 min room temperature mouse-anti-rat ICAM-1 (Serotec, Serotec Oxford UK 1 100 mouse-anti-rat VCAM-1 (HISS HISS |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | temperature mouse-anti-rat ICAM-1 (Serotec, Serotec Oxford UK 1 100 mouse-anti-rat VCAM-1 (HISS HISS Diagnostics Freiburg Germany 1 50 rabbit-anti-rat iNOS and |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | mouse-anti-rat VCAM-1 (HISS HISS Diagnostics Freiburg Germany 1 50 rabbit-anti-rat iNOS and rabbit-anti-rat eNOS (both both Alpha Diagnostic San Antonio USA |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | HISS Diagnostics Freiburg Germany 1 50 rabbit-anti-rat iNOS and rabbit-anti-rat eNOS (both both Alpha Diagnostic San Antonio USA 1 50 |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | Gene expression of p22 phox gp91 phox and eNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | Gene expression of p22 phox gp91 phox and eNOS |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | NAD(P)H NAD P H oxidase we examined two subunits (p22 p22 phox and gp91 phox of the multienzyme complex |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | As shown in Fig 3 p22 phox mRNA was upregulated in vehicle-treated diabetic rats (8.8 8.8 |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | Treatment with candesartan but not metoprolol led to decreased p22 phox mRNA levels in diabetic rats |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | RT-PCR and immunohistochemistry were performed to evaluate the inducibility of eNOS expression in skeletal muscle by diabetic conditions (immunohistological immunohistological results |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | Immunoreactivity of ICAM-1 VCAM-1 eNOS and iNOS |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | Immunoreactivity of ICAM-1 VCAM-1 eNOS and iNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | Immunoreactivity of ICAM-1 VCAM-1 eNOS and iNOS |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | Immunoreactivity of ICAM-1 VCAM-1 eNOS and iNOS |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | Diabetic rats demonstrated a marked increase (6-fold) 6-fold in ICAM-1 protein expression compared to non-diabetic-controls (0.00338 0.00338 _amp_#xb1 0.00137 vs |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | Diabetic rats treated with candesartan exhibited a significant lower ICAM-1 immunoreactivity whereas metoprolol had no effect on ICAM-1 expression |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | significant lower ICAM-1 immunoreactivity whereas metoprolol had no effect on ICAM-1 expression |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | As shown in Fig 4 VCAM-1 expression was also markedly increased under diabetic conditions (10-fold, 10-fold |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | Candesartan treatment significantly reduced VCAM-1 protein expression |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | Metoprolol showed no effect on VCAM-1 expression |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS-expression | 2.7 | Diabetic rats had a significantly higher iNOS-expression (0.05244 0.05244 _amp_#xb1 0.02323 vs 0.0127 _amp_#xb1 0.00179 P _amp_#x3c |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS-expression | 2.2 | vs 0.0127 _amp_#xb1 0.00179 P _amp_#x3c 0.05 Fig 4 and eNOS-expression (0.02805 0.02805 _amp_#xb1 0.00371 vs 0.00549 _amp_#xb1 0.00095 P _amp_#x3c |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | with candesartan but not metoprolol led to a normalisation of iNOS and eNOS protein expression levels in quadriceps muscle tissue of |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | but not metoprolol led to a normalisation of iNOS and eNOS protein expression levels in quadriceps muscle tissue of diabetic rats |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | of oxidative stress accompanied by an increased eNOS-mRNA expression increased ICAM-1 VCAM-1 iNOS and eNOS protein expression and impaired endothelium-dependent vasodilatation |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | oxidative stress accompanied by an increased eNOS-mRNA expression increased ICAM-1 VCAM-1 iNOS and eNOS protein expression and impaired endothelium-dependent vasodilatation which |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | stress accompanied by an increased eNOS-mRNA expression increased ICAM-1 VCAM-1 iNOS and eNOS protein expression and impaired endothelium-dependent vasodilatation which was |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | by an increased eNOS-mRNA expression increased ICAM-1 VCAM-1 iNOS and eNOS protein expression and impaired endothelium-dependent vasodilatation which was antagonized by |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | increased expression of the NAD(P)H NAD P H oxidase subunit p22 phox which is in agreement with previous works ( Zhang |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | NAD P H were paralleled by an increased expression of eNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | Identical findings of increased eNOS expression have been reported before in diabetic rats ( Hink |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | to understand this apparent paradox of diabetes-induced super induction of eNOS concomitantly with endothelial dysfunction |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | has become clear that in the setting of diabetes upregulated eNOS is dysfunctional or _amp_#x201c uncoupled_amp_#x201d and may be due to |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | is a reasonable explanation for our observation of an upregulated eNOS in combination with endothelial dysfunction |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | In the present study we also found an increased iNOS expression |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | NO derived from iNOS can function as a pro-inflammatory mediator and by reacting with |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | It is well established that iNOS synthesizes 10- to 50-fold more NO than the constitutive eNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | iNOS synthesizes 10- to 50-fold more NO than the constitutive eNOS and that its expression is increased in the setting of |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | production of pro-inflammatory cytokines and of leukocyte adhesion molecules (ICAM-1, ICAM-1 VCAM-1 as well as other inflammatory pathways in vascular endothelial |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | of pro-inflammatory cytokines and of leukocyte adhesion molecules (ICAM-1, ICAM-1 VCAM-1 as well as other inflammatory pathways in vascular endothelial cells |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | we were able to demonstrate enhanced vascular protein expression of ICAM-1 and VCAM-1 under diabetic conditions |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | able to demonstrate enhanced vascular protein expression of ICAM-1 and VCAM-1 under diabetic conditions |
| 2707 | ACE | angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 | ACE | 0.6 | inhibition of the renin_amp_#x2013 angiotensin system with angiotensin-converting enzyme (ACE) ACE inhibitors and angiotensin AT 1 receptor antagonists does not influence |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | levels down-regulation of eNOS-mRNA expression and reducing protein expression of eNOS and iNOS |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | of eNOS-mRNA expression and reducing protein expression of eNOS and iNOS |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | found only an upregulation of NAD(P)H NAD P H oxidase p22 phox while changes in gp91 phox remained insignificant ( Zhang |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | namely enhanced neutrophil-endothelium cell adhesion through increased expression of endothelial ICAM-1 and VCAM-1 |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | neutrophil-endothelium cell adhesion through increased expression of endothelial ICAM-1 and VCAM-1 |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | previous studies the present results demonstrate enhanced endothelial expression of ICAM-1 and VCAM-1 in diabetic rats ( Zhang et al. 2003 |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | the present results demonstrate enhanced endothelial expression of ICAM-1 and VCAM-1 in diabetic rats ( Zhang et al. 2003 |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | We showed significant reductions in ICAM-1 and VCAM-1 protein expression following 48 days of treatment with |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | We showed significant reductions in ICAM-1 and VCAM-1 protein expression following 48 days of treatment with low-dose candesartan |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | In the same model increased expression of VCAM-1 was antagonized by an angiotensin AT 1 receptor antagonist |
| 5344 | ICAM1 | intercellular adhesion molecule 1 (CD54), human rhinovirus receptor | ICAM-1 | 2.3 | that an immunohistological examination of the tissue expression pattern of ICAM-1 and VCAM-1 has been performed in an in vivo haemodynamically |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | immunohistological examination of the tissue expression pattern of ICAM-1 and VCAM-1 has been performed in an in vivo haemodynamically characterized peripheral |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | However although NAD(P)H NAD P H oxidase activity p22 phox and eNOS mRNA expression seemed to be normalized after |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | although NAD(P)H NAD P H oxidase activity p22 phox and eNOS mRNA expression seemed to be normalized after treatment with metoprolol |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | discrepancy we determined NAD(P)H NAD P H oxidase activity and p22 phox mRNA expression in the muscle and not in isolated |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 | 0.3 | mRNA expression of NAD(P)H NAD P H oxidase subunits (p22 p22 phox and gp91 phox and of endothelial nitric oxide synthase |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | and gp91 phox and of endothelial nitric oxide synthase (eNOS) eNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | Transcripts of NAD(P)H NAD P H oxidase subunits and of eNOS were evaluated by real-time polymerase chain reaction |
| 7873 | NOS2A | nitric oxide synthase 2A (inducible, hepatocytes) | iNOS | 2.7 | (VCAM)-1, VCAM -1 inducible nitric oxide (NO) NO synthase (iNOS) iNOS and endothelial NO synthase (eNOS), eNOS measured by semi-quantitative immunohistochemistry |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 4.5 | (NO) NO synthase (iNOS) iNOS and endothelial NO synthase (eNOS), eNOS measured by semi-quantitative immunohistochemistry and expressed as area fraction (AF) |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | Fig 5._amp_#xa0 Representative aspects of VCAM-1 expression in rat quadriceps muscle |
| 12663 | VCAM1 | vascular cell adhesion molecule 1 | VCAM-1 | 2.8 | VCAM-1 immunoreactivity is clearly present in the endothelium (magnification, magnification _amp_#xd7 |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | angiotensin ii | 1.0 | we explored protective blood pressure independent effects of the angiotensin ii type 1 at 1 receptor antagonist candesartan and the selective _amp_#x3b2; 1 adrenoceptor antagonist metoprolol. |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | increases in nad p h activity expression of its cytosolic subunit p22 phox and of endothelial no synthase e nos displayed enhanced oxidative stress. |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | candesartan but not metoprolol reduced nad p h activity attenuated diabetes induced over expression of p22 phox and enos mrna as well as icam 1 vcam 1 inos and enos immunoreactivity and led to a substantial improvement of endothelium dependent vasodilatation + 46.3% vs placebo treatment; p _amp_#x3c; 0.05 . |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | angiotensin ii | 1.0 | angiotensin ii accelerates the development of diabetic complications by promoting the generation of superoxide anions by activation of the angiotensin at 1 receptor rajagopalan et al. 1996 . |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | the following primers were used for the pcr analysis: enos: 5_amp_#x2032; gtgtttggccgagtcctcacc 3_amp_#x2032; and 5_amp_#x2032; ctcctgcaaggaaaagctctg 3_amp_#x2032; nad p h oxidase p22 phox subunit: 5_amp_#x2032; atgggcaacttgaagagcgtggc 3_amp_#x2032; and 5_amp_#x2032; tccatgtg gagcccttctt 3_amp_#x2032; nad p h oxidase gp91 phox subunit: 5_amp_#x2032; gaggtgggacaatacattttc 3_amp_#x2032; |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91 phox | 1.0 | _#x2032; ctcctgcaaggaaaagctctg 3_amp_#x2032; nad p h oxidase p22 phox subunit: 5_amp_#x2032; atgggcaacttgaagagcgtggc 3_amp_#x2032; and 5_amp_#x2032; tccatgtg gagcccttctt 3_amp_#x2032; nad p h oxidase gp91 phox subunit: 5_amp_#x2032; gaggtgggacaatacattttc 3_amp_#x2032; and 5_amp_#x2032; ctgcttatcacagccacaggc 3_amp_#x2032;. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | muscle nad p h oxidase activity was measured by superoxide dismutase inhibitable reduction of cytochrome c with nadh or nad p h as substrates. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | muscle nad p h oxidase activity was measured by superoxide dismutase inhibitable reduction of cytochrome c with nadh or nad p h as substrates. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | nadh stimulated production of reactive oxygen species was determined by following increases in cytochrome c absorbance. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | the experiments were performed in parallel with and without superoxide dismutase. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | the activity of nad p h oxidase was calculated as superoxide dismutase inhibitable cytochrome c reduction. 2.6. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | the activity of nad p h oxidase was calculated as superoxide dismutase inhibitable cytochrome c reduction. 2.6. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | oxidative stress in terms of production of reactive oxygen species was measured by superoxide dismutase inhibitable reduction of cytochrome c with nadh or nad p h as substrates 48 days after induction of diabetes mellitus. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | oxidative stress in terms of production of reactive oxygen species was measured by superoxide dismutase inhibitable reduction of cytochrome c with nadh or nad p h as substrates 48 days after induction of diabetes mellitus. |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | gene expression of p22 phox gp91 phox and enos |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91 phox | 1.0 | gene expression of p22 phox gp91 phox and enos |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | to further elucidate the role of nad p h oxidase we examined two subunits p22 phox and gp91 phox of the multienzyme complex. |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91 phox | 1.0 | to further elucidate the role of nad p h oxidase we examined two subunits p22 phox and gp91 phox of the multienzyme complex. |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | as shown in fig. 3 p22 phox mrna was upregulated in vehicle treated diabetic rats 8.8 _amp_#xb1; 1.9 vs 26.3 _amp_#xb1; 8.2 [arb units]; p _amp_#x3c; 0.05 whereas the changes in gp91 phox expression were not significant 48 days |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91 phox | 1.0 | as shown in fig. 3 p22 phox mrna was upregulated in vehicle treated diabetic rats 8.8 _amp_#xb1; 1.9 vs 26.3 _amp_#xb1; 8.2 [arb units]; p _amp_#x3c; 0.05 whereas the changes in gp91 phox expression were not significant 48 days after induction of the diabetic state 0.023 _amp_#xb1; 0.011 vs 0.029 _amp_#xb1; 0.02; n.s. . |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | treatment with candesartan but not metoprolol led to decreased p22 phox mrna levels in diabetic rats. |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91 phox | 1.0 | expression of gp91 phox mrna remained unchanged during treatment with candesartan and metoprolol. |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | in the present study we found increased nad p h oxidase activity and increased expression of the nad p h oxidase subunit p22 phox which is in agreement with previous works zhang et al. 2003 . |
| 2707 | ACE | angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 | angiotensin converting enzyme | 1.0 | show that candesartan did not influence endothelium independent vasodilatation which is in agreement with previous works demonstrating that inhibition of the renin_amp_#x2013;angiotensin system with angiotensin converting enzyme ace inhibitors and angiotensin at 1 receptor antagonists does not influence endothelium independent vasodilatation o'driscoll et al. 1999 and hornig et al. 2003 . |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | angiotensin ii | 1.0 | our data further suggest a pivotal role of angiotensin ii for the development of diabetes induced endothelial dysfunction. |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | angiotensin ii | 1.0 | both local vascular angiotensin ii production and angiotensin at 1 receptor expression are significantly increased in diabetic rats sechi et al. 1994 . |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | interestingly other groups also found only an upregulation of nad p h oxidase p22 phox while changes in gp91 phox remained insignificant zhang et al. 2003 . |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91 phox | 1.0 | interestingly other groups also found only an upregulation of nad p h oxidase p22 phox while changes in gp91 phox remained insignificant zhang et al. 2003 . |
| 333 | AGT | angiotensinogen (serpin peptidase inhibitor, clade A, member 8) | angiotensin ii | 1.0 | induction of adhesion molecules through angiotensin ii via the at 1 receptor has been described in a rat model tummala et al. 1999 . |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | however although nad p h oxidase activity p22 phox and enos mrna expression seemed to be normalized after treatment with metoprolol metoprolol could neither influence levels of inflammation under streptozotocin induced diabetic conditions nor could i |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | several hypotheses are possible to explain this discrepancy: we determined nad p h oxidase activity and p22 phox mrna expression in the muscle and not in isolated vascular tissue. |
| 19986 | CYCS | cytochrome c, somatic | cytochrome c | 1.0 | oxidative stress in terms of production of reactive oxygen species was measured in samples of rat skeletal muscle m quadriceps by superoxide dismutase inhibitable reduction of cytochrome c with nadh or nad p h as substrates. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | oxidative stress in terms of production of reactive oxygen species was measured in samples of rat skeletal muscle m quadriceps by superoxide dismutase inhibitable reduction of cytochrome c with nadh or nad p h as substrates. |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22 phox | 1.0 | fig. 3._amp_#xa0;mrna expression of nad p h oxidase subunits p22 phox and gp91 phox and of endothelial nitric oxide synthase enos . |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91 phox | 1.0 | fig. 3._amp_#xa0;mrna expression of nad p h oxidase subunits p22 phox and gp91 phox and of endothelial nitric oxide synthase enos . |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | endothelial nitric oxide synthase | 1.0 | fig. 3._amp_#xa0;mrna expression of nad p h oxidase subunits p22 phox and gp91 phox and of endothelial nitric oxide synthase enos . |