)| PMID |
11959796 ( ) |
|---|---|
| Title | Effects of chronic administration of the novel endothelin antagonist J-104132 on endothelial dysfunction in streptozotocin-induced diabetic rat. |
| Abstract | 1. The biosynthesis of endothelin-1 is increased in the diabetic state. So this peptide may cause diabetic vascular complications. We tested this possibility by chronically administering J-104132, a potent orally active mixed antagonist of endothelin A and B (ET(A)/ET(B)) receptors to streptozotocin (STZ)-induced diabetic rats and focusing on changes in endothelial function. 2. The acetylcholine (ACh)-induced endothelium-dependent relaxation was impaired in diabetic rats and this impairment was significantly attenuated following chronic administration of J-104132 (10 mg kg(-1), p.o., daily for 4 weeks). 3. In an in vitro experiment using aortae from diabetic rats, the ACh-induced relaxation was not changed by the presence of J-104132 (3 x 10(-9) M). 4. The expression levels of the mRNA for endothelial nitric oxide synthase was comparable among aortae from the three groups (control, diabetic and chronically J-104132-treated diabetic). 5. The amount of superoxide anion was significantly greater in aortae from diabetic rats than in controls. Chronic J-104132 treatment significantly decreased the level of superoxide anion in diabetic rats. 6. The expression of the p22phox mRNA for the NADH/NADPH oxidase subunit was significantly increased in STZ-induced diabetic rats and this increase was completely prevented by chronic administration of J-104132. 7. These results suggest that in STZ-induced diabetic rats, ET-1 may be directly involved in impairing endothelium-dependent relaxation via increased superoxide-anion production. Hoshi University, Shinagawa-ku, Tokyo 142-8501, Japan. |
NOTE: Color highlight is limited to the abstract and SciMiner text-mining mode. If you see much more identified targets below from "Targets by SciMiner Summary" and "Targets by SciMiner Full list", they may have been identified from the full text.
Targets by SciMiner Summary
| HUGO ID | Symbol | Target Name | #Occur | ActualStr |
|---|---|---|---|---|
| 3176 | EDN1 | endothelin 1 | 20 | ET-1 | endothelin 1 | |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | 19 | endothelial nitric oxide synthase | eNOS | |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | 13 | p22phox | |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | 11 | nadph oxidase | |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | 7 | GAPDH | glyceraldehyde 3 phosphate dehydrogenase | |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | 4 | SOD | superoxide dismutase | |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | 3 | gp91phox | |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | 1 | p67phox | |
| 12805 | XDH | xanthine dehydrogenase | 1 | xanthine oxidase | |
| 2595 | CYP1A1 | cytochrome P450, family 1, subfamily A, polypeptide 1 | 1 | cytochrome p 450 | |
| 2615 | CYP2B6 | cytochrome P450, family 2, subfamily B, polypeptide 6 | 1 | P-450 | |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | 1 | p47phox | |
Targets by SciMiner Full list
| HUGO ID | Symbol | Name | ActualStr | Score | FlankingText |
|---|---|---|---|---|---|
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | The expression of the p22phox mRNA for the NADH/NADPH NADH NADPH oxidase subunit was significantly |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | These results suggest that in STZ-induced diabetic rats ET-1 may be directly involved in impairing endothelium-dependent relaxation via increased |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | Endothelin-1 (ET-1), ET-1 a vasoconstrictor peptide secreted from endothelial cells is thought to |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | Plasma ET-1 levels are increased in the diabetic state ( Takahashi et |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | and the plasma concentration of big endothelin-1 the precursor of ET-1 is elevated in patients with diabetes mellitus ( Tsunoda et |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | Thus although ET-1 may also contribute to the normal maintenance of vascular tone |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | Since the plasma ET-1 level is increased in diabetic rats the impairment of the |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | . 1999 we tested the idea that the increase in ET-1 seen in streptozotocin-induced diabetic rats is a cause rather than |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | abnormal oxidative metabolism of NO rather than to decreases in eNOS mRNA and NO production ( Kobayashi _amp_#x00026 Kamata 2001 |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | expression of the mRNA for endothelial nitric oxide synthase (eNOS) eNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | Oligonucleotides (ON) ON for rat endothelial nitric oxide synthase (eNOS) eNOS were used with primers as described previously |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | PCR-amplified product given in brackets were rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) GAPDH ( X02231 position 492 _amp_#x02013 799 amplification of a 308 |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | sequence ON 1 5_amp_#x02032 -TCCCTCAAGATTGTCAGCAA-3_amp_#x02032 ON 2 5_amp_#x02032 -AGATCCACAACGGATACATT-3_amp_#x02032 rat eNOS ( RNU02534 amplification of a 693 bp sequence ON 3 |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | sequence ON 3 5_amp_#x02032 -TCCAGAAACACAGACAGTGCA-3_amp_#x02032 ON 4 5_amp_#x02032 -CAGGAAGTAAGTGAGAGC-3_amp_#x02032 rat p22phox (according according to Zalba et al . 2000 amplification of |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | Twenty-four (GAPDH) GAPDH or thirty (eNOS) eNOS PCR cycles (94_amp_#x000b0;C 94_amp_#x000b0 C for |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | Twenty-four (GAPDH) GAPDH or thirty (eNOS) eNOS PCR cycles (94_amp_#x000b0;C 94_amp_#x000b0 C for 1 min 62_amp_#x000b0 C |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | C for 1 min 72_amp_#x000b0 C for 1 min and p22phox PCR cycles (94_amp_#x000b0;C 94_amp_#x000b0 C for 1 min 57_amp_#x000b0 C |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | The eNOS p22phox and GAPDH products were quantified by scanning densitometry the |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | The eNOS p22phox and GAPDH products were quantified by scanning densitometry the amount |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | The eNOS p22phox and GAPDH products were quantified by scanning densitometry the amount of eNOS |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | GAPDH products were quantified by scanning densitometry the amount of eNOS and p22phox being normalized with respect to the amount of |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | were quantified by scanning densitometry the amount of eNOS and p22phox being normalized with respect to the amount of GAPDH product |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | and p22phox being normalized with respect to the amount of GAPDH product |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | Results Expression of the mRNA for eNOS To investigate the possible mechanisms underlying the impaired ACh-induced relaxation |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | individuals we examined whether the expression of the mRNA for eNOS is changed by chronic J-104132 treatment |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | chronically J-104132-treated diabetic rats revealed that the expression ratio eNOS/GAPDH eNOS GAPDH did not differ among the three groups ( Figure |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | J-104132-treated diabetic rats revealed that the expression ratio eNOS/GAPDH eNOS GAPDH did not differ among the three groups ( Figure 3 |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | Results Expression of the mRNA for p22phox subunit To investigate the mechanism underlying the increase in superoxide |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | we examined whether the expression of the mRNA for the p22phox subunit might have been changed by the chronic J-104132 treatment |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | The expression of p22phox mRNA was higher in diabetic rats than in control rats |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | Many components of the leukocyte-NADPH-oxidase complex _amp_#x02013 including p22phox p47phox p67phox and gp91phox (or or a related homologue _amp_#x02013 |
| 7660 | NCF1 | neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) | p47phox | 1.0 | Many components of the leukocyte-NADPH-oxidase complex _amp_#x02013 including p22phox p47phox p67phox and gp91phox (or or a related homologue _amp_#x02013 have |
| 7661 | NCF2 | neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) | p67phox | 1.0 | Many components of the leukocyte-NADPH-oxidase complex _amp_#x02013 including p22phox p47phox p67phox and gp91phox (or or a related homologue _amp_#x02013 have been |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.3 | of the leukocyte-NADPH-oxidase complex _amp_#x02013 including p22phox p47phox p67phox and gp91phox (or or a related homologue _amp_#x02013 have been identified in |
| 2615 | CYP2B6 | cytochrome P450, family 2, subfamily B, polypeptide 6 | P-450 | 0.3 | as xanthine oxidase ( Adkins _amp_#x00026 Taylor 1990 or cytochrome P-450 ( Bysani et al . 1990 may also play a |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.3 | a source of reactive oxygen species because (i) i the gp91phox mRNA for the NADH/NADPH NADH NADPH oxidase subunit is upregulated |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | rats ( Hink et al . 2001 and (ii) ii ET-1 increases the expression of gp91phox mRNA in human endothelial cells |
| 2578 | CYBB | cytochrome b-245, beta polypeptide (chronic granulomatous disease) | gp91phox | 2.3 | . 2001 and (ii) ii ET-1 increases the expression of gp91phox mRNA in human endothelial cells ( Duerrschmidt et al . |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | present study we showed that in STZ-induced diabetic rats the p22phox mRNA for the NADH/NADPH NADH NADPH oxidase subunit was significantly |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | We have previously reported that the plasma ET-1 concentration is increased in STZ-induced diabetic rats and that this |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | be due to an overexpression of the mRNA for prepro ET-1 ( Makino _amp_#x00026 Kamata 1998 Makino et al . 2001 |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | We have also reported that the overproduction of ET-1 seen in STZ-induced diabetes is a result of hyperglycaemia not |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | by the following sequence of events (i) i the plasma ET-1 concentration is increased in STZ-induced diabetic rats (ii) ii the |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | is increased in STZ-induced diabetic rats (ii) ii the increased ET-1 may stimulate NADPH oxidase which produces O 2 _amp_#x02212 (iii) |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | We also demonstrated in the present study that ET-1 may induce NADPH oxidase because chronic administration of the ET-1-receptor |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | by aortae from diabetic rats without altering the expression of eNOS mRNA |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | to untreated diabetics does not depend on a change in eNOS expression |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | As mentioned above the expression of the p22phox mRNA for the NADH/NADPH NADH NADPH oxidase subunit was significantly |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | the expression of the mRNA for endothelial NO synthase (eNOS) eNOS in aortae from controls STZ-diabetic and chronically J-104132-treated STZ-diabetic rats |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | (a) a Expression of the mRNA for eNOS assayed by RT _amp_#x02013 PCR |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | RT _amp_#x02013 PCR assay of expression of the mRNA for p22phox in aortae from controls STZ-diabetic and chronically J-104132-treated STZ-diabetic rats |
| 2577 | CYBA | cytochrome b-245, alpha polypeptide | p22phox | 2.8 | (a) a Expression of the mRNA for p22phox assayed by RT _amp_#x02013 PCR |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | eNOS | 3.2 | ACh acetylcholine eNOS endothelial nitric oxide synthase ET-1 endothelin-1 ET A /ET ET |
| 3176 | EDN1 | endothelin 1 | ET-1 | 0.3 | ACh acetylcholine eNOS endothelial nitric oxide synthase ET-1 endothelin-1 ET A /ET ET B endothelin A/endothelin A endothelin |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 1.6 | A /ET ET B endothelin A/endothelin A endothelin B receptor GAPDH glyceraldehydes-3-phosphate dehydrogenase HDL high-density lipoprotein KHS Krebs _amp_#x02013 Henseleit solution |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | SOD | 0.9 | polymerase chain reaction SDS sodium dodecyl sulphate SNP sodium nitroprusside SOD superoxide dismutase STZ streptozotocin VLDL very low-density lipoprotein |
| 3176 | EDN1 | endothelin 1 | endothelin 1 | 1.0 | abstract the biosynthesis of endothelin 1 is increased in the diabetic state. |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | endothelial nitric oxide synthase | 1.0 | the expression levels of the mrna for endothelial nitric oxide synthase was comparable among aortae from the three groups control diabetic and chronically j 104132 treated diabetic . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | the expression of the p22phox mrna for the nadh/nadph oxidase subunit was significantly increased in stz induced diabetic rats and this increase was completely prevented by chronic administration of j 104132. |
| 3176 | EDN1 | endothelin 1 | endothelin 1 | 1.0 | keywords: endothelin 1 endothelin antagonist aorta diabetes superoxide anion |
| 3176 | EDN1 | endothelin 1 | endothelin 1 | 1.0 | endothelin 1 et 1 a vasoconstrictor peptide secreted from endothelial cells is thought to play a pathological role in a number of vascular diseases goto et al . 1996 . |
| 3176 | EDN1 | endothelin 1 | endothelin 1 | 1.0 | plasma et 1 levels are increased in the diabetic state takahashi et al . 1990 ; makino _amp_#x00026; kamata 1998 ; 2000 ; makino et al . 2001 and the plasma concentration of big endothelin 1 the precursor of et 1 is elevated in patients with diabetes mellitus tsunoda et al . 1991 . |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | endothelial nitric oxide synthase | 1.0 | methods measurement of the expression of the mrna for endothelial nitric oxide synthase enos |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | endothelial nitric oxide synthase | 1.0 | oligonucleotides on for rat endothelial nitric oxide synthase enos were used with primers as described previously. |
| 4141 | GAPDH | glyceraldehyde-3-phosphate dehydrogenase | glyceraldehyde 3 phosphate dehydrogenase | 1.0 | the primers with the respective gen bank data library accession numbers and the coding sequence of the pcr amplified product given in brackets were:rat glyceraldehyde 3 phosphate dehydrogenase gapdh x02231 position 492 _amp_#x02013; 799 amplification of a 308 bp sequence on 1: 5_amp_#x02032; tccctcaagattgtcagcaa 3_amp_#x02032; on 2: 5_amp_#x02032; agatccacaacggatacatt 3_amp_#x02032;: rat e |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | recent studies have underscored the importance of nadph oxidase derived reactive oxygen species in vascular biology. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | many components of the leukocyte nadph oxidase complex _amp_#x02013; including p22phox p47phox p67phox and gp91phox or a related homologue _amp_#x02013; have been identified in endothelial cells or vascular smooth muscle cells jones et al . 1996 |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | reactive oxygen species from sources other than nadph oxidase such as xanthine oxidase adkins _amp_#x00026; taylor 1990 or cytochrome p 450 bysani et al . 1990 may also play a role. |
| 2595 | CYP1A1 | cytochrome P450, family 1, subfamily A, polypeptide 1 | cytochrome p 450 | 1.0 | reactive oxygen species from sources other than nadph oxidase such as xanthine oxidase adkins _amp_#x00026; taylor 1990 or cytochrome p 450 bysani et al . 1990 may also play a role. |
| 12805 | XDH | xanthine dehydrogenase | xanthine oxidase | 1.0 | reactive oxygen species from sources other than nadph oxidase such as xanthine oxidase adkins _amp_#x00026; taylor 1990 or cytochrome p 450 bysani et al . 1990 may also play a role. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | here we focused on nadph oxidase as a source of reactive oxygen species because i the gp91phox mrna for the nadh/nadph oxidase subunit is upregulated in the steady state in the aorta in stz induced diabetic rats hink et al . 2001 and ii et 1 increases the expression of gp91phox mrna in human endothelial cells duerrschmidt et |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | in the present study we showed that in stz induced diabetic rats the p22phox mrna for the nadh/nadph oxidase subunit was significantly increased too an increase that was completely antagonized by the chronic administration of j 104132. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | seen in stz induced diabetic rats may be explained by the following sequence of events: i the plasma et 1 concentration is increased in stz induced diabetic rats; ii the increased et 1 may stimulate nadph oxidase which produces o 2 _amp_#x02212; ; iii the additional o 2 _amp_#x02212; may not be metabolized to h 2 o 2 because superoxide dismutase activity is decreased in stz induced diabetic rats kamata _amp_# |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | mpairment of endothelium dependent relaxation; iv when j 104132 is chronically administered to stz induced diabetic rats it may have a long term antagonistic effect on the et 1 induced stimulation of nadph oxidase. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | eased in stz induced diabetic rats; ii the increased et 1 may stimulate nadph oxidase which produces o 2 _amp_#x02212; ; iii the additional o 2 _amp_#x02212; may not be metabolized to h 2 o 2 because superoxide dismutase activity is decreased in stz induced diabetic rats kamata _amp_#x00026; kobayashi 1996 ; kobayashi _amp_#x00026; kamata 1999b a disorder that may lead to an abnormal no metabolism and a subsequent im |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | we also demonstrated in the present study that et 1 may induce nadph oxidase because chronic administration of the et 1 receptor antagonist j 104132 normalized the level of this enzyme. |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | ntly reported that following incubation of aortae from control rats with ldl isolated from diabetic rats endothelium dependent relaxation was impaired and that this inhibitory effect was prevented by superoxide dismutase a scavenger of superoxide anions kobayashi et al . 2000 . |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | as mentioned above the expression of the p22phox mrna for the nadh/nadph oxidase subunit was significantly increased in stz induced diabetic rats and this increase was completely prevented by chronic administration of j 104132. |
| 14874 | NOX5 | NADPH oxidase, EF-hand calcium binding domain 5 | nadph oxidase | 1.0 | this effect of j 104132 may be due to a decrease in the aortic superoxide anion via an inhibitory effect of this agent on the induction of nadph oxidase. |
| 7876 | NOS3 | nitric oxide synthase 3 (endothelial cell) | endothelial nitric oxide synthase | 1.0 | ach acetylcholine enos endothelial nitric oxide synthase et 1 endothelin 1 et a /et b endothelin a/endothelin b receptor gapdh glyceraldehydes 3 phosphate dehydrogenase hdl high density lipoprotein khs krebs _amp_#x02013; henseleit solution ldl low density |
| 3176 | EDN1 | endothelin 1 | endothelin 1 | 1.0 | ach acetylcholine enos endothelial nitric oxide synthase et 1 endothelin 1 et a /et b endothelin a/endothelin b receptor gapdh glyceraldehydes 3 phosphate dehydrogenase hdl high density lipoprotein khs krebs _amp_#x02013; henseleit solution ldl low density lipoprotein na no |
| 11179 | SOD1 | superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) | superoxide dismutase | 1.0 | e phosphate nbt nitro blue tetrazolium o 2 _amp_#x02212; superoxide anion rt _amp_#x02013; pcr reverse transcription polymerase chain reaction sds sodium dodecyl sulphate snp sodium nitroprusside sod superoxide dismutase stz streptozotocin vldl very low density lipoprotein |